Effects of fluoride on metamorphosis, thyroid and skeletaldevelopment in Bufo gargarizans tadpoles

Hongfeng Zhao • Lihong Chai • Hongyuan Wang

Accepted: 22 June 2013 / Published online: 10 August 2013

� Springer Science+Business Media New York 2013

Abstract This study examined the effects of chronic

fluoride exposure on metamorphosis, thyroid and skeletal

development in tadpoles of Chinese Toad, Bufo gargariz-

ans. The tadpoles were exposed to fluoride concentrations

either at 0, 1, 5, 10, or at 50 mg L-1 from Gosner stage 26 to

Gosner stage 42. Body weight, total length and percentage

of tadpoles reaching metamorphosis climax were recorded,

and thyroid histological examinations were employed. In

addition, mRNA expression of both deiodinase type 2 (D2)

and deiodinase type 3 (D3) was analyzed by using RT-PCR

and skeletal systems were investigated by using double-

staining methodology at stage 42. Results showed that total

length and body weight were unaffected by fluoride expo-

sure at all concentrations while metamorphosis was strongly

inhibited only by 50 mg L-1 fluoride. Histomorphological

measurements showed the percentage of colloid depletion

in thyroid gland increased significantly, while the average

diameter of follicles was significantly shorter at 50 mg L-1

concentration. In addition, fluoride at 5 mg L-1 can stim-

ulate bone mineralization, while fluoride at 50 mg L-1 can

retard deposition of calcium. In conclusion, our study sug-

gests that 50 mg L-1 fluoride could damage follicular cells

in thyroid gland and induce a sharp reduction in thyroid

hormone probably through the up-regulation of D3 mRNA

expression, and these influences on thyroid system may

delay metamorphosis as well as ossification in bone tissue

by inhibiting calcium deposition.

Keywords Metamorphosis � Fluoride � Thyroid �Skeletal development � Bufo gargarizans

Introduction

Fluoride is widely distributed in nature in many forms

except its free form and exists only in combination with

other elements as fluoride compounds (Camargo 2003;

Mittal and Flora 2006). The primary sources of fluoride

intake include natural fluoride in foodstuffs and fluoridated

water, fluoride dentifrices, industrial dust and smokes

(Shulman and Wells 1997). However, concentrations of

fluoride in environment have increased dramatically due to

human activities in recent years. For example, phosphate

fertilizers, semiconductor manufacturing, glass and brick-

making industries, and coal power plants can raise fluoride

level of surface water more than 100 times (Camargo 2003;

Weinstein and Davison 2004). Therefore, fluoride pollution

in surface water has received much attention as fluoride

may be harmful to aquatic animals (Barbier et al. 2010).

Aquatic animals such as fish can take up fluoride

directly from water or to a much lesser extent via food.

Subsequently, fluoride tends to be accumulated mainly in

bone and cartilage (Camargo 2003; Shi et al. 2009).

Fluoride in suitable doses can inhibit dental caries and is

beneficial to skeletal development. However, excessive

fluorine intake may cause skeletal fluorosis, which is

characterized by dental mottling and skeletal manifesta-

tions such as crippling deformities, osteoporosis, and

osteosclerosis (Yan et al. 2010). Moreover, many investi-

gations have demonstrated that fluoride also had effects on

bone mineralization, bone cells and bone architecture

(Mousny et al. 2008; Brun et al. 2010).

H. Zhao � H. Wang (&)

College of Life Sciences, Shaanxi Normal University,

Xi’an 710062, People’s Republic of China

e-mail: hongyuanwang@snnu.edu.cn

L. Chai

College of Environmental Science and Engineering,

Chang’an University, Xi’an 710054, People’s Republic of China

123

Ecotoxicology (2013) 22:1123–1132

DOI 10.1007/s10646-013-1099-0

Amphibian metamorphosis is a morphological and

physiological transformation, which is regulated by thyroid

hormone (TH). TH includes thyroxine (T4) and 3,5,30-tri-iodothyronine (T3). The main bioactive form of TH is T3,

which facilitates metamorphosis by regulating a cascade of

genes controlling morphogenesis and development (Brown

and Cai 2007; Croteau et al. 2009). T3 concentration is

determined by relative activities of type 2 and 3 iodo-

thyronine deiodinases (D2 and D3). Majority of T3 is

locally derived from the localized metabolism of T4 to T3

catalyzed by D2 in tissues. The expression of D3 allows

tissue-specific regulation of intracellular T3 and T4

through the conversion of T4 to inactive rT3 (reverse T3)

and active T3 to inactive T2 (Kuiper et al. 2006). In

addition, TH is an essential regulatory factor in skeletal

development and plays an important role in maintenance of

bone structure and mineralization (Brown and Cai 2007).

