29
EUROFORGEN-NoE is funded by the European Commission within the 7th Framework Programme Peter M. Schneider Institute of Legal Medicine University of Cologne (Germany) 26/05/2016 Slide no 1 From Genetics to Genomics – European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations

From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Peter M. SchneiderInstitute of Legal Medicine

University of Cologne (Germany)

26/05/2016 Slide no 1

From Genetics to Genomics – European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations

Page 2: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Forensic DNA testing in criminal cases

• … has become the most successful tool for criminal

investigations, and has led to the introduction of national

DNA databases throughout Europe

• The European Standard Set (ESS) of (STR) markers has

enabled since 2005 (Treaty of Prüm) the European-wide

exchange of DNA profiles from unsolved crimes

• The German DNA Analysis Database (DAD)

Status in 03/2016:

- 1,143,150 records (854,350 persons, 288,800 stains)

- 216,300 hits (171,300 person-stain, 45,000 stain-stain)

Page 3: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

0

2000000

4000000

6000000

8000000

10000000

12000000

14000000

2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

Year Persons

The Growth of DNA Databases in Europe 2003 – 2015

1.6 millionunsolved crime cases

+450% +600%

Page 4: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

STR Typing by Electrophoresis

1996: 4 dyes / 10 marker

2016: 6 dyes / 24 marker

Page 5: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

STR Typing by CE: Advantages

• Standardization

– Commonly used nomenclature of alleles and genotypes

– Allele frequency estimates based on world-wide population studies

• Reliability

– Excellent reproducibility of results within and between laboratories

– Sensitive detection of „low level“ DNA amounts

• Acceptance

– National DNA databases

– Non-coding markers: „built-in“ privacy protection

– Good cost/benefit relationship

Page 6: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

STR Typing by CE: Limitations

• Challenging DNA samples

– Loss of information due to degradation

– Complex mixtures cannot be resolved

• Kinship testing

– Not sufficiently powerful for distant family relationships (e.g.for identification of human remains)

– Number of alleles/locus too small � allele frequencies too high

• Technical restrictions

– Multiplex typing using CE restricts number of markers per assay

– PCR/CE artifacts compromise detection sensitivity

Page 7: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Massively Parallel Sequencing (MPS):Examples of D12S391 allele 21 subtypes

D12S391[21]:AGAT[11]AGAC[9]AGAT[1]

D12S391[21]:AGAT[11]AGAC[10]

D12S391[21]:AGAT[12]AGAC[8]AGAT[1]

D12S391[21]:AGAT[12]AGAC[9]

D12S391[21]:AGAT[13]AGAC[7]AGAT[1]

D12S391[21]:AGAT[13]AGAC[8]

D12S391[21]:AGAT[13]GGAC[1]AGAC[7]

D12S391[21]:AGAT[14]AGAC[6]AGAT[1]

(Table from Gelardi et al 2014)

Page 8: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

0

200

400

600

800

1000

1200

1400

1600

1800

2000

15 16 17

2-Person Mixture

Major

Major

Minor

Shared

AGAT .. AGAC

AGAT .. AGATAGAT .. AGAT

2:1 major/minor mixture

16, 17 and 16, 17*

Stutter

Stutter

Page 9: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

MPS for Forensic SNP Typing

• gDNA SNP profiling

– Identity SNPs (autosomal, non-coding)

– Lineage SNPs (Y-Chr. / mtDNA, non-coding)

– Ancestry informative SNPs (both coding and non-coding)

– Phenotyping SNPs (FDP, mostly coding)

– X-Chr. SNPs for kinship cases (non-coding)

• DNA methylation profiling

– CpG islands associated with cell-specific gene expression

– Age prediction & body fluid / tissue identification

• mRNA profiling

– body fluid / tissue identification from cDNA

– Combined with coding SNP typing � donor identification

Page 10: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Forensic Sci. Int. Genet. 2016

10

- 8 genomic control DNA samples

- 552 test samples from 14 global populations

Page 11: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

Concordance

11

Inter-lab concordance

• 4 labs

• 8 control samples + 37 analyses

• 20 no-call genotypes in 8 SNPs

• 9 discordant genotypes in 4 SNPs

observed in 3 samples

Public genomic database concordance

• 2 databases: 1000 Genomes

Complete Genomics

• 4 / 5 control samples

• 21 analyses

• 14 no-call genotypes in 8 SNPs

• 4 discordant genotypes in 1 SNP

100% = 2688 genotypes

100% = 4736 genotypes

Page 12: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

Problematic Marker: rs2080161

12

rs2080161

NA11200 lab 1578 % + -

A: 53 9 47 6

C: 524 91 112 412

G: 0

T: 1 0 0 1

340 % + -

A: 92 27 90 2

C: 188 55 54 134

G: 0

T: 60 18 8 52

Exclusion of rs2080161 from any further analysis

False positive

insertionof C

TGGACTTTATGGGTTGTTGTTTTTTTGGTTTTTTTTTTGTTTTTTTTTTGCACTCATCACATTTTTTCATAGTGGAACAATTAAAAGAATAAGCAAATGGT

NA11200 lab 2

Page 13: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Global AIMs SNP Panel

• Ion PGM™ study – 5 EUROFORGEN labs (IMU, KCL, UCPH, USC, UHC)

• Extension of European – African – East Asian ancestry comparison & inclusion of

Native American and Oceanian ancestry

• Focus of marker selection – equivalent levels of differentiation between 5 global

populations:

13Phillips et al., FSI Genetics 11 (2014) 13-25, Building a forensic ancestry panel from the ground up: The EUROFORGEN Global AIM-SNP set

