Fezf2 regulates Brn3b in developing retinaTranscription Regulation; Neurodevelopment; Mouse . Abstract. generation in the mouse retina, we analyzed the Retinal ganglion cells (RGCs)

Fezf2 regulates Brn3b in developing retina

1

Transient Expression of Fez Family Zinc Finger 2 Regulates Brn3b in Developing Retinal Ganglion

Cells

Chunsheng Qu1,3,#

, Dandan Bian1,#

, Xue Li1, Jian Xiao

1, Chunping Wu

1, Yue Li

2, Tian Jiang

1, Xiangtian

Zhou1, Jia Qu

1, Jie-Guang Chen

1*

1School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, China State

Key Laboratory Cultivation Base and Key Laboratory of Vision Science, Ministry of Health of China, and

Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang 325000,

China.

2Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven,

CT 06520

3Clinical laboratory of LiShui People's Hospital, the Sixth Affiliated Hospital of Wenzhou Medical

University, LiShui, Zhejiang 323000, China

# C. Qu and D. Bian contributed equally to this work

Running Title: Fezf2 regulates Brn3b in developing retina

*Corresponding author:

Key Laboratory of Visual Science, and School of Optometry and Ophthalmology,

Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, P.R. China.

Tel.: +86-577-88067927; Fax: +86-577-88067934.

Email Address: Jie-Guang Chen ,

Keywords:

Fezf2; Brn3b; Retinal Ganglion Cells; In Utero Electroporation; Gene Knockout; Gene Expression;

Transcription Regulation; Neurodevelopment; Mouse

Abstract

Retinal ganglion cells (RGCs) are projection

neurons in the neural retina that relay visual

information from the environment to the central

nervous system. The early expression of MATH5

endows the post-mitotic precursors with RGC

competence and leads to the activation of Brn3b

that marks committed RGCs. Nevertheless, this

fate-commitment process and specifically,

regulation of Brn3b remains elusive. To explore

the molecular mechanisms underlying RGC

generation in the mouse retina, we analyzed the

expression and function of Fez family zinc finger

2 (FEZF2), a transcription factor critical for the

development of projection neurons in the cerebral

cortex. Fezf2 mRNA and protein were transiently

expressed at E16.5 in the inner neuroblast layer

and the prospective ganglion cell layer of retina,

respectively. Knockout of Fezf2 in the developing

retina reduced BRN3B+ cells and increased

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.689448The latest version is at JBC Papers in Press. Published on February 9, 2016 as Manuscript M115.689448

Copyright 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on May 31, 2020

http://ww

w.jbc.org/

Dow

nloaded from

mailto:[email protected]://www.jbc.org/cgi/doi/10.1074/jbc.M115.689448http://www.jbc.org/


2

apoptotic cell markers. Fezf2 knockdown by

retinal in utero electroporation diminished BRN3B,

but not the coexpressed ISLET1 and BRN3A,

indicating that the BRN3B decrease was the cause,

not the result, of the overall reduction of BRN3B+

RGCs in the Fezf2 knockout retina. Moreover, the

mRNA and a promoter activity of Brn3b were

increased in vitro by FEZF2, which bound to a 5´-

regulatory fragment in the Brn3b genomic locus.

These results indicate that transient expression of

Fezf2 in the retina modulates the transcription of

Brn3b and the survival of RGCs. This study

improves our understanding of the transcriptional

cascade required for the specification of RGCs and

provides novel insights into the molecular basis of

the retinal development.

Introduction

Retinal ganglion cells (RGCs) are generated from

a pool of retinal progenitor cells (RPCs). In all

vertebrates examined, RGCs are the first-born

neurons in the retina. In mice, multipotent RPCs

begin to exit mitosis and differentiate into RGC-

competent precursors around embryonic day 11

(E11). RGC-competence is fundamentally a cell-

intrinsic process that is activated by the early

expression of basic helix–loop–helix (bHLH)

transcription factor MATH5, a targeted deletion of

which blocks the formation of most RGCs (1).

MATH5 is expressed during or after the terminal

mitosis of RPCs (2), leading to a regulatory

cascade for RGC development. MATH5 induces

the expression of class IV POU-domain

transcription factor Pou4f2 (also known as

BRN3B), which is essential for the survival of

differentiated ganglion cells (3,4). Remarkably,

when Brn3b is selectively deleted, a significant

portion of RGCs dies by an enhanced apoptosis

(5,6). Moreover, BRN3B acts as a safeguard

mechanism by repressing cell differentiation of

amacrine and horizontal cells during the fate

commitment of RGCs (7). Although BRN3B

marks committed RGCs, it regulates RGC

maturation together with LIM-homeodomain

transcription factor ISLET1 that co-expresses with

BRN3B in post-mitotic, differentiating RGCs (8-

10).

MATH5 is critical for the competence and

hence the formation of RGC (1,2,11). The

regulation of fate commitment of RGC from the

competent cells is unclear since MATH5+

progenitors have the potential to give rise to all

seven major retinal cell types (12). In addition,

the temporal expression patterns of Math5 and

Brn3b mRNA are not identical. Brn3b show a

progressive increase starting from E12.5 and

persists at E16.5 when Math5 starts to decline

(2,5,13). A recent lineage tracing study of Math5-

expressing cells in the retina also argues that not

all of RGCs descends from MATH5+ progenitors

(14). Therefore, the precise transcriptional cascade

leading to the generation of RGCs remains to be

explored.

RGCs transmit visual information from the

environment to the central nervous system and are

the sole projection neurons in the retina. The

projection neurons in the cerebral cortex have

been extensively studied by in vivo genetic

manipulations. It was found that transcription

factor FEZF2 (also known as FEZL and ZFP312)

was expressed by the early neural progenitors in

the ventricular zone of the dorsal telencephalon.

Zinc finger protein FEZF2 represses the

expression of Hes5 in the proliferating neural stem

cells (15,16) and regulates the differentiation of

telencephalic precursors from mouse embryonic

stem cells (17). Fezf2 is required for the proper

specification and differentiation of subcerebral

projection neurons in the deep layers of cerebral

cortex (18-20). Overall, these observations led us

to hypothesize that Fezf2 may regulate

specification of the retinal projection neuron,

RGCs.

