Upload
buck-brent-oliver
View
222
Download
0
Embed Size (px)
Citation preview
From the Gene to the From the Gene to the GenomeGenome
Genetic Inheritance PatternsGenetic Inheritance Patterns
Observing Genetic Differences in Observing Genetic Differences in the DNAthe DNA
Each human has 46 chromosomes. Each human has 46 chromosomes. Each parent provides one member of a Each parent provides one member of a matched (homologous) chromosome pair. matched (homologous) chromosome pair.
Chromosomal Locations of GenesChromosomal Locations of Genes• Locus = area on chromosome where Locus = area on chromosome where
gene is located gene is located • Paired chromosomes have genes in Paired chromosomes have genes in
the same order, but may have the same order, but may have different forms of a gene at the same different forms of a gene at the same locuslocus
• Alleles = alternative forms of a geneAlleles = alternative forms of a gene– Dominant allele masks other Dominant allele masks other
allelesalleles– Recessive allele is masked Recessive allele is masked
• Gene = sequence of DNA that codes Gene = sequence of DNA that codes for a protein, gives rise to physical for a protein, gives rise to physical traittrait
Locus 1Locus 1Locus 2Locus 2
Locus 3Locus 3
Separation ofSeparation ofChromosome PairsChromosome Pairs
W w
ChromosomesChromosomesduplicateduplicate
Pairs separate
Duplicatesseparate
dominant allele
rec
ess
ive
alle
le
Each sex cell will Each sex cell will carry only one allele carry only one allele for each genefor each gene wwW W
wwW W
W wW w
Duplicatesseparate
Inheritance Pattern for One GeneInheritance Pattern for One Gene(for genes on pairs 1-22)(for genes on pairs 1-22)
TT or Tt = no diseaseTT or Tt = no diseasett = Tay-Sachs diseasett = Tay-Sachs disease
Donald, no diseaseDonald, no disease Darla, no diseaseDarla, no diseaseTtTt TtTt
TT
tt
T t T t
TTTT
TtTt
TtTt
tttt
Chances with each Chances with each pregnancy: pregnancy: 75% no disease75% no disease25% Tay-Sachs disease25% Tay-Sachs disease
phenotype = physical
characteristic
homozygous recessive
homozygous dominant
heterozygous(carrier)
genotype = set of alleles
Molecular Basis for Effects of Molecular Basis for Effects of Dominant and Recessive AllelesDominant and Recessive Alleles
• Dominant AlleleDominant Allele– codes for a functional proteincodes for a functional protein– eg. T allele gives instructions for making eg. T allele gives instructions for making
Hexosaminidase A (Hex A), an enzyme involved in Hexosaminidase A (Hex A), an enzyme involved in lipid metabolismlipid metabolism
• Recessive AlleleRecessive Allele– codes for a non-functional protein or prevents any codes for a non-functional protein or prevents any
protein product from being formedprotein product from being formed– eg. with the t allele, no functional Hex A is detectedeg. with the t allele, no functional Hex A is detected
Variations in Genetic Patterns: CodominanceVariations in Genetic Patterns: Codominance
Neither allele masks the other so that effects Neither allele masks the other so that effects of both alleles are observed in heterozygotes of both alleles are observed in heterozygotes without blendingwithout blending
Example: ABO Blood TypeExample: ABO Blood Type
Blood TypeBlood Type GenotypesGenotypes
Type AType A AA or AoAA or Ao
Type BType B BB or BoBB or Bo
Type ABType AB ABAB
Type OType O oooo
Alleles A and B are codominant.Alleles A and B are codominant.Alleles AAlleles A and B are completely dominant over o.and B are completely dominant over o.
Effects of both alleles observed
in phenotype
Type A
Type B
Type AB
Type O
Variations in Genetic Patterns: Multiple AllelesVariations in Genetic Patterns: Multiple AllelesThree or more alleles exist for one traitThree or more alleles exist for one trait[Note: A person can only carry any two[Note: A person can only carry any two of these alleles at once.] of these alleles at once.]
Examples: ABO Blood TypeExamples: ABO Blood Typeand also Rh Factorand also Rh Factor
PhenotypePhenotype Genotype*Genotype* Protein on Red Protein on Red Blood CellsBlood Cells
Rh PositiveRh Positive RR or RrRR or Rr Rhesus ProteinRhesus Protein
Rh NegativeRh Negative rrrr NoneNone
*Although there are multiple R alleles, R*Although there are multiple R alleles, R11, R, R22, R, R33, etc. all are, etc. all are
completely dominant over all of the r alleles, rcompletely dominant over all of the r alleles, r11, r, r22, r, r33, etc. , etc.
ABO Blood Type and Rh Factor are controlled by ABO Blood Type and Rh Factor are controlled by separate genes. They are inherited independently.separate genes. They are inherited independently.
Variations in Genetic Patterns: Polygenic InheritanceVariations in Genetic Patterns: Polygenic Inheritance
Many genes affect one traitMany genes affect one traitExample: Skin colorExample: Skin color
Number of Number of Dominant Dominant
AllelesAlleles
Skin Color*Skin Color*
(Phenotype)(Phenotype)
GenotypesGenotypes % Pigmentation*% Pigmentation*
00 WhiteWhite aabbaabb 0-11%0-11%
11 Light BlackLight Black Aabb or aaBbAabb or aaBb 12-25%12-25%
22 Medium BlackMedium Black AAbb or AaBb or AAbb or AaBb or aaBBaaBB
26-40%26-40%
33 Dark BlackDark Black AABb or AaBBAABb or AaBB 41-55%41-55%
44 Darkest BlackDarkest Black AABBAABB 56-78%56-78%
*Based on a study conducted in Jamaica. *Based on a study conducted in Jamaica.