So far numerous studies regarding the mechanisms of

fluoride action have focused on abnormal function of bone

in humans (Shivashankara et al. 2000), adult rats (Wang

et al. 2000), aquatic invertebrates and fishes (Camargo

2003). Previous study suggests that excessive fluoride

intake in amphibians may impair skeletal development, TH

synthesis and delay metamorphosis (Mann et al. 2009).

However, there is a very limited amount of information on

the actual effects of fluoride on thyroid gland and skeletal

development in amphibian metamorphosis.

In this study, we examined the effects of chronic fluo-

ride exposure on metamorphosis of B. gargarizans tadpoles

with various fluoride concentrations at 0, 1, 5, 10, and

50 mg L-1 from Gosner stage 26 to Gosner stage 42.

Morphological examinations were performed on thyroid

gland and skeletal tissue, and mRNA expressions of D2

and D3 were investigated.

Materials and methods

Chemicals and reagents

Sodium fluoride (NaF, molecular weight 41.99) was

obtained from Sigma-Aldrich Corporation (Sigma, St.

Louis, MO). NaF was dissolved in distilled water with stock

concentration at 1,000 mg L-1. And then, these stocking

solutions were diluted with tap water to various experiment

concentrations needed in this research. Dissolved oxygen

and ammonia of tap water were measured by using GDYS-

201 M multi parameter water quality analyzer (Little Swan,

China). PC300 waterproof portable meter (Clean, USA)

was used to monitor water conductance and salinity.

Test species and animal husbandry

Bufo gargarizans lives in most area of China. This species

reproduces in lakes, ponds, swamps, old riverbeds with

semi-flowing water. The larvae mainly live on algae and

detritus.

Five mating pairs were collected in February from Qin-

ling Mountains, Shaanxi Province, China (109�0605200E,

34�0005600N). Each couple was placed in one aquarium with

shallow water (50 mm). After spawning, embryos were

raised in another aquarium with shallow water (50 mm). All

aquaria were kept at 18 ± 1 �C under a 12 h light and 12 h

dark photoperiod.

NaF exposure experiment

When most tadpoles were at Gosner stage 26 (Gosner 1960),

normally developing tadpoles were randomly selected and

transferred into glass aquaria (50 cm 9 20 cm 9 10 cm)

with certain NaF concentration in 4 L dechlorinated tap

water. Tadpoles were fed on boiled vegetables when being

exposed to NaF. Any unconsumed food or feces was

siphoned from the tanks daily to provide optimal conditions

for tadpoles.

The nominal concentrations of NaF used were 1, 5, 10

and 50 mg L-1 respectively. Each treatment was quadru-

plicate, with 30 tadpoles per replicate. In one replicate 5

individuals were randomly selected for thyroid measure-

ment and histological examination at Gosner stage 28, 33

and 38 respectively. For other triple replicate, all of tad-

poles were prepared for monitoring metamorphosis process

(Gosner stage 42). A control group exposed to clean ins-

olated tap water was included in each experiment. Fifty

percent of test solutions volume was replaced daily and

completely exchanged every 2 days to maintain the

appropriate concentration of NaF and water quality.

Metamorphosis in toad normally begins at stage 38,

peaks at stage 42, and completes at stage 46. At the

metamorphic climax (initiation of forelimb emergence),

body weight and total length were recorded once for each

Gosner stage 42 tadpole until half of total number of tad-

poles (45 individuals) in control group developed into stage

G42. Each individual was weighted once on an analytical

balance having readability of nearest 0.001 g. Total lengths

of the tadpoles were measured to the nearest 0.01 mm by

Tesa-Cal Dura-Cal Digital electronic calipers. The number

of tadpoles initiating forelimb emergence (stage 42) was

also recorded daily for each replicate tank to assess the

percentage of individuals reaching metamorphosis climax.

1124 H. Zhao et al.

123

Determination of the skeletal development

In order to examine the skeletal development, we used the

double staining methodology to stain transparent specimen of

larval skeletons. Three tadpoles at Gosner stage 42 from each

aquarium were collected randomly. Both control and fluoride-

treated larvae were anaesthetized by 95 % alcohol, decolorized

with 30 % H2O2 and defatted with acetone. After being evis-

cerated and cleared, each specimen was stained using alcian

blue-alizarin red double staining methods (Taylor and van

Dyke 1985). Bones were stained in red and cartilages in blue.

The osteological terminology follows Duellman and Trueb

(1994). All photographs were taken with Cannon 7D digital

camera attached to a Zeiss Discovery V12 stereoscope.

Gross anatomical observations on thyroid gland

Both control and fluoride-treated larvae were fixed with

4 % paraformaldehyde after NaF exposure. 10 specimen of

each treatment were randomly selected to observe thyroid

glands under a Zeiss Discovery V12 stereoscope equipped

with Cannon 7D digital cameras.