In this study, we have examined the

expression and function of Fezf2 in the developing

retinas. We found that Fezf2 was transiently

expressed in retinas during the generation of

RGCs. To investigate the role of Fezf2, we

inhibited its expression by RNA interference and

deleted the gene by conditional Fezf2-knockout in

the retina. Our results showed that knockdown and

knockout of Fezf2 led to BRN3B inhibition and

impaired the formation of RGCs. Moreover,

FEZF2 regulated the transcription of Brn3b by

binding to a 5’-regulatory sequence of the Brn3b

locus.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

Experimental Procedures

Animals and Genotyping

Animal procedures were performed by the

protocol approved by Animal Care Committee of

Wenzhou Medical University. Tg (Fezf2-EGFP)

mice were created by the GENSAT project

(http://www.gensat.org/index.html) and obtained

from Mutant Mouse Regional Resource Center

(MMRC, USA). Fezf2flox/flox

mice were kindly

provided by Nenad Sestan at Yale University. The

exon 2, which encodes amino acids 1-279 of 455

in FEZF2, was targeted for removal (21). Tg(Six3-

cre)69Frty mouse was created by Yasuhide Furuta

at RIKEN Center for Developmental Biology in

Japan (22), and was initially obtained from Lin

Gan at University of Rochester Medical Center.

Dr. Furuta kindly granted permission for its use by

our group. The Fezf2 second exon was deleted in

retinas by crossing Fezf2flox/flox

and Six3-Cre mice.

The retina-specific knockout of Fezf2 was

identified by PCR genotyping using three primers

located in exon 1-3 of Fezf2 as described before

(21). The loss of Fezf2 expression was further

confirmed by quantitative PCR (q-PCR) or

Western blot in one eye whereas the counterpart

eye from the same embryo was taken for the

knockout study.

Tissue preparation

Mouse pups were put on ice to induce

hypothermia while pregnant dams were

anesthetized with Ketamine 100 mg/kg and

Xylazine 10mg/kg. Eyes from prenatal mice were

enucleated under a dissecting microscope and

fixed by immersion in 4% paraformaldehyde

(PFA). All tissues were cryoprotected in 30%

sucrose at 4°C, frozen by liquid nitrogen vapor,

and then embedded in OCT compound (Sakura

Tissue Tek, Torrance, CA). Cryosections of 16 μm

were mounted in Superfrost microscope slides

(Fisher Scientific, PA) for in situ

hybridization(ISH) and immunofluorescence (IF)

staining.

Immunostaining

We performed IF staining in the developing

retinas to determine the expression of molecular

markers of retinal cells. Cryosections of retinas

were washed and blocked at room temperature for

2 hours in a blocking solution (5% donkey normal

serum plus 1% BSA, 0.2% glycine, 0.2% lysine

and 0.3% Triton). The sections were incubated

overnight at 4°C with primary antibodies diluted

in the blocking solution. The antibodies used in

this study were mouse anti-SMI32 (1:200,

Covance, #14942601), goat anti-BRN3B (1:50,

Santa Cruz Biotechnology, sc-31989), rabbit anti-

MATH5 (1:200, Abcam, ab78046), rabbit anti-

ISLET1 (1:200, Abcam, ab20670), rabbit anti-

CASPASE III (1:200, Cell Signaling Technology,

#9622), goat anti-BRN3A (1:50, Santa Cruz

Biotechnology, sc-31984), and rabbit anti-FEZF2

(1:500, Abcam, ab69436). The samples were

processed with secondary antibodies: CyTM

3-

conjugated anti-rabbit IgG and dylightTM

549-

conjugated anti-Goat IgG (Jackson

ImmunoResearch, Laboratories, PA) at a 1:400

dilution. Fluorescence images were taken using a

laser scanning confocal microscope (Zeiss).

RNA in situ hybridization

Nonradioactive RNA in situ hybridizations of

Fezf2 were performed as described previously (18).

Digoxigenin (DIG)-labeled Fezf2 riboprobe

(corresponding to nucleotides 1241–1734 of

NM_080433) was generated by in vitro

transcription from a linearized TopoII-Fezf2

plasmid. The cryosections were hybridized with

the probe in a hybridization buffer (50%

formamide, 4XSSC, 50 mM NaH2PO4, 100 μg/ml

t-RNA, 7.5% Dextran Sulfate, 1X Denharts and

500 μg salmon sperm DNA) overnight at 65°C.

After high-stringency post-hybridization washes,

the hybridization signal was detected with an

alkaline phosphatase-conjugated anti-DIG

antibody and developed using NBT/BCIP

chromogen (Roche, IN). Hybridization pictures

were taken using a Nikon microscope (SMZ1500)

and an Olympus microscope (EX41).

Plasmid Constructs

For in vivo inhibition of Fezf2 expression, we

used Zfp312 siRNA-1 and Zfp312 siRNA-2 with

targeting sequence

GGAGAACTCGGCCTTGACA at 775-793, and

GGTGTTCAATGCTCACTAT at 886-904, of the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

coding region of Fezf2, respectively. The

scrambled scRNA-1 and scRNA-2 were created by

introducing three mutations in the target sequences.

The Zfp312 siRNA-1 and its scramble were cloned

in the lentiviral vector pLVTH while Zfp312

siRNA-2 and its scramble were created based on

pCGLH. All these constructs have been verified

in the previous study of Fezf2 functions in the

cerebral cortex (18). For Fezf2 expression, full-

length Fezf2 was cloned into pCAGEN (Addgene)

that harbors a CAG promoter. For chromatin

immunoprecipitation (ChIP), a V5 tag

(GKPIPNPLLGLDST) was inserted into Fezf2-

pCAGEN and pCAGGS-GFP following the

startup codon ATG of Fezf2 and GFP, respectively,

by PCR in-frame cloning.

