GH51 Arabinofuranosidase and Its Role in theMethylglucuronoarabinoxylan Utilization System in Paenibacillus sp.Strain JDR-2

Neha Sawhney, James F. Preston

Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida, USA

Methylglucuronoarabinoxylan (MeGAXn) from agricultural residues and energy crops is a significant yet underutilized biomassresource for production of biofuels and chemicals. Mild thermochemical pretreatment of bagasse yields MeGAXn requiring sac-charifying enzymes for conversion to fermentable sugars. A xylanolytic bacterium, Paenibacillus sp. strain JDR-2, produces anextracellular cell-associated GH10 endoxylanse (XynA1) which efficiently depolymerizes methylglucuronoxylan (MeGXn) fromhardwoods coupled with assimilation of oligosaccharides for further processing by intracellular GH67 �-glucuronidase, GH10endoxylanase, and GH43 �-xylosidase. This process has been ascribed to genes that comprise a xylan utilization regulon thatencodes XynA1 and includes a gene cluster encoding transcriptional regulators, ABC transporters, and intracellular enzymesthat convert assimilated oligosaccharides to fermentable sugars. Here we show that Paenibacillus sp. JDR-2 utilized MeGAXn

without accumulation of oligosaccharides in the medium. The Paenibacillus sp. JDR-2 growth rate on MeGAXn was 3.1-foldgreater than that on oligosaccharides generated from MeGAXn by XynA1. Candidate genes encoding GH51 arabinofuranosidaseswith potential roles were identified. Following growth on MeGAXn, quantitative reverse transcription-PCR identified a cluster ofgenes encoding a GH51 arabinofuranosidase (AbfB) and transcriptional regulators which were coordinately expressed alongwith the genes comprising the xylan utilization regulon. The action of XynA1 on MeGAXn generated arabinoxylobiose, arabi-noxylotriose, xylobiose, xylotriose, and methylglucuronoxylotriose. Recombinant AbfB processed arabinoxylooligosaccharidesto xylooligosaccharides and arabinose. MeGAXn processing by Paenibacillus sp. JDR-2 may be achieved by extracellular depoly-merization by XynA1 coupled to assimilation of oligosaccharides and further processing by intracellular enzymes, includingAbfB. Paenibacillus sp. JDR-2 provides a GH10/GH67 system complemented with genes encoding intracellular GH51 arabino-furanosidases for efficient utilization of MeGAXn.

The increasing use of nonrenewable fossil fuels, along with theirnegative impact on the environment, has encouraged research

to develop biological systems to provide alternative sources ofenergy. Prominent underutilized sources include lignocellulosics,the structural components of plant biomass that do not directlycompete with agricultural commodities for production of foodand fiber. These lignocellulosics contain cellulose as a source offermentable glucose and hemicelluloses as a source of fermentablepentoses for biofuels and chemicals. Current bioprocessing de-pends upon a combination of technologies for pretreatment torender the cellulose and hemicellulose components accessible toenzyme digestion and the development of microbial biocatalyststo efficiently ferment the products of enzyme digestion (1, 2).

For conversion of sugars to biomass-based products, Gram-negative bacteria (e.g., Escherichia coli, Zymomonas mobilis, andKlebsiella oxytoca for ethanol production), Gram-positive bacteria(e.g., Bacillus species for lactic acid production and Clostridiumspecies for butanol and acetic acid production), and yeast strains(e.g., Saccharomyces cerevisiae for ethanol production) have beendeveloped (1–6). The production of higher yields of fermentablesugars without the formation of inhibitory compounds generatedby thermochemical pretreatment may be achieved by developingbiocatalysts capable of direct and complete conversion of ligno-cellulosics to targeted products, and this method of productionreduces process costs by promoting simultaneous saccharificationand fermentation (SSF) and consolidated bioprocessing (CBP) (1,7). Alkaline pretreatments, when followed by saccharification us-ing enzymes, for example, endoxylanases, �-xylosidases, �-glucu-

ronidases, and �-L-arabinofuranosidases (8–13) for processinghemicellulosic pentosans and �-glucanases for processing cellu-lose, may be used to release saccharides for further conversion tobiomass-based products.

The sources for lignocellulosics include energy crops (dicots[e.g., sweetgum, poplar, eucalyptus] and monocots [e.g.,switchgrass, sweet sorghum]) and agricultural residues (e.g.,sugarcane bagasse and corn stover). The hemicelluloses as wellas the cellulose components of lignocellulosics provide a resourcefor bioconversion. The predominant polysaccharide in hemicel-lulose is 4-O-methylglucuronoxylan (MeGXn) in dicots and 4-O-methylglucuronoarabinoxylan (MeGAXn) in monocots. MeGXn

and MeGAXn are comprised of �-1,4-linked xylopyranosyl unitswith side chain substitutions, including �-1,2-linked 4-O-methyl-D-glucuronopyranosyl (MeG) residues and acetyl esters. MeGAXn

in grasses and agricultural residues, such as sorghum and sugar-cane bagasse, includes other side chain substitutions, including�-1,2- and/or 1,3-linked L-arabinofuranosyl residues, which maycomprise as much as 10 to 50% of the carbohydrate composition

Received 22 May 2014 Accepted 22 July 2014

Published ahead of print 25 July 2014

Editor: J. L. Schottel

Address correspondence to James F. Preston, jpreston@ufl.edu.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.01684-14

6114 aem.asm.org Applied and Environmental Microbiology p. 6114 – 6125 October 2014 Volume 80 Number 19

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

of the MeGAXn. Another common feature of MeGAXn is the pres-ence of O-feruloyl and O-p-coumaroyl esters linked to hydroxylgroups on arabinofuranosyl residues (8, 10, 13–16). Pretreatmentof lignocellulosic biomass is important to remove acetyl and otherester linkages from xylan for achieving complete hydrolysis. Bio-conversion systems require thermochemical pretreatments,which may include (i) acidic conditions to saccharify hemicellu-loses and enzymes to saccharify cellulose or (ii) neutral or basicconditions, which require enzymes for the saccharification ofhemicelluloses and cellulose (1, 2, 6, 17).

Paenibacillus sp. strain JDR-2, as well as some other bacteria, isan aggressively xylanolytic bacterium with a GH10/GH67 systemfor depolymerization and a xylan utilization regulon that accountsfor its efficient utilization of MeGXn (18–20). This study definesthe ability of Paenibacillus sp. JDR-2 to utilize MeGAXn fromsweet sorghum and sugarcane bagasse. This ability is correlatedwith the presence of a gene cluster in Paenibacillus sp. JDR-2 thatencodes a GH51 �-L-arabinofuranosidase and transcriptionalregulators that are upregulated by growth on MeGAXn and theability of this enzyme to process the products generated by theextracellular multimodular cell-associated GH10 endoxylanase(XynA1). Evidence supports a role of intracellular arabinofura-nosidases in the utilization of MeGAXn processed by the GH10XynA1 in which arabinoxylooligosaccharides (AXOS), xylooli-gosaccharides (XOS), and aldouronates (MeG-linked XOS), as prod-ucts of extracellular depolymerization, are assimilated through ABCtransporters and processed intracellularly to monosaccharides.We have identified genes, abfB and abfA, from Paenibacillus sp.JDR-2 encoding GH51 arabinofuranosidases which may assistother saccharifying enzymes produced by this organism to effi-ciently convert MeGAXn to biomass-based products. Althoughthe activity of recombinant AbfA was evaluated, abfA was notconsidered for detailed studies, as it has no neighboring genesencoding transcriptional regulators and ABC transporters, norwas it upregulated following the growth of Paenibacillus sp. JDR-2on MeGAXn. As a xylanolytic bacterium with a fully sequencedgenome, including a xylan utilization regulon, Paenibacillus sp.JDR-2 provides a system to further define and develop processesfor the efficient conversion of MeGAXn as well as MeGXn to tar-geted products (11, 18, 21, 22).