Histological measurements of thyroid gland

The specimen for thyroid anatomical observations were also

used for histological measurements. Control and exposed

larvae were fixed in 4 % paraformaldehyde and embedded in

paraffin after dehydration through an ascending ethanol series

and xylene. Serial longitudinal sections at 6 lm thickness

were collected across the area of noses from lateral to medial,

and stained with hematoxylin and eosin. The stained sections

were examined and photographed under Nikon ECLIPSE 80i

microscope equipped with a computer and imaging system.

We chose the largest thyroid section of the whole body

and selected the colloidal space of each follicle in the

images to analyze the toxic effects including alterations in

diameter of follicles and incidence of colloid depletion.

Reverse transcriptase polymerase chain reaction

(RT-PCR) analysis

Frozen whole larvae at Gosner stage 42 from control and

NaF treatment were used for extracting total RNA using

E.Z.N.A.TM tissue RNA Kit (Omega.). RNA quality of

samples was verified by the ratio of O.D. absorbencies

260/280 nm and RNA quantification was done through UV

spectrophotometry at 260 nm using Nano Drop instrument

(Thermo). Total RNA was transformed into complemen-

tary DNA (cDNA) by reverse transcription using the high

capacity cDNA reverse transcription kit (BioRT Two Step

RT-PCR Kit). PCRs were performed in 25 ll reactions

using 2 ll cDNA solution as template, and 109 PCR

buffer (Mg2?), 100 nM of dNTP mixture, specific primers,

Taq mix DNA polymerase (Takara) and distilled water

were contained in the reactions. PCRs were carried out

with an initial denaturation step at 94 �C for 3 min, fol-

lowed by 30 cycles of 94 �C for 30 s (denaturation), 52 �C

for 30 s (annealing), 72 �C for 1 min (extension), and the

final extension was performed at 72 �C for 10 min.

Sequences of the PCR primers are as follows: D2 primer

(sense: GTCAATTTTGGATCAGCTACC; antisense: CAT

TATTGTCCATGCAGTCAG), D3 primer (sense: CCAAC

ACGGAGGTGGTGAT; antisense: TTGCAGGCGAGCC

ATGAAC) and a-actin primer (sense: ATCTGGCATCAC

ACCTTCTAC; antisense: CTCCTGCTTGCTGATCCAC),

and the product size of D2, D3 and a-actin were 291, 142

and 802 bp respectively.

We analyzed the expression of D2 and D3 mRNA in

tadpoles exposed to different NaF doses and control tad-

poles. PCR products were separated by 1.5 % agarose gel

electrophoresis, stained with ethidium bromide (1 mg L-1)

and gel images were captured by Gel DocTM XR? with

Image LabTM software (BIO-RAD).

Statistical analysis

Differences of body weight and total length of larvae at

metamorphic climax (Gosner stage 42) in various treatments

were tested by one-way ANOVA with Bonferroni multiple

comparison tests. One way ANOVA was also employed to

find the differences of average diameter of follicles and inci-

dence of colloid depletion between each treatment. Analysis

of covariance (ANCOVA) was conducted on percentage of

completion of metamorphosis in various treatments with

monitoring days as covariate. Homogeneity of variances was

assessed using Levene’s test, and Gaussian distributions were

examined using Kolmogorov–Smirnov normality test. Per-

centage data were transformed to arcsine of square root values

before analysis. General linear model was deployed to esti-

mate time (days) of T0.5 in various treatments with T0.5 as the

dependent variable and monitoring days as the independent

variable. ANCOVA was also conducted to test the differences

between slopes with groups of treatments as covariate. Data

were reported as mean ± SEM. All the analyses were con-

ducted with SPSS 16.0. An overall value of 0.05 was used to

assess significant differences.

Results

Effect of NaF on the metamorphosis of Bufo

gargarizans larvae at stage G42

The metamorphosis climax (Gosner stage 42) initiated on

the 62nd day of NaF exposure at control, 1 and 5 mg L-1

Effects of fluoride on metamorphosis 1125

123

concentrations. In comparison, the initiation of metamor-

phosis peak was 2 days delayed (on the 64th day of NaF

exposure) at both 10 and 50 mg L-1 concentrations. By the

end of exposure periods (day 68), nearly 80 % completion

metamorphosis could be found in 5 mg L-1 group, while

only 23 % could be found in 50 mg L-1 group (Fig. 1).

ANCOVA (F4,29 = 25.687, P \ 0.01) also showed that

metamorphosis was significantly faster in 5 mg L-1 group

and significantly slower in 50 mg L-1 group compared

with that of control (Table 1). T0.5 of 5 mg L-1 group was

nearly 2 days shorter, and T0.5 of 50 mg L-1 group was

8 days longer than that of control. However, there are no

significant differences between any 2 treatments of mean

body weight (one-way ANOVA, P [ 0.05). No significant

difference was observed in total body length either (one-

way ANOVA, P [ 0.05) (Table 1).

