APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2009, p. 6850–6855 Vol. 75, No. 210099-2240/09/$12.00 doi:10.1128/AEM.00875-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Effect of Cinnamon Oil on icaA Expression and Biofilm Formation byStaphylococcus epidermidis�

Titik Nuryastuti,1,2 Henny C. van der Mei,1 Henk J. Busscher,1 Susi Iravati,2Abu T. Aman,2 and Bastiaan P. Krom1*

Department of BioMedical Engineering, University Medical Center Groningen and University of Groningen, Groningen, TheNetherlands,1 and Department of Microbiology, Faculty of Medicine, Gadjah Mada University, Yogyakarta, Indonesia2

Received 17 April 2009/Accepted 6 September 2009

Staphylococcus epidermidis is notorious for its biofilm formation on medical devices, and novel approaches toprevent and kill S. epidermidis biofilms are desired. In this study, the effect of cinnamon oil on planktonic andbiofilm cultures of clinical S. epidermidis isolates was evaluated. Initially, susceptibility to cinnamon oil inplanktonic cultures was compared to the commonly used antimicrobial agents chlorhexidine, triclosan, andgentamicin. The MIC of cinnamon oil, defined as the lowest concentration able to inhibit visible microbialgrowth, and the minimal bactericidal concentration, the lowest concentration required to kill 99.9% of thebacteria, were determined using the broth microdilution method and plating on agar. A checkerboard assaywas used to evaluate the possible synergy between cinnamon oil and the other antimicrobial agents. The effectof cinnamon oil on biofilm growth was studied in 96-well plates and with confocal laser-scanning microscopy(CLSM). Biofilm susceptibility was determined using a metabolic 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Real-time PCR analysis was performed to determine the effect of sub-MICconcentrations of cinnamon oil on expression of the biofilm-related gene, icaA. Cinnamon oil showed antimi-crobial activity against both planktonic and biofilm cultures of clinical S. epidermidis strains. There was onlya small difference between planktonic and biofilm MICs, ranging from 0.5 to 1% and 1 to 2%, respectively.CLSM images indicated that cinnamon oil is able to detach and kill existing biofilms. Thus, cinnamon oil isan effective antimicrobial agent to combat S. epidermidis biofilms.

Staphylococcus epidermidis is a gram-positive bacterium andan important agent of nosocomial infections worldwide. Treat-ment of these infections is increasingly problematic because ofthe resistance of clinical isolates to an increasing number ofantimicrobial agents and, more importantly, due to its ability togrow as a biofilm. Biofilm formation by S. epidermidis (35) canbe governed in part by the production of polysaccharide inter-cellular adhesin. Polysaccharide intercellular adhesin is pro-duced by enzymes encoded by the ica operon which comprisesfour intercellular adhesion genes: icaA, icaB, icaC, and icaD.The expression of the ica operon and biofilm formation aretightly regulated by icaR under in vitro conditions (15). Biofilmformation can be influenced by changing environmental con-ditions, such as the presence of subinhibitory concentrations ofantimicrobials like tetracycline and quinopristin-dalfopristin,as well as high temperatures, anaerobiosis, ethanol stress, andosmolarity (8, 9, 26, 37).

Previous studies have demonstrated that microorganismswithin biofilms are less susceptible to antimicrobial treatmentthan their planktonic counterparts (4), probably due to a com-bination of poor antimicrobial penetration, nutrient limitation,adaptive stress responses, induction of phenotypic variability,and persister cell formation (28). For this reason, current re-search has been focused on identifying new compounds that

have antimicrobial activity against microorganisms, both inplanktonic and biofilm modes of growth. Plant essential oilshave been used in food preservation, pharmaceutical thera-pies, alternative medicine, and natural therapies for manythousands of years (23, 36).

Cinnamon oil is one of the essential oils commonly used inthe food industry because of its special aroma (6). Cinnamo-mum is a genus in the family Lauraceae, many species of whichare used for spices. One of the species is Cinnamomum bur-mannii from Indonesia, also called Indonesian cassia (the com-mercial name is “cinnamon stick”). Several publications havedemonstrated the antibacterial activity of cinnamon oil iso-lated from the bark of this species (12, 18, 22, 39). Cinnamonoil was also shown to be effective against biofilm cultures ofStreptococcus mutans and Lactobacillus plantarum (14). In ad-dition, essential oil derived from the leaves of another closelyrelated species within this plant family, Cinnamomum osmo-phloeum (endemic to Taiwan), had an excellent inhibitory ef-fect on planktonic cultures of nine gram-positive and gram-negative bacteria, including methicillin-resistant Staphylococcusaureus and S. epidermidis (6). Previous studies reported thatthe predominant active compound found in cinnamon oil wascinnamaldehyde (36, 39). Cinnamaldehyde causes inhibition ofthe proton motive force, respiratory chain, electron transfer,and substrate oxidation, resulting in uncoupling of oxidativephosphorylation, inhibition of active transport, loss of poolmetabolites, and disruption of synthesis of DNA, RNA, pro-teins, lipids, and polysaccharides (11, 13, 33). In addition, animportant characteristic of volatile oils and their components istheir hydrophobicity, which enables them to partition into and

* Corresponding author. Mailing address: Department of BioMedicalEngineering, University Medical Center Groningen and University ofGroningen, P.O. Box 196, 9700 AD Groningen, The Netherlands.Phone: 31-50-3633160. Fax: 31-50-3633159. E-mail: b.p.krom@med.umcg.nl.

