Generation of a Canine Anti-EGFR (ErbB-1) Antibody for ...mct.aacrjournals.org/content/molcanther/13/7/1777.full.pdf · Passive Immunotherapy in Dog Cancer Patients Josef Singer1,3,

Large Molecule Therapeutics

Generation of a Canine Anti-EGFR (ErbB-1) Antibody forPassive Immunotherapy in Dog Cancer Patients

Josef Singer1,3, Judit Fazekas1,3,5, Wei Wang7, Marlene Weichselbaumer1,3, Miroslawa Matz1,Alexander Mader6, Willibald Steinfellner6, Sarah Meitz1,3, Diana Mechtcheriakova1, Yuri Sobanov1,Michael Willmann4, Thomas Stockner2, Edzard Spillner8, Renate Kunert6, and Erika Jensen-Jarolim1,3

AbstractPassive immunotherapy with monoclonal antibodies represents a cornerstone of human anticancer ther-

apies, but has not been established in veterinarymedicine yet. As the tumor-associated antigen EGFR (ErbB-1)

is highly conserved between humans and dogs, and considering the effectiveness of the anti-EGFR antibody

cetuximab in human clinical oncology, we present here a "caninized" version of this antibody, can225IgG, for

comparative oncology studies. Variable region genes of 225, the murine precursor of cetuximab, were fused

with canine constant heavy gamma and kappa chain genes, respectively, and transfected into Chinese hamster

ovary (CHO)DUKX-B11 cells. Of note, 480 cloneswere screened and the best cloneswere selected according to

productivity andhighest specificity in EGFR-coated ELISA.Uponpurificationwith ProteinG, the recombinant

cetuximab-like canine IgGwas tested for integrity, correct assembly, and functionality. Specific binding to the

surface of EGFR-overexpressing cells was assessed by flow cytometry and immunofluorescence; moreover,

binding to canine mammary tissue was demonstrated by immunohistochemistry. In cell viability and

proliferation assays, incubation with can225IgG led to significant tumor cell growth inhibition. Moreover,

this antibodymediated significant tumor cell killing via phagocytosis in vitro.We thus present here, for the first

time, the generation of a canine IgG antibody and its hypothetical structure. On the basis of its cetuximab-like

binding site, on the one hand, and the expression of a 91%homologous EGFRmolecule in canine cancer, on the

other hand, this antibodymay be a promising research compound to establish passive immunotherapy in dog

patients with cancer. Mol Cancer Ther; 13(7); 1777–90. �2014 AACR.

IntroductionMalignant diseases are major health problems in

humans, as well as in the area of veterinary medicine.Although pets and owners share several environmental

(1) as well as genetic risk factors (2) to develop cancer,comparative oncology approaches treating human andpet patients with similar drugs to gain more insight intobiologic activity, pharmacokinetics, or therapeutic indiceshave only recently been initiated (3, 4).

Standard therapy regimens for veterinary patients withcancer comprise surgery, radiotherapy, and chemother-apy with drugs that have been long established in humanmedicine, for example, cyclophosphamide, 5-fluoroura-cil, and doxorubicin for treatment of canine mammarycarcinoma (5). Modern targeted approaches, such asreceptor tyrosine kinase inhibitors (6, 7) or cancer vaccines(8), have just been introduced into veterinarian medicinein recent years, but these have shownpromising results sofar.

Passive immunotherapy with monoclonal antibodies isa key element in therapy guidelines on human oncology.However, immunoglobulins, such as cetuximab (Erbitux;Merck) for the treatment of colorectal carcinoma over-expressing EGFR (epidermal growth factor receptor,ErbB-1; ref. 9) or trastuzumab (Herceptin; Genentech) formetastatic breast cancer overexpressing HER2 (humanepidermal growth factor receptor-2, ErbB-2; ref. 10), havenot yet been introduced in veterinary medicine at all.

Our group could previously demonstrate that both ofthese targets, EGFR and HER2, have close sequential and

Authors' Affiliations: 1Comparative Immunology and Oncology, Instituteof Pathophysiology and Allergy Research, Medical University of Vienna;2Centre for Physiology and Pharmacology, Medical University of Vienna;3Comparative Medicine, Messerli Research Institute, University of Veter-inary Medicine Vienna, Medical University Vienna and University Vienna;4Department for Companion Animals and Horses, University of VeterinaryMedicine Vienna; 5Department for Applied Life Sciences, University ofApplied Sciences, FH Campus Wien; 6Department of Biotechnology,VIBT–BOKU, University of Natural Resources and Life Sciences, Vienna,Austria; 7Department of Immunology, Capital Medical University, Beijing,PR China; and 8Institute of Biochemistry andMolecular Biology, Universityof Hamburg, Hamburg, Germany

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

J. Singer and J. Fazekas contributed equally to this work.

Corresponding Author: Erika Jensen-Jarolim, Comparative Medicine,Messerli Research Institute, University of Veterinary Medicine Vienna,Medical University Vienna and University Vienna, and Comparative Immu-nology and Oncology, Institute of Pathophysiology and Allergy Research,Medical University of Vienna, Waehringer Guertel 18-20, A-1090 Vienna,Austria. Phone: 43-1-40400-51200; Fax: 43-1-40400-61880; E-mail:[email protected]

doi: 10.1158/1535-7163.MCT-13-0288

�2014 American Association for Cancer Research.

MolecularCancer

Therapeutics

www.aacrjournals.org 1777

on May 23, 2018. © 2014 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst April 22, 2014; DOI: 10.1158/1535-7163.MCT-13-0288

http://mct.aacrjournals.org/

structural homologs in dogs. More specifically, even therelevant epitopes for targeting with cetuximab and tras-tuzumab are conserved and leadupon targeting to similarbiologic events in vitro (11). The growth-inhibitory effectof EGFR and HER2 targeting is due to the silencing ofimportant signaling pathways [PI3K, Ras–Raf (MAPK),JNK, and PLCg] of growth factors [EGF; ref. 12; andtransforming growth factor-a (TGFa); refs. 13–15]. Sig-naling via EGFRmediates characteristic features ofmalig-nancy, such as higher proliferation, but is also associatedwith higher genomic instability and hormone therapyresistance resulting in poorer overall prognosis in clinics(16).

Both cetuximab and trastuzumab attract immune effec-tor cells to the site of the tumor and elicit tumor cell deathvia antibody-dependent cell-mediated phagocytosis(ADCP) or antibody-dependent cell-mediated cytotoxic-ity (ADCC; refs. 17–19). Growth signal inhibition, as wellas immune cell-mediated tumor cell death, contribute tohigh efficacy of cetuximab and trastuzumab in clinicaluse and lead to clear benefits for patients with advancedcolorectal carcinoma with wild-type KRAS status in caseof cetuximab treatment (20, 21), as well as longer progres-sion-free and overall survival in patients with metastaticbreast cancer with trastuzumab treatment, respectively(22).

As most clinically applied monoclonal antibodies wereoriginally generated in mice, their murine constantregions had to be replaced by human ones ("chimeriza-tion") to avoid immunogenicity and rendering them fullyfunctional. One step further, when only the murine com-plementarity-determining region (CDR) is grafted into theframework of a consensus human IgG, a "humanized"antibody, such as trastuzumab, results, which is even lessimmunogenic (23). In the case of cetuximab, chimerizationof its mouse precursor antibody "225" (24) led to a 5-foldhigher relative affinity toward EGFR as a positive "sideeffect" and higher biologic efficacy in a human tumorxenograft model (25).

Consequently, the "caninization" of monoclonal anti-bodiesmust take placewhen approaching canine patientswith cancer (see the schematic in Fig. 1). Antibodiesagainst oncogenic proteins can act as either tumor pro-moting (e.g., via cross-linking growth factor receptors andthereby activating the receptors) or tumor inhibiting (e.g.,via interference of binding of growth factors), dependingon their epitope specificity (26, 27). For 225, it could bedemonstrated that upon binding of the antibody to EGFR,EGF-mediated growth signals are inhibited, and the chi-merized cetuximab proved to be highly efficacious inclinical trials and clinical use (28). Thus, it was of eminentimportance for this study to use the specificity of thissuccessfully applied antibody.

In addition to the growth-inhibitory action due togrowth signal deprivation (11), a caninized cetuximab-like "225 IgG" antibody would lead to the attraction ofimmune effector cells toward the site of the malignancy.Several studies reported cytotoxic activity of macro-

phages against canine osteosarcoma (29), melanoma(30), or lymphoma (31), as well as cytotoxic activity ofcanine natural killer (NK) cells against leukemia blasts(32), two immune effector cell populations, which expressFcg receptors. Moreover, monocytes, which are known tohave tumoricidal properties inhumans, couldbe recruitedinto tumors (33–35); similarly, neutrophilic granulocytescould also exert ADCC against malignant cells (36). Fur-thermore, it could be demonstrated that cross-presenta-tion of tumor-associated antigens via Fc receptors ondendritic cells could lead to activation of tumor-reactiveT cells and subsequent tumor regression (17).

