Dna Fp...Mahtab

Embed Size (px)

Citation preview

  • 7/30/2019 Dna Fp...Mahtab

    1/24

    MD.MAHTABM.Sc.

    BIOTECHNOLOGY

  • 7/30/2019 Dna Fp...Mahtab

    2/24

    Era of DNA Technology:Information through

    DNA

    The molecule is so beautiful. Its glory was reflected on Francis and me.

    - James Watson on DNA

  • 7/30/2019 Dna Fp...Mahtab

    3/24

    Biometricsuniquely recognizing humans

  • 7/30/2019 Dna Fp...Mahtab

    4/24

    The blueprints (genetic information) formaking proteins is stored within our DNA. It is

    the job of DNA to control the order in whichthese 20 different amino acids are put together.

    The DNA of every human being on the planet is99.9% the same. It is the 0.1% that makes all

    the difference!

    Any type of organism can be identified byexamination of DNA sequences which is

    unique to that species.

    The molecule of life: DNA

  • 7/30/2019 Dna Fp...Mahtab

    5/24

    Technology Transition

    DNA Fingerprinting Dr. Alec Jeffrey 1985

    DNA Profiling FBI (RFLP) 1988

    PCR STRs 1993

    Mitochondrial DNA - 1996

    SNPs

    Chips

  • 7/30/2019 Dna Fp...Mahtab

    6/24

    YOUR DNA: Your Ultimate Genetic Bar Code

    DNA Fingerprinting is a methodwhere:

    a persons genetic traits, genes, are

    used to make specific strings of DNA

    letters that are cut into patterns ofshorter strings separated by length

    these banding patterns canidentify a unique human being!

    YOUR DNABandingPattern Will Identify

    YOU! Image of a DNA fingerprint

  • 7/30/2019 Dna Fp...Mahtab

    7/24

  • 7/30/2019 Dna Fp...Mahtab

    8/24

    Restriction Fragment Length

    Polymorphism (RFLP)

    Detects a single base pair change in DNA

    Must occur within a restriction enzyme cleavage sequence to be

    visible

    It is the length differences associated with DNA strandsor RFLPs that allow one to distinguish one person fromanother

    Often used in disease screening such as in the detection ofsickle cell anemia

  • 7/30/2019 Dna Fp...Mahtab

    9/24

    RFLP

  • 7/30/2019 Dna Fp...Mahtab

    10/24

  • 7/30/2019 Dna Fp...Mahtab

    11/24

    What creates this unique pattern?

    Satellite DNA: repetitive DNA sequence.

    Macrosatellite: core sequence 100 to 6500bp

    Minisatellite: core sequence of 10-20bp repeatedmultiple times

    Microsatellite: small arrays of tandem repeats of2 to 4bp in length

  • 7/30/2019 Dna Fp...Mahtab

    12/24

    Repeats of Satellite DNA

    Repeat units vary in length from 2bp to long stretches of6000bp or more

    These repeat units are lined up head to tail and composesatellite DNA and are interspersed throughout the genome

    The number of units varies person to person

    Thus these sequences are calledVNTRs (variable numberof tandem repeats)

    A VNTR is a locus that is hyper variable due to a largenumber of alleles each characterized by a differentnumber of repeat units

  • 7/30/2019 Dna Fp...Mahtab

    13/24

    Southern blotting can be used to visualize the variation

    Probes specific to the repeat unit are hybridized to DNAcut with a restriction enzyme that cuts just outside theVNTR

    This allows for the difference in VNTR length to be

    detected

    Two commonly used probes are known as:

    33.6 (AGGGCTGGAGG)18

    31.5 (AGAGGTGGGCAGGTGG)29

    These are multi-locus minisatellite probesand show about17 different DNA bands for each individual

  • 7/30/2019 Dna Fp...Mahtab

    14/24

    PCR amplification of VNTR

    PCR is particularly useful in forensic analysis as it allowsminute amounts of DNA to be analyzed

    DNA can be obtained from blood stains, semen, saliva, orhair roots

    Instead of digesting the DNA PCR is used to amplify theVNTRs and the products are run on a gel and visualized by

    stainingThis process requires primers that anneal just outside theVNTR

  • 7/30/2019 Dna Fp...Mahtab

    15/24

  • 7/30/2019 Dna Fp...Mahtab

    16/24

  • 7/30/2019 Dna Fp...Mahtab

    17/24

    Short Tandem Repeats (STR)

    Are a variation on VNTRs, but use the smallest repeatsunits often only 2 to 4 bp in length

    aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatgga

    gt

    tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacg

    aa

    ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacag

    at

    tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatt

    tg

    13 core loci of tetrameric repeats are tested together tomake a DNA profile

    The sequence above is locus D7S280 which is located on

    chromosome 7

  • 7/30/2019 Dna Fp...Mahtab

    18/24

  • 7/30/2019 Dna Fp...Mahtab

    19/24

    CriminalIdentification &Forensics

    DNA fingerprints can be usedas biological evidence

    Strands of DNA can be foundon hair, blood or semen.

    DNA isolated from thoseevidence can be comparedthrough VNTR patterns.

    Useful in solving crimes likemurder and rape.