Variations in Genetic Patterns: Variations in Genetic Patterns: Sex Influenced GenesSex Influenced Genes
Genes that have different dominance Genes that have different dominance patterns in males and femalespatterns in males and females
Example: Pattern BaldnessExample: Pattern BaldnessCaused by a dominant allele in males,Caused by a dominant allele in males,
but a recessive allele in femalesbut a recessive allele in females
bbbb
BB or BbBB or Bb bbbb
BB or BbBB or Bb
Inheritance for Sex-linked GenesInheritance for Sex-linked Genes(for genes on pair 23)(for genes on pair 23)
Hemophilic Male Non-hemophilic Hemophilic Male Non-hemophilic
FemaleFemale
XXhh
YY
XXHH X Xhh
XXHHXXhh XXhhXXhh
XXHHYY XXhhYY
Chance for each pregnancy:Chance for each pregnancy:¼ non-hemophilic females; ¼ hemophilic females ¼ non-hemophilic females; ¼ hemophilic females
¼ non-hemophilic males; ¼ hemophilic males ¼ non-hemophilic males; ¼ hemophilic males
x Xx XHHXXhh
Males carry only one copy of genes on the X chromosomeMales carry only one copy of genes on the X chromosomeFemales can be homozygous or heterozygous these genesFemales can be homozygous or heterozygous these genes
H = no hemophiliaH = no hemophiliah = hemophiliah = hemophilia
GrampsGrampsXXhhYY
(father is hemophilic)(father is hemophilic)
XXhhYY
The Human Genome Project: Genetic Differences at the DNA Level
Per 23 chromosomes
Now estimated at 30,000
genes
Studying DNAStudying DNA• Cut chromosomal DNA into smaller pieces Cut chromosomal DNA into smaller pieces
with restriction enzymeswith restriction enzymes
5’— A A G T C G G A T C C T G A C G T— 3’5’— A A G T C G G A T C C T G A C G T— 3’ 3’— T T C A G C C T A G G A C T G C A— 5’3’— T T C A G C C T A G G A C T G C A— 5’
sticky endsticky end
sticky endsticky end
G A T C C T G A C G T— 3’G A T C C T G A C G T— 3’ G A C T G C A— 5’G A C T G C A— 5’
5’— A A G T C G5’— A A G T C G3’— T T C A G C C T A G3’— T T C A G C C T A G
Bam H1Bam H1
Bam H1Bam H1Results inResults in
separate fragments separate fragments
Studying DNAStudying DNA
• Cut chromosomal DNA into smaller pieces Cut chromosomal DNA into smaller pieces with restriction enzymeswith restriction enzymes
• Separate DNA pieces by size using agarose Separate DNA pieces by size using agarose gel electrophoresisgel electrophoresis
Electric current is applied Electric current is applied to separate DNA by sizeto separate DNA by size
UV light is used to detect a UV light is used to detect a fluorescent dye attached to fluorescent dye attached to
the DNA fragmentsthe DNA fragments
Example of a gel patternExample of a gel pattern
DNA samples are placed DNA samples are placed in an agarose gelin an agarose gel
Agarose Gel ElectrophoresisAgarose Gel Electrophoresis
larger fragments
smaller fragments
Studying DNAStudying DNA
• Transfer DNA to filter for analysis with probe Transfer DNA to filter for analysis with probe that will bind to specific sequencethat will bind to specific sequence
DNA separated by sizeDNA separated by sizeis transferred from is transferred from agarose gel to filteragarose gel to filter
DNA pattern on filter will be identical to gel separation pattern.DNA pattern on filter will be identical to gel separation pattern.
Studying DNAStudying DNA
Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the sequence of complementary to the sequence of interest; Used to locate a copy of the interest; Used to locate a copy of the DNA sequence by hybridizationDNA sequence by hybridization
Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene
AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA
AATCGCAGCTTAGCGATAGCTTAGCGAT
TCGAATCGCTATCGAATCGCTA
Denature DNA by heatingDenature DNA by heating
DNA Pattern on Gel Pattern on Filter after probe binding
Studying DNAStudying DNA
• Allow probe to bind to DNA on filter, visualize Allow probe to bind to DNA on filter, visualize region of probe attachmentregion of probe attachment
DNA on filter is DNA on filter is exposed to probe exposed to probe to detect to detect complementary complementary sequences.sequences.
Studying DNAStudying DNA• Identify similarities and differences between Identify similarities and differences between
individuals– Paternity Testingindividuals– Paternity Testing
X
X
X
X
X
X
X
X
Testing for Sickle Cell Alleles
Studying DNAStudying DNA• Identify patterns that are unique to specific Identify patterns that are unique to specific
genes– Medical Genetic Testinggenes– Medical Genetic Testing
On the basis of this analysis, the genotype of the fetus is 1. AS 2. AA 3. SS 4. Unknown
Future Directions: Future Directions: Gene TherapyGene Therapy
Andrew Gobea
Ashanthi DeSilva
Treated for SCIDTreated for SCIDSevere Combined Immune DeficiencySevere Combined Immune Deficiency