Upload
duongmien
View
214
Download
1
Embed Size (px)
Citation preview
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Molecular Biology
▪ Three main disciplines of biotechnology – Biochemistry
– Genetics
– Molecular Biology
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Central Dogma
▪ DNA!RNA!Protein!Trait
The Structure of DNA
• Long molecule:
• Three basic components:
• Backbone formed by:
• Nucleotides can be joined together in any order.
History of DNA
• James Watson & Francis Crick (1953)
– Model:
– Discovered hydrogen bonds could form between nitrogenous bases.
– Principle of base pairing
History of DNA
• James Watson & Francis Crick (1953) – Discovered
structure of DNA. – Model was double
helix. • Twisted ladder.
DNA Length
• DNA molecules are very LONG. – Prokaryote: DNA length = 1.6 mm; Cell size = 1.6
µm. • DNA is 1000 X longer than cell.
• Eukaryotes – DNA packed even more tightly.
Chromosome Structure
• Chromosomes
– Packed tightly together to form
• DNA is tightly coiled around proteins
Chromosome Structure
• Chromatin in interphase = bowl of spaghetti. • Chromatin during mitosis = chromosome pairs (X).
DNA Replication
• Structure Meets Function – Structure of DNA explained how it could be copied.
• Each strand can be used to make the other strand.
DNA Replication
• Cell must duplicate its DNA before dividing. – Each new cell has
complete set of DNA molecules.
• DNA molecules separate into two strands.
DNA Replication
• Replication
– Hundreds of sites in genome.
– Occurs in both directions. • Why?
DNA replication animation
DNA Replication
• Replication carried out by enzymes.
• Each new DNA molecule:
Real-time DNA replication
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Central Dogma
▪ DNA!RNA!Protein!Trait – The main flow of protein synthesis in a cell
DNA vs RNA● DNA double helix explains HOW DNA can be replicated● DOES NOT explain how a gene works!
● First step in decoding genes is to copy DNA into RNA.
Structure of RNA● Long chain of nucleotides:
● Structure Meets Function- Three main differences between DNA and RNA:
Types of RNA● Three main types: messenger RNA (mRNA), ribosomal
RNA (rRNA), and transfer RNA (tRNA).
● Ribosomal RNA (rRNA)
Types of RNA● Three main types: messenger RNA (mRNA), ribosomal
RNA (rRNA), and transfer RNA (tRNA).
● Transfer RNA (tRNA)
Making RNA from DNA: Transcription
● The process in a cell by which genetic material is copied from ONE strand of DNA to a complementary strand of RNA for protein production.
● Requires:
● How is RNA polymerase similar to DNA polymerase?
Making RNA from DNA: Transcription
● First step of gene expression.
● Steps of transcription:● RNA polymerase:
● Uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA.● Can either strand of DNA be used as a template?
Making RNA from DNA: Transcription
● How does RNA polymerase know where to begin and where to stop?● RNA polymerase:
Can you work like RNA polymerase and transcribe this DNA?
● TACTAGACGGTAGCACATATG (DNA)● AUGACUGCCAUCGUGUAUAC (RNA)
RNA Editing● mRNA needs to be processed before it reaches its final
destination.
● Gene is broke into 2 parts:● Introns
● Exons
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Central Dogma
▪ DNA!RNA!Protein!Trait – The main flow of protein synthesis in a cell
▪ Exceptions to Central Dogma – Reverse Transcription
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Restriction Enzymes
▪ Formed in bacteria
▪ Recognize
▪ Cut in either
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Restriction Enzymes
▪ Formed in bacteria to resist infection by viral DNA
▪ Recognize a particular nucleotide pattern
▪ Cut in either a blunt or staggered pattern
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Naming Restriction Enzymes
▪ EcoRI – E = – co = – R = – I =
▪ PstI – P = – St = – I =
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Using Restriction Enzymes
▪ Cut source DNA and plasmid DNA with the same enzyme or enzymes
▪ Mix the fragments ▪ Add DNA ligase to reform sugar
phosphate bonds
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
How the Gel Box Works
▪ When gel box is running, water is separated into hydrogen and oxygen gas
▪ Buffers ensure that the pH remains constant
+_
Anode (oxidation):O2 + 4 H+ + 4 e-
e-
e-
Cathode (reduction):
H2OH+ O2
2 H2O4 H+ + 4 e- 2 H2
H2
2 H2 O2
NH+ OHHO
HO
H3C
O
O-
Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›
Gel Imaging and Size Estimation
▪ FAST Blast™ DNA Stain
▪ SYBR® Safe – Inverted image