    Example: The scandal ofPresident Clinton with MonicaLewinsky

    http://rds.yahoo.com/S=96062857/K=Lewinsky+and+Clinton/v=2/TID=I001_0/SID=w/l=II/SS=i/OID=ed8d134fe00a0c5a/R=1/*-http://images.search.yahoo.com/search/images/view?back=http%3a//images.search.yahoo.com/search/images%3fsrch=1%26p=Lewinsky%2band%2bClinton%26ei=UTF-8%26n=20%26fl=0&h=121&w=150&imgcurl=www.washingtonpost.com/wp-srv/images/homepg2/clinton_lewinsky_montage.jpg&imgurl=www.washingtonpost.com/wp-srv/images/homepg2/clinton_lewinsky_montage.jpg&name=%3cb%3eclinton%3c/b%3e_%3cb%3elewinsky%3c/b%3e_montage.jpg&p=Lewinsky+and+Clinton&rurl=http%3a//www.washingtonpost.com/wp-srv/politics/special/clinton/faq.htm&rcurl=http%3a//www.washingtonpost.com/wp-srv/politics/special/clinton/faq.htm&type=jpeg&no=1&tt=137http://rds.yahoo.com/S=96062857/K=DNA+fingerprinting/v=2/TID=I001_0/SID=w/l=II/SS=i/OID=cd44fa1707c4864a/R=3/*-http://images.search.yahoo.com/search/images/view?back=http%3a//images.search.yahoo.com/search/images%3fp=DNA%2bfingerprinting%26ei=UTF-8%26cop=mss%26tab=3%26b=1&h=208&w=106&imgcurl=www.vetark.co.uk/Images/DNA%2520fingerprint.jpeg&imgurl=www.vetark.co.uk/Images/DNA%2520fingerprint.jpeg&name=%3cb%3eDNA%3c/b%3e+fingerprint.jpeg&p=DNA+fingerprinting&rurl=http%3a//www.vetark.co.uk/birdDNApages.html&rcurl=http%3a//www.vetark.co.uk/birdDNApages.html&type=jpeg&no=3&tt=364http://en.wikipedia.org/wiki/File:Codis.svg
  • 7/30/2019 Dna Fp...Mahtab

    20/24

    CODISCombined DNA Index

    System

    National software developed by the FBI

    Distributed to local, state, and national crime labs

    All 50 states mandate inclusion of DNA fingerprint (if available)from violent and sexually motivated crimes

    Mostly a database of STR regions

    Thousands of matches have led to the capture of criminals thatotherwise would not have been caught

    This has led numerous people to suggest a national DNA database

    that would include only polymorphism information

    http://en.wikipedia.org/wiki/File:Codis.svg
  • 7/30/2019 Dna Fp...Mahtab

    21/24

  • 7/30/2019 Dna Fp...Mahtab

    22/24

    Parentage tests

    determine if the alleged father of a child is

    the biological father

    The child (C) will share one band with thebiological mother (M) and one band with

    alleged father #1 (AF1), the biological father.

    No bands are shared between the child andalleged father #2 (AF2), the excluded male.

  • 7/30/2019 Dna Fp...Mahtab

    23/24

    References DNA Fingerprinting Using Amplified Fragment Length Polymorphisms (RFLP)

    By: Heidi Chial, Ph.D. (Write Science Right) 2008 Nature Education

    Citation: Chial, H. (2008) DNA fingerprinting using amplified fragment length polymorphisms (AFLP): No genomesequence required. Nature Education1(1)

    Forensics, DNA Fingerprinting, and CODIS

    By: Karen Norrgard, Ph.D. (Write Science Right) 2008 Nature Education

    Citation: Norrgard, K. (2008) Forensics, DNA fingerprinting, and CODIS. Nature Education1(1)

    "CODIS National DNA Index System". Fbi.gov. Retrieved 2010-04-03.

    Codis Statistics, 06/2008,

    (http://www.fbi.gov/hq/lab/codis/clickmap.htm)

    Kijkmagazine, 01 January 2009

    Use of DNA in Identification". Accessexcellence.org. Retrieved 2010-04-03.

    "Restrictions on use and destruction of fingerprints and samples". Wikicrimeline.co.uk. 2009-09-01. Retrieved 2010-04-03.

    Lewinsky scandal", The Columbia Encyclopedia, Sixth Edition, 2008,As Retrieved 2010-02-09

    John M. Butler, Forensic DNA Typing: Biology, Technology, and Genetics of STR Markers, Second Edition, Academic

    Press, 2005.

    DNA Fingerprint Analysis of Three Short Tandem Repeat (STR)

    Loci for Biochemistry and Forensic Science Laboratory CoursesS

    Received for publication, November 21, 2005, and in revised form, April 3, 2006 Kathleen McNamara-Schroeder,

    Cheryl Olonan, Simon Chu, Maria C. Montoya, Mahta Alviri,

    Shannon Ginty, and John J. Love

    From the Department of Chemistry and Biochemistry, San Diego State University,

    San Diego, California 92182-1030

    http://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.accessexcellence.org/RC/AB/BA/Use_of_DNA_Identification.phphttp://www.wikicrimeline.co.uk/index.php?title=Identification_by_body_samples_and_impressionshttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.wikicrimeline.co.uk/index.php?title=Identification_by_body_samples_and_impressionshttp://www.accessexcellence.org/RC/AB/BA/Use_of_DNA_Identification.phphttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htm
  • 7/30/2019 Dna Fp...Mahtab

    24/24