In summary, we propose the generated canine anti-EGFR IgG tobe apotentially highly effective immunother-apeutical tool for clinical veterinary oncology. This anti-body could serve as a candidate-research molecule toestablish passive immunotherapy for canine patientswith cancer as well as a useful tool for proof-of-conceptstudies in comparative oncology settings. Pharmacokinet-ic, pharmacodynamic, and pharmacovigilance data ofclinical trials in dog patients with cancer will render inreturn important information for a large number ofresearchers working on the ErbB-1/EGFR for humananticancer therapy.

Materials and MethodsCells, monoclonal antibodies, and recombinantproteins

The Chinese hamster (Cricetulus griseus) ovary cell line,Chinese hamster ovary (CHO) DUKX-B11, was purchasedfrom the American Type Culture Collection (ATCC; Cat.No. CRL-9096) and cultivated in Pro CHO 5 Medium(Lonza Group AG) supplemented with Phenol Red (15mg/L), 0.5 mg/mL Geneticin (G418), 4 mmol/L L-gluta-mine, and methotrexate (0.038 mmol/L). CHO DUKX-B11cells were cultivated under serum-free conditions to en-sure that they grow in suspension and that an easier puri-fication of IgG upon large-scale production is allowed.

Canine (Canis lupus familiaris) mammary carcinoma celllines P114 and Sh1b were a kind gift of Dr. Gerard Rutte-man (Department of Clinic Science and Companion Ani-mals, University of Utrecht, Utrecht, the Netherlands).Both cell lines were maintained in DMEM/F12 supple-mented with 10% fetal calf serum (FCS), 2 mmol/L L-glutamine, and 10 mg/mL gentamicin sulfate.

Canine (Canis lupus familiaris) cell lines CF33 and CF41,derived from carcinoma of the mammary gland, wereobtained from ATCC (Cat. No. CRL-6227 for CF33 andCRL-6232 for CF41) and cultivated in DMEM supplemen-ted with 10% FCS, 2 mmol/L L-glutamine, penicillin (100U/mL), and streptomycin (100 mg/mL).

The canine cell line TLM1 was used as an EGFR-neg-ative model cell. This oral malignant melanoma cell line(37) was kindly provided by Jaime F. Modiano (MasonicCancer Center, University of Minnesota, Minneapolis,MN)andkept inDMEM,10%FCS, 2mmol/LL-glutamine,penicillin (100 U/mL), and streptomycin (100 mg/mL).

Singer et al.

Mol Cancer Ther; 13(7) July 2014 Molecular Cancer Therapeutics1778




The human (Homo sapiens) EGFR-overexpressing cellline A431, derived from an epidermoid carcinoma, andHT29, colorectal adenocarcinoma cells, were purchasedfrom ATCC (Cat. No. CRL-1555 for A431 and HTB-38 forHT29). A431 cells were allowed to grow in DMEM sup-plemented with 10% FCS, penicillin (100 U/mL), andstreptomycin (100 mg/mL). HT29 cells were maintainedin RPMI-1640 medium, augmented with 10% FCS, 2mmol/L L-glutamine, and 10 mg/mL gentamicin sulfate.The human mammary carcinoma cell line BT474 was akind gift of Prof. Dr. Thomas Grunt (Institute for CancerResearch, Medical University of Vienna, Vienna, Austria)and was kept in a-MEM (Minimum Essential Medium)supplemented with 10% FCS, 2 mmol/L L-glutamine,penicillin (100 U/mL), and streptomycin (100 mg/mL).All cells were kept at 37�C in a humidified atmosphere of5% CO2.The human cell lines BT474 and A431 were authenti-

cated by single-nucleotide polymorphism (SNP) profiling(Multiplexion GmbH) and HT29 by short tandem repeat(STR)profiling (DDCMedical); non-human cell lineswerenot authenticated.All cell lines were grown initially, and multiple ali-

quots were cryopreserved for long-term storage in liq-uid nitrogen. After resuscitation, cells were passaged nomore than 10 times before a new aliquot was thawed foruse. For flow cytometric and cell proliferation/viabilityassays, cells were used between passages 5 and 10.Blood samples from dogs, in the course of diagnostic

work-ups or routine check-ups at the oncology unit at theSmall Animal Hospital, University of Veterinary Medi-

cine Vienna (Vienna, Austria), were used for peripheralblood mononuclear cell (PBMC) purification. The studywas discussed and approved by the Institutional EthicsCommittee in accordance with Good Scientific Practice(GSP) guidelines and national legislation.

Cetuximab (Erbitux), a chimeric IgG1 anti-EGFRmono-clonal antibody, was acquired from Merck KGaA, andtrastuzumab (Herceptin), a humanized IgG1 monoclonalanti-HER2 antibody, was obtained from Roche. Rituxi-mab (MabThera), a chimeric IgG1 anti-CD20 monoclonalantibody, served as an isotype control (Roche). Dog IgG(mixed breed, affinity purified from serum, produced byInnovative Research, and distributed byDunn Labortech-nik GmbH)was used as a canine antibody isotype control(canine IgG standard).

Recombinant human extracellular domain (ECD)-EGFR was purchased from ACROBiosystems. Recombi-nant human ECD-HER2 was purified via its His-tag fromsupernatants of transfected Lec-1 cells, whichwere a kindgift of Prof. Daniel Leahy (Johns Hopkins UniversitySchool of Medicine, Baltimore, MD). Bovine serum albu-min (BSA) served as an additional negative control pro-tein and was obtained from Sigma-Aldrich.

Cloning of canine Fc regions from PBMCs,cetuximab-variable regions from 225, and vectordesign

Using real-timePCR, four canine IgGheavy chaingenes(IgG A, B, C, and D) were obtained from normal caninePBMCcDNA.Of these subclasses, IgGCwas chosen for allconsecutive cloning approaches.

Figure 1. Schematic overview ofantibody generation. Forgeneration of can225IgG, variableheavy chain gene regions of225 were fused to canine gamma-immunoglobulin C constantregions genes and introduced intopIRES DHFR_SV40 using therestriction sites NotI and BamHI.Similarly, variable light chain generegions of 225 were combined withdog kappa light chain constantregions and cloned into the vectorpIRES_NEO SV40, using againNotI andBamHI as restriction sites.Subsequently, CHO DUKX-B11cells were cotransfected with bothplasmids for production ofrecombinant antibodies.

Generation of a Canine Anti-EGFR Antibody

www.aacrjournals.org Mol Cancer Ther; 13(7) July 2014 1779




Oligonucleotide primers for obtaining the IgGC con-stant region sequence were gatcctcgagcgcctccaccacggccc(forward sequence containing an XhoI site) and gatcggcc-cagccggcctcaatggtggtgatggtgtttacccggagaatgggag(reverse sequence providing an SfiI site). In addition,primers gatcggcgcgccagccgtctatttgttccaaccatct (forwardsequencewith an SgsI site included) and gatctctagagcctgt-tagtccactctctgacact (reverse sequence with an XbaI site)were used for canine Ig kappa.

The cetuximab heavy chain variable region was ampli-fied from cDNA of its murine precursor hybridomacell line 225 (ATCC no. HB-8508), using the primersgatcatttaaatgtgtccagtgtcaggtgcagctgaagcagtcag and gat-cctcgagccgacagtgaccagagtcccttg and incorporating anSwaI and an XhoI site. The variable light chain region wasamplified using the primers gatccctgcagggtgccagatgtga-catcttgctgactcagtctc and gatcggcgcgcctttcagctccagcttggt-ccc, providing an SbfI and an SgsI site.

Final sequences were optimized for expression inCricetulus griseus and synthesized by GeneArt (GeneArt AG). Completely fused gamma heavy chain product(1.4 kbp) was introduced into the vector pIR-ES_dhfr_SV40, applying NotI and BamHI restrictionsites (Fig. 1, bottom right). Similarly, fused kappa lightchain gene product (0.7 kbp) was cloned into the vectorpIRES_NEO_SV40, again using NotI and BamHI asrestriction sites (Fig. 1, bottom left).

The newly generated constructs were transformedinto Escherichia coli DH5a cells, and DNA sequences ofthe inserts were verified by Sanger sequencing (Micro-synth, The Swiss DNA Company). Subsequently, large-scale vector DNA was produced and purified using thePureLink HiPure Plasmid Midiprep Kit (Invitrogen,Life Technologies) according to the manufacturer’sinstructions.

Model generationThe model of can225IgG antibody was based on the

crystal structure of an intact mouse IgG1 monoclonalantibody (38) with the PDB ID: 1IGY (resolution: 3.2 A).Modeling was carried out with MODELLER (version9v8; ref. 39) using the automodel protocol. Fifty modelswere generated. Model quality was assessed using theDOPE score (40) and ProCheck (41). The model with thebest DOPE score was selected for visualization andanalysis.