MATERIALS AND METHODSPreparation of xylans and oligosaccharides. MeGXn was prepared fromsweetgum (Liquidambar styraciflua) wood as previously described (22).Alkaline treatment was applied to the extraction of MeGAXn from stalksof sorghum [Sorghum bicolor (L.) Moench] and sugarcane (Saccharum sp.cv. CP89-2143). Sorghum (PD1 M81-E Citra 2011 batch) and sugarcanestalk bagasse (obtained from John E. Erikson, Agronomy Department atthe University of Florida) were processed using the same procedure usedfor sweetgum (22). Oligosaccharides were prepared by digesting 2% sor-ghum MeGAXn in 10 mM sodium phosphate buffer, pH 6.5, with 3.5 U ofthe recombinant GH10 XynA1 catalytic domain (XynA1CD) (22) withmild rotation at 30°C. After 24 h, an additional 2 U of XynA1CD wasadded and the incubation was continued for another 24 h. The reactionwas stopped by heating the mixture in a 70°C water bath for 10 min. Theundigested polysaccharide and the XynA1CD were separated from lower-molecular-weight oligosaccharides by using an Amicon Centriprep 3,000-molecular-weight-cutoff filter device (Millipore) operated at 3,000 rpm(Sorvall RC-3 swinging bucket rotor). The filtrate was lyophilized anddissolved in deionized water. The total carbohydrate content was deter-mined for all preparations by a phenol-sulfuric acid assay (23) to preparesubstrates of the desired concentration. The oligosaccharides were iden-

tified by thin-layer chromatographic (TLC) analysis (11, 24). The degreeof polymerization in sweetgum MeGXn was 231 (15), and that in sorghumMeGAXn was estimated to be 76. The degree of polymerization in sor-ghum MeGAXn was determined by Nelson’s reducing sugar assay (25) fortotal reducing sugar content and the phenol-sulfuric acid assay (23).

Growth studies of Paenibacillus sp. JDR-2 and substrate utilization.Paenibacillus sp. JDR-2 was isolated from decaying sweetgum wood in ourlaboratory (11, 18, 21, 22). A glycerol freezer stock of Paenibacillus sp.JDR-2 stored at �80°C was resuscitated on 0.5% oat spelt xylan agar plateswith Zucker-Hankin minerals (ZH) medium (pH 7.4) (26) containing0.01% yeast extract and incubated at 30°C for 2 to 3 days. The cultureswere regularly transferred onto fresh plates in order to maintain viablecultures throughout the studies. A colony was picked from the plate andwas used to inoculate 2 ml of ZH medium with 1% yeast extract in culturetubes (16 by 100 mm), which were incubated at 30°C at high rotation(speed 8) on a Roto-Torque rotator inclined at an angle of 45° overnight.The cells were harvested and used for subculturing at a 2% initial inocu-lum into 5 ml of fresh ZH medium containing 1% yeast extract in culturetubes (16 by 100 mm) under the conditions described above or into largervolumes of medium in 250-ml baffled culture flasks. The cultures wereshaken at 220 rpm using a G-2 gyratory shaker (New Brunswick Scien-tific) at 30°C until the cultures reached mid-exponential phase. Forgrowth studies, cells from exponential-phase cultures were harvestedand suspended in ZH medium containing 0.1% yeast extract with 0.5%sorghum MeGAXn, sugarcane MeGAXn, or oligosaccharides derivedfrom XynA1CD digestion of sorghum MeGAXn. Growth studies werecarried out using a 2% initial inoculum in 20 ml medium cultured at 30°Cas described above.

Determination of growth and substrate utilization. Aliquots of cul-tures were sampled at regular intervals of time to record the growth andthe amount of substrate remaining in the medium. Growth, which wasestimated from the turbidity, was determined by measurement of theoptical density at 600 nm (OD600) using a 1.00-cm cuvette. Cultures werediluted to obtain an OD600 between 0.2 and 0.8 and corrected for dilutionto generate the growth curves. For substrate utilization studies, aliquots ofcultures were centrifuged at room temperature to separate the cell pelletfrom the medium remaining in the supernatant. To determine the rateand extent of substrate utilization, the cell-free medium was used to de-termine the total amount of carbohydrate remaining by the phenol-sul-furic acid assay (23) with xylose as the standard. To identify the productsaccumulating in the medium and to study the rate of hydrolysis of thesubstrate, 200 to 220 nmol of total carbohydrate xylose equivalents wasspotted on a TLC plate (20 by 20 cm; 0.25-mm thickness; Silica Gel 60;Millipore), developed, and analyzed as previously described (11).

Structural modeling of GH51 arabinofuranosidase from Paeniba-cillus sp. JDR-2. A Protein Data Bank (PDB) file for AbfB was generatedfrom the amino acid sequence with the Phyre2 program (27). The closesthomolog of AbfB was GH51 from Geobacillus stearothermophilus T6 (PDBaccession number 1QW9), with which AbfB (GenBank accession no.ACT02231.1) shared 68% similarity and which served as the template forthreading. The USCF Chimera (version 1.8) program (28) was used formodeling of the structures. The Pfam program (29) was used to locate thecatalytic nucleophile and proton donor sites. The Clustal Omega program(30) was used for the alignment of the amino acid sequences (http://www.ncbi.nlm.nih.gov/) of GH51 arabinofuranosidases.

Preparation of RNA. Paenibacillus sp. JDR-2 was cultured as de-scribed above. Paenibacillus sp. JDR-2 cells harvested from mid-exponen-tial-phase cultures were used to make a 2% inoculum of ZH mediumcontaining 0.1% yeast extract with 20 ml 0.5% of sorghum MeGAXn,sugarcane MeGAXn, sweetgum MeGXn, or xylose, and the culture wasincubated at 30°C in 250-ml baffled culture flasks with shaking, as de-scribed above. Cultures growing in ZH medium containing 0.5% yeastextract without carbohydrate were used as controls. The cultures wereallowed to grow until the estimated early mid-exponential growth phase.These cultures were used for RNA isolation and purification and were

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6115

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

streaked onto xylan agar plates to confirm the purity of the cultures. Thecells were harvested by centrifugation at a relative centrifugal force of4,300 � g for 10 min at 4°C, resuspended in 25 mM sodium phosphatebuffer, pH 7.0, and centrifuged as described above. The procedure derivedfrom the FastLane Cell RT-PCR Handbook (Qiagen) was used for RNAisolation and purification. RNA was treated with DNase using a TurboDNA-free kit following the prescribed protocol (Ambion). The RNA con-centrations were determined by measurement of the absorbance at 260nm (A260), and the ratio of A260/A280 was determined to estimate thepurity of the RNA.

qRT-PCR. Quantitative reverse transcription-PCR (qRT-PCR) wascarried out using a QuantiTect SYBR green RT-PCR kit (Qiagen) follow-ing the protocol prescribed in the accompanying handbook. The qualityof the RNA preparations was characterized by evaluation for DNA con-tamination by carrying out reactions for known transcript targets withand without reverse transcriptase. The qRT-PCR was conducted in 25-�lreaction mixtures containing primers corresponding to the genes of in-terest (which yielded products that were 100 to 150 bp in size), 0.5 �g ofRNA, 2� QuantiTect SYBR green RT-PCR master mix, QuantiTect re-verse transcriptase mix, and RNase-free water. The qRT-PCRs were car-ried out using a CFX96 real-time C1000 thermal cycler (Bio-Rad) underconditions of 50°C for 30 min; 95°C for 15 min; and 40 cycles at 94°C for15 s, 56°C for 30 s, and 72°C for 30 s, followed by melting curve determi-nation. The primer pairs designed for the target genes, which are identi-fied by their locus tags, are listed in Table 1. A standard curve was gener-ated using genomic DNA isolated from Paenibacillus sp. JDR-2 andpurified using the protocol derived from that provided by the manufac-turer of the DNeasy blood and tissue kit (Qiagen); PCR was performed

using a QuantiTect SYBR green PCR kit (Qiagen) following the manufac-turer’s protocol.