Effect of sodium fluoride on bone formation

The skeletal systems of tadpoles were demonstrated by using

the double staining in control (Fig. 2a), 5 mg L-1 (Fig. 2b),

10 mg L-1 (Fig. 2c), and 50 mg L-1 concentrations (Fig. 2d).

Parasphenoid and frontoparietal bones were well ossified

indicated by red staining in control specimen (Fig. 2e). In

5 mg L-1 group, greater ossification was observed in the

frontoparietal, parasphenoid and exoccipital bones compared

to control group (Fig. 2f). Ossification of parasphenoid and

frontoparietal bones in 10 mg L-1 group was not different

from that of control (Fig. 2g). In contrast, the chondrocranium

of 50 mg L-1 group remains mostly cartilaginous, suggesting

ossification was not well developed (Fig. 2h).

The vertebral column of tadpoles consists of presacral,

sacral and postsacral regions. In control and 10 mg L-1

group, most of the arches began to ossify, while transverse

process in all of the arches remains cartilaginous indicated by

blue staining (Fig. 2i, k). Both arches and transverse process

were completely ossified with no cartilage remaining in

5 mg L-1 group (Fig. 2j). No obvious ossification was

observed in vertebral column of 50 mg L-1 group (Fig. 2l).

The hindlimb bone was composed of ilium, the femur,

the tibiofibula, the tibiale, the fibulare and the pes. In

control group and 10 mg L-1 group, the ossification center

of ilium, the femur, the tibiofibula, the tibiale, the fibulare

and the pes can be distinctly observed (Fig. 2m, o). Greater

ossification of hindlimb bone was observed in 5 mg L-1

group compared with the control group (Fig. 2n). In con-

trast, only some bones such as ilium and tibiofibula are

ossified in 50 mg L-1 group (Fig. 2p).

Effect of NaF on thyroid gland in larvae

of Bufo gargarizans

As depicted in Fig. 3, the paired thyroid gland situated

ventral to the hyobranchial skeleton, and medial to the

geniohyoideus. In control group, the thyroid gland of tad-

poles at stage G28 was composed of a small strip of cells,

and no follicle was observed (Fig. 3a). The volume of

thyroid gland at stage G33 was greater than that at stage

G28. Moreover, follicles could be found at stage G33

(Fig. 3b). Compared with those at stage G33, follicles at

stage G38 had a remarkable increase in size and number

(Fig. 3c). At stage G42, thyroid gland volume did not differ

from that at stage G38 while the number of follicles

increased considerably (Fig. 3d).

The morphological alterations were confirmed by his-

tological study of thyroid glands at different stages in

various treatments. Figure 4a and b illustrated that thyroid

gland differentiation was incompletely at stage G28 and the

colloid in follicles could not be found. Compared with

control, the size of thyroid glands did not change signifi-

cantly in other treatments (Fig. 4c). However, peripheral

colloid vacuolation and partial colloid depletion occurred

in 50 mg L-1 group at stage G33 (Fig. 4d). Figure 4e

showed regular shaped follicles were lined by a single layer

of tightly arranged follicular epithelial cells in control

group while loosely-arranged irregular follicular epithelial

cells can be observed in 50 mg L-1 group at stage G38

(Fig. 4f). At stage G42, no obvious histological changes

can be found in control (Fig. 4g). However, NaF at 50 mg

L-1 resulted in 2 major histological alterations: one is that

follicular epithelial cell became multilayered and number

of follicles increased, and the other is that partial colloid

depletion and peripheral colloid vacuolation increased in

thyroid glands (Fig. 4h).

Figure 5a showed the variations of incidence of colloid

depletion between control and other treatments. At stage

33, the incidence of depletion was not different between

any two treatments. However, at stage 38, the percentageFig. 1 Time course of metamorphosis (cumulative) in tadpoles

exposed to NaF at control, 1, 5, 10 and 50 mg L-1 concentrations

1126 H. Zhao et al.

123

of colloid depletion increased significantly in 50 mg L-1

group compared with that in control, and the difference

maintained at stage 42. Moreover, the average diameter of

follicles was significantly shorter in 50 mg L-1 fluoride

exposure group than that in control group at stage 38, and

the diameter in 50 mg L-1 group maintained significantly

shorter at stage 42. Meanwhile, the diameter of follicles at

10 mg L-1 concentration was also significantly shorter

than that of control (Fig. 5b).

Effect of NaF on D2 and D3 expression

The relative expression of the mRNA for D2 and D3 in

whole body of tadpole was investigated by RT-PCR

(Fig. 6). Agarose gel electrophoresis showed that single

291, 142 and 802 bp PCR products were amplified for D2,

D3 and a-actin respectively. With visual inspection of the

gel bands, we did not observe any obvious difference in the

relative D2 mRNA expression. In contrast, the relative D3

mRNA expression appears to be up-regulated in 50 mg

L-1 group (Fig. 6).