Conservation mappingSequences of human anti-EGFR IgG [assembled of the

cetuximab variable regions from PDB ID: 1YY8 (RCSBPDB-database, The Research Collaboratory for StructuralBioinformatics), the constant heavy chain region P01857(Uniprot database), and the constant kappa light chainregion P01834 (Uniprot database)] were aligned to thoseof can225IgGantibodyusingMuscle 3.7 (42) and analyzedusing Clustal X (43). The sequence conservation scores, asdefined by Clustal, were then mapped onto the model ofthe can225IgG antibody.

Production of recombinant antibodiesPurified plasmids were transfected into CHO DUKX-

B11 cells using polyethylenimine (PEI; 25-kD linear, Poly-sciences Inc.) as transfection agent and seeded onto 96-well cell culture plates to generate 480 different clonesin total. Clones of interest were selected by G418 andincreasing concentrations of methotrexate (methotrexatehydrate; Sigma-Aldrich) and screened by ELISA for anti-body production yields as well as for specificity againstEGFR.

ELISAFor productivity screening of the clones, ELISA plates

(Immuno MaxiSorp; Nunc) were coated overnight at 4�Cwith 1 mg/mL rabbit anti-dog IgG (Fc; Acris AntibodiesGmbH) or 0.5 mg/mL goat anti-dog light chain antibodies(Bethyl Laboratories, Inc.) in carbonate buffer, respective-ly. After a blocking step, cell culture supernatants ofclones of interest were diluted at 1:5 in phosphate-buff-ered saline (PBS), 0.05% Tween20 (PBST) þ 1% BSA(Sigma-Aldrich). Following application, the plates wereincubated for 1 hour at room temperature. Rabbit anti-dogIgG horseradish peroxidase (HRP; Jackson ImmunoRe-search Europe Ltd.) was applied at a 1:5,000 dilution inPBST þ 1% BSA, again for 1 hour at room temperature.Between all incubation steps, plates were washed threetimes with 200 mL PBST. For detection, 3,30,5,50-tetra-methylbenzidine (TMB; BD Biosciences) was added, andafter stopping the reaction with 1.8 mol/L H2SO4, theoptical density (OD) absorbencies of the wells were mea-sured at 450 nm (with a reference at 620 nm) with amultiwell plate reader (Infinite M200 PRO; Tecan GroupAG).

To test the secreted antibodies for their selectivitytoward EGFR, cell culture supernatants of clones display-ing thehighest yields of total IgGwere examined inEFGR-specific ELISA as well. Immunoassay plates (ImmunoMaxiSorp; Nunc) were coated overnight at 4�C with 0.5mg/mL recombinant human EGFR (Acro Biosystems) incarbonate buffer. To prevent unspecific binding, blockingwas carried out for 2 hours at room temperaturewith Tris-buffered saline (TBS), 0.05% Tween20 (TBST) þ 1% driedmilk powder (DMP).Cell culture supernatantsweredilut-ed at 1:5 in TBST þ 0.1% DMP. Control antibodies cetux-imab (positive) and trastuzumab (serving as negativecontrol) were applied in four serial dilution steps (1:2),starting with 0.5 mg/mL, again in TBST þ 0.1% DMP.Plates were incubated for 2 hours at room temperature.Rabbit anti-dog IgG HRP (1:5,000) or anti-human IgGHRP, at a 1:8,000 dilution, were applied to the respectivewells in TBST þ 0.1% DMP, following an incubationperiod of 1 hour at room temperature. Between each step,plates were washed three times with 200 mL TBST. HRPsignal was again detected with TMB substrate.

PAGE and immunoblottingForprotein gel electrophoresis, self-cast 10%SDS–acryl-

amide gels were used.

Singer et al.





Semi-dry blottingwas performed according to the stan-dard blotting protocols, using nitrocellulose membranes.Blocking was carried out by incubation in TBS, 0.1%Tween20 (TBST; 50 mmol/L, 150 mmol/L NaCl; pH7.5) þ 5% DMP for 2 hours at room temperature. Fordetection of the canine heavy gamma Fc chain, HRP-labeled rabbit anti-dog IgG (Fc) antibodies (JacksonImmunoResearch Europe Ltd.) were used at a 1:5,000dilution. After washing three times with TBST for 10minutes, binding of the HRP-conjugated antibodies wasdetected by incubation with ECL BD OptEIA substrate(BD Biosciences), using a VersaDoc Imaging System (Bio-Rad Laboratories, Inc.).For detection of the canine kappa light chain, goat anti-

dog light chain (Bethyl Laboratories, Inc.) and rabbit anti-goat IgG alkaline phosphatase (AP; Sigma-Aldrich) anti-bodies were consecutively used at a 1:2,000 dilution.BindingofAP-labeled antibodieswasdetectedusingnitroblue tetrazolium chloride/5-bromo-4chloro-3-indosylphosphate, toluidine salt solution (NBT/BCIP; RocheDiagnostics GmbH).

Purification of recombinant proteinsThe can225IgG cell culture supernatant of the chosen

clone 3A3 (subclone 3A3/14E1, respectively) was dia-lyzed before purification in 20 mmol/L sodium phos-phate buffer (pH 7.0) overnight at 4�C under gentlestirring. Dialysis buffer was exchanged at least twice. Forpurification of the dialyzed supernatant, the Fast Protein

Liquid Chromatography system (FPLC; €AKTA; GEHealthcare Europe GmbH) was applied, using either a1 mL HiTrap Protein A HP column (GE Healthcare), a 1mL recombinant Protein A column (UNOsphere SUPrA;Bio-Rad Laboratories, Inc.), or a 5 mL HiTrap Protein AHP column (GE Healthcare). Furthermore, several small-scale purification attempts using Protein G Sepharose 4Fast Flow beads (GE Healthcare) were performed beforeFPLCpurificationwithHiTrapProteinGHP5mLcolumn(GEHealthcare)was established,with aflowrate of 5mL/min. To elute bound can225IgG, 0.1 mol/L Glycine–HClbuffer (pH 2.7) was applied. Upon elution, samples wereimmediately neutralizedwith 1mol/L Tris–HCl (pH 9.0).

Circular dichroism spectroscopyCircular dichroism (CD) spectroscopic analyses were

performed as described previously (44, 45). In short, dogantibodysamples (c¼ 100mg/mLddH2O)wereassessedata J-715 spectropolarimeter (Jasco), using a 1-mm path-length quartz cuvette (Hellma) equilibrated at 20�C. Scanspeed for spectrameasurementwas 50 nm/min at a 0.2-nmresolution. The average of five scans was taken as resultafter subtraction of the baseline spectrum and is shown asmean residue ellipticity (h) at the respective wavelengths.

Flow cytometryToassess specific binding of the generated can225IgG to

natural canine EGFR expressed on the surface of caninemammary carcinoma cell lines, flow cytometric analyses

were performed. Cells (300,000/tube) were washed threetimes with FACS buffer (PBS þ 2% normal goat serum).Afterward, cells were incubated for 30 minutes at 4�C inthe dark with 200 mL of 10 mg/mL can225IgG as primaryantibody and 200 mL of 10 mg/mL canine IgG standard asisotype control, in FACS staining buffer (PBSþ2%normalgoat serum þ1% normal rabbit serum). Upon washingwith FACS buffer, cells were incubated with 200 mL of 10mg/mL rabbit anti-dog IgG FITC antibodies (JacksonImmunoResearch Europe Ltd.) for 30 minutes at 4�C.After another washing step, cells were analyzed usingthe dual-laser FACSCalibur (BD Biosciences).

To evaluate binding properties of can225IgG to dogmonocytes, PBMCs were isolated from canine patientswith carcinoma using Ficoll-Paque separation (GEHealthcare Europe GmbH). PBMCs were incubated with200 mL of 10 mg/mL can225IgG as primary antibody and200 mL of 10 mg/mL canine IgG standard as positivecontrol, respectively. Subsequently, cells were incubatedwith 200 mL of 10 mg/mL anti-dog IgG FITC and mouse

anti-human CD14 phycoerythrin (PE; clone T€UK4; LifeTechnologies), which is cross-reactive to dog CD14 toidentify monocytic cells. Analysis was again carried outusing a dual-laser FACSCalibur (BD Biosciences). Histo-grams of FACS data were plotted with the FlowJo 10.0.6software (TreeStar, Inc.).

Viability assaysTo assess the tumor-inhibitory properties of the recom-

binant can225IgG, tetrazolium-based cell viability assayswere performed according to the manufacturer’s instruc-tions (EZ4U The 4th Generation Non Radioactive CellProliferation & Cytotoxicity Assay Kit; Biomedica). A431cells were seeded at a density of 3 � 104 per well in a 96-well plate (round-bottomed). After overnight incubationfor proper adhesion to the plate, cells were treated witheither 5 mg/mL can225IgG, 5 mg/mL cetuximab, 5 mg/mLdog IgG standard, or 5 mg/mL rituximab for 48 hours.Subsequently, tetrazolium substrate was added, and afteranother 3 hours of incubation, OD was measured at 450nm with 620 nm as the reference wavelength.