� Published ahead of print on 11 September 2009.

6850

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from

disturb the lipid bilayer of the cell membrane, rendering themmore permeable to protons. Extensive leakage from bacterialcells or the exit of critical molecules and ions ultimately leadsto bacterial cell death (36).

The susceptibility of S. epidermidis to cinnamon oil derivedfrom the bark of Cinnamomum burmannii, however, has neverbeen published, neither for planktonic organisms nor forstaphylococci in a biofilm mode of growth. Hence, the currentstudy was undertaken to establish the efficacy of this oil as anantimicrobial agent against clinical S. epidermidis isolates inplanktonic and biofilm cultures. Chlorhexidine, triclosan, andgentamicin were used as positive controls in addition to exam-ination of possible synergistic effects by combining cinnamonoil with any of these clinically used antimicrobials.

MATERIALS AND METHODS

Bacterial strains. Sixteen clinical isolates of S. epidermidis (Table 1) werecollected from Sardjito Hospital, Yogyakarta, Indonesia, and identified as re-ported previously in the Microbiology Department, Gadjah Mada University,Yogyakarta, Indonesia (32). Isolates were obtained from blood, cerebrospinalfluid, pus, and urine. S. epidermidis strains RP62A (ATCC 35984) and ATCC12228 were included as ica-positive and ica-negative reference strains, respec-tively. All strains were cultured at 37°C in tryptic soy broth (TSB; Oxoid) with orwithout agar.

Clinical isolates of S. epidermidis were screened for the presence of icaA byPCR using the primers listed in Table 2 (19, 32, 40). Briefly, S. epidermidis strainswere grown overnight at 37°C on a TSB agar plate. A colony of each isolate wastaken and resuspended in 20 �l sterile demineralized water (dH2O). Samples wereheated to 100°C for 5 min, and the bacterial debris and unlysed organisms wereremoved by centrifugation (21,000 � g for 10 min). Five microliters of thesupernatants was used as template DNA in a PCR analysis using gyrB as a controlfor the presence of DNA.

Antimicrobials. Cinnamon stick (Cinnamomum burmannii), originally pro-duced in Indonesia, was obtained from a local market in Tawangmangu in the

center of Java, Indonesia, and was authenticated by botanical experts. Cinnamonoil was extracted by steam distillation to obtain a volatile oil (38). Stock solutionsof 16% cinnamon oil in 5% propylene glycol (PG) and 128 mg/liter triclosan(Flochea) in 5% PG were made to enhance their solubility in suspension (42) andused the following dilution. Equal amounts (final concentrations) of PG wereincluded in cultures in order to determine the effect of PG in the absence ofcinnamon. Chlorhexidine (Sigma-Aldrich) and gentamicin (Sigma-Aldrich) werediluted with sterile dH2O to obtain fourfold stock solutions of 64 mg/liter and 128mg/liter, respectively, as positive controls.

Susceptibility of planktonic bacteria to cinnamon oil in comparison withchlorhexidine, gentamicin, and triclosan. The MIC and minimal bactericidalconcentrations (MBCs) for cinnamon oil, chlorhexidine, triclosan, and gentami-cin of planktonic S. epidermidis cultures were determined in TSB using the brothmicrodilution method (1). Suspensions of S. epidermidis were prepared by re-suspending one colony of an overnight culture from TSB agar in TSB broth. Thebacterial density was adjusted to 1 � 108 bacteria/ml in 0.9% NaCl, using opticaldensities at 625 nm of 0.08 to 0.10 as a reference, corresponding to 0.5 McFarlandunits. The bacteria were further diluted with TSB to obtain inocula containing1 � 106 bacteria/ml. Each well of a tissue culture polystyrene microtiter plate(water contact angle, 56 degrees; Falcon; Becton Dickinson Labware, FranklinLakes, NJ) containing 100 �l of the antimicrobial agent at different concentra-tions or PG solution was inoculated with 100 �l of the bacterial suspension.Following a 24-h incubation at 37°C, the wells were visually inspected for growth.The MIC was defined as the lowest concentration that did not show growth.Controls containing antimicrobial agents in broth without bacterial inocula wereincluded. Following the MIC assay, MBCs were determined by plating 10 �l ofeach of the clear wells onto TSB agar plates. The MBC was defined as the lowestconcentration yielding no growth following incubation at 37°C for 24 h. Datafrom at least three biological replicates were evaluated, and averages werecalculated.

Synergistic effects of cinnamon oil with chlorhexidine, triclosan, and genta-micin. To determine possible synergistic effects of cinnamon oil in combinationwith chlorhexidine, triclosan, and gentamicin, a checkerboard assay was per-formed as described previously (3, 14, 34). Briefly, each well of a 96-well micro-titer plate was filled with 100 �l of TSB, and 100 �l of cinnamon oil was addedto the first row in a twofold-decreased concentration, while 100 �l of the otherantimicrobial agent was added to the right column in decreasing concentrations.Thus, serial twofold dilutions of the antimicrobial compounds were made in eachrow/column (final concentrations were 2 to 0.01% [vol/vol] for cinnamon oil, 32to 0.2 mg/liter for gentamicin and triclosan, and 8 to 0.05 mg/liter for chlorhexi-dine). The wells were then inoculated with 100 �l of the bacterial suspensionscontaining 1 � 106 bacteria/ml. Controls containing inocula in TSB alone andantimicrobial compounds without inoculum were included. The microtiter plateswere incubated at 37°C for 24 h, and the MIC of the combination of bothantimicrobial compounds was determined by visual inspection.