Construction of abfB and abfA expression vectors. Using Paenibacil-lus sp. JDR-2 gene sequences, the open reading frames were selected andused for designing the primer pairs with cloning sites for the abfB gene(locus tag, PJDR2_3599; GenBank accession no. ACT02231.1) and theabfA gene (locus tag, PJDR2_3019; GenBank accession no. ACT01665.1)(Table 1). Paenibacillus sp. JDR-2 was cultured in Luria-Bertani (LB)broth, also referred to as lysogeny broth, at 30°C with shaking as describedearlier, until the culture reached an OD600 of 0.5, and genomic DNA wasextracted as described above. The abfB gene (1,512 bp) and the abfA gene(1,521 bp) were produced and amplified by PCR using Hot Start high-fidelity DNA polymerase (Thermo Scientific) under conditions of 95°Cfor 5 min; 10 cycles of 94°C for 9 s, 50°C for 1 min, and 72°C for 2.3 min;30 cycles of 94°C for 9 s and 68°C for 2.3 min; and an additional extensionat 72°C for 10 min. The purification of the products was carried out byagarose gel electrophoresis using a QIAquick gel extraction kit (Qiagen).The sizes of the purified products were confirmed by restriction digestion.

Production and purification of AbfB and AbfA. The pETite expres-sion vector from the Expresso T7 cloning and expression system (Luci-gen) was used, and the C-terminal histidine-tagged abfB or abfA gene wascloned into Escherichia coli 10G (Lucigen). After transformation, theclones were selected on LB plates containing kanamycin (30 �g/ml). Theplasmids were isolated, and digestion (NdeI and NotI sites on the vector)was performed to confirm insertion of the gene into the vector. pETite-abfB (expression vector carrying abfB) or pETite-abfA (expression vectorcarrying abfA) and pRARE (Novagen) were cotransformed into E. coliBL21(DE3). The transformants were selected on LB plates containing 30�g/ml kanamycin and 34 �g/ml chloramphenicol (LB-Kan30-Cm34).Single colonies were inoculated in 2 ml of LB-Kan30-Cm34 in culturetubes (13 by 100 mm), incubated overnight at 37°C and 250 rpm, andstored at �80°C in 25% glycerol. These stocks were used for streaking outfresh LB-Kan30-Cm34 plates, and the plates were incubated overnight at37°C. Single colonies of BL21(DE3) harboring pETite-abfB or pETite-abfA and pRARE were used to inoculate 20 ml LB-Kan30-Cm34 into125-ml culture flasks, the flasks were incubated as described above, andthe contents of the flasks were transferred to 650 ml LB-Kan30-Cm34medium in a 2.8-liter flask and cultured as described above. When theOD600 reached 1.0, 1.00 mM isopropyl �-D-1-thiogalactopyranoside(IPTG) was added and the incubations were continued at 24°C and 150rpm for 3 h. Protein expression was verified by SDS-PAGE. Cells wereharvested and disrupted for purification of proteins using histidine tagcolumns as described previously (11). Desalting of proteins was carriedout using PD-10 columns (GE Healthcare), which were eluted with 50mM sodium acetate, pH 6.5. The purity of AbfB and AbfA was verified bySDS-PAGE using Precision Plus protein standards (Bio-Rad). An SDS-4% to 15% polyacrylamide gel was used and stained with Coomassie bril-liant blue.

Determination of optimal conditions and kinetic parameters forAbfB activity. A bicinchoninic acid assay (Thermo Scientific) was used fordetermination of the protein concentrations using bovine serum albuminas the standard. Enzymatic assays were carried out in 100-�l reactionmixtures by using the chromogenic substrate para-nitrophenyl-�-L-ara-binofuranoside (pNP-A) in 50 mM sodium acetate buffer, pH 6.5, at 30°C,and the increase in the absorbance at 405 nm was monitored over time.The optimal conditions for AbfB were determined by carrying out assaysusing 0.2 mM pNP-A, 0.3 �g AbfB, and 50 mM sodium acetate buffer, pH6.5, at 30°C, unless a different condition was specified. Optimal condi-tions of buffer and pH were determined by assaying in 50 mM citratebuffer (pH 4 to 6), 50 mM sodium acetate buffer (pH 5 to 8), and 50 mMpotassium phosphate buffer (pH 5 to 8) at 30°C. To determine the optimaltemperature, the resulting optimum pH and optimum buffer were used tomeasure activity at temperatures ranging from 30°C to 50°C. Tempera-ture stability analysis was carried out by incubating AbfB at different tem-peratures and assaying aliquots (under defined assay conditions) at regu-

TABLE 1 Primers used in qRT-PCR and cloning and production ofrecombinant enzymes

Locus tag GenePrimerorientationa Sequence

PJDR2_3599 abfB Fb CTGGTTGGCTCCGATGTTATRb AAGTACCGCCAGGATGATTG

PJDR2_3598 arsR Fb ATGCGGAATGTCCAGTTGATRb GGTGGTCCAGCGATGTTAAT

PJDR2_0221 xynA1 Fb ACCGTTATCAGATGGCTTGGRb GCTTTGTTGAGCTGGGAGTC

PJDR2_1323 aguA Fb GCATGGCTGAGATACGATCARb ATCCCTTCCATCGGTACTCC

PJDR2_1318 araC Fb GGAATCGCTTGGCTATGAAARb GGATATCCGCGATAACGAGA

PJDR2_1320 lplA Fb GGCGCATTTATTCCTCTTGARb ATTTTGCCGTCTGCTTGTCT

PJDR2_3599 abfB Fc GAAGGAGATATACATATGACTATTCGTTCCAGCATGCT

Rc GTGATGGTGGTGATGATGTCCTTTTTTCGTCTGCAGGC

PJDR2_3019 abfA Fc GAAGGAGATATACATATGGTTCAAACGAAGCTTGGC

Rc GTGATGGTGGTGATGATGTTCGACCGGAACGCGAAA

a F and R, forward and reverse primers, respectively.b Primers for 100- to 150-bp transcript targets used in qRT-PCR.c Primers used for cloning and production of recombinant enzymes, where thesequence in bold refers to the defined vector sequence, including the start codon on theforward primer and 6� histidine anticodons on the reverse primer.

Sawhney and Preston

6116 aem.asm.org Applied and Environmental Microbiology

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

lar intervals of time to estimate the amount of activity remaining.Determination of specific activities and kinetic studies of purified AbfBand AbfA were carried out by performing enzymatic assays using pNP-Ain 50 mM sodium acetate buffer, pH 6.5, at 30°C. One unit of activity wasdefined as the amount of enzyme that released 1 �mol of product per minat the defined temperature.

Specificity of AbfB and its reaction with MeGAXn and arabinoxyloo-ligosaccharides. Reaction mixtures containing 1.5% sorghum MeGAXn

in the presence of 15 �g XynA1CD (22) and/or AbfB per 1 ml mixturewere incubated at 30°C for 16 h. A fraction of the reaction mixture whereMeGAXn was digested by XynA1CD was filtered (as described above) toobtain oligosaccharides, which were further treated with AbfB in 50 mMsodium acetate buffer, pH 6.5, at 30°C for 16 h. The reactions werestopped by heating in a 70°C water bath for 10 min, and the samples (200nmol/sample) were examined by TLC, as described above (11).

The remaining reaction mixtures were filtered, and the amount ofarabinose released was determined by high-pressure liquid chromatogra-phy (HPLC) using an Aminex HPX87-H column (Bio-Rad) connected toHewlett-Packard HP1090 filter photometric and refractive index detec-tors in series (Agilent Technologies) (5).

The activity of AbfB on MeGAXn with and without XynA1CD wasestimated by carrying out reactions with 0.5% sorghum MeGAXn and 30

�g/ml of enzyme in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 4 h.Aliquots were removed from the reaction mixture every 30 min to carryout Nelson’s assay for estimation of total reducing sugars (25).