Proliferation assaysTo directly measure DNA replication, BrdU Prolifer-

ation assays (Roche) were performed. BrdU (bromo-deoxyuridine) is a nonradioactive compound, which isincorporated into the genomic DNA of proliferatingcells during DNA synthesis. EGFR-expressing caninecell lines P114 and Sh1b, as well as the negative controlcell line TLM1, were seeded onto 96-well cell cultureplates at a density of 3 � 103 cells per well. After 18hours of growing in full medium, cells were incubatedwith 5 mg/mL concentrations of can225IgG or cetuxi-mab for 24 hours before labeling with BrdU. After alabeling period of 4 hours, incorporated BrdU wasdetected with an HRP-conjugated anti-BrdU antibody.Bound antibodies were detected with TMB, and colorreaction was measured at 450 nm in an ELISA reader,






with 630 nm as a reference value (Infinite M200 PRO;Tecan Group AG).

ADCC/ADCP assayTodetermine the levels of immune cell-mediated tumor

cell killing via ADCC and ADCP, a three-color flowcytometric assay (46) was adapted to the canine system.EGFR-expressing canine P114 cells were stained withCFDA [Spiro(isobenzofuran-1(3H),90-(9H)xanthene)-5-carboxylic acid, 30,60-bis(acetyloxy)-oxo-, (acetyloxy)methyl ester; Invitrogen, Life Technologies] and servedas target cells. PBMCs, purified from canine patients withcancer, served as effector cells. Effector (E) and target (T)cellswere coincubated at a ratio of 3:1 (300,000E:100,000T;total volume ¼ 400 mL) in the presence or absence ofcan225IgG (c¼ 2.5 mg/mL). After 2.5 hours of incubation,the killing assay was stopped by adding ice-cold FACSbuffer. Effector cells were labeled with anti-CD14 PE

(clone T€UK4; Life Technologies). After another 30 min-utes of incubation at 4�C and subsequent washing,dead cells were labeled with 7-amino-actinomycin D(7-AAD; eBioscience) for 15 minutes at 4�C. After a finalwashing step, cells were resuspended in 200 mL FACSbuffer and analyzed on a dual-laser FACSCalibur (BDBiosciences).

Data handling and statistical analysisFlow cytometric experiments of receptor binding and

competitive binding were repeated at least three times,and histograms display one representative example. Incell viability assays, each treatment group consisted ofeight samples, statistical analyses of assays were per-formed by means of a two-sided t test, and significancewas accepted at �,P < 0.05; ��,P < 0.01; and ��,P < 0.001. Inproliferation assays, each treatment group consisted of sixsamples, and statistical analyses were performed analo-gously. In ADCC/ADCP assays, 3 canine patients withcancer were investigated, and three samples were mea-sured from each dog. Statistical analyses were performedagain by using the two-sided t test. All statistic calcula-tions were performed using the GraphPad Prism 4 soft-ware (GraphPad).

ResultsConstruction and modeling of can225IgG

Figure 2 shows the topography of the constructedcan225IgG antibody in comparisonwith human cetuximabIgG. Thus, the variable region and EGFR-binding site wasgrafted on the canine IgG backbone (Supplementary TableS1). Sequence comparisons suggested an approximately60% homology across heavy and light chains. On the basisof this information,weapproached in silico thehypotheticalstructure of the canine cetuximab counterpart. The infor-mation was collected by assembling cetuximab variableregions from PDB (ID: 1YY8) with amino acid translationsof the constant canine heavy chain region C geneAAL35303.1/AF354266.1, and the canine constant kappalight chain region gene, XP_532962.3 (Fig. 2A). Upon closerinvestigation of conserved structures between human andcanine immunoglobulin sequences, "conservation map-ping" could be performed on the modeled antibody. Ascanbeseen inFig. 2B, regionswith identical aminoacidsaredepicted inblue,whereas aminoacid changesare indicatedin various shades of green, depending on the grade ofdiscrepancy of amino acids. As the variable regions of bothheavy and light chains were taken from the original cetux-imab sequence, no differences can be observed in this partof the molecule. Regions with highest amino acid variabil-ity include the hinge region and parts of the constantregions that do not bind to Fcg receptors.

Productivity and specificity screening of transfectedclones in ELISA

Plasmids for heavy and light chains of can225IgG wereconstructed on the basis of the above information andtransfected into CHO DUKX-B11 cells. Clones with high-est production yields (Fig. 3A) were screened for speci-ficity in ELISA coated with the ECD of human recombi-nant EGFR, and recombinant human HER2 for controlpurposes. Original cetuximab antibody was used as apositive control. All tested clones produced IgG highlyspecific to EGFR, whereas none of it bound to HER2, aclosely related andhighly homologousmolecule that doesnot display the 225 epitope (Fig. 3B).

Figure 2. Molecular modeling ofnewly generated can225IgGantibody. A, model of canineantibody, based on humancrystallographic structures; heavychain shown in green, light chain inpink. B, conservation map ofcan225IgG antibodies; identicalamino acids of human and caninemolecules are shown in blue, andvarying amino acids are depicted inshades from light gray to green,based on the degree of variation(gray, similar; dark green, highlydifferent).

Singer et al.





Integrity testing of secreted antibodies in cell culturesupernatantsSevenhighlyproductive andspecific cloneswere select-

ed for further analysis. The integrity of the generatedantibodieswas proven byWestern blot analysis, detectingthe canine heavy gamma and kappa light chain. Thesignals were observed at the correct molecular size incomparison with canine IgG standard (canine IgG STD),and no unassembled single heavy chains were detectable(Fig. 3C). In parallel, the detection of light chain displayedsharp bands at the samemolecular size as that of purifiedstandard canine IgG, and again no unassembled singlelight chains were traceable (Fig. 3D). Therefore, eachselected clone produced intact, correctly assembledantibodies.

Purification of recombinant proteinsHavingdisplayedhighproductivity, specific binding to

recombinant EGFR, as well as intact and correct assemblyof cetuximab-like can225IgG, clone 3A3 was subjected toamplification and supernatants to purification via ProteinA affinity chromatography. As can be seen from Supple-mentary Fig. S1A, unexpectedly and despite publishedwork (47–49), can225IgG did not bind to Protein A.In contrast, substantial binding to Protein G Sepharose

beads could be observed (Supplementary Fig. S1B), result-ing in proper purification of the recombinant can225IgGantibodies from cell culture supernatant (SupplementaryFig. S2). Thus, FPLC in combination with Protein G col-umns was chosen as the method for large-scalepurification.

Integrity testing of purified antibodiesAs an additional step of quality control, we assessed the

correct folding of the purified antibodies in CD spectros-copy. The secondary structures of can225IgG cannot beexpected to be identical to the purified canine IgG STD,due to its different specificity and the presence of kappaand lambda light chains. Nonetheless, Fig. 3E still dis-plays comparable traces of molecular ellipticity betweenthe two molecules.

Flow cytometric analysis of can225IgG binding toEGFR-expressing cellsFor specificity testing of the generated can225IgG

toward natural EGFR on the surface of cells, flow cyto-metric analyses were performed. EGFR-overexpressingcanine mammary carcinoma cells P114 and Sh1b, as wellas the established human EGFR-overexpressing modelcell lines A431 and HT29, were used (Fig. 4). The newlygenerated can225IgG specifically stained all four cell lines,depending on the amount of expressed proteins. P114cells were stained with a shift in median fluorescenceintensity (DMFI) of 5.86 (4.44 for isotype control to 10.30for can225IgG). Sh1b cells showed a DMFI of 4.67, HT29 of92.65, and A431 had a DMFI of 946.83. In the case of theCF33 and CF41 cells, which express low levels of EGFR(11), specific staining could again be observed (Supple-

mentary Fig. S3A and S3B). The specificity of can225IgGwas further affirmed by staining EGFR-negative caninemelanoma cells TLM1, rendering only background signal(Supplementary Fig. S3C).

Possible affinity differences of can225IgG bindingtoward canine and human EGFR were addressed bycompetitive flow cytometry on canine P114 and humanBT474 cells (a human mammary carcinoma cell line thatshows similar EGFR expression as the investigated caninemammary carcinoma cells; see Supplementary Fig. S3D).Supplementary Fig. S4A–S4C displays that A431 cellswould not have been applicable for this assay, as theirEGFR density is more than 100-fold.

The known affinity of cetuximab binding to humanEGFR has a Kd value of 0.39 nmol/L (50). As can be seenfrom Supplementary Fig. S4D, can225IgG binding tocanine cancer cells can be removed by molar excess ofsoluble human EGFR, whereas this is not possible whencan225IgG binds to human cancer cells (SupplementaryFig. S4E). It can, thus, be concluded that due to the fouramino acid changes in the 225 epitope (11), there is adifference in the affinity of the newly generatedcan225IgG toward human and canine EGFR; however,the affinity is still high enough to bind and exert function.

