Development and evaluation of a recombinase polymerase … · 2020. 9. 2. · RESEARCH Open Access Development and evaluation of a recombinase polymerase amplification assay for rapid

RESEARCH Open Access

Development and evaluation of arecombinase polymerase amplificationassay for rapid detection of strawberry redstele pathogenMustafa Ahmad Munawar1* , Anna Toljamo1, Frank Martin2, Elina Oksanen1 and Harri Kokko1

Abstract

Phytophthora fragariae causes drastic damage in strawberry crops. P. fragariae infects strawberry roots and causesred stele root rot. Although P. fragariae is a quarantine organism, its spread in Finland continues as more and morefields contract the disease. The spread can be halted through developing rapid and reliable detection assays. Wehave developed a rapid recombinase polymerase amplification (RPA) assay for P. fragariae targeting thePhytophthora mitochondrial DNA intergenic atp9-nad9 marker. The assay is DNA-extraction free and capable ofdetecting as low as 10 fg of P. fragariae genomic DNA. We found the assay reliable for diagnosing field plants whensamples are adequately collected. We also applied the RPA assay to the detection of the pathogen in the soilthrough coupling the assay with baiting with the host plant. The results suggest that if only a small number ofsamples are analysed, the baiting results will not be reliable.

Keywords: Phytophthora fragariae, Red stele, Recombinase polymerase amplification, Crude maceration, Baiting,Indicator plants

BackgroundPhytophthora fragariae is a quarantine organism (A2 listof EPPO) and causes red stele root rot of strawberry.This disease is common in regions with cool and moistclimates, with damage more extensive in heavy saturatedclay soils and during early or late summer. The pathogenfirst destroys fine roots and later progresses upwards inthe stele of larger roots. Plants wilting usually first ap-pears in low or poorly drained areas of fields and the af-fected area progressively widens over time. When plantswith early wilting symptoms are dug out, their majorroots have less lateral roots and present a ‘rat-tail ap-pearance’. Dissecting major roots upwards displays ab-normal reddish colour in internal cores known as ‘red

stele’ and considered as a typical diagnostic feature ofthe disease. The disease has drastic nature and causeswilting, stunted growth, less or no strawberries and fewstolons. Moreover, the pathogen can persist at least tenyears in infested soils through its survival form of oo-spores (Maas, 1998; Ellis, 2008; Newton et al. 2010).The disease has badly damaged strawberry crops in

North America, Switzerland, Germany, France andSweden (Maas 1998). P. fragariae was not present inFinland according to the EPPO/ CABI, 1997. The absenceof the pathogen was also confirmed by the countrywidesurvey for red-stele disease conducted on strawberry rootscollected in 1995 (Pohto 1999). However, in 2012 EVIRA(Finnish Food Safety Authority) surprisingly detected P.fragariae for the first time among 55 of the strawberryplantations collected from outdoor horticultural produc-tion in different regions of Finland (EVIRA 2013). InNorth Savo region of Finland, we have observed crop

© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you giveappropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate ifchanges were made. The images or other third party material in this article are included in the article's Creative Commonslicence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtainpermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

* Correspondence: [email protected] of Environmental and Biological Sciences, University of EasternFinland, 70211 Kuopio, FinlandFull list of author information is available at the end of the article

Phytopathology ResearchMunawar et al. Phytopathology Research (2020) 2:26 https://doi.org/10.1186/s42483-020-00069-4

http://crossmark.crossref.org/dialog/?doi=10.1186/s42483-020-00069-4&domain=pdfhttp://orcid.org/0000-0002-2604-850Xhttp://creativecommons.org/licenses/by/4.0/mailto:[email protected]

damages (loss of plants) of up to 90%, while we have diag-nosed 17 fields with red stele among the 42 problematicfields investigated in summer 2017 and 2018. Strawberrycrop has a unique importance in Finland. Out of the total19,131 ha open area cultivated during 2018 in Finland,4160 ha area produced strawberry with a total yield over15 million kg (Niemi and Väre 2019).Common techniques employed for Phytophthora diag-

nosis include symptom observation, microscopy, baiting,immunological assays, and polymerase chain reaction(PCR) (Martin et al. 2012). Duncan (1976) employedsusceptible alpine strawberry as bait to quantify thepathogen in infested soils. The bait plants Fragaria vescaclone VS1, and Fragaria vesca var. alpina (Baron Sole-macher) were planted with different dilutions of soil andkept at 15 °C for 5 weeks. After 5 weeks, bait plants wereexamined for red steles and oospore presence. In an-other article, Duncan (1980) presented a root-tip baitmethod for the detection of red stele disease in stockplants. In this method, root tips were collected fromstock plants and mixed with compost. Then the tips-compost mixtures were added to pots and planted withbait plants Fragaria vesca var. alpina (Baron Solema-cher). Plant pots were watered every 6 h through mist ir-rigation, and the temperature was maintained at 15 °C.After 5 weeks, bait plants were examined for red stelesand oospore presence. The root-tip baiting was reportedsufficiently sensitive with capability to detect even oneinfected plant among 99 healthy ones.For immunological diagnosis, antisera raised against