To measure the promoter activity in the 5’-

regulatory region of Brn3b, a conservative one kb

fragment upstream from starting site of Brn3b was

amplified by PCR using primers

(tcgctttcttccttctctgaa and

cggcaataatctaataatagctgtcaa). The PCR product

was cloned into pGL4.18, a promoterless firefly

luciferase vector co-expressing neomycin

resistance gene (Promega). Mouse neuroblastoma

N2a cells were transfected with the pGL4.18-

promoter and cultured in the presence of G418 for

two months to select the cells stably expressing the

plasmid. All constructs were confirmed by

sequencing prior to the in vivo and in vitro

experiments.

Retinal in utero electroporation

Plasmids were delivered to the developing

retina by retinal in utero electroporation (IUE)

(23). Briefly, E13.5 pregnant mice were

anesthetized and attached to a clean table. The

abdominal cavity was opened to expose the uterine

horns. DNA solution (4 μg/μl in Tris-EDTA buffer

containing 0.1% fast green) were injected through

the uterus wall using a polished pulled glass

micropipette. The head of each embryo was placed

between tweezer-type electrodes, and five square

electric pulses (38 V, 50 ms) were passed at one-

second intervals using a BTX electroporator. The

wall and skin of the abdominal cavity were aligned

and sutured. The embryos were allowed to develop

in vivo until E17.5 or P7. Then the mice were

sacrificed to remove the brains together with eyes

for fixation in PFA.

FACS sorting:

To study the effect of Fezf2, we isolated

E17.5 retinas from the Fezf2-siRNA-transfected

mice. Retinas were peeled from the eyeballs and

collected under a stereomicroscope (ZEISS).

The tissues were minced and incubated with 0.05%

trypsin for 8 min at 37°C. Single cell suspensions

were prepared by trituration, suspension, and

filtration. GFP+ cells were separated by

fluorescence-activated cell sorting (FACS) using

FACSAria II cell sorter (BD Biosciences) and

were taken for measuring the gene expression by

quantitative PCR (q-PCR).

Real-time RT-PCR

To quantitate the gene expression of Fezf2

and Brn3b, we synthesized cDNA from the RNA

isolated from the retina (SuperScriptTM

First-

Strand Synthesis System, Invitrogen).

Quantitative PCR (q-PCR) was performed using

an ABI 7900 system (Applied Biosystems) and

monitored based on SYBR Green I dye detection

with the primer sets for Fezf2

(accatggtctccagggaag; tcggaacgcatctccttg) and

Brn3b (tcgctttcttccttctctgaa;

cggcaataatctaataatagctgtcaa). The primer sets are

unique to the targeted genes and do not map to any

other genes in the mouse genome according to

blast search. Gene expression levels were

normalized to a reference gene Actin. The Ct

value was defined as the number of PCR cycles

required for the fluorescent signal to grow beyond

a threshold.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was

performed by following the protocol of EZ CHIP

KIT (Millipore, 17-371). N2a cells were

transfected with pCAG-V5-Fezf2 and pCAG-V5-

GFP. The cells were crosslinked with 1% PFA

and lysed on the ice. The lysates were sonicated to

shear the chromatin and incubated overnight at

4°C with anti-V5 antibody bound to Dynal Protein

A/G beads (1:10; Abcam, ChIP Grade ab9116).

The precipitate from V5-FEZF2 and V5-GFP in


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

Dynabeads was extensively washed and eluted at

65°C for 15 min with Elusion Buffer (1% SDS, 10%

1M NaHCO3 in H2O). The eluted protein-

chromatin complexes were reverse-crosslinked by

incubation with 5M NaCl overnight at 65°C. Both

ChIPed and input DNA were treated with RNaseA,

proteinase K and then followed by DNA

purification.

PCR and q-PCR of ChIP DNA

To determine if FEZF2 binds to Brn3b

genomic DNA, we amplified a tentative regulatory

region of Brn3b (-315 ~ +310) (chr8: 78436342-

78436967) by PCR with a primer set

(GTGCAGGCTGCCTGCGTGA;

CCGAAGCACCGACCTGGCTAG). The input

DNA from the transfected cells was taken as a

positive control for gel analysis of ChIP DNA. In

a similar manner, the region covering FEZF2

binding motifs (CAGCAACC) (-230~-137) was

examined by q-PCR with primers

(GCAGGCTCCGGTCCTT;

ACAGCAGAGCGCCTGC). A part of 3’UTR of

Brn3b (1507 to 1595) was amplified as a negative

control by primers

(ACCGGAATTGTTTTCTGATAGC;

CTTTCCCTTCGCCCTCTTT).

Data analysis

For all q-PCR and the luciferase assay, data

were presented as mean±SD from three

independent experiments with duplication of

reading. For cell counting from the

immunostaining, mean and standard deviation

were calculated from 12 sections based on 3-4

samples (eyes). Control and the experimental

group were compared by Independent-Samples T

Test using SPSS 17.0 software (SPSS Inc, USA).

* designates a statistic difference with *p


6

compared with the control at E17.5 (Fig 3C).

Knocking out Fezf2 attenuated Brn3b mRNA

levels (Fig 3C) and reduced BRN3B protein in the

isolated retina (Fig 3D). The number of BRN3B+

cells was reduced in the retinal sections from the

knockout mice (Fig 3E). The wild-type retina had

42.6 ± 3.0 BRN3B+ cells (per field, 40x) in the

GCL, which decreased to 23.8 ± 2.1 when Fezf2

was deleted (Fig 3F). We also noticed an almost

complete reduction of BRN3B+ cells in the NBL

(Fig 3E and 3F). A few of BRN3B+ cells

scattered in NBL of the wild-type mice represent

the newly generated ganglion cells en route to the

GCL.

Previous studies have established that Brn3b

is required for preventing nascent RGCs from

apoptotic cell death during retinal development

(5,26). Therefore, we investigated apoptotic cells

in control and Fezf2-null retinas by the activation

of CASPASE III. The cells with activated

CASPASE III were found in the GCL of Fezf2-/-

retina (Fig 3E). Fezf2-deleted retina had a 2.5-fold

more of CASPASE III+ cells than did the wild-

type at E17.5 (Fig 3G) when maximum apoptosis

occurs in the Brn3b-knockout mice (5). The

number of apoptotic cells in the Fezf2 knockout

retina is comparable with that in the Brn3b-deleted

retina at E17.5 (5). The increase in apoptosis in

the Fezf2-/- retina suggests that Fezf2 is needed for

the proper function of Brn3b in the developing

retina.