Discussion

Our results showed that fluoride at concentration of 50 mg

L-1 significantly inhibited metamorphosis and prolonged

T0.5 in larvae of B. gargarizans. These findings are con-

sistent with the inhibitory effects of other chemicals on

amphibians such as fungicide prochloraz, polybrominated

diphenyl ethers and cadimium (Flament et al. 2003; Balch

et al. 2006; Brande-Lavridsen et al. 2010). However,

fluoride at concentration of 5 mg L-1 significantly accel-

erated metamorphosis and shortened T0.5, which indicates

that the inhibitory effect of fluoride on amphibian meta-

morphosis development seems to be dosage dependent.

Surprisingly, body weight and total length in larvae at

metamorphic climax were not significantly affected by

experimental treatments relative to untreated control. As

amphibian metamorphosis is mainly regulated by TH,

inhibition of metamorphosis suggests high dose of fluoride

may disrupt TH homeostasis.

Histopathological changes of thyroid gland can be

induced by various chemicals including methoxychlor

(Fort et al. 2004); ethylenethiourea (ETU) (Opitz et al.

2006), perchlorate (Hu et al. 2006), acetochlor (Helbing

et al. 2006), 4-tert-octylphenol (Croteau et al. 2009) and

decabromodiphenyl ether (DE-83R) (Qin et al. 2010).

Usually, morphological changes in thyroid gland were

characterized by reduced colloid, glandular hypertrophy

and cellular hyperplasia and hypertrophy (Kaori and Keiko

2012). In our study, NaF at 50 mg L-1 gave rise to mul-

tilayer follicular epithelial cells, peripheral colloid vacuo-

lation as well as follicular cell hyperplasia. Moreover,

some follicles showed a remarkable decrease in size in

50 mg L-1 group. As far as we know, it is the first piece of

evidence showing the effect of fluoride on thyroid mor-

phology. Although the mechanism by which fluoride

influences histological structures of thyroid gland remains

unclear, we hypothesize fluoride can produce reactive

oxygen species which often causes morphological changes

in thyroid gland and decrease of TH in the serum.

Thyroid hormone is produced by thyroid gland and is

subsequently transported to peripheral tissues where its

concentration can be modified by the action of type 2 and 3

deiodinases (Huang et al. 2001). D2 seems to play a critical

role in maintaining intracellular T3 (biologically active

form of thyroid hormone) levels in target tissues such as

brain, pituitary and tail. In contrast, D3 is considered as a

major thyroid hormone-inactivating enzyme (Wagner et al.

2003). T3 is essential to complete metamorphosis because

high level of T4 at metamorphosis climax cannot induce

final morphological changes. At the climax of metamor-

phosis in the tail, there is a sharp drop in D3 activity and a

rapid rise in D2 (Wang and Brown 1993; Cai and Brown

2004). A lot of endocrine disrupting chemicals have been

demonstrated to change the expressions of deiodinase

enzymes, such as perchlorate and acetochlor. For example,

Li et al. (2009) demonstrated that exposure to acetochlor

could down-regulate D2 mRNA level in the Gobiocypris

rarus larvae. In addition, Li et al. (2011) reported that the

exposure of Chinese rare minnow larvae to perchlorate

(50 lg L-1) for 21 days resulted in up-regulation of D2

mRNA level and down-regulation of D3 mRNA level. In

Table 1 Estimated time (days) required for 50 % of the larvae (T0.5) to develop from stage G26 to stage G42

Tadpoles at stage G42 Control NaF at 1 mg L-1 NaF at 5 mg L-1 NaF at 10 mg L-1 NaF at 50 mg L-1

Body weight 0.16 ± 0.05 0.17 ± 0.06 0.17 ± 0.05 0.16 ± 0.05 0.15 ± 0.07

Total length 24.76 ± 0.29 25.53 ± 0.30 24.53 ± 0.24 24.36 ± 0.29 24.63 ± 0.36

R2 0.953 0.954 0.967 0.901 0.842

Slope 0.088 0.090 0.140* 0.098 0.040*

T0.5 (days) 67.9 68.3 66.0 67.8 76.3

Estimates are based on regression analysis of the number of larvae at stage G42 and monitoring days. (R2) coefficient of determination, * means

the significant difference on the slope between that concentration and control. T0.5 was calculated based on linear regression analysis

Effects of fluoride on metamorphosis 1127

123

our study, NaF treatment at 50 mg L-1 appears to up-

regulate D3 mRNA expression while has no effect on D2

mRNA expression at metamorphic climax (G42). The

results suggest that high concentration of fluoride may

induce histopathological changes of thyroid gland and in

turn to inhibit T3 level through the up-regulation of D3

gene expression in the larvae.