To determine the synergistic or antagonistic activity of antimicrobial combi-nations, the fractional inhibitory concentration (FIC) and FIC index (FICI) weredetermined as described by Odds (34). Briefly, the FIC of cinnamon oil plusanother antimicrobial agent was calculated as the MIC of each agent when usedin combination with the other agent divided by the MIC when used alone (FIC �MIC in combination/MIC alone). Accordingly, each antimicrobial combinationproduced two FIC values, which were summed to produce the FICI (FICI � FIC

TABLE 1. Planktonic MIC and MBC of cinnamon oil (CIN),chlorhexidine (CHX), triclosan (TRI), and gentamicin

(GEN) against clinical S. epidermidis isolatesa

StrainCIN (%) CHX

(mg/liter)TRI

(mg/liter)GEN

(mg/liter)

MIC MBC MIC MBC MIC MBC MIC MBC

ica-positive46 0.5 2 1 8 �32 �32 �32 �3264 1 2 2 8 �32 �32 4 16236 0.5 1 2 4 �32 �32 4 8734 1 2 2 8 �32 �32 �32 �32169 1 2 2 8 2 �32 �32 �32RP62A 1 2 2 8 1 �32 �32 �32

ica-negative1239 2 �2 4 8 �32 �32 �32 �32134 1 2 1 2 0.5 �32 2 4368 1 2 2 8 2 �32 �32 �32628 0.5 1 2 8 2 �32 �32 �32397 1 2 2 8 �32 �32 1 2163 1 2 4 8 �32 �32 �32 �321486 1 2 4 8 �32 �32 �32 �321119 1 2 2 4 1 �32 �32 �3258 1 2 4 16 �32 �32 �32 �32846 1 2 1 8 �32 �32 1 2724 1 2 2 8 2 4 �32 �32ATCC 12228 0.5 1 2 8 0.5 �32 �32 �32

a Values represent results of five experiments with triplicate wells, alwayscoinciding within one serial dilution.

TABLE 2. Primer sequences for PCR and real-time PCR used inthis studya

Primer (reference) Sequence (5� to 3�) Productsize (bp)

AT(°C)

PCRicaA forward

(19)CAGTATAACAACATTCT

ATTG1,425

icaA reverse GAGAATTGATAAGAGTTCC

Real-time PCRicaA-1 forward

(32)GGAAGTTCTGATAATACT

GCTG124 56

icaA-1 reverse GATGCTTGTTTGATTCCCTCgyrB-3 forward GGAGGTAAATTCGGAGGT 129 57.1gyrB-3 reverse CTTGATGATAAATCGTGCCA

a AT, optimal annealing temperature.

VOL. 75, 2009 EFFECT OF CINNAMON OIL AGAINST S. EPIDERMIDIS BIOFILMS 6851

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from

of cinnamon oil � FIC of another antimicrobial agent). Synergy was defined asa FICI value of �0.5, no interaction was defined as a FICI value of �0.5 to 4.0,and antagonism was defined as a FICI value of �4 (10, 34).

Biofilm formation in the presence of cinnamon oil and the effect on icaAexpression. Biofilms were grown as described previously (7, 32). Briefly, wells ofa 96-well tissue culture polystyrene microtiter plate (Falcon; Becton DickinsonLabware, Franklin Lakes, NJ) were filled with 100 �l of TSB containing cinna-mon oil (twofold final concentrations) and subsequently inoculated with a 1:100dilution of an overnight culture. Final concentrations of cinnamon oil were 2 to0.01% (vol/vol). After incubation for 24 h at 37°C, the plates were gently washedtwice with phosphate-buffered saline (PBS; 10 mM potassium phosphate, 0.15 MNaCl, pH 7.0) and stained with 1% (wt/vol) crystal violet solution for 30 min atroom temperature in order to determine the biofilm mass. The excess stain waswashed off with dH2O. Subsequently, the biofilms were resuspended in acid-isopropanol (5% [vol/vol] 1 M HCl in isopropanol) and, finally, the A575 wasmeasured in a Fluostar Optima microplate reader (BMG Labtech).