MicroscopySpecific binding of purified can225IgG antibodies was

also confirmed by microscopy. Whereas neither canine(Supplementary Fig. S5A, top left) nor human isotypecontrols (Supplementary Fig. S5A, bottom left) showedany signal, both can225IgG (Supplementary Fig. S5A, topright) and the original antibody cetuximab (Supplemen-tary Fig. S5A, bottom right) displayed strong, membrane-specific staining of A431 cells.

To further investigate the binding properties ofcan225IgG on malignant tissue, canine mammary carci-noma samples were tested for EGFR expression with theFDA-approved in vitro diagnostic EGFR pharmDx kit.Positive specimens, which show a strong and completemembrane-specific staining (Supplementary Fig. S5B,left), were also used for staining with purified dog IgGstandard and can225IgG (Supplementary Methods). Thecontrol dog IgG standard did not stain any structuresspecifically (Supplementary Fig. S5B, middle), whereasincubation with can225IgG resulted in EGFR staining,comparable with the diagnostic kit, though less intense(Supplementary Fig. S5B, right).

Cell viability and proliferation assaysFor assessment of the tumor-inhibitory properties of the

newly generated can225IgG antibody, cell viability assayswith highly EGFR-overexpressing A431 cells were per-formed (Fig. 5A). After 48 hours of treatment withcan225IgG, only 85.80% of viable cells could be detected(compared with untreated A431 cells), whereas incuba-tion with purified dog IgG standard led to normal cellgrowth (98.79%). Thus, significant growth inhibitioncould be observed (P ¼ 0.0002).






Singer et al.





For control purposes, the same experiment was con-ducted with cetuximab and rituximab, respectively(in same concentrations, 5 mg/mL). Again rituximab, theunspecific isotype control, showed no growth-inhibitoryeffect (100.53%), whereas treatment with cetuximab led tothe expected significant growth inhibition (84.44%; P ¼0.0001).In addition to the tetrazolium-based cell viability

assays, BrdU incorporation experiments were carried outto measure the direct impact of the newly generatedcan225 IgG on the proliferation of canine cancer cells.

Thus, P114 and Sh1b cells were incubated for 24 hourswith can225IgG as well as cetuximab, which served aspositive control. As can be seen in Fig. 5B and C, bothcanine cell lines could be significantly inhibited in theirgrowth by cetuximab and can225IgG (P114: P < 0.0001 forboth antibody-treated groups compared with untreatedcells; Sh1b:P¼ 0.002 for cetuximab-treated andP¼ 0.0034for can225IgG-treated cells compared with untreatedones). In contrast, treatment of EGFR-negative canineTLM1 cells did not lead to any significant change inproliferation (Fig. 5D).

Figure 3. Integrity testing of can225IgG. A, productivity testing of selected clones in ELISA. Antibody yields of 20 selected supernatants from transfectedCHO-cell clones. Productivity ranged from 200 to almost 1,900 ng/mL. Four clones showed remarkably higher levels by producing more than 1,000 ng/mLof can225IgG. Finally, clone 3A3 was chosen for large-scale production. Displayed are mean values � standard error of the mean (SEM; n ¼ 4). B,specificity testing of selected clones toward EGFR in ELISA. Clones displaying high levels of IgG production were screened for EGFR specificity. All selectedclonesdisplayed high specificity selectively towardEGFRandonly background signal toward the control proteinHER2.Displayed aremeanODvalues�SEM(n ¼ 2). C, Western blot analysis of selected cell culture supernatants testing for presence of dog gamma heavy chain. Clones that underwent positiveproductivity and specificity screening in ELISA were also tested for integrity in Western blot analysis. All selected clones displayed a sharp band atapproximately 250 kD, the same height as canine IgG standard, the purified control IgG from dog serum. D, Western blot analysis of selected cell culturesupernatants testing for presence of dog kappa light chain. Clones that displayed canine gamma heavy chain in cell culture supernatants were testedfor kappa light chain presence. All tested clones displayed a sharp band at approximately 250 kD, the sameheight as canine IgG standard. E, CD spectrometryof can225IgG in comparison with purified canine IgG standard protein. Spectra are represented as the mean residue ellipticity (q; y-axis) at respectivewave lengths (x-axis). Analysis of the far-UVCDspectrumof can225IgG showed a strongmaximumat approximately 200 nmand aminimumat approximately220 nm, comparable with purified canine IgG standard.

Figure 4. Flow cytometricassessment of can225IgG bindingto EGFR on cells. A, canine P114cells could be specifically stainedwith can225IgG (black line),compared with isotype controlstaining (gray histogram);difference in mean fluorescenceintensity (DMFI) ¼ 5.86. B, canineSh1b cells, DMFI¼ 4.67. C, humancolorectal cancer cells HT29, DMFI¼ 92.65. D, human A431epidermoid carcinoma cells, DMFI¼ 946.83.






Flow cytometric analysis of can225IgG binding tocanine monocytes

Functionality of the newly generated antibody withrespect to binding to Fcg receptors on dog immune cellswas tested by flow cytometry. Thus, PBMCs of caninepatients with cancer (n ¼ 3) were purified and stainedwith can225IgG or dog IgG standard as positive control.Monocytes, important effector cells in tumor immuno-therapy, were identified by staining with anti-CD14 PEand as shown in Fig. 6A, can225IgG binds to the sameextent on monocytes as the purified canine IgG standard.

ADCC/ADCP assaysAs one of the major mechanisms of cetuximab is to

confer immune-mediated tumor cell death, the newlygenerated can225IgG was also assessed in this regard.Therefore, a three-color flow cytometric method wasapplied, which is able to measure ADCC and ADCPsimultaneously. Again, EGFR-overexpressing caninemammary carcinoma cells P114were investigated. A total

of 1 � 105 cells were coincubated with three times theamount of PBMCs, isolated fromdogpatientswith cancer.After 2.5 hours of incubation in the presence of can225IgG,a significant difference in the level of ADCP could beobserved (P ¼ 0.0153; Fig. 6C). For ADCC (Fig. 6B), nosignificant difference could be displayed.

DiscussionAs human and veterinary oncology face similar chal-

lenges, such as comparable incidence rates in certaintumor types (51), with studies even reporting higher ratesin dogs for mammary cancer in the same geographic area(52), comparative approaches could be highly valuable forboth human and veterinary oncology. Recent studiesrecognized the high similarities between human andcanine genes as a result to the unraveling of the caninegenome (53). Similar genetic risk factors were identifiedfor humans and dogs contributing to breast cancer devel-opment, including BRCA-1 and BRCA-2 (2). In addition,clinical features of the disease, such asmetastatic behavior

Figure 5. Effects of can225IgG treatment on viability and proliferation of cancer cells. A, cell viability assay of human EGFR-overexpressing A431 cells. Isotypecontrols rituximab and canine IgG STD showed no growth inhibition on EGFR-overexpressing A431 cells in comparison with untreated cells (100%). Incontrast, incubation with can225IgG led to significant growth inhibition (85.80%; P¼ 0.0002) similar to cetuximab treatment (84.44%; P¼ 0.0001). Box andwhiskers plot, whiskers displaying minimum and maximum values (n ¼ 8). B, cell proliferation assay of canine EGFR-overexpressing P114 cells. Newlygenerated can225IgG and cetuximab, which served as positive control, led to strong and significant growth inhibition after 24 hours of treatment. Box andwhiskers plot, whiskers displaying minimum and maximum values (n ¼ 6). C, cell proliferation assay of canine EGFR-overexpressing Sh1b cells. Newlygenerated can225IgG (P¼ 0.0034) and cetuximab (P¼ 0.002), which served as positive control, led to strong and significant growth inhibition after 24 hours ofincubation, compared with untreated cells. Box and whiskers plot, whiskers displaying minimum and maximum values (n ¼ 6). D, cell proliferation assay ofcanine EGFR-negative TLM1 cells. Neither treatment with can225IgG nor cetuximab led to significant changes in growth of canine EGFR-negative TLM1melanoma cells. Box and whiskers plot, whiskers displaying minimum and maximum values (n ¼ 6). n.s., not significant.

Singer et al.





