22
Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at http://www.divshare.com/download/83012-a1c

Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Embed Size (px)

Citation preview

Page 1: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Fraction of citationswithin patents that areto non-patent documents

A copy of this presentation is available at http://www.divshare.com/download/83012-a1c

Page 2: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

6.3%6.3% 6.4%6.4%

43%43%

total patentstotal citations to

other patentstotal citations to non-patents

Life science's share of...

Page 3: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

GovernmentGovernment Companies/Companies/UniversitiesUniversities

literature

publicfunding

Page 4: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

NIHNIH

GovernmentGovernment Companies/Companies/UniversitiesUniversities

literature!

literature

publicfunding

Page 5: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

GovernmentGovernment Companies/Companies/UniversitiesUniversities

patentdisclosure

monopoly

Page 6: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

??

GovernmentGovernment Companies/Companies/UniversitiesUniversities

patentdisclosures !

monopoly

patentdisclosures

Page 7: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 8: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

<PubmedArticle> <MedlineCitation Owner="NLM" Status="MEDLINE"> <PMID>16051143</PMID> <DateCreated> <Year>2005</Year> <Month>07</Month> <Day>29</Day> </DateCreated> <DateCompleted> <Year>2005</Year> <Month>09</Month> <Day>20</Day> </DateCompleted> <DateRevised> <Year>2006</Year> <Month>11</Month> <Day>15</Day> </DateRevised> <Article PubModel="Print"> <Journal> <ISSN IssnType="Print">0092-8674</ISSN> <JournalIssue CitedMedium="Print"> <Volume>122</Volume> <Issue>2</Issue> <PubDate> <Year>2005</Year> <Month>Jul</Month> <Day>29</Day> </PubDate> </JournalIssue> <Title>Cell</Title> <ISOAbbreviation>Cell</ISOAbbreviation> </Journal> <ArticleTitle>Stochastic gene expression in a

lentiviral positive-feedback loop: HIV-1 Tatfluctuations drive phenotypic diversity.

</ArticleTitle> <Pagination>

Page 9: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Pubmed

Page 10: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

CTTCATCAATTATCGTACTCTTGTTAATGTGGTAAAATATAAACTGGACCACATGAGAAGAAGAATTGAGACCGATGAGAGAGATTCGACCAACCGGGCTTCCTTCAAATGTCCTGTCTGTAGTAGTACTTTCACAGACTTAGAAGCTAATCAGCTCTTTGATCCTATGACAGGAACTTTCCGCTGTACTTTTTGCCATACAGAGGTAGAAGAGGATGAATCAGCAATGCCCAAAAAAGATGCACGCACACTTTTGGCAAGGTTTAATGAACAAATTGAGCCCATTTATGCATTGCTTCGGGAGACAGAGGATGTGAACTTGGCCTATGAAATACTTGAGCCAGAACCCACAGAAATCCCAGCCCTGAAACAGAGCAAGGACCATGCAGCAACTACTGCTGGAGCTGCTAGCCTAGCAGGTGGGCACCACCGGGAAGCATGGGCCACCAAAGGTCCTTCCTATGAAGACTTATACACTCAGAATGTTGTCATTAACATGGATGACCAAGAAGATCTTCATCGAGCCTCACTGGAAGGGAAATCTGCCAAAGAGAGGCCTATTTGGTTGAGAGAAAGCACTGTCCAAGGGGCATATGGTTCTGAAGATATGAAAGAAGGGGGCATAGATATGGACGCATTTCAGGAGCGTGAGGAAGGCCATGCTGGGCCACCAAAGGTCCTTCCTATGAAGACTTATACACTCAGAATGTTGTCATTAACATGGATGACCAAGAAGATCTTCATCGAGCCTCACTGGAAGGGAAATCTGCCAAAGAGAGGCCTATTTGGTTGAGAGAAAGCACTGTCCAAGGGGCATATGGTTCTGAAGATATGAAAGAAGGGGGCATAGATATGGACGCATTTCAGGAGCGTGAGGAAGGCCATGCTGAGAAGGGGGCATAGATATGGACGCATTTCAGGAGC

Page 11: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 12: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 13: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Genome

Graphic stolen from NIH/NLM/NCBI

Page 14: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Pubmed

Page 15: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 16: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 17: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

How can we patch the patent literature into this existingcyberinfrastructure in the life sciences?

Page 18: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 19: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 20: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 21: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at
Page 22: Fraction of citations within patents that are to non-patent documents A copy of this presentation is available at

Pubmed

A copy of this presentation is availableat http://www.divshare.com/download/83012-a1c