Total RNA was isolated from 24-h biofilm cultures grown with and without0.01% cinnamon oil in 12-well tissue culture polystyrene plates (water contactangle, 59 degrees; Costar, Corning, NY) as described previously (32). Briefly,after resuspending the biofilms by pipetting, bacteria were pelleted by centrifu-gation and frozen at �80°C. Samples were thawed slowly on ice and resuspendedin 100 �l diethylpyrocarbonate-treated water, after which the bacterial suspen-sion was frozen in liquid nitrogen. Frozen bacteria were ground using a mortarand pestle. Total mRNA was isolated using the Invisorb Spin Cell RNA mini kit(Invitek, Freiburg, Germany) according to the manufacturer’s instructions. DNAwas removed using the DNA-free kit from Ambion, and the absence of genomicDNA was verified by real-time PCR prior to reverse transcription. For all sam-ples, 35 cycles of PCR using the gyrB primer set (Table 2) did not result in anydetectable signal. One �g of total RNA was used for cDNA synthesis (IScript;Bio-Rad) according to the manufacturer’s instructions. Real-time PCR was per-formed as described previously (32). Reaction mixtures were prepared in dupli-cate using the CAS-1200 pipetting robot (Corbett Life Science, Sydney, Austra-lia). Normalized expression levels of icaA (see primers in Table 2) werecalculated using the threshold cycle method (2���CT) (27) with untreated bio-films as controls and gyrB as the reference.

Biofilm susceptibility to cinnamon oil. Biofilms were grown as described abovebut without cinnamon oil. After a 24-h incubation at 37°C, the biofilms werewashed three times with sterile PBS, after which the biofilms were exposed to 200�l of cinnamon oil, with oil concentrations ranging from 2 to 0.01% (vol/vol).The plates were incubated for 1, 3, and 24 h at 37°C, after which the cinnamonoil was removed by washing twice with 200 �l PBS. Bacterial viability wasanalyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide(MTT; Sigma) as described previously (5). Briefly, 100 �l prewarmed MTTsolution (0.5 mg/ml) in PBS containing 0.1% glucose and 10 �l of 10 �Mmenadion was added to each well. The plates were incubated at 37°C for 30 min,and the MTT solution was removed. Bacteria were washed once with PBS andresuspended in acid isopropanol (5% [vol/vol] 1 M HCl in isopropanol). Finally,the absorbance was measured (A560). The biofilm MIC was defined as theconcentration of cinnamon oil showing A560 values equal to or lower than thoseof the control, i.e., the biofilm-negative strain, S. epidermidis strain ATCC 12228.

Confocal laser-scanning microscopy (CLSM) was used to visualize biofilmstreated with 2% cinnamon oil for 1, 3, and 24 h. Biofilms grown in 12-well tissueculture polystyrene plates were washed with PBS and stained with the bacteriallive/dead stain BacLight (Molecular Probes, Leiden, The Netherlands) for 30min in the dark. Excess stain was removed, and the biofilms were submerged in2 ml PBS. CLSM images were collected using a Leica TCS SP2 CLSM with a �40water objective using 488 nm excitation and 500 to 523 nm (green, alive) and 622to 722 nm (red, dead) emission filter settings.

RESULTS

The susceptibility of clinical isolates of S. epidermidis tocinnamon oil, chlorhexidine, triclosan, and gentamicin is sum-marized in Table 1. All clinical isolates included were suscep-tible to cinnamon oil, with a planktonic MIC ranging from 0.5to 1%, except for strain 1239 which showed a higher MIC of2%. Ten out of 18 S. epidermidis strains used in this studyshowed resistance to triclosan (MIC higher than 32 mg/liter)(2, 16, 21, 41). Gentamicin resistance was observed in 13 out of18 strains (MIC higher than 32 mg/liter) (24). The planktonic

MIC of clinical S. epidermidis strains for chlorhexidine, one ofthe most widely used skin antiseptics, was 1 to 4 mg/liter, andno resistant strains were observed (25). The planktonic MBCsof cinnamon oil were twofold higher (P 0.001) than theirMICs for the same strain. Chlorhexidine demonstrated a four-fold-higher (P 0.001) MBC than MIC on average, whiletriclosan showed no bactericidal activity in the concentrationrange evaluated here (MBC � 32 mg/liter), except forstrain 724.

Synergy between cinnamon oil and each of the other threeantimicrobials was evaluated for three icaA-positive clinicalisolates (strains 46, 64, and 236) and the two reference strains.Strain 46 is resistant to both triclosan and gentamicin, whilestrains 64 and 236 are resistant only to triclosan. StrainsRP62A and ATCC 12228 are resistant only to gentamicin. Acombination of cinnamon oil with gentamicin showed synergyfor strains 64 and 236 (Table 3), while a combination of cin-namon oil with chlorhexidine showed synergy for all strainstested. A combination of cinnamon oil with triclosan showedonly synergy for the two reference strains, RP62A and ATCC12228 (Table 3).

The effects of cinnamon oil on biofilm formation by thehigh-biofilm-producing strains (46 and 64), intermediate bio-film formers (236 and RP62A), and the negative control(ATCC 12228) were determined. The negative control did notform a biofilm in the presence or absence of cinnamon oil. Thegrowth of S. epidermidis strains 46 and 64, a high-biofilm-producing strain, and RP62A could be inhibited by a cinnamonoil concentration of 0.5%, while the intermediate strain 236required significantly (P 0.01) less cinnamon oil to preventbiofilm growth (0.25%). Interestingly, for S. epidermidis strainsRP62A and 236, there was a twofold (P 0.05) induction of

TABLE 3. Antimicrobial activities of cinnamon oil (CIN) incombination with chlorhexidine (CHX), triclosan (TRI),

and gentamicin (GEN) against S. epidermidis clinicalisolates using a checkerboard assaya