RESULTSGrowth of Paenibacillus sp. JDR-2 and substrate utilization.Paenibacillus sp. JDR-2 showed rapid growth on both sorghumand sugarcane MeGAXn substrates, with the efficient andnearly complete utilization of the substrates. The substrate uti-lization curve closely corresponded to the growth curve (Fig.1A and B). Growth patterns were observed to be similar in bothcases. Upon reaching stationary phase, Paenibacillus sp. JDR-2sporulated, as confirmed by phase-contrast microscopy (data notshown). Oligosaccharides (generated from sorghum MeGAXn

with XynA1CD) as the substrate were observed to have a lower rateand extent of utilization than MeGAXn (Fig. 1C and D), indicatingthat the cell-associated XynA1 catalyzes the depolymerization ofMeGAXn, followed by the rapid assimilation of oligosaccharidesinto the cell with minimal diffusion into the medium. The rate ofPaenibacillus sp. JDR-2 growth on MeGAXn was 3.1-fold greater

FIG 1 Growth and MeGAXn utilization by Paenibacillus sp. JDR-2. Paenibacillus sp. JDR-2 was cultured in 20 ml ZH medium containing 0.1% yeast extractsupplemented with 0.5% sorghum MeGAXn (A), 0.5% sugarcane MeGAXn (B), or 0.5% oligosaccharides (derived from sorghum MeGAXn digested byXynA1CD) (C) in 250-ml baffled flasks at 30°C and 220 rpm. Closed squares and open squares, growth (OD600) and the amount of substrate remaining (percent),respectively. The total amount of substrate remaining was determined by the phenol-sulfuric acid assay. (D) Comparison of the rate of utilization of substratesduring the exponential phase of growth derived from panels A and C for sorghum MeGAXn (open circles) and sorghum oligosaccharides (open triangles). Therate of utilization was determined as the slope (K). R2 values were 0.9683 and 0.9377 for sorghum MeGAXn and sorghum oligosaccharides generated by XynA1CDdigestion, respectively.

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6117

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

than that on oligosaccharides generated by digestion of MeGAXn

by XynA1CD (Fig. 1D). These experiments were repeated, and theresults were reproducible.

The oligomeric products generated by extracellular XynA1CDdid not accumulate in the medium during the growth of Paeniba-cillus sp. JDR-2 on 0.5% sorghum MeGAXn (Fig. 2A). The absenceof detectable arabinose accumulation indicates an absence of anextracellular arabinofuranosidase associated with Paenibacillus sp.JDR-2. The growth of Paenibacillus sp. JDR-2 on 0.5% oligosac-charides obtained by digestion of sorghum MeGAXn by XynA1CD(Fig. 2B) indicates incomplete utilization of the substrates. Thissuggests that Paenibacillus sp. JDR-2 assimilates the oligosaccha-rides (including AXOS, XOS, and aldouronates) as they are gen-erated on the cell surface by XynA1 acting on MeGAXn. The in-crease in the amount of xylose from 18 to 24 h may result fromcells that have entered the sporulation phase and have releasedintracellular enzymes, which may digest the remaining substratein the medium (Fig. 2B). It was observed that Paenibacillus sp.JDR-2 grows rapidly and preferably on polysaccharides, such assorghum or sugarcane MeGAXn, as well as sweetgum MeGXn,rather than monosaccharides, including glucose and xylose (22),as well as arabinose (unpublished data). The growth yield and rateof growth of Paenibacillus sp. JDR-2 on monosaccharides werelower than those on MeGAXn (unpublished data).

Genomic organization of abfB and abfA and structural com-parisons of encoded arabinofuranosidases. The genes with locustags PJDR2_3599 and PJDR2_3019, encoding AbfB and AbfA,

respectively, of the GH51 family of arabinofuranosidases, wereselected for further consideration because they are close homologsof the fully characterized arabinofuranosidase from Geobacillusstearothermophilus T6, which has been implicated in the efficientprocessing of MeGAXn (31, 32). The abfB gene was considered forfurther study on the basis of its location in the genome and thepresence of neighboring genes encoding transcriptional regula-tors and ABC transporters (Fig. 3C). The MeGAXn utilizationsystem of Paenibacillus sp. JDR-2 should then include a gene en-coding an extracellular multimodular cell surface-anchoringGH10 endoxylanase which depolymerizes xylan, 9 genes com-prising an aldouronate utilization gene cluster, and a separategene cluster including abfB, all contributing to the rapid assim-ilation of oligosaccharides and further intracellular processing(Fig. 3A to C).

The CAZy (http://www.cazy.org/) database, which classifiesenzymes on the basis of protein folding patterns, predicts themembers of the GH51 family to possess alpha-beta barrel struc-tures. The (�/�)8 structure of AbfB was modeled (Fig. 4), and theclosest homolog was arabinofuranosidase from Geobacillus stearo-thermophilus T6, with which AbfB shares 68% similarity and forwhich the structure-function relationship is defined. On the basisof sequence alignments (data not shown) and information fromPfam, the catalytic activity of AbfB is conferred by catalytic nu-cleophile E293 and proton donor E174.

Coregulation of abfB with xylan utilization genes. The levelsof expression of the following genes in cultures growing on differ-

FIG 2 Carbohydrate utilization and product accumulation by Paenibacillus sp. JDR-2. Paenibacillus sp. JDR-2 in 20 ml ZH medium containing 0.1% yeastextract supplemented with 0.5% sorghum MeGAXn (A) or 0.5% oligosaccharides derived from sorghum MeGAXn digested by XynA1CD (B) was cultured in250-ml baffled flasks at 30°C and 220 rpm. First lane, xylose (X1), xylobiose (X2), xylotriose (X3), and xylotetraose (X4) as standards (10 nmol each); second lane,MeGX1, MeGX2, MeGX3, and MeGX4 aldouronates as standards (10 nmol each); third lane, arabinose (A) as a standard (10 nmol); lanes labeled with differenttimes, aliquots of cell-free supernatants from cultures collected at regular time intervals. The cell-free supernatants were spotted on the TLC plate and developedas described in Materials and Methods.

Sawhney and Preston

6118 aem.asm.org Applied and Environmental Microbiology

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

ent substrates were studied by qRT-PCR: abfB (PJDR2_3599) anda neighboring gene, arsR (PJDR2_3598; encoding a transcrip-tional regulator), along with genes comprising the xylan utiliza-tion regulon, xynA1 (PJDR2_0221), aguA (PJDR2_1323), araC

(PJDR2_1318; encoding a transcriptional regulator), and lplA(PJDR2_1320; encoding an ABC transporter). Compared togrowth in yeast extract without carbohydrate, the xynA1 and aguAgenes were significantly upregulated when Paenibacillus sp. JDR-2was grown on sorghum MeGAXn, sugarcane MeGAXn, or sweet-gum MeGXn relative to their regulation when it was grown onxylose. Constitutive expression of the abfB gene and its neighbor-ing arsR gene was observed when Paenibacillus sp. JDR-2 wasgrown on xylan or monosaccharides. Higher numbers of abfBmRNA molecules were determined with sorghum MeGAXn andsugarcane MeGAXn as the substrates than with sweetgum MeGXn

as the substrate, indicating upregulation in the presence ofMeGAXn compared to the level of regulation in the presence ofMeGXn. This indicates a possible role of AbfB in digesting ara-bino-linked substrates. The coregulation of xynA1 and genes com-prising an aldouronate utilization gene cluster, which has beenstudied previously to define the MeGXn utilization system (18),was extended here to evaluate the expression of xynA1 and thealdouronate utilization gene cluster in coordination with expres-sion of abfB and its neighbors to define the MeGAXn utilizationsystem in Paenibacillus sp. JDR-2 (Fig. 5).

Cloning, expression, and characterization of AbfB and AbfA.The abfB or abfA PCR product was cloned into the pETite vectorand cotransformed along with pRARE into E. coli BL21(DE3). Theoverexpressed 6� His-tagged protein AbfB (503 amino acid resi-dues with a molecular mass of 56 kDa; ExPASy) or AbfA (506amino acid residues with a molecular mass of 57 kDa; ExPASy)was purified and verified to be a single band of the appropriatemolecular mass on an SDS-polyacrylamide gel stained with Coo-massie brilliant blue. The optimal buffer and optimal pH for themaximum activity of AbfB at 30°C were defined (Fig. 6A). AbfBshowed optimal activity at pH 6.5 in 50 mM sodium acetatebuffer. This condition was used to determine that activity wasoptimal at 42°C (Fig. 6B). AbfB was stable for at least 6 h from

FIG 3 Genes comprising the MeGAXn utilization system and encoded products. (A) xynA1; (B) aldouronate utilization gene cluster; (C) abfB and neighboringgenes.