The normal mineralization of bone mainly involves the

deposition of calcium (Williams et al. 2008). Usually, aliz-

arin red can combine with calcium ions from bone tissues in

Fig. 2 The whole skeleton of larvae of B. gargarizans (G42) are

shown stained for bone (red) and cartilage (blue). a–d The whole

skeleton of larvae of Gosner stage 42. e–h The cranium skeleton of

larvae of Gosner stage 42. i–l The axial skeleton of larvae of Gosner

stage 42. m–p The hindlimb skeleton of larvae of Gosner stage 42.

Scale for a–d, 4 mm; scale for e–h, 1 mm; scale for i–l, 1.5 mm;

scale for m–p, 1 mm (Color figure online)

1128 H. Zhao et al.

123

Fig. 3 Gross morphology of thyroid gland at different development

stages of B. gargarizans larvae in control group. a Thyroid gland of B.

gargarizans larvae at stage G28; b thyroid gland of B. gargarizans

larvae at stage G33; c thyroid gland of B. gargarizans larvae at stage

G38; d thyroid gland of B. gargarizans larvae at stage G42. For gross

morphology, skin and interhyoideus muscle were removed to expose

the thyroid gland. Thyroid gland (arrows) was located on both sides

of urobranchial cartilage. ge geniohyoideus, co copula II. Scale for

a–d, 100 lm

Effects of fluoride on metamorphosis 1129

123

Fig. 4 Histological examinations of thyroid glands at different

development stages of B. gargarizans larvae. a Thyroid gland of B.

gargarizans at stage G28 in control group. b Thyroid gland of B.

gargarizans at stage G28 exposed to 50 mg L-1 NaF. c Thyroid gland

of B. gargarizans at stage G33 in control group. d Thyroid gland of B.

gargarizans at stage G33 exposed to 50 mg L-1 NaF. e Thyroid gland

of B. gargarizans at stage G38 in control group. f Thyroid gland of B.

gargarizans at stage G38 exposed to 50 mg L-1 NaF. g Thyroid gland

of B. gargarizans at stage G42 in control group. h Thyroid gland of B.

gargarizans at stage G42 exposed to 50 mg L-1 NaF. Scale for a–h,

50 lm

1130 H. Zhao et al.

123

a chelation process. Therefore, alizarin red staining could be

used for detecting calcium ions deposits and ossification in

bone (Kerney et al. 2010). Fluoride has been shown to have

an effect on bone mineralization, bone cells and bone

architecture. With this double-staining technique, we found

that ossification of skeleton system was influenced by fluo-

ride treatment. Interestingly, the effect is dose dependent.

Low doses of fluorine (5 mg L-1) stimulated bone miner-

alization, while high dosage of fluoride (50 mg L-1) retar-

ded deposition of calcium. This is the first study to our

knowledge to test fluoride exposure on skeletal systems in

anuran tadpoles. Considering that the skeletal ossification is

under the regulation of TH (Ahmed et al. 2008; Kerney et al.

2010), we hypothesize that fluoride may affect skeletal

ossification through disrupting the thyroid system. In Sibe-

rian sturgeon, Acipenser baerii, fluoride ion has been shown

to accumulate in bone and cartilage tissue and suggested to

affect growth (Shi et al. 2009). Fluoride may also affect

skeletal ossification locally.

Conclusions

The primary focus of this study was to determine the

effects of chronic fluoride exposure on B. gargarizans

larvae from Gosner stage G26 to Gosner stage G42. High

dosage of fluoride (50 mg L-1) reduced metamorphosis

rate and increased T0.5, but it had few effects on larvae

weight and total length. Histological examinations have

clearly revealed that 50 mg L-1 fluoride could cause thy-

roid gland hypofunction and structural damage. In addition,

bone mineralization was also affected by fluoride. Calcium

deposition was inhibited in 50 mg L-1 group, but it was

accelerated in 5 mg L-1 group.

In summary, the underlying mechanism about the

effects of fluoride on metamorphosis and mineralization is

still unknown. However, our study suggests that high dose

fluoride could damage follicular cells in thyroid, and thy-

roid damage results in up-regulation of D3 gene expression

and a sharp reduction in thyroid hormone. The decrease of

TH had double adverse effects: one is that it delays com-

plete metamorphosis; the other is that it retards ossification

and inhibits calcium deposition in bone.