Strain Strainresistance

Antimicrobialagent

combination

FIC

FICI ResultCIN Other

drug

46 Genr CIN � GEN 0.5 1 1.5 NITrir CIN � CHX 0.1 0.2 0.3 S

CIN � TRI 0.2 1 1.2 NI

64 Trir CIN � GEN 0.1 0.125 0.225 SCIN � CHX 0.1 0.25 0.35 SCIN � TRI 0.5 1 1.5 NI

236 Trir CIN � GEN 0.02 0.125 0.145 SCIN � CHX 0.05 0.25 0.3 SCIN � TRI 0.2 1 1.2 NI

RP62A Genr CIN � GEN 0.1 1 1.1 NICIN � CHX 0.05 0.1 0.15 SCIN � TRI 0.01 0.02 0.03 S

ATCC 12228 Genr CIN � GEN 0.2 1 1.2 NICIN � CHX 0.2 0.25 0.45 SCIN � TRI 0.02 0.04 0.06 S

a Genr, gentamicin resistance; Trir, triclosan resistance; S, synergy; NI, nointeraction.

6852 NURYASTUTI ET AL. APPL. ENVIRON. MICROBIOL.

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from

biofilm formation by cinnamon oil at a concentration of 0.01 to0.05% (Fig. 1).

Since the effect of 0.01% cinnamon oil seemed to stimulatebiofilm formation, it was analyzed in more detail by followingicaA expression using real-time PCR. Relative to the unex-posed control, icaA was overexpressed in all strains when ex-posed to 0.01% cinnamon oil (Fig. 2). Normalized fold expres-sion of icaA was between two and four times that of strains 46,64, and 236 when exposed to 0.01% cinnamon. Interestingly,strain RP62A exposed to 0.01% cinnamon demonstrated 37times the overexpression of icaA compared to the untreatedcontrol and a 10-fold-stronger overexpression of icaA com-pared to the other strains.

The susceptibility of S. epidermidis biofilms to cinnamon oilwas studied by exposing 24-h-old biofilms to cinnamon oil,ranging from 0.01 to 2% (vol/vol) for 1, 3, and 24 h. The twohigh-biofilm-producing strains had a biofilm MIC of 2%(strains 46 and 64), whereas the intermediate biofilm-produc-ing strains (236 and RP 62A) showed a biofilm MIC at 1%after 24 h. Interestingly, treatment of the intermediate biofilm-

producing strains with 1% cinnamon oil for 3 h and 24 hresulted in the complete loss of metabolic activity, while a 1-hexposure resulted in a residual metabolic activity of 14% rel-ative to that of the untreated control (Fig. 3A). For the high-biofilm-producing strains, 24-h exposure to 1% cinnamon oildid not result in the complete loss of metabolic activity butshowed 20 to 30% residual metabolic activity (Fig. 3A). Expo-sure to 2% cinnamon oil for 24 h resulted in the completedisappearance of metabolic activity (Fig. 3B).

The effect of cinnamon oil on preexisting biofilms was alsostudied by using CLSM. For the high-biofilm-producingstrains, treatment with 2% cinnamon oil for 1 and 3 h reducedthe number of bacteria present in the biofilm (compare Fig. 4Band C with A), but the remaining bacteria were viable (Fig. 4Band C). After treatment for 24 h, cinnamon oil efficientlyremoved the majority of the bacteria from the biofilm, and inaddition, the remaining bacteria were dead (Fig. 4D). For anintermediate biofilm-producing strain exposed to 2% cinna-mon oil, biofilm detachment was observed after 1 h of treat-ment (Fig. 4E and F), and remaining bacteria were viable,while 3 h and 24 h of treatment resulted in both bacterialdetachment and death (Fig. 4G and H, respectively).

DISCUSSION

Several investigations have studied the antimicrobial effectsof cinnamon oil (6, 14, 31, 36, 39). However, there is verylimited information about its effect on S. epidermidis, either inplanktonic or biofilm cultures. In the present study, it is shownthat cinnamon oil has antimicrobial activity against both plank-tonic and biofilm cultures of clinical S. epidermidis strains. Thisis in line with other reports showing that cinnamon oil had themost potent bactericidal properties compared to 20 other es-sential oils against different important pathogens (36, 39). Re-markably, many of the clinical S. epidermidis strains used in this

FIG. 1. Effect of cinnamon oil on S. epidermidis biofilm formation.Biofilm formation, as a function of cinnamon oil concentration, was asdetermined using crystal violet staining. Bars indicate the mean A575values of three independent experiments, each done in triplicate wells.Values are expressed as means standard deviation.

FIG. 2. Expression of icaA in S. epidermidis strains in response tocinnamon oil. The normalized fold expression of icaA in biofilmsexposed to 0.01% cinnamon for 24 h (gray bars) was plotted againstunexposed control biofilms (black bars), using gyrB as the referencegene. The 2���CT was calculated from the average CT values of tworeactions.

FIG. 3. Effect of cinnamon oil exposure on metabolic activity of S.epidermidis biofilms after 1 h, 3 h, and 24 h of exposure. Biofilms byhigh-biofilm-producing (46 and 64) and intermediate biofilm-produc-ing (236 and RP62A) strains were exposed to 1% (A) or 2% (B) cin-namon oil. Relative residual metabolic activity was calculated fromA560 values with the unexposed control set to 100%. The error barsdenote standard deviations over three experiments with separatelycultured bacteria.