The reduction of RGC marker BRN3B was

similarly observed in the P7 retina. In Fezf2-null

retinas, BRN3B+ cells were reduced to about 47.3%

of those in wild-type littermates (Fig 4A and 4B).

As an alternative approach to determining the cell

types that reduced in Fezf2 (-/-) retinas, we

immunostained retinas with anti-SMI-32, which

predominantly labels the axons of RGCs (6). As

shown in Fig 4C, Fezf2(-/-) retinas had a

decreased population of SMI-32 immunoreactive

processes, suggesting a loss of RGC axons.

Consistently, the optic nerve appeared thinner in

the Fezf2-deleted retina as compared with the

control (Fig 4D). In addition, we noticed that

axons from Fezf2 knockout RGCs occasionally

bifurcated within the retina (Fig 4C), reminiscence

of aberrant axonal trajectories as seen in the Brn3b

knockout retina (27). All these results support that

the transient expression of Fezf2 is essential for

the proper expression of Brn3b and formation of

RGCs.

3. Fezf2 knockdown inhibits BRN3B

expression

Fezf2 knockout reduced BRN3B+ RGCs in

the retina, either as direct effects of inhibition of

Brn3b expression or as effects of developmental

changes leading to loss of BRN3B+ RGCs

indirectly. To determine whether the loss of

BRN3B+ RGCs was caused by a cell autonomous

or a non-cell autonomous mechanism, we knocked

down Fezf2 in a small population of retinal cells

within the context of a healthy environment by

retinal in utero electroporation (IUE). Fezf2 in the

developing retina was knocked down with

lentiviral shRNA that specifically inhibit Fezf2

expression by RNA interference (18). Plasmid

pLVTH-Fezf2-siRNA-1 that harbors a reporter

gene Gfp was delivered into the eyecups of E13.5

embryos by IUE. The consequences of Fezf2

inhibition were examined in the transfected retinas

at E17.5, one day after the maximal expression of

endogenous Fezf2 (Fig 1 and 2). The cells

expressing the siRNA moved to the GCL normally

as those expressing pLVTH-Fezf2-scRNA-1, a

scramble RNA that does not target to any

sequences. This result suggests that the inhibition

of Fezf2 does not interfere with the normal

migration of RGCs. We analyzed the expression

of marker genes, MATH5, ISLET1, BRN3B in the

transfected cells by IF. Substantial populations of

scramble RNA-electroporated cells expressed

MATH5, ISLET1, and BRN3B as measured by

their colocalization with the co-transfected GFP

(Fig 5A). MATH5 and ISLET1 were expressed

similarly in the Fezf2-siRNA-transfected cells as

in the scramble transfectants (MATH5 siRNA

24.8%, scRNA23.2%; ISLET1 siRNA 23.8%,

scRNA21.4%). In contrast, compared to the

scrambled control, introducing Fezf2-siRNA-1

resulted in a massive reduction of BRN3B-positive

cells (siRNA 1.1%, scRNA17.2%) (Fig 5B).

Likewise, Fezf2-siRNA-2, but not the

correspondent scramble control, diminished the

BRN3B+ cells in the developing retina (data not

shown). The similar effect introduced by two

siRNAs that target to different locations in the

FEZF2 supports that the inhibition of BRN3B was

attributed to the knockdown of FEZF2 specifically.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

Fezf2 inhibition abolished BRN3B+ cells, but not

ISLET1 that coexpresses with BRN3B,

demonstrating that Fezf2 is essential for the

expression of Brn3b, rather than controls the

survival of BRN3B + RGCs directly.

In mature retinas, BRN3A and BRN3B are

each expressed in approximate 70% RGCs in an

overlapping pattern. Since Brn3a was considered

as a downstream target of Brn3b (28), we

evaluated the expression of BRN3A in the cells

knocking down with Fezf2-siRNA-2. Fezf2

inhibition did not change significantly the ratio of

colocalization of BRN3A+ and the transfectants

(Fig 5D and 5E), indicating that Fezf2 inhibition

had no effect on the expression of BRN3A. Our

result is consistent with the previous study with a

knock-in alkaline phosphatase to visualize

individual genetically altered RGCs. It was found

that Brn3b is not required for the maintenance of

Brn3a expression in the RGCs. The loss of Brn3a

in Brn3b-null retinas is more likely due to an

overall reduction of the BRN3A+ RGC number

rather than the inhibition of Brn3a expression (27).

Since FEZF2 is a transcription factor, we

envisioned that the transcription and mRNA level

of Brn3b may be subject to the regulation by

FEZF2. To test this, we inhibited the Fezf2

expression by electroporating pLVTH-Fezf2-

siRNA-1 and pLVTH-Fezf2-scRNA-1 plasmids

into the eyecups of E13.5 embryos. The

electroporated cells were dissociated from the

retinas at E17.5 and isolated by FACS on the basis

of expression of the reporter GFP. Assays with q-

PCR revealed that Fezf2-siRNA-expressing cells

had a decreased level of Brn3b mRNA relative to

those expressing the scramble control, following

the inhibited expression of Fezf2 by the

interference RNA (Fig 5C). This data suggests that

Brn3b depends on the transient expression of

Fezf2 during the retinal development.

To determine if FEZF2 is a determinant of

Brn3b expression in vivo, we also performed a

gain of functional study by in utero

electroporation of Fezf2-pCAGEN into the

developing retina. Expression of Fezf2 under a

CAG promoter resulted in overall inhibitions of

RGC-related genes including Math5, Islet1 and

Brn3b (Fig 6). A strong ectopic expression of this

transcription factor may alter the phenotype of

host cells dramatically. It was found that striatal

progenitors change their fate from medium spiny

neurons to cortical-like projection neurons after

ectopic expression of Fezf2 (29). The intrinsic

transient expression, but not a high and sustained

expression of Fezf2, is essential for RGC

development in the retina.