mycelia of Phytophthora fragariae showed cross-reactivity with other Phytophthora and Pythium species(Amouzou-Alladaye et al. 1988; Werres 1988; Mohan1989). In contrast, PCR development has been successfulover time. The foremost PCR assays developed for thedetection of P. fragariae utilized the multicopy internaltranscribed spacer (ITS) region. Stammler and Seemüller(1993) developed a PCR assay from the ITS region ofthe rDNA for the detection of Phytophthora rubi andfound the assay equally specific for P. fragariae. LaterBonants et al. (1997) found the assay less sensitive andcross-reacting with Phytophthora citrophthora, Phy-tophthora nicotianae A1 and Phytophthora capsici.Using the ITS region, Bonants et al. (1997) further devel-oped a nested PCR assay, and improved specificity andsensitivity of P. fragariae detection. The nested PCR wasable to detect the pathogen in symptomless plants witha sensitivity reported down to twenty zoospores. Thenested PCR was also coupled with ELISA (enzyme-linked immunosorbent assay), and for the purpose, acapture probe was designed according to an ITS 1 loca-tion with maximum basepair difference from other Phy-tophthora species. The PCR-ELISA design resulted insuperior specificity. In a separate study, Bonants et al.

(2004) coupled the nested PCR assay with bait test andshortened the baiting time up to 14 days. The study alsocompared the sensitivity of different PCR formats for thedetection of P. fragariae DNA. The PCR formats of gelelectrophoresis, PCR-ELISA, TaqMan, and MolecularBeacon were reported equally sensitive, all detecting aslow as 100 ag P. fragariae DNA through nested PCR. Incontrast, the DIAPOPS (detection of immobilized ampli-fied product in a one-phase system) format was reportedless sensitive with detection limit as low as 10 fg P. fra-gariae DNA through nested PCR.Besides development of Phytophthora species-level PCR

assays, the ITS region has also been utilized to developPhytophthora genus-specific PCR assays and those assayswere coupled with restriction enzymes or sequencing toidentify different Phytophthora species including P. fragar-iae (Cooke and Duncan 1997; Ristaino et al. 1998; Cameleet al. 2005; Drenth et al. 2006). Single copy genes contain-ing introns have also been employed for P. fragariae-spe-cific PCR assays. Ioos et al. (2006) developed single-roundPCR assays from RAS-like and TRP1 genes with sensitivitydown to 100 fg. Recently, a multicopy mitochondrialmarker, the spacer between the atp9-nad9 genes, with anappropriate level of variation among Phytophthora specieswas used to develop species-specific diagnostic assays.The atp9-nad9 is a unique marker of the genus Phy-tophthora and it is a highly conserved gene order presentin almost all the Phytophthora species but absent in therelated genus Pythium, Eumycotan fungi and plants (Bilo-deau et al. 2014; Miles et al. 2015; Miles et al. 2017). Withthis locus several Phytophthora species-specific assayshave been developed, including assays for P. fragariae:TaqMan qPCR assays (Bilodeau et al. 2014; Miles et al.2017; Rojas et al. 2017; Hao et al. 2018; Munawar et al.2020), SYBR Green PCR assays (Munawar et al. 2020),and recombinase polymerase amplification (RPA) assays(Miles et al. 2015; Rojas et al. 2017; Munawar et al. 2019).Certified commercial plant stock was reported to have

been infected with red stele (Duncan 1980). In 2017, wehave also found red steles in one of the certified nurseryplant boxes imported from another EU member countryto the North Karelia region of Finland. P. fragariae in-fection also has a cryptic nature and can be distributedvia asymptomatic exported plants. Besides the crypticnature of the pathogen, disease symptoms may alsodisappear during warm summer weather (McGrew1889). Moreover, in the case of extensive field dam-age, the leftover plants do not always present redsteles. For these reasons, a rapid, sensitive, on-siteand reliable assay such as RPA is of the utmost im-portance. In this study we are presenting developmentof an RPA assay for detection of P. fragariae throughatp9-nad9 marker, following our previous assay de-sign (Munawar et al. 2019).