FIG 4 Alpha-beta barrel (�/�)8 structure of GH51 AbfB. This structure was de-veloped using the PDB file generated by the Phyre2 and Chimera programs, withthe closest homolog being to the arabinofuranosidase from Geobacillus stearo-thermophilus T6. The catalytic role of AbfB is conferred to catalytic nucleophileGlu293 and proton donor Glu174, based on alignment and information fromPfam. The distance between Glu293 and Glu174 was calculated to be 4.6 Å.

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6119

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

30°C to 50°C, lost 50% of its activity in less than 2 h and almost allof its activity in 6 h at 60°C, and lost all of its activity in less than 30min at 70°C and above (Fig. 6C). The kinetic parameters of AbfBwere evaluated using pNP-A in 50 mM sodium acetate buffer, pH6.5, at 30°C. The specific activity of AbfB was 12.9 U/mg (1 U ofactivity is equal to 1 �mol of product formed/min); Km was 1.08mM, Vmax was 13.2 U/mg, and kcat was 12.5/s (Fig. 6D). The ac-tivity was determined by measurement of the increase in theabsorbance at 405 nm over time, and it was observed that thereaction velocity increased with an increase in the substrate con-centration and then reached saturation (Fig. 6E). The arabino-furanosidase activity of AbfA was characterized, and it was foundto have a specific activity of 9.5 U/mg for pNP-A at pH 6.5 and30°C.

Products generated by the action of AbfB on sorghumMeGAXn and its complementary role with XynA1. TLC analysiswas carried out to study (i) the action of recombinant AbfB andXynA1CD together on MeGAXn, (ii) the action of XynA1CD onMeGAXn followed by the action of AbfB, and (iii) the action ofAbfB on filtered oligomers generated from MeGAXn that had pre-viously been digested by XynA1CD (Fig. 7). Lanes 5 to 9 displaythe dominant oligomeric products xylobiose (X2), xylotriose (X3),and MeGX3, along with small amounts of MeGX4 and xylose,

generated by the action of GH10 XynA1CD on MeGAXn as thesubstrate. These were also seen with MeGXn as the substrate (22).Other significant components with mobilities slightly lower thanthose of the X2 and X3 standards were detected as well. The actionof AbfB along with that of XynA1CD (lanes 6 and 9) resulted in theconversion of these to XOS with mobilities corresponding to thoseof X2, X3, and arabinose, supporting their identities as arabinoxy-lobiose (AX2) and arabinoxylotriose (AX3). The absence of de-tectable arabinose in lane 7 indicates that AbfB is not veryactive in cleaving the arabinose side chains by acting directly onthe polysaccharide and that it requires XynA1CD to first depoly-merize the MeGAXn. The lanes with dark spots at the origin indi-cate the remaining amount of undigested MeGAXn in the reactionmixtures (Fig. 7). This experiment clearly indicates that theGH10/GH67 system does not require pretreatment of MeGAXn

by arabinofuranosidase; rather, the AXOS generated on digestionof MeGAXn by XynA1 are preferable substrates for the action ofAbfB to remove the arabinofuranose substitutions.

The amount of arabinose released during these reactionswas estimated by HPLC, and it was observed that AbfB has anextremely low specificity toward polysaccharides but has highspecificity toward oligomers generated from MeGAXn digested byXynA1CD (Table 2; Fig. 8). The amount of arabinose releasedfrom MeGAXn when digested by the combined action ofXynA1CD and AbfB was 17 times greater than that generated bythe direct action of AbfB on MeGAXn. On the basis of determina-tion of the total carbohydrate content by the phenol-sulfuric acidassay and on the basis of the results of HPLC for determination ofthe amount of arabinose released after complete removal of thearabino linkages from oligosaccharides by AbfB, the arabinofura-noside substitution on the sorghum stalk MeGAXn backbone wasestimated to be 1.0 arabinose residue for every 9.4 xylose residues.The specific activities of AbfB on MeGAXn with and withoutXynA1CD were 0.23 and 0.07 U/mg, respectively, as determinedby Nelson’s reducing sugar assay (25).

AbfA, a close homolog of the GH51 arabinofuranosidase fromGeobacillus stearothermophilus T6 and AbfB, was similar to AbfBwith respect to the kcat and Km values obtained with pNP-A as thesubstrate, and AbfA also generated products from oligosaccha-rides derived from the xylanolytic digestion of MeGAXn similar tothose generated by AbfB. AbfA was not considered for detailedstudies, as the abfA gene did not have neighboring genes encodingtranscriptional regulators and ABC transporters. Moreover, abfAwas not upregulated following the growth of Paenibacillus sp.JDR-2 on MeGAXn (unpublished data).

DISCUSSION

The fully sequenced genome of Paenibacillus sp. JDR-2 identifiedgenes comprising a GH10/GH67 system for the processing ofMeGAXn as well as MeGXn. For the processing of MeGAXn, thissystem includes xynA1, which encodes extracellular multimodularcell-associated GH10 endoxylanase (22); an aldouronate utiliza-tion gene cluster with aguA, xynA2, xynB, and genes encodingtranscriptional regulators and ABC transporters (18); and the dis-tally located abfB. All of these genes participate in a process thatincludes the depolymerization of MeGAXn, the rapid assimilationof oligomeric products, and intracellular metabolism (Fig. 3).Paenibacillus sp. JDR-2 utilizes MeGAXn more efficiently and witha higher growth yield than MeGXn, suggesting that the largeramounts of neutral sugars (AXOS and XOS) and smaller amounts

FIG 5 MeGAXn utilization system gene expression in Paenibacillus sp.JDR-2. Paenibacillus sp. JDR-2 cultures were grown in ZH medium contain-ing 0.1% yeast extract with different substrates containing 0.5% carbohy-drate (�, sorghum MeGAXn; , sugarcane MeGAXn; o, sweetgumMeGXn; , xylose) or without carbohydrate ( ) as a control. The cultureswere grown in 250-ml baffled flasks at 30°C and 220 rpm. The cells wereharvested from the early mid-exponential phase, and RNA was isolated, puri-fied, and treated with DNase. qRT-PCR was carried out to study the levels ofexpression of abfB and the neighboring gene, arsR, encoding a transcriptionalregulator, along with those of xylan utilization regulon genes xynA1, aguA,araC (encoding a transcriptional regulator), and lplA (encoding an ABC trans-porter). The expression studies were carried out using threshold cycle (CT)values to determine the number of mRNA molecules and employing thegenomic DNA to generate the standard curve by PCR.

Sawhney and Preston

6120 aem.asm.org Applied and Environmental Microbiology

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

of acidic sugars (aldouronates) generated by the depolymerizationof MeGAXn are more preferable for the growth of Paenibacillus sp.JDR-2 (unpublished data). The higher growth rate and the pref-erence that Paenibacillus sp. JDR-2 shows for growth on and uti-lization of MeGAXn rather than the oligosaccharide products ofdepolymerization, also shown for the utilization of MeGXn (11,22), support a process in which assimilation and metabolism arecoupled thermodynamically, if not mechanistically, to the depo-lymerization catalyzed by the cell-associated XynA1 GH10 en-doxylanase. The rapid disappearance and lack of accumulation ofAXOS as well as XOS and aldouronates in the medium furthersupport this interpretation. XynA1, which has carbohydrate bind-ing modules to interact with xylan and surface layer homologydomains to anchor to the bacterial cell surface, is expected to gen-erate oligosaccharides at the cell surface, where they may associatewith substrate binding components of the ABC transporter com-plex, enabling the rapid assimilation of oligosaccharides withouttheir diffusion into the medium (22). This interpretation is alsosupported by the lower rate of substrate utilization by Paenibacil-lus sp. JDR-2 when grown on oligosaccharides produced by the invitro enzymatic hydrolysis of MeGAXn using XynA1CD (Fig. 2).