4. FEZF2 binds to and activates a 5’-

regulatory region of Brn3b

Since both knockout and knockdown of Fezf2

decreased Brn3b mRNA in retinas (Fig 3C and

4C), Fezf2 may regulate Brn3b at the transcription

level. FEZF2 acted as a histone deacetylase-

associated repressor down-regulating multiple

oncogenes through direct binding to their

promoters (30). In zebrafish, FEZF2 binds to a

core consensus-binding site (CAGCAACC), by

which the transcription factor drives a forebrain

enhancer activity of reporter genes both in vitro

and in vivo (31). Four contiguous FEZF2 binding

motifs are located at -274, -195, +21, +211 of the

transcriptional starting site of Brn3b locus (Fig

7A). We cloned this tentative regulatory region

containing the Fezf2-binding motifs into pGL4.18,

a luciferase reporter vector for measuring

promoter activity. The pGL4.18-Brn3b-promoter

was stably expressed in Neuroblastoma N2a cells,

which then were transiently transfected with

Fezf2-pCAGEN and pCAGEN, or pLVTH-Fezf2-

siRNA-1 and pLVTH-Fezf2-scRNA-1. The

relative luciferase activity of Fezf2-transfected

cells was 2.1-fold higher than that of control.

Conversely, the activity of Fezf2-siRNA-

transfected group was decreased by 51.6% as

compared to those of the scrambled control (Fig

7B). The results indicate that this regulatory

sequence near the five prime untranslated region

(5’UTR) is positively regulated by FEZF2 and

constitutes a part of Brn3b promoter.

To investigate whether the increased

transcriptional activity mediated by the Brn3b-

promoter resulted from FEZF2 binding, we

generated V5-tagged GFP and Fezf2 expression

constructs and expressed the fusion proteins into

the N2a cells. The DNA fragments bound to

FEZF2 were isolated by chromatin


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

immunoprecipitation (ChIP) with a V5 antibody

and analyzed by q-PCR and gel electrophoresis

following PCR. The region by which FEZF2

activated the reporter activity was successfully

amplified by PCR using the ChIP DNA as a

template (Fig 7C). Consistently, the predicted

binding fragment of FEZF2 was enriched by 3.7-

fold when compared to the 3’UTR as assayed by

q-PCR (Fig 7D). In contrast, V5 antibody failed

to pull-down the Brn3b promoter region from the

cells expressing V5-GFP (Fig 7C). The data

suggest that FEZF2 binds to a promoter region that

contains FEZF2 consensus-binding sites and helps

to drive the transcription of Brn3b.

Discussion:

Retinal neurons start to generate from

neuroepithelial cells in the optic cup during the

middle gestation. Newly generated neurons exit

the cell cycle and migrate toward the inner (vitreal)

side of the optic cup. By E13.5, the retina begins

to transform from a uniform sheet of

neuroepithelial cells into two layers of prospective

GCL and NBL. The present study examined the

expression and function of FEZF2, a key

transcription factor regulating the cortical

projection neurons, in the developing retina. We

found that a peak of transient expression of Fezf2

mRNA occurs at E16.5 in the NBL where the

retinal progenitors are located (Fig 1).

Interestingly, FEZF2 protein was found in the

GCL and colocalized with the RGC marker

BRN3B (Fig 2). The transient expression of Fezf2

in the migrating retinal cells may allow its protein

to accumulate in the post-migratory neurons in

GCL. The pattern of Fezf2 expression is spatially

analog to that of Math5. A knock-in lacZ at Math5

locus appeared in the retina including GCL (2),

despite that Math5 mRNA was expressed in the

NBL at E15.5 (11). The expression of Fezf2 at

E16.5 supports it as a later regulator of Brn3b;

Fezf2 may not regulate the peak formation (E11.5-

14.5) but help the survival of RGC around E17.5

when the maximal apoptosis occurs (5).

The roles of Fezf2 in the developing retina

were examined by the studies of loss of function.

We found that Fezf2 knockout retina had a reduced

BRN3B+ RGCs (Fig 3 and 4). To determine if this

reduction is an effect of inhibition of Brn3b

expression, or developmental changes leading to

the loss of BRN3B+ RGCs, we knocked down

Fezf2 in a small population of retinal cells with

RNA interference by in utero electroporation (18).

The results supported that the knockdown of Fezf2

repressed BRN3B cell-autonomously. The

inhibition of BRN3B was not accompanied by any

loss of ISLET1 and BRN3A, two RGC markers

that largely overlap with the expression of BRN3B

(Fig 5). This observation indicates that reduction

of BRN3B is the cause, not the result, of the

decrease in BRN3B+ RGCs in the knockout retina.

The BRN3B deficit increased the apoptosis of

RGCs and reduced the optic nerve fibers (Fig 3

and 4), as expected for its function in the

maintenance and survival of RGCs (5,6).

Our data revealed that Fezf2 was essential for

the proper expression of BRN3B while it had no

effects on BRN3A (Fig 5D and 5E), a closely

related protein in the family of class IV POU-

domain transcription factor, indicating a specific

action of Fezf2 on Brn3b. A recent study found

that the high-mobility-group domain-containing

transcription factors SOX4 / SOX11 express in the

developing mouse retina and function redundantly

to regulate the generation and survival of RGCs

(32). SOX4 and SOX11 transactivate Fezf2 by

competing with the specific repressor SOX5 in the

cerebral cortex (33). It is not clear whether SOX4

and SOX11 participate in the transient activation

of Fezf2 in the retina. However, our results are

consistent with the observation that targeted

disruption of SOX4 or SOX11, positive regulators

of Fezf2 (33), caused a reduction of RGCs in

retinas (32).

The mechanisms responsible for the FEZF2

regulation of Brn3b were explored in the present

study. A 5’-regulatory region of Brn3b containing

putative FEZF2 binding motif was enriched in the

DNA-protein complex in the N2a cells expressing

V5-FEZF2, but not those expressing V5-GFP (Fig

7). This observation suggests that FEZF2 may

bind to a tentative promoter of Brn3b. In vitro

assay found that FEZF2 activated a reporter

construct carrying the 5'-regulatory part of Brn3b.