Munawar et al. Phytopathology Research (2020) 2:26 Page 2 of 12

ResultsIsolation of P. fragariae and sequencing of atp9-nad9markerFor isolation of P. fragariae from infected field plants,we collected red cores, disinfected them with the trad-itional isolation reagent ‘Teepol L Detergent’ or routine70% ethanol, and plated them on Phytophthora selectiveagar. Images of an infected plant, rat-tails, and red coresare presented in Fig. 1. We performed isolation trials for17 red stele-infected fields but succeeded with only threefields. We also compared the traditional Teepol L Deter-gent disinfection method with the routine 70% ethanoldisinfection during isolation trials from three of the in-fected fields. We found no difference between the twomethods in restriction of contaminant growth on thePhytophthora selective agar. Moreover, we sequencedthe three of our P. fragariae isolates (MRV1, VTJ1 andKRT1), the SCRP245 fvf7 P. fragariae isolate, and five P.fragariae infected plants, all originating from differentfields, and observed unvaried atp-nad9 sequence identi-cal to the GenBank accession numbers JF771842,JF771843, or JF771844.

Optimum RPA assayMiles et al. (2015) provided partial atp9-nad9 sequencesof more than one hundred Phytophthora species to sup-port further development of Phytophthora assays. We

aligned those sequences with Geneious 8.1.9 (Geneious,New Zealand) and recognized the partial atp9 gene se-quence, intergenic spacer, and partial nad9 gene se-quences. We have presented alignment of the atp9-nad9sequences, keeping one isolate per Phytophthora species(Additional file 1: Figure S1). Subsequently, we designedan RPA assay by picking forward RPA primers from thegenus-conserved region of the atp9 gene, and reverseRPA primers and an overlapping reverse probe (Twis-tAmp exo probe) from the intergenic spacer betweenthe atp9 and nad9 genes. The positions of each primerand probe for the optimized RPA assay are presented inFig. 2.The RPA assay was optimum with the forward primer

‘Phy_Gen_F3’ at a concentration of 600 nM (3 μL of10 μM), reverse primer ‘Phy_Frag_R29’ at a concentra-tion of 260 nM (1.3 μL of 10 μM), and the probe ‘Phy_Frag_RevP3’ at a concentration of 100 nM (0.5 μL of10 μM). Rest of the components were kept as per manu-facturer’s recommendations. Template or maceratedsample volume was kept at 1 μL. Primer and probe se-quences are presented in Table 1.

Sensitivity and specificity of RPA assayWe evaluated sensitivity of the RPA assay through amp-lifying 1/10 dilution of P. fragariae (MRV1 isolate) gen-omic DNA ranging from 1 ng/μL to 1 fg/μL. Weprepared dilutions of genomic DNA extracted fromdried hyphae of P. fragariae and quantified with a Qubit2.0 Fluorometer, utilizing Qubit dsDNA HS Assay Kit(Thermo Fisher Scientific). We found the RPA assaycould consistently detect down to 10 fg of P. fragariaegenomic DNA (five repeats). Amplification curves are pre-sented in Fig. 3. We repeated the amplification of DNA di-lutions after spiking individual RPA reaction with 1 μL ofhealthy rootlet macerate. Spiking with healthy rootletsmacerate slightly raised baseline fluorescence signal in alltubes and only lessened steepness of 10 fg curve (data notshown). We also compared the sensitivity of the RPAassay in parallel with the P. fragariae-specific SYBR Greenand TaqMan PCR assays described by Munawar et al.(2020) and Bilodeau et al. (2014). The result showed thatthe P. fragariae-specific TaqMan and SYBR PCR assaysare more sensitive with a detection limit down to 1 fg of P.fragariae genomic DNA (four replicates for both PCR as-says). The RPA assay amplified all of the four P. fragariaeisolates and presented no amplification with 50–100 pgDNA of Phytophthora cactorum, Phytophthora taxonraspberry, Phytophthora megasperma, Phytophthora rosa-cearum, Phytophthora ramorum, Phytophthora plurivora,Phytophthora pini, Phytophthora cambivora, Phytophthoracinnamomi, Pythium sylvaticum, Botrytis cinerea, Colleto-trichum acutatum, Mucor hiemalis, Fusarium avenaceum,and Fusarium proliferatum. Details of the isolates utilized

Fig. 1 Typical symptoms of red stele disease of strawberry. a Astunted plant held by hands. The plant is suffering from red steledisease and the yellow arrows are pointing to the dissected rat-tailsdisplaying red cores. b A detached dissected rat-tail root displayingred core. c A fully pealed root core prior to plating on Phytophthoraselective agar. The lower part of the core has turned red due to redstele disease


in sensitivity and specificity analyses are provided inTable 2.