VOL. 75, 2009 EFFECT OF CINNAMON OIL AGAINST S. EPIDERMIDIS BIOFILMS 6853

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from

study showed resistance to triclosan (10 out of 18 strains), anantimicrobial agent widely used in medical practice. In addi-tion, resistance to gentamicin, the most commonly used anti-biotic in bone cement with its wide antibacterial spectrum, wasalso common (13 out of 18 strains) (30). These large propor-tions of resistant strains are probably due to the Indonesianorigin of the strains, since antibiotic use is relatively wide-

spread there compared to, e.g., in The Netherlands (20).Strains showing resistance to gentamicin, triclosan, or bothwere still susceptible to cinnamon oil. Interestingly, the plank-tonic MIC and MBC to cinnamon oil were similar to thebiofilm MIC and MBC of the same strain, ranging from 0.5 to1% and 1 to 2% (vol/vol), respectively. This suggests thatcinnamon oil has similar antimicrobial activity against plank-tonic bacteria and bacteria in biofilms. In addition, anotheradvantage of the use of essentials oil over antibiotics may bethat bacteria do not develop resistance to essential oils (29).The present study showed that cinnamon oil has synergisticactivity with chlorhexidine, triclosan, and gentamicin except forstrains that are resistant against triclosan or gentamicin. Im-portantly, no antagonism between cinnamon oil and any of thegenerally used disinfectants or antimicrobials included was ob-served. In combination with cinnamon oil, the amount of chlo-rhexidine, gentamicin, and triclosan required to achievegrowth inhibition was reduced significantly (10-, 8-, and 50-fold, respectively) (data not shown). For chlorhexidine, thisfinding is in line with results of a previous study showing thatin combination with cinnamon oil, a 10-fold-lower chlorhexi-dine concentration was needed for equivalent inhibition ofbiofilm cultures of S. mutans and L. plantarum (14). The syn-ergistic activity between an essential oil and an antimicrobialagent may be due to their action on either different (17) orsimilar targets of bacterial cells, i.e., cell membranes (14, 25).This is supported by results presented here. Cinnamon oil andone of its main components, cinnamaldehyde, act on theplasma membranes, similarly to chlorhexidine (inhibition ofthe same target), while gentamicin inhibits protein synthesisand triclosan inhibits a specific metabolic pathway required forfatty acid synthesis in bacteria (inhibition of different targets)(14, 25). The synergistic activity of cinnamon oil with otherantimicrobial agents could be beneficial in clinical settings, forexample, to improve skin antisepsis and to eliminate antimi-crobial-resistant S. epidermidis strains (25). Using combina-tions of relatively cheap cinnamon oil with relatively expensiveantimicrobials can lower the cost of therapy significantly.

Our results clearly indicated that the expression of icaA isstrongly enhanced by the presence of sub-MIC concentrationsof cinnamon oil. To our knowledge, this is the first report thatcinnamon oil could act as an inducer of biofilm formation inclinical S. epidermidis strains. Biofilm formation can be inducedby conditions that are potentially toxic for bacterial cells, suchas high levels of osmolarity, detergents, urea, ethanol, oxida-tive stress, and the presence of sub-MICs of some antibiotics(9, 26, 37).

Interestingly, CLSM imaging of cinnamon-treated biofilmsshows not only that biofilm bacteria are effectively killed bycinnamon oil but that cinnamon oil is also able to detachbiofilms. This shows that cinnamon oil has a dual mode ofaction against S. epidermidis biofilms; it is able to detach ad-hering bacteria from a substratum surface and it can kill bac-teria. Furthermore, from the CLSM analysis it appears thatdetachment of biofilm bacteria is a more rapid process than theactual killing (compare the decrease in biomass with the ab-sence of dead bacteria after a 1-h incubation with cinnamon oilin Fig. 4). This also illustrates that the reduction in metabolicactivity upon exposure of the biofilm to cinnamon oil, as ob-

FIG. 4. Representative CLSM images of biofilms of a high-biofilm-producing S. epidermidis strain 46 (A to D) and intermediate biofilm-producing strain RP62A (E to H) in 12-well tissue culture polystyreneplates after exposure to 2% cinnamon oil for 1 h (B and F), 3 h (C andG), and 24 h (D and H) of incubation, while panels A and E showuntreated control biofilms. Biofilms were stained with BacLight viabil-ity stain. Bar, 75 �m in all images.

6854 NURYASTUTI ET AL. APPL. ENVIRON. MICROBIOL.

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from

served here, is predominantly caused by the detachment ratherthan killing of biofilm bacteria.

In conclusion, this study demonstrated that cinnamon oil hasexcellent antibacterial activity, either alone or in combinationwith triclosan, gentamicin, or chlorhexidine, against clinical S.epidermidis isolates. This essential oil was able to inhibit bio-film formation, detach existing biofilms, and kill bacteria inbiofilms of clinical S. epidermidis strains. Importantly, biofilmswere equally as sensitive to cinnamon oil as their planktoniccounterparts, probably due to the dual activity of cinnamon oilon existing biofilms. Further study is warranted to elucidate thecomplex mode of action of cinnamon and its componentsagainst biofilms of S. epidermidis and other clinically relevantmicrobes.