The result indicates that FEZF2 enhances the

transcription of Brn3b by binding to the genomic

locus of Brn3b. Notably, the Wilms’ tumor gene Wt1, which encodes a zinc-finger transcription factor,

also activates the transcription from 5’ regulatory

sequence of Brn3b (34). The 5’ sequence including


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

5’UTR may contain positive control elements

driving the transcription of Brn3b. Mouse embryos with targeted disruption of Wt1 exhibit thinner

retinas and enhanced apoptotic cell death of RGCs

(34). This is in parallel to our observation that

Fezf2-null retinas had increased apoptosis and

reduced optic nerve (Fig 3 and 4). Future studies are

needed to determine whether Fezf2 knockout leads to

a visual deficiency in the mice.

Although a transient expression of Fezf2 is

required for Brn3b, the sustained expression

completely blocked BRN3B (Fig 6). The underlying

mechanisms responsible for the inhibition of Brn3b

are not clear. It remains to be excluded that the

genomic locus of Brn3b may harbor unknown regions mediating the inhibition by FEZF2. On the

other hand, the sustained expression of Fezf2 blocked MATH5 in addition to BRN3B and ISLET1

(Fig 6). We speculate that the Fezf2 could function

as a repressor of Math5, and thereafter, inhibit its

downstream targets. It is known that a targeted

deletion of Math5 abolishes the retinal expression of

Brn3b (2), despite that Fezf2 expresses transiently in the developing retina. Therefore, if Math5 were depressed by a sustained Fezf2, Brn3b would be

blocked. With the inhibition of Math5, the phenotype of retinal cells may be altered by the

ectopic expression of Fezf2, a fate-determining gene

of dorsal telencephalic progenitors and the cortical

projection neurons (17, 29).

In conclusion, we have determined the

expression and function of Fezf2 in the developing

retina. The transient expression of Fezf2 is

essential for the development and survival of

BRN3B+ RGCs by regulating the transcription of

Brn3b. This study provides novel insights into the

molecular mechanisms underlying the RGC and

retinal development.

Acknowledgements

The authors thank Yasuhide Furuta at RIKEN Center for Developmental Biology in Japan for granting the

permission for using the Tg(Six3-cre)69Frty mouse, and Nenad Sestan at Yale University for providing

Fezf2 floxed mouse and reagents. We would also like to thank former students in the lab, Huaping Tao,

Yuee Zhao, Huateng Cao and Yong Li, who helped with the experiments during this study. The work was

supported by Natural Science Foundation of China (grants: #31500850 to C Qu and #81571096 to JG

Chen) and Zhejiang Provincial Natural Science Foundation of China (Grant NO. LQ16H120001 to C

Qu).

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.

Author contributions

JGC designed the research; CQ, DB, JX and CW performed the research; CQ, DB, XL, JX, YL and TJ

analyzed data; JGC and XL wrote the paper; XZ and JQ contributed reagents/materials.

References

1. Yang, Z., Ding, K., Pan, L., Deng, M., and Gan, L. (2003) Math5 determines the competence

state of retinal ganglion cell progenitors. Developmental biology 264, 240-254

2. Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson, R. L., Klein, W. H., and Gan, L.

(2001) Requirement for math5 in the development of retinal ganglion cells. Genes Dev 15, 24-29

3. Hutcheson, D. A., and Vetter, M. L. (2001) The bHLH factors Xath5 and XNeuroD can

upregulate the expression of XBrn3d, a POU-homeodomain transcription factor. Developmental

biology 232, 327-338

4. Liu, W., Mo, Z., and Xiang, M. (2001) The Ath5 proneural genes function upstream of Brn3 POU

domain transcription factor genes to promote retinal ganglion cell development. Proceedings of


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

the National Academy of Sciences of the United States of America 98, 1649-1654

5. Gan, L., Wang, S. W., Huang, Z., and Klein, W. H. (1999) POU domain factor Brn-3b is essential

for retinal ganglion cell differentiation and survival but not for initial cell fate specification.

Developmental biology 210, 469-480

6. Gan, L., Xiang, M., Zhou, L., Wagner, D. S., Klein, W. H., and Nathans, J. (1996) POU domain

factor Brn-3b is required for the development of a large set of retinal ganglion cells. Proceedings

of the National Academy of Sciences of the United States of America 93, 3920-3925

7. Qiu, F., Jiang, H., and Xiang, M. (2008) A comprehensive negative regulatory program

controlled by Brn3b to ensure ganglion cell specification from multipotential retinal precursors.

The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 3392-3403

8. Mu, X., Fu, X., Beremand, P. D., Thomas, T. L., and Klein, W. H. (2008) Gene regulation logic

in retinal ganglion cell development: Isl1 defines a critical branch distinct from but overlapping

with Pou4f2. Proceedings of the National Academy of Sciences of the United States of America

105, 6942-6947

9. Pan, L., Deng, M., Xie, X., and Gan, L. (2008) ISL1 and BRN3B co-regulate the differentiation

of murine retinal ganglion cells. Development 135, 1981-1990

10. Elshatory, Y., Deng, M., Xie, X., and Gan, L. (2007) Expression of the LIM-homeodomain

protein Isl1 in the developing and mature mouse retina. The Journal of comparative neurology

503, 182-197

11. Brown, N. L., Patel, S., Brzezinski, J., and Glaser, T. (2001) Math5 is required for retinal

ganglion cell and optic nerve formation. Development 128, 2497-2508

12. Feng, L., Xie, Z. H., Ding, Q., Xie, X., Libby, R. T., and Gan, L. (2010) MATH5 controls the

acquisition of multiple retinal cell fates. Molecular brain 3, 36

13. Brown, N. L., Kanekar, S., Vetter, M. L., Tucker, P. K., Gemza, D. L., and Glaser, T. (1998)

Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages

of retinal neurogenesis. Development 125, 4821-4833

14. Brzezinski, J. A. t., Prasov, L., and Glaser, T. (2012) Math5 defines the ganglion cell competence

state in a subpopulation of retinal progenitor cells exiting the cell cycle. Developmental biology