(54) or dissemination into the bone marrow and circula-tion, have been closely investigated (55). Several tumor-associated antigens, particularly important for targetedtherapies in human oncology, could also be identified incanine malignancies, such as CD20 (56), EGFR (57–59),HER2 (60), or VEGF (61). Our group revealed in a pre-vious study that close homologs of EGFR (ErbB-1) andHER2 (ErbB-2) are overexpressed in canine mammarycarcinoma lesions; and more importantly, that the rele-vant epitopes for the clinically applied monoclonal anti-bodies cetuximab and trastuzumab are highly conservedbetween the two species (11). Both antibodies are effectivein human clinical use (20, 22), but they have as well atumor-inhibitory potential on canine mammary carcino-ma cells in vitro (11).Thus, targeting of EGFR in veterinary clinical oncology

could contribute to new insights into cancer biology,development of resistance mechanisms, or safety andefficacy of targeted therapies of the next generation. Bytesting newanti-EGFRagents head-to-head in human andcanine patients, state-of-the-art therapies could be pro-vided simultaneously for veterinary medicine. This goalis strongly fostered by the comparative oncology trialsconsortium, founded by the National Cancer Institute(NCI, Bethesda, Maryland) in 2003 (3).Cetuximab (Erbitux), a monoclonal mouse–human chi-

meric IgG1antibodydirected against humanEGFR (ErbB-1), could serve as a promising lead compound for com-parative studies, because its activity is not limited togrowth signal inhibition mediated via its Fab region, butit is also able to elicit immune cell–mediated tumor celldeath via its Fc regions. 225, the murine precursor ofcetuximab, was chimerized leading to higher relativeaffinity toward EGFR and higher biologic efficacy in

in vivo studies with human tumor xenografts (25). Thus,we aimed to similarly generate a "caninized" 225 IgGantibody, termed can225IgG, by applying the same var-iable regions as 225, but fuse themwith canine Fcg regions(Fig. 1) to exploit the canine cellular effector mechanisms.Therefore, its variable regions were amplified from thecDNA of the hybridoma cell line 225 and reassessed withthe published amino acid sequence of the cetuximab-Fabcocrystallized with human EGFR (62). As dogs displayfour different isotypes of g-immunoglobulins (IgGA, B, C,andD; ref. 63), specific primers against each subclassweredesigned and gene sequences were obtained from caninePBMC cDNA. Gamma heavy chain protein of IgGC dis-played 67.7% identity to the amino acid sequence of thehuman IgG1heavy chain (RCSBpdb-database,No. 3RY6),an isotype long known for mediating cytotoxicity inhumans (64) and representing the isotype of almost allFDA-approved monoclonal antibodies (65). Thus, IgGCwas chosen for all subsequent cloning steps and forproduction of the chimeric can225IgG. To match theobtained gamma heavy chain C sequence with publishedones, alignment against the published protein sequenceAAL35303.1/AF354266.1 (63) was performed. This align-ment displayed four amino acid mutations between thetwo sequences, which could be explained by geneticdivergence due to breeding. As a complete analysis ofthe influence of race and breeding would have exceededthe focus of this study, we decided to use the publishedsequence from NCBI’s Protein database (National Centerfor Biotechnology Information, Bethesda, MD). Similarly,the amino acid sequence of the extracted kappa constantregion was aligned to XP_532962.3, which resulted incomplete accordance. Final sequences were optimized forproduction in Cricetulus griseus and transfected into CHO

Figure 6. Binding of can225IgG to canine monocytes and assessment of immune cell–mediated cancer cell death. A, evaluation of can225IgG bindingto Fcg receptors on monocytic cells purified from dog patients with cancer. Monocytes (gated as CD14 PE–positive) were stained with anti-dog IgGFITC (gray histogram). Can225IgG (dotted line) as well as canine IgG STD (black line, serving as positive control) are able to bind specifically;DMFI for can225IgG ¼ 18.3; DMFI for canine IgG STD ¼ 19.3 (n ¼ 3, one representative example depicted). B, measurement of ADCC of P114cells mediated by can225IgG. PBMCs were purified from dog patients with cancer (n ¼ 3) and incubated with P114 cells for 2.5 hours in thepresence or absence of can225IgG, which led to no significant change of cytotoxicity levels. C, measurement of ADCP of P114 cells mediatedby can225IgG. PBMCs were purified from dog patients with cancer (n ¼ 3) and incubated with P114 cells for 2.5 hours in the presence or absence ofcan225IgG, which led to a significant increase in phagocytosis of cancer cells (P ¼ 0.0153).






DUKX-B11 cells. Having established stable-transfectedcell lines, clones were screened for productivity (Fig.3A) and specificity (Fig. 3B).

Supernatants of clones that have undergone positiveELISA screening were again tested by Western blotanalysis to determine the biochemical properties ofsecreted proteins. Figure 3C shows that all selectedclones displayed a sharp band at the same molecularmass as control IgG standard, thus representing fullyassembled canine immunoglobulins (Fig. 3D). As thepositive control IgG comprises kappa and lambda lightchains, and the detection antibody is directed againstboth, the signal intensity of the can225IgG band, com-prising only kappa, cannot be compared par for par.

According to the literature, we expected medium-to-strong binding affinity of Protein A to canine IgG (47–49). Thus, purification of the recombinant can225IgGantibodies via Protein A affinity chromatography wasour first method of choice, but can225IgG did not bindto recombinant Protein A (Supplementary Fig. S1A).This prompted us to purify via Protein G (66). Supple-mentary Fig. S1B demonstrates that can225IgG bound toProtein G and could be eluted via a pH shift with 0.1mol/L glycine (pH 2.5) buffer. Again, SDS–PAGEaffirmed the stability and purity of eluted proteins.Purified can225IgG showed the same sharp band ascan225IgG in cell culture supernatants before purifica-tion, indicating proper refolding after neutralization inTris–HCl buffer (pH 9.0; Supplementary Fig. S2). Fur-thermore, still no unassembled heavy or light chainscould be detected in the gel.

To confirm theproper folding of can225IgGafter the pHdrop during purification, CD spectroscopy was per-formed (Fig. 3E), displaying again comparable results formolecular ellipticity between can225IgG and canine IgGstandard.

For closer examination of tertiary structures of thenewly generated can225IgG, molecular modeling wasapplied on the basis of crystallographic structures ofhuman antibodies. Figure 2A displays predicted struc-tures of can225IgG and the assembly of heavy and lightchains based on these assumptions. To localize differ-ences, "conservation mapping" was performed, display-ing high variability between human and canine mole-cules, especially in the hinge region of the antibodies (Fig.2B).

Next, the binding capacity of can225IgG to EGFR wastested by flow cytometric analyses with EGFR-overex-pressing human as well as canine carcinoma cell lines. Asillustrated in Fig. 4 and Supplementary Fig. S3, can225IgGis capable of detecting EGFR on the surface of cell lines(such as A431, HT29, P114, Sh1b, CF33, and CF41 cells)that have been previously reported to express this recep-tor; yet, no binding was seen on TLM1 canine melanomacells (Supplementary Fig. S3C). Also, in immunofluores-cence, can225IgG displayed the same membrane-specificstaining pattern on A431 cells as that of cetuximab (Sup-plementary Fig. S5A).

Moreover, binding of can225IgG to EGFR expressed onmalignant caninemammary cancer lesions could be dem-onstrated by immunohistochemistry, again leading to acomparable staining pattern like the FDA-approved diag-nostic EGFR pharmDx test (Supplementary Fig. S5B).Different staining intensities of can225IgG and EGFRpharmDx can, at least in part, be explained by a differentepitope specificity of 2-18C9, the monoclonal antibodyused in thediagnostic kit (2-18C9binds to the extracellularcysteine-rich region of the molecule spanning domain IIproximal to the transmembrane region, whereas 225 hasits epitope in domain III of EGFR), as it was also demon-strated previously that distinct antibodies against EGFRlead todifferent staining intensities in immunohistochem-istry (67, 68).

The most important aim of this study was to demon-strate the tumor-inhibitory potential of can225IgG. Indeed,both can225IgG and cetuximab rendered comparable levelsof growth inhibition in vitro via growth signal depletionafter 24 or 48 hours of incubation, respectively (Fig. 5).

All cellular assays clearly illustrate that can225IgGshows the same or comparable biochemical and function-al properties as original cetuximab.

Moreover, we also addressed the immune-mediatedtumoricidal effects of can225IgG. Therefore, we provedits capability to bind to Fcg receptors on caninemonocyticcells (Fig. 6A),which are knownas important effector cellsin tumor immunotherapy (35). Indeed, coincubated withcanine PBMCs, can225IgGwas able tomediate significantlevels of phagocytosis (ADCP) in canine mammary car-cinoma cells (Fig. 6C). Yet, no significant ADCC could berecorded (Fig. 6B), possibly due to partially high back-ground cytotoxicity and large variation in the samplescaused by a high diversity of the canine patients withrespect to age, sex, andbreed.However, the observationofan IgG antibodymediating significant amounts of ADCP,but not ADCC, in this three-color flow cytometric methodwas also previously described for trastuzumab andHER2-overexpressing cancer cells in the human setting(18, 69).

In summary, this newly generated "caninized" anti-EGFRantibody seems to be highly specific as well as effective intargeting EGFR-overexpressing canine tumor cells. Its cani-nization prevents adverse reactions, such as anaphylaxisor serum sickness in treated dogs, making this antibody asafe research lead compound for the first passive immuno-therapy approaches in canine patients with cancer.

Disclosure of Potential Conflicts of InterestE. Spillner has ownership interest in a patent. No potential conflicts of

interest were disclosed by the other authors.