Maceration bufferMiles et al. (2015) tested different commercial andhomemade buffers for their suitability for maceration ofplant tissues aimed at RPA, and found GEB 2 (AgdiaInc. Unites States) and standard ELISA grinding buffersuitable for the purpose. We further investigated if allcomponents of the homemade standard ELISA grindingbuffer are crucial. We prepared a standard ELISA grind-ing buffer as 1× phosphate-buffered saline buffer supple-mented with 2 g of bovine serum albumin (BSA), 20 g ofPVP-40, and 0.5 mL of Tween 20 per litre buffer. Wealso prepared three modified ELISA grinding buffers,each missing one of the crucial components: BSA-free,PVP-free and Tween-free ELISA grinding buffers. Allbuffers were prepared without pH adjustment. We col-lected fine rootlets from naturally infected plants, andpooled, chopped, divided them equally into four 2 mLround-bottom Eppendorf tubes and weighted to prepare1:10 (w/v) macerates. We macerated three samples witheither BSA-free, PVP-free, or Tween-free ELISA grind-ing buffer and the fourth sample with a standard ELISAgrinding buffer. After maceration, we tested superna-tants from the four tubes with the RPA assay. We sur-prisingly found that the three rootlet samples maceratedin BSA-free, PVP-free and Tween-free ELISA grindingbuffers, and the fourth rootlet sample macerated instandard ELISA grinding buffer (full components) all

gave equal amplification curves. We repeated the experi-ment and included a fifth tube in which rootlets weremacerated only in autoclaved distilled water. All the fivetubes had equal amplification curves with onset of am-plifications between 5.0 and 5.5 min.

Field validationIn the field validation by Munawar et al. (2020), 22 finerootlet samples were collected or received from differentproblematic fields of North Savo region of Finland,crudely macerated in water for doing some RPA assayand also for extraction of DNA for further validation.The DNA samples were analyzed with P. fragariae- andP. cactorum-specific PCR assays, and a Phytophthoragenus-specific PCR assay aimed for Sanger sequencing.The validation revealed that among the 22 rootlet sam-ples, nine contained P. fragariae, one was co-infectedwith both P. fragariae and P. cactorum, and four con-tained P. cactorum. We also analyzed the rootlet macer-ates prepared by Munawar et al. (2020) in parallel withthe P. fragariae-specific RPA assay of this study andcompared the results. The P. fragariae-specific RPAassay of this study gave identical results with the tenrootlet samples containing P. fragariae. We alsomatched the results with plant symptoms and foundnine out of the ten positive plants had typical red steles.Detailed results of the field validation are presented inTable 3. RPA results were recorded as time (minutes) ofonset of amplification while PCR results are presented asCt (cycle threshold).

Fig. 2 Location of primers and probe in the RPA assay

Table 1 Sequences of the optimal primers and probe for the RPA assay

Primer/ probe Name Sequence (5′-3′)

Forward primer Phy_Gen_F3 TGATGGCTTTCTTAATTTTATTTGCTTTTTA

Reverse Primer Phy_Frag_R29 TGTTTGAAAAGAGCTAATTACGTATTAAATAT

TwistAmp exo probe Phy_Frag_RevP3 AATTACGTATTAAATATACATATATATC-T(ROX)-A-(dSpacer)-T(BHQ2)-ACGAGATTAATATAAT[3′-C3SPACER]


Soil testingTo evaluate combination of baiting and the RPA assayfor testing soil contamination with P. fragariae, weemployed three contaminated fields located in NorthSavo region of Finland and labelled them as A, B and Cfield. Similarly, we adopted two methods for baiting inthe evaluation. In the first method, indicator plants Fra-garia vesca var. alpina (Baron Solemacher), grown fromseeds and approximately two months old, were plantedin fields A and B for five weeks. The field A was activelysuffering from red stele and at a low site, strawberryplants were progressively dying. We planted five indica-tor plants at the low site. The field B was cultivated withgreen peas, but it had a history of red stele infection afew years ago. We planted 10 indicator plants randomlyacross the field. After five weeks, we removed the indica-tor plants from fields A and B, observed symptoms andtested them with the RPA assay. We found all the fiveindicator plants from the field A were positive with theRPA assay while only one of them had typical symptomof red steles. Regarding the 10 indicator plants collectedfrom the field B, none of them had red steles, while onlyone turned positive with the RPA assay.In the second method of baiting, we utilized baiting