365, 395-413

15. Shimizu, T., Nakazawa, M., Kani, S., Bae, Y. K., Kageyama, R., and Hibi, M. (2010) Zinc finger

genes Fezf1 and Fezf2 control neuronal differentiation by repressing Hes5 expression in the

forebrain. Development 137, 1875-1885

16. Ohtsuka, T., Sakamoto, M., Guillemot, F., and Kageyama, R. (2001) Roles of the basic helix-

loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. The

Journal of biological chemistry 276, 30467-30474

17. Wang, Z. B., Boisvert, E., Zhang, X., Guo, M., Fashoyin, A., Du, Z. W., Zhang, S. C., and Li, X.

J. (2011) Fezf2 regulates telencephalic precursor differentiation from mouse embryonic stem cells.

Cerebral cortex 21, 2177-2186

18. Chen, J. G., Rasin, M. R., Kwan, K. Y., and Sestan, N. (2005) Zfp312 is required for subcortical

axonal projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral

cortex. Proceedings of the National Academy of Sciences of the United States of America 102,

17792-17797

19. Chen, B., Schaevitz, L. R., and McConnell, S. K. (2005) Fezl regulates the differentiation and

axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proceedings of the

National Academy of Sciences of the United States of America 102, 17184-17189

20. Molyneaux, B. J., Arlotta, P., Hirata, T., Hibi, M., and Macklis, J. D. (2005) Fezl is required for

the birth and specification of corticospinal motor neurons. Neuron 47, 817-831

21. Han, W., Kwan, K. Y., Shim, S., Lam, M. M., Shin, Y., Xu, X., Zhu, Y., Li, M., and Sestan, N.

(2011) TBR1 directly represses Fezf2 to control the laminar origin and development of the

corticospinal tract. Proceedings of the National Academy of Sciences of the United States of

America 108, 3041-3046


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

22. Furuta, Y., Lagutin, O., Hogan, B. L., and Oliver, G. C. (2000) Retina- and ventral forebrain-

specific Cre recombinase activity in transgenic mice. Genesis 26, 130-132

23. Garcia-Frigola, C., Carreres, M. I., Vegar, C., and Herrera, E. (2007) Gene delivery into mouse

retinal ganglion cells by in utero electroporation. BMC Dev Biol 7, 103

24. Ohsawa, R., and Kageyama, R. (2008) Regulation of retinal cell fate specification by multiple

transcription factors. Brain research 1192, 90-98

25. Farah, M. H. (2006) Neurogenesis and cell death in the ganglion cell layer of vertebrate retina.

Brain Res Rev 52, 264-274

26. Farah, M. H., and Easter, S. S., Jr. (2005) Cell birth and death in the mouse retinal ganglion cell

layer. The Journal of comparative neurology 489, 120-134

27. Badea, T. C., Cahill, H., Ecker, J., Hattar, S., and Nathans, J. (2009) Distinct roles of transcription

factors brn3a and brn3b in controlling the development, morphology, and function of retinal

ganglion cells. Neuron 61, 852-864

28. Mu, X., Fu, X., Sun, H., Beremand, P. D., Thomas, T. L., and Klein, W. H. (2005) A gene

network downstream of transcription factor Math5 regulates retinal progenitor cell competence

and ganglion cell fate. Developmental biology 280, 467-481

29. Rouaux, C., and Arlotta, P. (2010) Fezf2 directs the differentiation of corticofugal neurons from

striatal progenitors in vivo. Nature neuroscience 13, 1345-1347

30. Shu, X. S., Li, L., Ji, M., Cheng, Y., Ying, J., Fan, Y., Zhong, L., Liu, X., Tsao, S. W., Chan, A.

T., and Tao, Q. (2013) FEZF2, a novel 3p14 tumor suppressor gene, represses oncogene EZH2

and MDM2 expression and is frequently methylated in nasopharyngeal carcinoma.

Carcinogenesis 34, 1984-1993

31. Chen, L., Zheng, J., Yang, N., Li, H., and Guo, S. (2011) Genomic selection identifies vertebrate

transcription factor Fezf2 binding sites and target genes. The Journal of biological chemistry 286,

18641-18649

32. Jiang, Y., Ding, Q., Xie, X., Libby, R. T., Lefebvre, V., and Gan, L. (2013) Transcription factors

SOX4 and SOX11 function redundantly to regulate the development of mouse retinal ganglion

cells. The Journal of biological chemistry 288, 18429-18438

33. Shim, S., Kwan, K. Y., Li, M., Lefebvre, V., and Sestan, N. (2012) Cis-regulatory control of

corticospinal system development and evolution. Nature 486, 74-79

34. Wagner, K. D., Wagner, N., Vidal, V. P., Schley, G., Wilhelm, D., Schedl, A., Englert, C., and

Scholz, H. (2002) The Wilms' tumor gene Wt1 is required for normal development of the retina.

The EMBO journal 21, 1398-1405

Figure legends

Figure 1, Expression of Fezf2 in the developing retina. (A), Sections of mouse retinas at the

designated developmental stages were processed for Fezf2 ISH. Fezf2 was transiently expressed in the

retinas with maximal expression occurring at E16.5. (B), Fezf2 was expressed in the inner NBL at E16.5.

(C), Coronal section of the E16.5 brain showing expression of Fezf2 in the cortex (arrow) and the retina

(arrowheads). All bars, 200 μm.

Figure 2, Expression of FEZF2 in the developing retina. (A), FEZF2 expressions were determined in

the retinal sections by IF at the indicated developmental stages. FEZF2 was expressed in prospective

GCL of the retina at E16.5. (B), FEZF2 expression colocalized with BRN3B. Bar of the figure, 200μm.

Bar in the insert: 50μm.

