DNA Structure and Analysis - Norwell High School · Molecular Biology Three main disciplines of ... The process in a cell by which genetic material is copied ... 2014_15_Chapter4_Background_Student_Presentation

DNA Structure and Analysis

Chapter 4: Background

Biotechnology: A Laboratory Skills Course | explorer.bio-rad.com‹#›

Molecular Biology

▪ Three main disciplines of biotechnology – Biochemistry

– Genetics

– Molecular Biology


Central Dogma

▪ DNA!RNA!Protein!Trait

Pop Quiz: What do you know about DNA???

Pop Quiz: What do you know about DNA???

The Structure of DNA

• Long molecule:

• Three basic components:

• Backbone formed by:

• Nucleotides can be joined together in any order.

The Structure of DNA

• Nitrogenous base

• Two Families: – Purines

– Pyrimidines

History of DNA• Chargaff (1952)

History of DNA

• Rosalind Franklin (1952)

History of DNA

• James Watson & Francis Crick (1953)

– Model:

– Discovered hydrogen bonds could form between nitrogenous bases.

– Principle of base pairing

History of DNA

• James Watson & Francis Crick (1953) – Discovered

structure of DNA. – Model was double

helix. • Twisted ladder.

DNA and Chromosomes

• Eukaryotes: DNA located in nucleus in form of chromosomes.

DNA Length

• DNA molecules are very LONG. – Prokaryote: DNA length = Cell

size = • DNA:

DNA Length

• DNA molecules are very LONG. – Prokaryote: DNA length = 1.6 mm; Cell size = 1.6

µm. • DNA is 1000 X longer than cell.

• Eukaryotes – DNA packed even more tightly.

Chromosome Structure

• Chromosomes

– Packed tightly together to form

• DNA is tightly coiled around proteins

Chromosome Structure

• Chromatin in interphase = bowl of spaghetti. • Chromatin during mitosis = chromosome pairs (X).

DNA Replication

• Structure Meets Function – Structure of DNA explained how it could be copied.

• Each strand can be used to make the other strand.

DNA Replication

• Cell must duplicate its DNA before dividing.

DNA Replication

• Cell must duplicate its DNA before dividing. – Each new cell has

complete set of DNA molecules.

• DNA molecules separate into two strands.

DNA Replication

• Replication

– Hundreds of sites in genome.

– Occurs in both directions. • Why?

DNA replication animation

http://www.youtube.com/watch?v=teV62zrm2P0

DNA Replication

• Replication carried out by enzymes.

• Each new DNA molecule:

Real-time DNA replication

http://www.youtube.com/watch?v=yqESR7E4b_8


Central Dogma

▪ DNA!RNA!Protein!Trait – The main flow of protein synthesis in a cell

DNA vs RNA● DNA double helix explains HOW DNA can be replicated● DOES NOT explain how a gene works!

Central Dogma of Biology

● Two BIG Steps:

DNA vs RNA● DNA double helix explains HOW DNA can be replicated● DOES NOT explain how a gene works!

● First step in decoding genes is to copy DNA into RNA.

Structure of RNA● Long chain of nucleotides:

● Structure Meets Function- Three main differences between DNA and RNA:

Structure of RNA vs DNA

Structure of RNA● Analogy: RNA is a working copy of a single gene.

● Main function:

Types of RNA● Three main types:

● Messenger RNA (mRNA)

Types of RNA● Three main types: messenger RNA (mRNA), ribosomal

RNA (rRNA), and transfer RNA (tRNA).

● Ribosomal RNA (rRNA)

Types of RNA● Three main types: messenger RNA (mRNA), ribosomal

RNA (rRNA), and transfer RNA (tRNA).

● Transfer RNA (tRNA)

Making RNA from DNA: Transcription

● The process in a cell by which genetic material is copied from ONE strand of DNA to a complementary strand of RNA for protein production.

● Requires:

● How is RNA polymerase similar to DNA polymerase?


● Sense strand● Template

● Antisense strand

● RNA polymerase


● First step of gene expression.

● Steps of transcription:● RNA polymerase:

● Uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA.● Can either strand of DNA be used as a template?


● How does RNA polymerase know where to begin and where to stop?● RNA polymerase:


● How does RNA polymerase know where to begin and where to stop?

Can you work like RNA polymerase and transcribe this DNA?

● TACTAGACGGTAGCACATATG (DNA)

Can you work like RNA polymerase and transcribe this DNA?

● TACTAGACGGTAGCACATATG (DNA)● AUGACUGCCAUCGUGUAUAC (RNA)

RNA Editing● mRNA needs to be processed before it reaches its final

destination.

● Gene is broke into 2 parts:● Introns

● Exons

RNA Editing

● An enzyme:

● A cap and a tail:


Central Dogma

▪ DNA!RNA!Protein!Trait – The main flow of protein synthesis in a cell

▪ Exceptions to Central Dogma – Reverse Transcription


Restriction Enzymes

▪ Formed in bacteria

▪ Recognize

▪ Cut in either


Restriction Enzymes

▪ Formed in bacteria to resist infection by viral DNA

▪ Recognize a particular nucleotide pattern

▪ Cut in either a blunt or staggered pattern


Naming Restriction Enzymes

▪ EcoRI – E = – co = – R = – I =

▪ PstI – P = – St = – I =


Using Restriction Enzymes

▪ Cut source DNA and plasmid DNA with the same enzyme or enzymes

▪ Mix the fragments ▪ Add DNA ligase to reform sugar

phosphate bonds


Electrophoresis


How the Gel Box Works

▪ When gel box is running, water is separated into hydrogen and oxygen gas

▪ Buffers ensure that the pH remains constant

+_

Anode (oxidation):O2 + 4 H+ + 4 e-

e-

e-

Cathode (reduction):

H2OH+ O2

2 H2O4 H+ + 4 e- 2 H2

H2

2 H2 O2

NH+ OHHO

HO

H3C

O

O-


Gel Imaging and Size Estimation

▪ FAST Blast™ DNA Stain

▪ SYBR® Safe – Inverted image


Size Estimation

Size

, bas

e pa

irs

100

1,000

10,000

100,000

Distance, mm0 6 12 18 24

B

A

Size (bp) Distance (mm)

23,000 11.0 9,400 13.0

6,500 15.0

4,400 18.0

2,300 23.0

2,000 24.0

Documents

DNA Structure and Analysis - Norwell High School · Molecular Biology Three main disciplines of ... The process in a cell by which genetic material is copied ... 2014_15_Chapter4_Background_Student_Presentation