The unique property of Paenibacillus sp. JDR-2 of carrying outefficient depolymerization of MeGAXn and MeGXn coupled withthe assimilation and intracellular metabolism of the products ofdepolymerization supports its further development as a biocata-lyst for the bioconversion of hemicelluloses to targeted products(11). Paenibacillus sp. JDR-2 appears to have evolved a processallowing the conservation of ATP by transporting more xylose andarabinose units in the form of AXOS, XOS, and aldouronates. Thebioenergetics involved in the transport of AXOS may support theefficient growth and utilization of MeGAXn by Paenibacillus sp.JDR-2, as described in studies of the cellulose utilization of Clos-tridium thermocellum (33).

The characterized GH51 arabinofuranosidases from Clostrid-ium thermocellum ATCC 27405 (34), Geobacillus stearothermophi-lus T6 (31, 32), and Bacillus subtilis 168 AbfA (35) are very closelyrelated to AbfB and AbfA from Paenibacillus sp. JDR-2. The prop-erties of these arabinofuranosidases are comparable to those of thearabinofuranosidases from Paenibacillus sp. JDR-2, where AbfBhas a structure predicted to be very similar to that of the GH51arabinofuranosidase from Geobacillus stearothermophilus T6. Pu-rified AbfB has a Km of 1.08 mM for pNP-A at pH 6.5 and 30°C and

FIG 6 Optimal conditions and kinetic parameters of AbfB. (A) pH optimization was carried out at 30°C using 50 mM buffers, such as sodium acetate buffer(closed squares), citrate buffer (open diamonds), or potassium phosphate buffer (open triangles); (B) temperature optimization was carried out using 50 mMsodium acetate buffer, pH 6.5, at 30 to 50°C; (C) temperature stability analysis was carried out by incubating AbfB at different temperatures, such as 30°C (opencircles), 37°C (open triangles), 42°C (closed squares), 50°C (dashes), 60°C (closed circles), 70°C (closed triangles), and 80°C (open squares), followed by assayingof aliquots at regular intervals of time to estimate the remaining activity; (D) Lineweaver-Burk plot generated using the relation between reaction velocity (V) andpNP-A substrate concentration ([S]) to determine the kinetic parameters of AbfB. (E) Velocity of the AbfB reaction plotted against the pNP-A substrateconcentration. The specific activity of AbfB was 12.9 U/mg (1 U of activity is equal to 1 �mol of product formed/min); Km was 1.08 mM, Vmax was 13.2 U/mg,and kcat was 12.5/s.

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6121

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

no loss of activity for 6 h at 50°C, suggesting that abfB may be asuitable candidate for development of a bacterial biocatalyst inSSF. It has greater specificity toward AXOS than MeGAXn. It alsohas slight xylosidase activity of 0.07 U/mg (where 1 U of activity isequal to 1 �mol of product formed/min) when para-nitrophenyl-xylopyranoside is used as the substrate in 50 mM sodium acetatebuffer, pH 6.5, at 30°C (unpublished data). Geobacillus stearother-mophilus T6, which possesses a GH51 arabinofuranosidase alongwith the GH10/GH67 system, has been evaluated as a candidatefor biomass processing (20), and the findings for G. stearothermo-

philus signify the need to explore the metabolic potential of Paeni-bacillus sp. JDR-2 and its unique properties for development as abiocatalyst to directly and efficiently convert hemicellulosic bio-mass to biomass-based products.

The higher level of abfB expression obtained when Paenibacil-lus sp. JDR-2 is grown in the presence of MeGAXn than when it isgrown in the presence of MeGXn supports the significance of AbfBin cleaving the arabinofuranose side chain substitutions from theassimilated oligosaccharides generated by depolymerization ofMeGAXn. The upregulation of abfB expression when Paenibacillussp. JDR-2 is cultured with MeGAXn compared to its level of ex-pression when it is cultured with MeGXn and its cooperative ex-pression with the distally located xynA1 and aldouronate utiliza-tion gene cluster further support its role in the MeGAXn

utilization system. The genes encoding ABC transporters in thealdouronate utilization gene cluster are highly upregulated whenPaenibacillus sp. JDR-2 is cultured on MeGAXn and MeGXn,contributing to the assimilation of oligosaccharides producedby the depolymerization of xylan. The levels of expression ofthese genes have recently been evaluated by Paenibacillus sp.JDR-2 transcriptomic analysis by RNA sequencing (RNA-seq) ofcells grown on substrates such as sorghum MeGAXn, sweetgumMeGXn, xylose, arabinose, and glucose (unpublished data).Among all the genes in Paenibacillus sp. JDR-2 predicted to en-code arabinofuranosidases of the GH51 and GH43 families, onlyabfB was upregulated, as determined by RNA-seq (unpublisheddata).

AbfB is highly active and more specific toward AXOS thanpolysaccharide MeGAXn. XynA1 has previously been shown byTLC analysis to digest MeGXn to produce X2, X3, and MeGX3 (22).With MeGAXn, AbfB generates two additional components, onewith a mobility slightly less than that of X2 and a second one witha mobility slightly less than that of X3. The observation that treat-ment with AbfB converts these components to products with TLCmobilities corresponding to those of X2, X3, and arabinose indi-cates that they are AX2 and AX3 (Fig. 7). The genome of Paeniba-cillus sp. JDR-2 revealed the absence of a sequence correspondingto the signal peptide on abfB, thereby indicating that it is an intra-cellular enzyme and hence more efficient in processing AXOSthan MeGAXn. Since the action of XynA1CD on MeGAXn gener-ates AX2 and AX3 as prominent oligosaccharides, along with X2,X3, and MeGX3, the arabino linkages on the AXOS prevent the

FIG 7 Products generated by the action of recombinant AbfB and XynA1CDon sorghum MeGAXn. AbfB and/or XynA1CD was incubated in MeGAXn in50 mM sodium acetate buffer, pH 6.5, at 30°C for 16 h, with the reactioncomponents being resolved by TLC, as described in Materials and Methods.Lane 1, xylose (X1), xylobiose (X2), xylotriose (X3), and xylotetraose (X4) asstandards (10 nmol each); lane 2, MeGX1, MeGX2, MeGX3, and MeGX4 al-douronates as standards (10 nmol each); lane 3, arabinose (A) as a standard (10nmol); lane 4, MeGAXn control (200 nmol); lanes 5 to 9, reaction mixturecontaining 200 nmol of MeGAXn that was incubated with the indicated en-zymes. The oligomers were obtained by digesting MeGAXn with XynA1CD andfiltering out the oligomeric products to be treated with AbfB, as shown in lanes8 and 9.

TABLE 2 AbfB-mediated release of arabinose from MeGAXn andoligosaccharides derived from MeGAXn digested with XynA1CDa

Substrate XynA1CD AbfBArabinoseconcn (mM)

MeGAXn � � NDb

MeGAXn � � 0.023MeGAXn � � 0.39Oligosaccharides � � NDOligosaccharides � � 0.341a MeGAXn was treated with XynA1CD and/or AbfB in 50 mM sodium acetate buffer,pH 6.5, at 30°C for 16 h. A fraction of the reaction mixture where MeGAXn wasdigested with XynA1CD was filtered to separate out oligosaccharides from theundigested xylan. The oligosaccharides were treated with AbfB in 50 mM sodiumacetate buffer, pH 6.5, at 30°C for 16 h. The reaction was stopped by heating in a 70°Cwater bath for 10 min. The reaction mixtures were filtered, and the amount ofarabinose released was determined by HPLC.b ND, not detected.

Sawhney and Preston

6122 aem.asm.org Applied and Environmental Microbiology

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

release of xylose for metabolism until AbfB removes the arabinosefrom AXOS. With arabinose representing 10% of the pentoses andwith the AXOS AX2 and AX3 being generated in equal amounts,following extracellular processing as much as 40% of the MeGAXn

may require intracellular removal of arabinose by AbfB for furtherconversion to form pentoses for fermentation.