ACKNOWLEDGMENTS

This study has been funded by the University Medical Center Gro-ningen and the University of Groningen, Groningen, The Netherlands.

REFERENCES

1. Amsterdam, D. 1996. Susceptibility testing of antimicrobials in liquid media,p. 52–111. In V. Loman (ed.), Antibiotics in laboratory medicine. Williamsand Wilkins, Baltimore, MD.

2. Bamber, A. I., and T. J. Neal. 1999. An assessment of triclosan susceptibilityin methicillin-resistant and methicillin-sensitive Staphylococcus aureus. J.Hosp. Infect. 41:107–109.

3. Bonapace, C. R., J. A. Bosso, L. V. Friedrich, and R. L. White. 2002. Com-parison of methods of interpretation of checkerboard synergy testing. Diagn.Microbiol. Infect. Dis. 2002. 44:363–366.

4. Brown, M. R. W., and P. Gilbert. 1993. Sensitivity of biofilms to antimicrobialagents. J. Appl. Bacteriol. 74:87S–97S.

5. Cerca, N., S. Martins, F. Cerca, K. K. Jefferson, G. B. Pier, R. Oliveira, andJ. Azeredo. 2005. Comparative assessment of antibiotic susceptibility of co-agulase-negative staphylococci in biofilm versus planktonic culture as as-sessed by bacterial enumeration or rapid XTT colorimetry. J. Antimicrob.Chemother. 56:331–336.

6. Chang, S. T., P. F. Chen, and S. C. Chang. 2001. Antibacterial activity of leafessential oils and their constituents from Cinnamomum osmophloeum. J.Ethnopharmacol. 77:123–127.

7. Christensen, G. D., L. M. Baddour, and W. A. Simpson. 1987. Phenotypicvariation of Staphylococcus epidermidis slime production in vitro and in vivo.Infect. Immun. 55:2870–2877.

8. Conlon, K. M., H. Humphreys, and J. P. O’Gara. 2002. icaR encodes atranscriptional repressor involved in environmental regulation of ica operonexpression and biofilm formation in Staphylococcus epidermidis. J. Bacteriol.184:4400–4408.

9. Cramton, S. E., M. Ulrich, F. Gotz, and G. Doring. 2001. Anaerobic condi-tions induce expression of polysaccharide intercellular adhesin in Staphylo-coccus aureus and Staphylococcus epidermidis. Infect. Immun. 69:4079–4085.

10. Darouiche, R. O., M. D. Mansouri, P. V. Gawande, and S. Madhyastha.2008. Efficacy of combination of chlorhexidine and protamine sulphateagainst device-associated pathogens. J. Antimicrob. Chemother. 61:651–657.

11. Denyer, S. P. 1995. Mechanisms of action of antibacterial biocides. Int.Biodeterior. Biodegrad. 36:227–245.

12. Fabian, D., M. Sabol, K. Domaracka, and D. Bujnakova. 2006. Essentialoils—their antimicrobial activity against Escherichia coli and effect on intes-tinal cell viability. Toxicol. In Vitro 20:1435–1445.

13. Farag, R. S., Z. Y. Daw, F. M. Hewedi, and G. S. A. Elbatory. 1989. Anti-microbial activity of some Egyptian spice essential oils. J. Food Prot. 52:665–667.

14. Filoche, S. K., K. Soma, and C. H. Sissons. 2005. Antimicrobial effects ofessential oil in combination with chlorhexidine digluconate. Oral Microbiol.Immunol. 20:221–225.

15. Fitzpatrick, F., H. Humphreys, and J. P. O’Gara. 2005. Evidence foricaADBC-independent biofilm development mechanism in methicillin-resis-tant Staphylococcus aureus clinical isolates. J. Clin. Microbiol. 43:1973–1976.

16. Fraise, A. P. 1998. Topical treatment for eradication of MRSA. CME Bull.Med. Microbiol. 2:10–11.

17. Fyve, L., F. Amstrong, and J. Stewart. 1998. Inhibition of Listeria monocy-togenes and Salmonella enteritidis by combinations of plant oils and deriva-tives of benzoic acid: the development of synergistic antimicrobial combina-tions. Int. J. Antimicrob. Agents 9:198–199.

18. Gill, A. O., and R. A. Holley. 2004. Mechanisms of bactericidal action of

cinnamaldehyde against Listeria monocytogenes and of eugenol against L.monocytogenes and Lactobacillus sakei. Appl. Environ. Microbiol. 70:5750–5755.

19. Handke, L. D., K. M. Conlon, S. R. Slater, S. Elbaruni, F. Fitzpatrick, H.Humphreys, W. P. Giles, M. E. Rupp, P. D. Fey, and J. P. O’Gara. 2004.Genetic and phenotypic analysis of biofilm phenotypic variation in multipleStaphylococcus epidermidis isolates. J. Med. Microbiol. 53:367–374.

20. Hart, C. A., and K. Kariuki. 1998. Antimicrobial resistance in developingcountries. BMJ 317:647–650.

21. Hospital Infection Society. 1990. Revised guidelines for the control of epi-demic methicillin-resistant Staphylococcus aureus. Report of a combinedworking party of the Hospital Infection Society and British Society forAntimicrobial Chemotherapy. J. Hosp. Infect. 16:351–377.