Acknowledgments We are grateful to Dr. Gang Wang from Uni-

versity of Kentucky for valuable suggestions and improving scientific

Fig. 5 Histomorphological endpoints measured in thyroid gland of

control, 1, 5, 10 and 50 mg L-1 NaF-treated Gosner stage 33, Gosner

stage 38 and Gosner stage 42 B. gargarizans larvae. a Incidence of

colloid depletion of B. gargarizans larvae exposed to NaF at five

concentrations at different development stages. b Effect of NaF on

average diameter of follicle in B. gargarizans larvae at different

development stages. Standard errors are indicated by error bars

(n = 5 larvae per treatment group). Asterisk indicates a statistically

significant difference compared to the control (*P B 0.05 and

**P B 0.01)

Fig. 6 Effect of various NaF concentrations on D2 and D3 mRNA

levels in B. gargarizans larvaes at stage G42. Panel a showed agarose

gel images of amplified cDNA fragments for D2 and D3 in control

group. Panel b showed agarose gel images of amplified cDNA

fragments for D2 and D3 in 1 mg L-1 group. Panel c showed agarose

gel images of amplified cDNA fragments for D2 and D3 in the 5 mg

L-1 group. Panel d showed agarose gel images of amplified cDNA

fragments for D2 and D3 in the 10 mg L-1 group. Panel e showed

agarose gel images of amplified cDNA fragments for D2 and D3 in

the 50 mg L-1 group. m1 600 bp DNA marker, the DNA marker

contained following fragments: 100, 200, 300, 400, 500, 600 bp. m2

DL 2,000 bp DNA marker, the DNA marker contained following

fragments: 100, 250, 500, 750, 1,000, 2,000 bp. The D2 291, D3 142

and a-actin 802 bp products are indicated. a-Actin was used as an

internal control

Effects of fluoride on metamorphosis 1131

123

writings. The work was supported by National Science Foundation

(No. 30200026) and special fund of Shaanxi Normal University (No.

GK261001) to H.Y.W. and National Science Foundation (No.

31201726) to H.F.Z.

Conflict of interest The authors declare that they have no conflicts

of interest.

References

Ahmed OM, El-Gareib AW, El-Bakry AM, Abd El-Tawab SM,

Ahmed RG (2008) Thyroid hormones states and brain develop-

ment interactions. Int J Dev Neurosci 26:147–209

Balch GC, Velez-Espino LA, Sweet C, Alaee M, Metcalfe CD (2006)

Inhibition of metamorphosis in tadpoles of Xenopus laevis

exposed to polybrominated diphenyl ethers (PBDEs). Chemo-

sphere 64:328–338

Barbier O, Arreola-Mendoza L, Del Razo LM (2010) Molecular

mechanisms of fluoride toxicity. Chem Biol Interact 188:319–333

Brande-Lavridsen N, Christensen-Dalsgaard J, Korsgaard B (2010)

Effects of ethinylestradiol and the fungicide prochloraz on

metamorphosis and thyroid gland morphology in Rana tempo-

raria. Open Zool J 3:7–16

Brown DD, Cai L (2007) Amphibian metamorphosis. Dev Biol

306:20–33

Brun LR, Pera LI, Rigalli A (2010) Bone morphometry and

differences in bone fluorine containing compounds in rats

treated with NaF and MFP. Biomed Pharmacother 64:1–6

Cai L, Brown DD (2004) Expression of type II iodothyronine

deiodinase marks the time that a tissue responds to thyroid

hormone-induced metamorphosis in Xenopus laevis. Dev Biol

266:87–95

Camargo JA (2003) Fluoride toxicity to aquatic organisms: a review.

Chemosphere 50:251–264

Croteau MC, Davidson M, Duarte-Guterman P, Wade M, Popesku JT,

Wiens S, Lean DR, Trudeau VL (2009) Assessment of thyroid

system disruption in Rana pipiens tadpoles chronically exposed to

UVB radiation and 4-tert-octylphenol. Aquat Toxicol 95:81–92

Duellman WE, Trueb L (1994) Biology of amphibians. Johns

Hopkins University, Baltimore

Flament S, Kuntz S, Chesnel A, Grillier-Vuissoz I, Tankozic C,

Penrad-Mobayed M, Auque G, Shirali P, Schroeder H, Chardard

D (2003) Effect of cadmium on gonadogenesis and metamor-

phosis in Pleurodeles waltl (urodele amphibian). Aquat Toxicol

64:143–153

Fort DJ, Guiney PD, Weeks JA, Thomas JH, Rogers RL, Noll AM,

Spaulding CD (2004) Effect of methoxychlor on various life

stages of Xenopus laevis. Toxicol Sci 81:454–466

Gosner KL (1960) A simplified table for staging anuran embryos and

larvae with notes on identification. Herpetologica 16:183–190

Helbing CC, Ovaska K, Ji L (2006) Evaluation of the effect of

acetochlor on thyroid hormone receptor gene expression in the

brain and behavior of Rana catesbeiana tadpoles. Aquat Toxicol

80:42–51

Hu F, Sharma B, Mukhi S, Patino R, Carr JA (2006) The colloidal

thyroxine (T4) ring as a novel biomarker of perchlorate exposure

in the African clawed frog Xenopus laevis. Toxicol Sci 93:

268–277

Huang H, Cai L, Remo BF, Brown DD (2001) Timing of metamor-

phosis and the onset of the negative feedback loop between the

thyroid gland and the pituitary is controlled by type II iodothyr-

onine deiodinase in Xenopus laevis. PNAS 98:7348–7353

Kaori M, Keiko O (2012) Thyroid hormone-disrupting effects and the

amphibian metamorphosis assay. J Toxicol Pathol 25:1–9

Kerney R, Wassersug R, Hall BK (2010) Skeletal advance and arrest

in giant non-metamorphosing African clawed frog tadpoles

(Xenopus laevis: daudin). J Anat 216:132–143

Kuiper GG, Klootwijk W, Morvan DG, Destree O, Darras VM, Van

derGeyten S, Demeneix B, Visser TJ (2006) Characterization of

recombinant Xenopus laevis type I iodothyronine deiodinase:

substitution of a proline residue in the catalytic center by serine

(Pro132Ser) restores sensitivity to 6-propyl-2-thiouracil. Endo-

crinology 147:3519–3529

Li W, Zha J, Li Z, Yang L, Wang Z (2009) Effects of exposure to

acetochlor on the expression of thyroid hormone related genes in

larval and adult rare minnow (Gobiocypris rarus). Aquat Toxicol

94:87–93

Li W, Zha J, Yang L, Li Z, Wang Z (2011) Regulation of

iodothyronine deiodinases and sodium iodide symporter mRNA

expression by perchlorate in larvae and adult Chinese rare

minnow (Gobiocypris rarus). Mar Pollut Bull 63:350–355

Mann RM, Hyne RV, Choung CB (2009) Amphibians and agricul-

tural chemicals: review of the risks in a complex environment.

Environ Pollut 157:2903–2927

Mittal M, Flora SJ (2006) Effects of individual and combined

exposure to sodium arsenite and sodium fluoride on tissue

oxidative stress, arsenic and fluoride levels in male mice. Chem

Biol Interact 162:128–139

Mousny M, Omelon S, Wise L, Everett ET, Dumitriu M, Holmyard

DP, Banse X, Devogelaer JP, Grynpas MD (2008) Fluoride

effects on bone formation and mineralization are influenced by

genetics. Bone 43:1067–1074

Opitz R, Hartmann S, Blank T (2006) Evaluation of histological and

molecular endpoints for enhanced detection of thyroid system

disruption in Xenopus laevis tadpoles. Toxicol Sci 90:337–348

Qin X, Xia X, Yang Z, Yan S, Zhao Y, Wei R, Li Y, Tian M, Zhao X,

Qin Z, Xu X (2010) Thyroid disruption by technical decabro-

modiphenyl ether (DE-83R) at low concentrations in Xenopus

laevis. J Environ Sci 22:744–751

Shi X, Zhuang P, Zhang LZ, Feng GP, Chen LQ, Liu JY, Qu L, Wang

RF (2009) The bioaccumulation of fluoride ion (F-) in Siberian

sturgeon (Acipenser baerii) under laboratory conditions. Che-

mosphere 75:376–380

Shivashankara AR, Shivarajachankara YM, Hanumanth RS, Gop-

alakrishna BP (2000) A clinical and biochemical study of

chronic fluoride toxicity in children of Kheru Thanda of

Gulbarga district, Karnataka, India. Fluoride 33:66–73

Shulman JD, Wells LM (1997) Acute fluoride toxicity from ingesting

home-use dental products in children, birth to 6 years of age.

J Public Health Dent 57:150–158

Taylor WR, van Dyke GC (1985) Revised procedures for staining and

clearing small fishes and other vertebrates for bone and cartilage

study. Cybium 9:107–111

Wagner MS, Morimoto R, Dora JM, Benneman A, Pavan R, Maia AL

(2003) Hypothyroidism induces type 2 iodothyronine deiodinase

expression in mouse heart and testis. J Mol Endocrin 31:541–550

Wang Z, Brown DD (1993) The thyroid hormone-induced gene

expression program for amphibian tail resorption. J Biol Chem

268:16270–16278

Wang YN, Xiao KQ, Liu JL, Dallner G, Guan ZZ (2000) Effect of

long term fluoride exposure on lipid composition in rat liver.

Toxicology 146:161–169

Weinstein LH, Davison AW (2004) Fluorides in the Environment:

Effects on Plants and Animals. CABI Publishing, Cambridge

Williams AJ, Robson H, Kester MH, van Leeuwen JP, Shalet SM,

Visser TJ, Williams GR (2008) Iodothyronine deiodinase

enzyme activities in bone. Bone 43:126–134

Yan X, Yan X, Morrison A, Han T, Chen Q, Li J, Wang J (2010)

Fluoride induces apoptosis and alters collagen I expression in rat

osteoblasts. Toxicol Lett 200:133–138

1132 H. Zhao et al.

123