Species such as Bacillus subtilis 168 have evolved a GH11/GH30xylan utilization system which produces extracellular GH30 andGH11 (36, 37) as well as XynD (9), which release smaller products,including xylose, X2, X3, MeGX3, and arabinose. These speciesmay possess ABC transporters that may aid with the assimilationof xylose, XOS, and arabinose. This system is not as efficient as aGH10/GH67 system for the generation of xylose for fermentation,since it accumulates MeGX3 in the medium, which cannot beassimilated and metabolized (15, 37). In Paenibacillus sp. JDR-2,the GH10/GH67 system complemented with intracellular pro-cessing by enzymes, including GH51 arabinofuranosidases, pro-vides an advantage for the intracellular removal of arabinose sinceit efficiently assimilates AXOS. Moreover, the GH10/GH67 xylanutilization system in Paenibacillus sp. JDR-2 achieves the completeconversion of xylan (11, 18, 22). This system possesses ABC trans-porters to assimilate all the oligosaccharides, including AXOS,XOS, and aldouronates, to achieve complete conversion to pro-

duce fermentable sugars in higher yields, allowing the completeconversion of the xylose in MeGAXn as well as MeGXn to biofuelsand chemicals. The presence of arabinofuranose side chains on theoligosaccharides may prevent further processing by intracellularxylanase (XynA2) and �-xylosidase (XynB) enzymes, making thearabinofuranosidase activity of AbfB required for the generationof products that can be processed by these intracellular enzymesencoded by the genes belonging to the aldouronate utilizationgene cluster (Fig. 9).

The genome of Paenibacillus sp. JDR-2 includes genes that playa prominent role in the complete hydrolysis of a variety of poly-saccharides, such as MeGAXn, MeGXn, starch, arabinan, and bar-ley glucan, producing cell-associated enzymes. Paenibacillus sp.JDR-2 has the ability to grow more rapidly on the polysaccharidesthan on the oligosaccharides derived from them or monosaccha-rides. Paenibacillus sp. JDR-2 has evolved a GH10/GH67 systemfor the complete and direct conversion of MeGAXn for metabo-lism. This bacterium also has the potential to hydrolyze aldouro-nates like MeGX3 and MeGX1, which are otherwise not metabo-lized. Paenibacillus sp. JDR-2 has been shown to grow underoxygen-limiting conditions and produce small quantities of lac-tate, acetate, and ethanol (22), and work is in progress to improve

FIG 8 HPLC profiles quantifying the release of arabinose on treatment of oligosaccharides generated from XynA1CD -digested sorghum MeGAXn with andwithout AbfB. Components were resolved using an HPX87-H column and detected by differential refractometry, as described in Materials and Methods. Theretention times of the xylose and arabinose standards are 14.7 and 16.1 min, respectively. The area of eluted xylose was an average of 4,397 units, equivalent toan average concentration of 0.140 mM, and the area of eluted arabinose was 9,270 units, equivalent to a concentration of 0.341 mM. (A) Oligosaccharides withoutAbfB treatment; (B) oligosaccharides with AbfB treatment. Norm., arbitrary units.

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6123

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

yields. The metabolic potential of Paenibacillus sp. JDR-2 supportsits further development as a biocatalyst for the efficient and com-plete conversion of hemicelluloses to fermentable sugars.

ACKNOWLEDGMENTS

We thank K. T. Shanmugam and L. O. Ingram, Department of Microbi-ology and Cell Science, for use of facilities and advice and John E. Erick-son, Department of Agronomy, for providing sorghum and sugarcanebagasse. We appreciate the assistance provided by John D. Rice and MunSu Rhee, Department of Microbiology and Cell Science.

This research was supported by Biomass Research & DevelopmentInitiative competitive grant no. 2011-10006-30358 from the USDA Na-tional Institute of Food and Agriculture.

REFERENCES1. Ingram LO, Aldrich HC, Borges AC, Causey TB, Martinez A, Morales

F, Saleh A, Underwood SA, Yomano LP, York SW, Zaldivar J, Zhou S.1999. Enteric bacterial catalysts for fuel ethanol production. Biotechnol.Prog. 15:855– 866. http://dx.doi.org/10.1021/bp9901062.

2. Jarboe LR, Grabar TB, Yomano LP, Shanmugan KT, Ingram LO. 2007.Development of ethanologenic bacteria. Adv. Biochem. Eng. Biotechnol.108:237–261. http://dx.doi.org/10.1007/10_2007_068.

3. Jeffries TW, Jin YS. 2004. Metabolic engineering for improved fermen-tation of pentoses by yeasts. Appl. Microbiol. Biotechnol. 63:495–509.http://dx.doi.org/10.1007/s00253-003-1450-0.

4. Lynd LR, Wyman CE, Gerngross TU. 1999. Biocommodity engineering.Biotechnol. Prog. 15:777–793. http://dx.doi.org/10.1021/bp990109e.

5. Ou MS, Ingram LO, Shanmugam KT. 2011. L(�)-Lactic acid produc-tion from non-food carbohydrates by thermotolerant Bacillus coagu-lans. J. Ind. Microbiol. Biotechnol. 38:599 – 605. http://dx.doi.org/10.1007/s10295-010-0796-4.

6. Shanmugam KT, Ingram LO. 2008. Engineering biocatalysts for produc-tion of commodity chemicals. J. Mol. Microbiol. Biotechnol. 15:8 –15.http://dx.doi.org/10.1159/000111988.

7. Olson DG, McBride JE, Shaw AJ, Lynd LR. 2012. Recent progress inconsolidated bioprocessing. Curr. Opin. Biotechnol. 23:396 – 405. http://dx.doi.org/10.1016/j.copbio.2011.11.026.

8. Biely P, Vrsanska M, Tenkanen M, Kluepfel D. 1997. Endo-beta-1,4-xylanase families: differences in catalytic properties. J. Biotechnol. 57:151–166. http://dx.doi.org/10.1016/S0168-1656(97)00096-5.

9. Bourgois TM, Van Craeyveld V, Van Campenhout S, Courtin CM, Del-cour JA, Robben J, Volckaert G. 2007. Recombinant expression and char-acterization of XynD from Bacillus subtilis subsp. subtilis ATCC 6051: a GH43 arabinoxylan arabinofuranohydrolase. Appl. Microbiol. Biotechnol.75:1309 –1317. http://dx.doi.org/10.1007/s00253-007-0956-2.

10. Kuhad RC, Singh A, Eriksson KE. 1997. Microorganisms and enzymesinvolved in the degradation of plant fiber cell walls. Adv. Biochem. Eng.Biotechnol. 57:45–125.

11. Nong G, Rice JD, Chow V, Preston JF. 2009. Aldouronate utilization inPaenibacillus sp. strain JDR-2: physiological and enzymatic evidence forcoupling of extracellular depolymerization and intracellular metabolism.Appl. Environ. Microbiol. 75:4410 – 4418. http://dx.doi.org/10.1128/AEM.02354-08.

12. Preston JF, Rice JD, Chow MC. 1993. Pectinolytic bacteria and theirsecreted pectate lyases: agents for the maceration and solubilization ofphytomass for fuels production. Biomass Bioenergy 5:215–222. http://dx.doi.org/10.1016/0961-9534(93)90072-C.

13. Preston JF, Hurlbert JC, Rice JD, Ragunathan A, St John FJ. 2003. Micro-bial strategies for the depolymerization of glucuronoxylan: leads to the bio-technological applications of endoxylanases, p 191–210. In Mansfield SD,Saddler JN (ed), Application of enzymes to lignocellulosics. ACS SymposiumSeries, no. 855. American Chemical Society, Washington, DC.

14. Billa E, Koullas DP, Monties B, Koukios EG. 1997. Structure andcomposition of sweet sorghum stalk components. Ind. Crops Prod. 6:297–302. http://dx.doi.org/10.1016/S0926-6690(97)00031-9.