Figure 3, Targeted disruption of Fezf2 leads to a reduction of BRN3B+ RGCs and an increase in

apoptosis. (A), The Fezf2 second exon harbors two loxp sites flanking the second exon. P1, P2, and P3

are the three genotyping primers located in the exon 1-3 of Fezf2 locus. (B), Gel electrophoresis of the

PCR products from the genotyping. The presence of first loxp site and the absence of exon 2 were


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12

determined by PCR with the primer sets of P1-P2 and P1-P3, respectively. Expression of Cre was also

confirmed in the knockout mice by PCR (data not shown). (C), E17.5 retinas were isolated from wild-

type and Fezf2-null mice, and the relative expressions of Brn3b and Fezf2 were measured by q-PCR. The

knockout mice had a diminished expression of Fezf2 and Brn3b. (D), The expression of BRN3B and

FEZF2 were measured in the isolated retinas from control and Fezf2-null retinas by Western blots with α-

tubulin as an internal control. (E), Immunostaining of BRN3B and activated CASPASE III at E17.5 in

control and Fezf2 knockout retinas. Knocking out Fezf2 reduced BRN3B+ cells and increased apoptotic

cells. Bar of the figures in IF of BRN3B: 200μm and 50 μm for low and high magnitude, respectively.

Bar of the figure in CASPASE III: 50 μm. (F), Histogram showed the numbers of BRN3B+ in GCL and

NBL per field (40x). (G), A total of CASPASE III+ cells per section in control and Fezf2-null retinas.

Figure 4, Reduced BRN3B+ cells and axons in Fezf2-/- mice at P7. (A), Whole mount retinas from

wild-type and Fezf2-/- mice at P7 were examined for the expression of BRN3B. Inserts were enlarged

images at 40x. Bar of the figure: 5000μm. Bar in the insert: 30μm. (B), A histogram shows that the

number of BRN3B+ cells per field (40x) was significantly reduced in the knockout mice. (C), SMI32

staining in the whole mount of retinas from wild-type and Fezf2-/- mice at P7. The knockout retina had

weakened axonal processes as compared to the wild-type. The arrow in the Fezf2-/- retinal section points

to an aberrant axon bifurcation. Bar of the figure: 30μm. (D), The eyes with attached optic nerves were

dissected out. The optic nerve in the Fezf2-/- mice was thinner than the wild-type. The image was a

representative from 4 samples (eyes).

Figure 5, Inhibition of BRN3B expression by Fezf2-siRNA. (A), Fezf2-scRNA-1 or Fezf2-siRNA-1

was delivered to one eyecup of E13.5 embryos (Green). Retinal sections were examined for the

expression of MATH5, ISLET1 and BRN3B (Red) at E17.5. Similar to those expressing Fezf2-scRNA-1,

Fezf2-siRNA-1 transfected cells was partially colocalized with MATH5 and ISLET1 (arrowheads). In

contrast, the retinal cells expressing Fezf2-siRNA were mostly BRN3B-negative. (B), Histogram showed

the percentages of colocalization in the Fezf2-siRNA-1 and Fezf2-scRNA-1-transfected cells. (C), Single

cell suspensions prepared at E17.5 from the transfected retinas were sorted by FACS. The relative

expression of Brn3b and Fezf2 was measured in GFP+ cells by q-PCR. (D), Fezf2-scRNA-2 or Fezf2-

siRNA-2 was delivered to eyecups of E13.5 embryos (Green). Retinal sections were examined for the

expression of BRN3A (Red) at E17.5. Arrowheads indicate colocalizations of BRN3A and the transfected

GFP. (E), No significant difference in the percentage of colocalization between the scramble and the

siRNA-transfected cells. Bar of the figure, 200μm. Bar in the insert: 20μm.

Figure 6, Over-expression of Fezf2 alters phenotype of the retinal cells. (A), The retinas transfected

with pCAGEN and Fezf2-pCAGEN were examined at E17.5 with IF. The colocalization of MATH5,

ISLET1 and BRN3B (Red) with GFP were determined by IF. (B), Histogram showed the percentages of

colocalization in pCAGEN and Fezf2-pCAGEN groups. Over-expression of Fezf2 abolished the

expression of MATH5, ISLET1 and BRN3B. Bar of the figure, 200μm. Bar in the insert: 20μm.

Figure 7, FEZF2 binds to 5’ regulatory sequence in Brn3b. (A), Schematic diagram of the genomic

structure of Brn3b. A tentative promoter including the 5’UTR of Brn3b contains predicted FEZF2

binding motifs (yellow bar). (B), Relative luciferase activities measured in the lysates of N2a cells. N2a

cells stably expressing pGL4.18-Brn3b-promoter were assayed for the luciferase activities after transient

expression of the indicated constructs for two days. Fezf2-pCAGEN increased whereas Fezf2-siRNA

decreased the luciferase activities. (C)-(D), ChIP with an anti-V5 antibody precipitated FEZF2-bound

DNA from the N2a cells expressing V5-tagged FEZF2, but not those expressing V5-GFP. The DNA was

analyzed by gel electrophoresis (C) of the PCR products for the presence of the tentative promoter and

measured by q-PCR (D) for the enrichment of the binding sequence. The input of ChIP and the pull-

down without V5 antibody were taken as a positive and a negative control of the PCR, respectively. The

control sequence for the q-PCR in Fig 7D is a region in the 3’UTR of Brn3b locus.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

Figure 1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

Figure 2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


15

Figure 3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


16

Figure 4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


17

Figure 5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


18

Figure 6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


19

Figure 7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Xiangtian Zhou, Jia Qu and Jie-Guang ChenChunsheng Qu, Dandan Bian, Xue Li, Jian Xiao, Chunping Wu, Yue Li, Tian Jiang,

Retinal Ganglion CellsTransient Expression of Fez Family Zinc Finger 2 Regulates Brn3b in Developing

published online February 9, 2016J. Biol. Chem.

10.1074/jbc.M115.689448Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from
http://www.jbc.org/lookup/doi/10.1074/jbc.M115.689448http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M115.689448v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2016/02/09/jbc.M115.689448http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2016/02/09/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2016/02/09/jbc.M115.689448http://www.jbc.org/cgi/alerts/etochttp://www.jbc.org/

Documents

Fezf2 regulates Brn3b in developing retinaTranscription Regulation; Neurodevelopment; Mouse . Abstract. generation in the mouse retina, we analyzed the Retinal ganglion cells (RGCs)