Authors' ContributionsConception and design: E. Jensen-JarolimDevelopment of methodology: J. Singer, J. Fazekas, W. Wang, M. Weich-selbaumer, D. Mechtcheriakova, E. Spillner, R. KunertAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J. Singer, J. Fazekas, W. Wang, M. Weichselbau-mer, A. Mader, S. Meitz, D. Mechtcheriakova, M. Willmann, T. Stockner,R. Kunert, E. Jensen-Jarolim

Singer et al.





Analysis and interpretation of data (e.g., statistical analysis, biostatis-tics, computational analysis): J. Singer, J. Fazekas, M. Weichselbaumer,S. Meitz, D. Mechtcheriakova, T. Stockner, R. Kunert, E. Jensen-JarolimWriting, review, and/or revision of the manuscript: J. Singer, J. Fazekas,M. Weichselbaumer, D. Mechtcheriakova, M. Willmann, T. Stockner,E. Jensen-JarolimAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): W. Steinfellner, Y. Sobanov,R. KunertStudy supervision: D. Mechtcheriakova, E. Jensen-JarolimOther: M. Matz, E. Spillner

AcknowledgmentsThe authors thank all members of the Jensen-Jarolim laboratory for

inspiring discussions and support. They also thank Prof. Wrba for help indetection of EGFR in canine cancer samples, Judith Frei for assisting in

ADCC/ADCP assays, and Michael Schranz for excellent advice in ampli-fying immunohistochemical signals with tyramide.

Grant SupportThis work was supported by grant P23398-B11 (to E. Jensen-Jarolim) of

the Austrian Science Fund (FWF) and J. Singer and J. Fazekas weresupported by the CCHD PhD program, FWF project W1205-B09 (to E.Jensen-Jarolim).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received April 22, 2013; revised April 14, 2014; accepted April 14, 2014;published OnlineFirst April 22, 2014.

References1. Takashima-Uebelhoer BB, Barber LG, Zagarins SE, Procter-Gray E,

Gollenberg AL, Moore AS, et al. Household chemical exposures andthe risk of canine malignant lymphoma, a model for human non-Hodgkin's lymphoma. Environ Res 2012;112:171–6.

2. Rivera P, von Euler H. Molecular biological aspects on canine andhuman mammary tumors. Vet Pathol 2011;48:132–46.

3. Gordon I, PaoloniM,MazckoC,KhannaC. TheComparativeOncologyTrials Consortium: using spontaneously occurring cancers in dogs toinform the cancer drug development pathway. PLoS Med 2009;6:e1000161.

4. Paoloni M, Khanna C. Translation of new cancer treatments from petdogs to humans. Nat Rev Cancer 2008;8:147–56.

5. Sorenmo K. Canine mammary gland tumors. Vet Clin North Am SmallAnim Pract 2003;33:573–96.

6. London CA, Malpas PB, Wood-Follis SL, Boucher JF, Rusk AW,Rosenberg MP, et al. Multi-center, placebo-controlled, double-blind,randomized study of oral toceranib phosphate (SU11654), a receptortyrosine kinase inhibitor, for the treatment of dogswith recurrent (eitherlocal or distant)mast cell tumor followingsurgical excision.ClinCancerRes 2009;15:3856–65.

7. Lachowicz JL, Post GS, Brodsky E. A phase I clinical trial evaluatingimatinib mesylate (Gleevec) in tumor-bearing cats. J Vet Intern Med2005;19:860–4.

8. Bergman PJ, Camps-Palau MA, McKnight JA, Leibman NF, Craft DM,LeungC, et al. Development of a xenogeneic DNA vaccine program forcanine malignant melanoma at the Animal Medical Center. Vaccine2006;24:4582–5.

9. Schmoll HJ, Van Cutsem E, Stein A, Valentini V, Glimelius B,Haustermans K, et al. ESMO Consensus Guidelines for manage-ment of patients with colon and rectal cancer. A personalizedapproach to clinical decision making. Ann Oncol 2012;23:2479–516.

10. Cardoso F, Fallowfield L, Costa A, Castiglione M, Senkus E. Locallyrecurrent or metastatic breast cancer: ESMO Clinical Practice Guide-lines for diagnosis, treatment and follow-up. AnnOncol 2011;22(Suppl6):vi25–30.

11. Singer J, Weichselbaumer M, Stockner T, Mechtcheriakova D, Soba-nov Y, Bajna E, et al. Comparative oncology: ErbB-1 and ErbB-2homologues in canine cancer are susceptible to cetuximab and tras-tuzumab targeting. Mol Immunol 2012;50:200–9.

12. Sato JD, Kawamoto T, Le AD, Mendelsohn J, Polikoff J, Sato GH.Biological effects in vitroofmonoclonal antibodies to humanepidermalgrowth factor receptors. Mol Biol Med 1983;1:511–29.

13. Eccles SA. The epidermal growth factor receptor/Erb-B/HER family innormal and malignant breast biology. Int J Dev Biol 2011;55:685–96.

14. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. NatRev Mol Cell Biol 2001;2:127–37.

15. Yarden Y, Shilo BZ. SnapShot: EGFR signaling pathway. Cell2007;131:1018.

16. Rimawi MF, Shetty PB, Weiss HL, Schiff R, Osborne CK, ChamnessGC, et al. Epidermal growth factor receptor expression in breast cancer

association with biologic phenotype and clinical outcomes. Cancer2010;116:1234–42.

17. Yang X, Zhang X,Mortenson ED, Radkevich-BrownO,Wang Y, Fu YX.Cetuximab-mediated tumor regression depends on innate and adap-tive immune responses. Mol Ther 2013;21:91–100.

18. Karagiannis P, Singer J, Hunt J, Gan SK, Rudman SM, Mechtcher-iakova D, et al. Characterisation of an engineered trastuzumab IgEantibody and effector cell mechanisms targeting HER2/neu-positivetumour cells. Cancer Immunol Immunother 2009;58:915–30.

19. Spillner E, PlumM, Blank S, Miehe M, Singer J, Braren I. RecombinantIgE antibody engineering to target EGFR. Cancer Immunol Immun-other 2012;61:1565–73.

20. Vale CL, Tierney JF, Fisher D, AdamsRA, Kaplan R,Maughan TS, et al.Does anti-EGFR therapy improve outcome in advanced colorectalcancer? A systematic review and meta-analysis. Cancer Treat Rev2012;38:618–25.

21. Tol J, Punt CJ. Monoclonal antibodies in the treatment of metastaticcolorectal cancer: a review. Clin Ther 2010;32:437–53.

22. Harris CA, Ward RL, Dobbins TA, Drew AK, Pearson S. The efficacy ofHER2-targeted agents in metastatic breast cancer: a meta-analysis.Ann Oncol 2011;22:1308–17.

23. Brekke OH, Sandlie I. Therapeutic antibodies for human diseases atthe dawn of the twenty-first century. Nat Rev Drug Discov 2003;2:52–62.

24. Mendelsohn J. Epidermal growth factor receptor inhibition by amono-clonal antibody as anticancer therapy. Clin Cancer Res 1997;3:2703–7.

25. Goldstein NI, Prewett M, Zuklys K, Rockwell P, Mendelsohn J. Bio-logical efficacy of a chimeric antibody to the epidermal growth factorreceptor in a human tumor xenograft model. Clin Cancer Res1995;1:1311–8.

26. Chang C, Takayanagi A, Yoshida T, Shimizu N. Recombinant humanIgG antibodies recognizing distinct extracellular domains of EGFreceptor exhibit different degrees of growth inhibitory effects onhuman A431 cancer cells. Exp Cell Res 2013;319:1146–55.

27. Knittelfelder R, Riemer AB, Jensen-JarolimE.Mimotope vaccination—from allergy to cancer. Expert Opin Biol Ther 2009;9:493–506.

28. You B, Chen EX. Anti-EGFR monoclonal antibodies for treatment ofcolorectal cancers: development of cetuximab and panitumumab.J Clin Pharmacol. 2011 Mar 11. [Epub ahead of print].

29. Kurzman ID, Shi F, Vail DM,MacEwen EG. In vitro and in vivo enhance-ment of canine pulmonary alveolar macrophage cytotoxic activityagainst canine osteosarcoma cells. Cancer Biother Radiopharm 1999;14:121–8.

30. Soergel SA, MacEwen EG, Vail DM, Potter DM, Sondel PM, HelfandSC. The immunotherapeutic potential of activated canine alveolarmacrophages and antitumor monoclonal antibodies in metastaticcanine melanoma. J Immunother 1999;22:443–53.

31. Steplewski Z, Rosales C, Jeglum KA, McDonald-Smith J. In vivodestruction of canine lymphoma mediated by murine monoclonalantibodies. In Vivo 1990;4:231–4.






32. Nariai N, Kitagawa K, Nariai K, Kosaka T, Kuwabara M, Kiuchi Y.Active-oxygen involvement in canine NK-mediated cytotoxicity. J VetMed Sci 2000;62:457–60.