15. St. John FJ, Rice JD, Preston JF. 2006. Characterization of XynC fromBacillus subtilis subsp. subtilis strain 168 and analysis of its role in depoly-merization of glucuronoxylan. J. Bacteriol. 188:8617– 8626. http://dx.doi.org/10.1128/JB.01283-06.

16. Verbruggen MA, Spronk BA, Schols HA, Beldman G, Voragen AG,Thomas JR, Kamerling JP, Vliegenthart JF. 1998. Structures of enzy-mically derived oligosaccharides from sorghum glucuronoarabinoxy-lan. Carbohydr. Res. 306:265–274. http://dx.doi.org/10.1016/S0008-6215(97)10064-7.

17. Mosier N, Wyman C, Dale B, Elander R, Lee YY, Holtzapple M, LadischM. 2005. Features of promising technologies for pretreatment of lignocel-lulosic biomass. Bioresour. Technol. 96:673– 686. http://dx.doi.org/10.1016/j.biortech.2004.06.025.

18. Chow V, Nong G, Preston JF. 2007. Structure, function, and regulation ofthe aldouronate utilization gene cluster from Paenibacillus sp. strain JDR-2.J. Bacteriol. 189:8863– 8870. http://dx.doi.org/10.1128/JB.01141-07.

19. Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH,Hickey EK, Peterson JD, Nelson WC, Ketchum KA, McDonald L,Utterback TR, Malek JA, Linher KD, Garrett MM, Stewart AM, CottonMD, Pratt MS, Phillips CA, Richardson D, Heidelberg J, Sutton GG,Fleischmann RD, White O, Eisen JA, Salzberg SL, Smith HO, VenterJC, Fraser CM. 1999. Evidence for lateral gene transfer between archaeaand bacteria from genome sequence of Thermotoga maritima. Nature 399:323–329. http://dx.doi.org/10.1038/20601.

20. Shulami S, Gat O, Sonenshein AL, Shoham Y. 1999. The glucuronic acidutilization gene cluster from Bacillus stearothermophilus T-6. J. Bacteriol.181:3695–3704.

21. Chow V, Nong G, St John JF, Rice JD, Dickstein E, Chertkov O, BruceD, Detter C, Brettin T, Han J, Woyke T, Pitluck S, Nolan M, Pati A,Martin J, Copeland A, Land ML, Goodwin L, Jones JB, Ingram LO,Shanmugam KT, Preston JF. 2012. Complete genome sequence of Paeni-bacillus sp. strain JDR-2. Stand. Genomic Sci. 6:1–10. http://dx.doi.org/10.4056/sigs.2374349.

22. St. John FJ, Rice JD, Preston JF. 2006. Paenibacillus sp. JDR-2 andXynA1: a novel system for methylglucuronoxylan utilization. Appl. Envi-ron. Microbiol. 72:1496 –1506. http://dx.doi.org/10.1128/AEM.72.2.1496-1506.2006.

23. Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F. 1956. Color-imetric method for the determination of sugars and related substances.Anal. Chem. 28:350 –356. http://dx.doi.org/10.1021/ac60111a017.

24. Bounias M. 1980. N-(1-Naphthyl)ethylenediamine dihydrochloride as anew reagent for nanomole quantification of sugars on thin-layer plates by

FIG 9 Model displaying the coupling of depolymerization, assimilation,and intracellular metabolism for utilization of MeGAXn or MeGXn inPaenibacillus sp. JDR-2. X, �-1,4-linked xylopyranosyl units (X, xylose; X2,xylobiose; X3, xylotriose); MeG, �-1,2-linked 4-O-methyl-D-glucuronopy-ranosyl residues (MeG, methylglucuronate; MeGX3, aldotetrauronate); A,�-1,2- and/or 1,3-linked L-arabinofuranosyl residues (A, arabinose; AX2,arabino-linked X2; AX3, arabino-linked X3); XynA1, extracellular cell-as-sociated GH10 endoxylanse; AguA, GH67 �-glucuronidase; AbfB, GH51�-L-arabinofuranosidase; XynA2, GH10 endoxylanse; XynB, GH43 �-xy-losidase; ABC, ABC transporters.

Sawhney and Preston

6124 aem.asm.org Applied and Environmental Microbiology

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from

a mathematical calibration process. Anal. Biochem. 106:291–295. http://dx.doi.org/10.1016/0003-2697(80)90523-0.

25. Nelson N. 1944. A photometric adaptation of the Somogyi method for thedetermination of glucose. J. Biol. Chem. 153:375–380.

26. Zucker M, Hankin L. 1970. Regulation of pectate lyase synthesis in Pseu-domonas fluorescens and Erwinia carotovora. J. Bacteriol. 104:13–18.

27. Kelley LA, Sternberg MJ. 2009. Protein structure prediction on the Web:a case study using the Phyre server. Nat. Protoc. 4:363–371. http://dx.doi.org/10.1038/nprot.2009.2.

28. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM,Meng EC, Ferrin TE. 2004. UCSF Chimera—a visualization system forexploratory research and analysis. J. Comput. Chem. 25:1605–1612. http://dx.doi.org/10.1002/jcc.20084.

29. Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths-Jones S,Khanna A, Marshall M, Moxon S, Sonnhammer EL, Studholme DJ,Yeats C, Eddy SR. 2004. The Pfam protein families database. NucleicAcids Res. 32:138 –141. http://dx.doi.org/10.1093/nar/gkm960.

30. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWil-liam H, Remmert M, Söding J, Thompson JD, Higgins DG. 2011. Fast, scalablegeneration of high-quality protein multiple sequence alignments using ClustalOmega. Mol. Syst. Biol. 7:539. http://dx.doi.org/10.1038/msb.2011.75.

31. Hövel K, Shallom D, Niefind K, Belakhov V, Shoham G, Baasov T,Shoham Y, Schomburg D. 2003. Crystal structure and snapshots alongthe reaction pathway of a family 51 alpha-L-arabinofuranosidase. EMBO J.22:4922– 4932. http://dx.doi.org/10.1093/emboj/cdg494.

32. Shallom D, Belakhov V, Solomon D, Shoham G, Baasov T, Shoham Y.2002. Detailed kinetic analysis and identification of the nucleophile inalpha-L-arabinofuranosidase from Geobacillus stearothermophilus T-6, afamily 51 glycoside hydrolase. J. Biol. Chem. 277:43667– 43673. http://dx.doi.org/10.1074/jbc.M208285200.

33. Zhang YH, Lynd LR. 2005. Cellulose utilization by Clostridium ther-mocellum: bioenergetics and hydrolysis product assimilation. Proc.Natl. Acad. Sci. U. S. A. 102:7321–7325. http://dx.doi.org/10.1073/pnas.0408734102.

34. Taylor EJ, Smith NL, Turkenburg JP, D’Souza S, Gilbert HJ, Davies GJ.2006. Structural insight into the ligand specificity of a thermostable family51 arabinofuranosidase, Araf51, from Clostridium thermocellum.Biochem. J. 395:31–37. http://dx.doi.org/10.1042/BJ20051780.

35. Inácio JM, Correia IL, de Sá-Nogueira I. 2008. Two distinct arabino-furanosidases contribute to arabino-oligosaccharide degradation in Bacil-lus subtilis. Microbiology 154:2719 –2729. http://dx.doi.org/10.1099/mic.0.2008/018978-0.

36. Nishitani K, Nevins DJ. 1991. Glucuronoxylan xylanohydrolase. Aunique xylanase with the requirement for appendant glucuronosyl units.J. Biol. Chem. 266:6539 – 6543.

37. Rhee MS, Wei L, Sawhney N, Rice JD, St John FJ, Hurbert JC, PrestonJF. 2014. Engineering the xylan utilization system in Bacillus subtilis forproduction of acidic xylooligosaccharides. Appl. Environ. Microbiol. 80:917–927. http://dx.doi.org/10.1128/AEM.03246-13.

Paenibacillus Methylglucuronoarabinoxylan Utilization

October 2014 Volume 80 Number 19 aem.asm.org 6125

on April 23, 2021 by guest

http://aem.asm

.org/D

ownloaded from