Europe33

Africa8

East Asia31

Oceania28

America28

128 SNPsEUROFORGEN-NoE

Global AIM SNP Panel

tri6

Page 14: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Sensitivity: 10ng – 10pg DNA input (NA07000

14

• Full profiles 10 ng – 100pg

• A single no-call, no allele or locus drop-out for samples ≥100pg

• 10.1% allele drop-outs in heterozygous genotypes ≤50pg

• 0.8% allele drop-in ≤50pg

• 10pg:

48.4% correct genotypes

38.3% locus drop-out

5.3% allele drop-out

0.8% allele drop-in

25

cycles

25+5

cycles

25+5

cycles25

cycles

25+5

cycles

Page 15: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Mixture Analysis

15

homozygousno-call heterozygous

Loss of sensitivity due to min_allele_freq = 0.1

Page 16: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Red: unmixed 1000 Genomes/CEPH populations

Yellow: admixed 1000 Genomes/CEPH populations

Green: 14 global populations typed in EUROFORGEN labs

Selection of populations for study

16

East Timor

Fiji

Jamaica

Sierra LeoneIvory CoastGhana

Csango/RomaniaSzekely/Hungary

Kurdish Iraq

Somalia

Greenland/Nuuk

India

Vietnam

Afghanistan

Page 17: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Population Analysis

Unmixed reference populations (1000 Genomes/CEPH)

Admixed study populations vs reference populations

17

East Timor

Somalia

Afghanistan

East Asia Oceania

America

Africa

Central South

Asia

Europe

Page 18: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Ion PGM™ Global AIMs Study - Summary

• 127/128 SNPs with reliable performance (1 SNP excluded)

• > 99% concordance for inter-lab and public genomic database

comparison

• Full SNP profiles down to 100pg

• 5 + 1 global unmixed reference populations differentiated:

Africa - Europe - Central South Asia - East Asia - Oceania - America

• Unmixed EFG study populations in compliance with reference

populations

• Admixed EFG study populations clustered between different

reference populations

18

Page 19: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

MPS: SWOT Analysis

STRENGTHS

• „All-inclusive“ approach for all forensic markers

• Maximal amount of data from minimal amount of sample

• Deconvolution of complex mixtures

WEAKNESSES

• Long sample-to-data period

• Expensive (for the time being)

• Lack of standardization

• Requires new resources for bioinformatics and data storage

Page 20: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

MPS: SWOT Analysis

OPPORTUNITIES

• May provide new intelligence leads on

previously unsolved cases

• Allows to generate all data in advance, and

irrespective of available information at the

time of the analysis

THREATS

• All-inclusive typing kits may collect more

information than needed

• Entering the „slippery slope“ of

accumulating sensible personal data

– Why not sequence the entire genome?

• How can the massive amounts of data be

secured and filtered?

Page 21: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

MPS in Forensics: Conclusions

• MPS is only a new technology, but

– … the limitations have neither been explored nor defined

– … has created a demand to collect more data than needed

– … there is a growing interest, both from industry, to sell a new product, and from the forensic community to use what is available

The unlimited application in casework and for national DNA databases may eventually lead to a paradigm shift.

What can be done?

Page 22: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

MPS in Forensics: Conclusions

What can be done:

– Create separate modules (primer sets) for coding / non-coding / ancestry informative markers

• to be used alone or in combination

• depending on depth of investigation, or the legal framework

– Keep sensible genetic data separated from national databases

– Use bioinformatic filters to mask sensible personal data

– Develop a ‚privacy by design‘ framework of probabilities to communicate results of FDP and ancestry typing without disclosing real DNA data to the end-user

Page 23: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

www.ialm2016venice.org

Page 24: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

EUROFORGEN Conference - June 23, 2016Forensic DNA analysis in the light of the new security needs

Session 1: FROM CRIME SCENE TO COURT ROOM

• John Butler (NIST), Sarah Chu (New York), Peter Gill (Oslo)

Session 2: FROM GENOTYPE TO PHENOTYPE

• A. Valdes (KCL), W. Branicki (JU), C. Phillips (USC)

Session 3: SCIENCE IN SOCIETY

• L. Roewer (Berlin), E. Murphy (NYU Law School),

H. Machado (Coimbra), M. Wienroth (Northumbria)

L. Prieto (Madrid), K. Reid (London)

Roundtable Discussion

• Current challenges in ethical, legal & social aspects in different

European countries – R. Williams (chair)

Page 25: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

EUROFORGEN Conference - June 23, 2016

• Venue and registration details

– www.ialm2016venice.org

– Venice Convention Center, Lido Island

– Reduced registration for IALM partner societies available until May 31st, 2016

– Current members of the EUROFORGEN Virtual Institute will get an additional discount after the conference

– Includes access to all sessions of IALM Symposium

• Session on Forensic Genetics and Genomics, June 24th

– Speakers: A. Carracedo, M. Kayser, W. Parson, P. Schneider

– Short presentations

Page 26: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

26/05/2016 Slide no 26

Please do not forget to join our Facebook group!… already 281 members!

Page 27: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

26/05/2016 Slide no 27

Page 28: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

Thank you very much for your attention!

26/05/2016 Slide no 28

Page 29: From Genetics to Genomics – European Perspectives for an Integrated Approach … · 2020-06-12 · Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal

EUROFORGEN-NoE is funded by the European Commissionwithin the 7th Framework Programme

For Forensic or Paternity Use Only. When used for purposes other than Human Identification the instruments and software modules cited are for Research Use Only. Not for use in diagnostic procedures. Speaker was provided travel and hotel support by Thermo Fisher Scientific for this presentation, but no remuneration

26/05/2016 Slide no 29