33. Griffith TS, Wiley SR, Kubin MZ, Sedger LM, Maliszewski CR, FangerNA. Monocyte-mediated tumoricidal activity via the tumor necrosisfactor-related cytokine, TRAIL. J Exp Med 1999;189:1343–54.

34. Washburn B, Weigand MA, Grosse-Wilde A, Janke M, Stahl H, RieserE, et al. TNF-related apoptosis-inducing ligand mediates tumoricidalactivity of human monocytes stimulated by Newcastle disease virus.J Immunol 2003;170:1814–21.

35. Dalle S, Thieblemont C, Thomas L, Dumontet C. Monoclonal anti-bodies in clinical oncology. Anticancer Agents Med Chem 2008;8:523–32.

36. Challacombe JM, Suhrbier A, Parsons PG, Jones B, Hampson P,Kavanagh D, et al. Neutrophils are a key component of the antitumorefficacy of topical chemotherapy with ingenol-3-angelate. J Immunol2006;177:8123–32.

37. Ritt MG, Wojcieszyn J, Modiano JF. Functional loss of p21/Waf-1 in acase of benign canine multicentric melanoma. Vet Pathol 1998;35:94–101.

38. Harris LJ, Skaletsky E, McPherson A. Crystallographic structure of anintact IgG1 monoclonal antibody. J Mol Biol 1998;275:861–72.

39. Sali A, Blundell TL. Comparative protein modelling by satisfaction ofspatial restraints. J Mol Biol 1993;234:779–815.

40. Shen MY, Sali A. Statistical potential for assessment and prediction ofprotein structures. Protein Sci 2006;15:2507–24.

41. Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, ThorntonJM. AQUA and PROCHECK-NMR: programs for checking the qualityof protein structures solved by NMR. J Biomol NMR 1996;8:477–86.

42. Edgar RC. MUSCLE: multiple sequence alignment with high accuracyand high throughput. Nucleic Acids Res 2004;32:1792–7.

43. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics2007;23:2947–8.

44. Swoboda I, Bugajska-Schretter A, Verdino P, Keller W, Sperr WR,Valent P, et al. Recombinant carp parvalbumin, the major cross-reactive fish allergen: a tool for diagnosis and therapy of fish allergy.J Immunol 2002;168:4576–84.

45. Starkl P, Felix F, Krishnamurthy D, Stremnitzer C, Roth-Walter F,Prickett SR, et al. An unfolded variant of the major peanut allergenAra h 2 with decreased anaphylactic potential. Clin Exp Allergy2012;42:1801–12.

46. Bracher M, Gould HJ, Sutton BJ, Dombrowicz D, Karagiannis SN.Three-colour flowcytometricmethod tomeasure antibody-dependenttumour cell killing by cytotoxicity and phagocytosis. J Immunol Meth-ods 2007;323:160–71.

47. Warr GW, Hart IR. Binding of canine IgM and IgG to protein A ofStaphylococcus aureus: a simple method for the isolation of canineimmunoglobulins from serum and the lymphocyte surface. Am J VetRes 1979;40:922–6.

48. YamamotoS,OmuraM,HirataH. Isolation of porcine, canine and felineIgG by affinity chromatography using protein A. Vet Immunol Immu-nopathol 1985;9:195–200.

49. ScottMA,Davis JM, SchwartzKA. Staphylococcal protein Abinding tocanine IgG and IgM. Vet Immunol Immunopathol 1997;59:205–12.

50. KimGP,GrotheyA. Targeting colorectal cancerwith humananti-EGFRmonoclonocal antibodies: focus on panitumumab. Biologics2008;2:223–8.

51. Marconato L, Gelain ME, Comazzi S. The dog as a possible animalmodel for human non-Hodgkin lymphoma: a review. Hematol Oncol2013;31:1–9.

52. Owen LN. A comparative study of canine and human breast cancer.Invest Cell Pathol 1979;2:257–75.

53. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB,Kamal M, et al. Genome sequence, comparative analysis and haplo-type structure of the domestic dog. Nature 2005;438:803–19.

54. Cooley DM, Waters DJ. Skeletal metastasis as the initial clinicalmanifestation of metastatic carcinoma in 19 dogs. J Vet Intern Med1998;12:288–93.

55. Jaillardon L, Barthelemy A, Goy-Thollot I, Pouzot-Nevoret C, Fournel-Fleury C. Mammary gland carcinoma in a dog with peripheral bloodand bone marrow involvement associated with disseminated intra-vascular coagulation. Vet Clin Pathol 2012;41:261–5.

56. Jubala CM,Wojcieszyn JW, Valli VE, Getzy DM, Fosmire SP, Coffey D,et al. CD20 expression in normal canine B cells and in canine non-Hodgkin lymphoma. Vet Pathol 2005;42:468–76.

57. Gama A, Gartner F, Alves A, Schmitt F. Immunohistochemical expres-sion of epidermal growth factor receptor (EGFR) in canine mammarytissues. Res Vet Sci 2009;87:432–7.

58. FukuokaH,CooperO,Ben-ShlomoA,MamelakA,RenSG,BruyetteD,et al. EGFR as a therapeutic target for human, canine, and mouseACTH-secreting pituitary adenomas. J Clin Invest 2011;121:4712–21.

59. Sabattini S,Mancini FR,Marconato L, Bacci B, Rossi F, Vignoli M, et al.EGFR overexpression in canine primary lung cancer: pathogeneticimplications and impact on survival. Vet Comp Oncol. 2012 Sep 20.[Epub ahead of print].

60. Ferreira E, Gobbi H, Saraiva BS, Cassali GD. Columnar cell lesions ofthe canine mammary gland: pathological features and immunophe-notypic analysis. BMC Cancer 2010;10:61.

61. Millanta F, Caneschi V, Ressel L, Citi S, Poli A. Expression of vascularendothelial growth factor in canine inflammatory and non-inflamma-tory mammary carcinoma. J Comp Pathol 2010;142:36–42.

62. Li S, Schmitz KR, Jeffrey PD, Wiltzius JJ, Kussie P, Ferguson KM.Structural basis for inhibition of the epidermal growth factor receptorby cetuximab. Cancer Cell 2005;7:301–11.

63. Tang L, SampsonC,DreitzMJ,McCall C.Cloning andcharacterizationof cDNAs encoding four different canine immunoglobulin gammachains. Vet Immunol Immunopathol 2001;80:259–70.

64. BruggemannM,WilliamsGT, BindonCI, ClarkMR,WalkerMR, JefferisR, et al. Comparison of the effector functions of human immunoglo-bulins using a matched set of chimeric antibodies. J Exp Med1987;166:1351–61.

65. Reichert JM, Wenger JB. Development trends for new cancer thera-peutics and vaccines. Drug Discov Today 2008;13:30–7.

66. Peng ZK, Simons FE, Becker AB. Differential binding properties ofprotein A and protein G for dog immunoglobulins. J Immunol Methods1991;145:255–8.

67. Buffet W, Geboes KP, Dehertogh G, Geboes K. EGFR-immunohis-tochemistry in colorectal cancer and non-small cell lung cancer:comparison of 3 commercially available EGFR-antibodies. Acta Gas-troenterol Belg 2008;71:213–8.

68. Lee HJ, Xu X, Choe G, Chung DH, Seo JW, Lee JH, et al. Proteinoverexpression and gene amplification of epidermal growth factorreceptor in nonsmall cell lung carcinomas: comparison of fourcommercially available antibodies by immunohistochemistry andfluorescence in situ hybridization study. Lung Cancer 2010;68:375–82.

69. Petricevic B, Laengle J, Singer J, Sachet M, Fazekas J, Steger G,et al. Trastuzumab mediates antibody-dependent cell-mediatedcytotoxicity and phagocytosis to the same extent in both adjuvantand metastatic HER2/neu breast cancer patients. J Transl Med2013;11:307.


Singer et al.




2014;13:1777-1790. Published OnlineFirst April 22, 2014.Mol Cancer Ther Josef Singer, Judit Fazekas, Wei Wang, et al. Immunotherapy in Dog Cancer PatientsGeneration of a Canine Anti-EGFR (ErbB-1) Antibody for Passive

Updated version

10.1158/1535-7163.MCT-13-0288doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2014/04/22/1535-7163.MCT-13-0288.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/13/7/1777.full#ref-list-1

This article cites 67 articles, 8 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/13/7/1777.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/13/7/1777To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-13-0288

http://mct.aacrjournals.org/content/suppl/2014/04/22/1535-7163.MCT-13-0288.DC1

http://mct.aacrjournals.org/content/13/7/1777.full#ref-list-1

http://mct.aacrjournals.org/content/13/7/1777.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/13/7/1777


Documents

Generation of a Canine Anti-EGFR (ErbB-1) Antibody for ...mct.aacrjournals.org/content/molcanther/13/7/1777.full.pdf · Passive Immunotherapy in Dog Cancer Patients Josef Singer1,3,