22. Inouye, S., H. Yamaguchi, and T. Takizawa. 2001. Screening of the antibac-terial effects of a variety of essential oils on respiratory tract pathogens, usinga modified dilution assay method. J. Infect. Chemother. 7:251–254.

23. Jones, F. A. 1996. Herbs—useful plants, their role in history and today. Eur.J. Gastroenterol. Hepatol. 8:1227–1231.

24. Jorgensen, J. H., and J. D. Turnidge. 2003. Susceptibility test methods:dilution and disk diffusion methods, p. 1108–1127. In P. R. Murray (ed.),Manual of clinical microbiology, vol. 1. ASM Press, Washington, DC.

25. Karpanen, T. J., T. Worthington, E. R. Hendry, B. R. Conway, and P. A.Lambert. 2008. Antimicrobial efficacy of chlorhexidine digluconate aloneand in combination with eucalyptus oil, tea tree oil and thymol againstplanktonic and biofilm cultures of Staphylococcus epidermidis. J. Antimicrob.Chemother. 62:1031–1036.

26. Knobloch, J. K. M., M. A. Horstkotte, H. Rohde, P. Kaulfers, and D. Mack.2002. Alcoholic ingredients in skin disinfectants increase biofilm expressionof Staphylococcus epidermidis. J. Antimicrob. Chemother. 49:683–687.

27. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expressiondata using real-time PCR and the 2���CT method. Methods 25:402–408.

28. Mah, T. C., and G. A. O’Toole. 2001. Mechanism of biofilm resistance toantimicrobial agents. Trends Microbiol. 9:34–39.

29. Monzote, L., A. M. Montalvo, R. Scull, M. Miranda, and J. Abreu. 2007.Activity, toxicity and analysis of resistance of essential oil from Chenopodiumambrosioides after intraperitoneal, oral and intralesional administration inBALB/c mice infected with Leishmania amazonensis: a preliminary study.Biomed. Pharmacother. 61:148–153.

30. Neut, D., E. P. de Groot, R. S. K. Kowalski. J. R. van Horn, H. C. van derMei, and H. J. Busscher. 2005. Gentamicin-loaded bone cement with clin-damycin or fusidic acid added: biofilm formation and antibiotic release.J. Biomed. Mater. Res. 73:165–170.

31. Niu, C., and E. S. Gilbert. 2004. Colorimetric method for identifying plantessential oil components that affect biofilm formation and structure. Appl.Environ. Microbiol. 70:6951–6956.

32. Nuryastuti, T., H. C. van der Mei, H. J. Busscher, R. Kuijer, A. T. Aman, andB. P. Krom. 2008. recA mediated spontaneous deletions of the icaADBCoperon of clinical Staphylococcus epidermidis isolates: a new mechanism ofphenotypic variations. Antonie van Leeuwenhoek 94:317–328.

33. Nychas, G. J. E. 1995. Natural antimicrobials from plants, p. 58–89. In G. W.Gould (ed.), New methods of food preservations. Blackie Academic, Lon-don, United Kingdom.

34. Odds, F. C. 2003. Synergy, antagonism, and what the chequerboard putsbetween them. J. Antimicrob. Chemother. 52:1.

35. O’Gara, J. P. 2007. ica and beyond: biofilm mechanisms and regulation inStaphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol.Lett. 270:179–188.

36. Prabuseenivasan, S., M. Jayakumar, and S. Ignacimuthu. 2006. In vitroantibacterial activity of some plant essential oils. BMC Complement. Altern.Med. 6:39.

37. Rachid, S., K. Ohlsen, W. Witte, J. Hacker, and W. Ziebuhr. 2000. Effect ofsubinhibitory antibiotic concentration on polysaccharide intercellular adhe-sin expression in biofilm-forming Staphylococcus epidermidis. Antimicrob.Agents Chemother. 44:3357–3363.

38. Robbers, J. E., M. K. Speedie, and V. E. Tyler. 1996. Pharmacognosy andpharmacobiotechnology. Lippincott Williams and Wilkins, Baltimore, MD.

39. Shan, B., Y. Z. Cai John, and H. Corke. 2007. Antibacterial properties andmajor bioactive components of cinnamon stick (Cinnamon burmannii): ac-tivity against foodborne pathogenic bacteria. J. Agric. Food Chem. 55:5484–5490.

40. Skow, A., K. A. Mangold, M. Tajuddin, A. Huntington, B. Fritz, R. B.Thomson, and K. L. Kaul. 2005. Species-level identification of staphylococ-cal isolates by real-time PCR and melt curve analysis. J. Clin. Microbiol.43:2876–2880.

41. Suller, M. T. E., and A. D. Russel. 2000. Triclosan and antibiotic resistancein Staphylococcus aureus. J. Antimicrob. Chemother. 46:11–18.

42. Yazdankhah, S., A. A. Scheie, A. Hoiby, B. Lunestad, E. Heir, T. Ø. Fotland,K. Naterstad, and H. Kruse. 2006. Triclosan and antimicrobial resistance inbacteria: an overview. Microb. Drug Resist. 12:83–90.

VOL. 75, 2009 EFFECT OF CINNAMON OIL AGAINST S. EPIDERMIDIS BIOFILMS 6855

on March 13, 2021 by guest

http://aem.asm

.org/D

ownloaded from