units and soil samples from field C. Strawberry field Cwas destroyed by red stele disease in 2016 and 2017. Insummer 2017, the farmer cultivated hemp on half of thefield and green peas on the other half. The field C hasan inclination, but no particular low or poorly drainedsite. In spring 2018, we collected eight soil samples fromlower and hemp side, and eight soil samples from lowerand pea side. We transferred the 16 soil samples intobaiting units and also set up two negative and two posi-tive control baiting units. Positive units were added withsoil containing artificially infected strawberry roots (fromanother study), while in negative units, containers were

solely filled with distilled water. On day 7, 10, 14, 21, 35,and 49 we removed three indicator plants or their rootshanging in the water from each baiting unit, pooledthem and tested with the RPA assay. On day 7, two ofthe eight baiting units containing soil from hemp side ofthe field were positive, while none of the units represent-ing the pea side were positive with the P. fragariae RPAassay. Positive controls were also positive for P. fragariaeon day 7. On the 10th day, positive units among thehemp-related baiting units remained at two, while oneunit was positive among the eight baiting units contain-ing soil from pea side of the field. On day 14 resultswere the same as day 10. On the 21st day, the RPA re-sults remain unchanged for soil from the hemp croppedfield, while another unit was positive (total two) amongthe eight pea-related baiting units. RPA testing on the35th day (5 weeks) revealed a total of three positiveamong the eight units containing soil from the hempside of the contaminated field, while positive unitsamong the baiting units added with soil from pea side ofthe field remained two. On day 49 results were the sameas day 35. The rootlets from negative control unitsremained negative till day 49. We also noticed darkeningof the roots in all positive baiting units after around aweek of RPA positivity. The results of soil testingthrough baiting units are summarized in Table 4.

DiscussionDesigning a species-specific PCR detection assay re-quires a marker with high discriminatory power, with asuperior sensitivity achieved through the use of a multi-copy marker. The ITS region is a high-copy locus widelyused for species identification, but it has limited reso-lution power to discriminate among Phytophthora spe-cies. Recently, Phytophthora species-specific RPA assaystargeting the single copy gene Ypt1 have been developed

Fig. 3 Amplification curves of RPA assay for concentrations ranging from 1 ng to 10 fg purified genomic DNA of P. fragariae


(Dai et al. 2019a; Dai et al. 2019b; Yu et al. 2019). In con-trast, the mitochondrial atp9-nad9 marker is a multicopylocus and exhibits enough sequence divergence for design-ing assay on species-level identification of Phytophthora.The atp9-nad9 marker is unique to genus Phytophthorabut is absent in related genus Pythium, Eumycotan fungiand plants (Bilodeau et al. 2014; Miles et al. 2015; Mileset al. 2017). For these reasons, we also targeted the atp9-nad9 marker for designing P. fragariae-specific RPA assay.Although species-level RPA assays were successfully

developed in a wide range of Phytophthora taxa by usingthe atp9-nad9 marker (Miles et al. 2015; Rojas et al.2017), RPA assay of this study has only been validatedagainst a limited number of taxa due to limited resourcesand therefore, we strongly recommend further analysis ofspecificity with more taxa.In our RPA primer screening process, we faced the

challenge of background amplification that was resolvedthrough redesigning reverse primers from adjacent loca-tions. RPA primers depend on enzymes and proteins for

Table 2 Isolates utilized in sensitivity and specificity analyses and their origins

Species Isolatenumber

Host Source/Origin Result ofspecificityanalysis

Phytophthorafragariae

MRV1 Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland

Amplificationonset at ~ 5min


VTJ1 Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland



KRT1 Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland



SCRP245fvf7

Fragaria ananassa Most probably isolated from United Kingdom Amplificationonset at ~ 5min

Phytophthoracactorum

PO245 Fragaria ananassa Isolated from Poland and donated by Grażyna Szkuta fromPaństwowa Inspekcja Ochrony Roślin i Nasiennictwa

Noamplification

Phytophthorataxon raspberry

GE5 Unknown (species also confirmedthrough atp9-nad9 sequencing)

Unknown origin Noamplification

Phytophthoramegasperma

GE9 Unknown (species also confirmedthrough atp9-nad9 sequencing)


Phytophthorarosacearum

SO18 Unknown (species also confirmedthrough atp9-nad9 sequencing)


Phytophthoraramorum

Ph426 Rhododendron catawbiense‘Grandiflorum’

Isolated from Finland and donated by Anna Poimala from theNatural Resources Institute Finland (Luke)

Noamplification

Phytophthoraplurivora

Ph441 Rhododendron ‘Marketta’ Isolated from Finland and donated by Anna Poimala from theNatural Resources Institute Finland (Luke)

Noamplification

Phytophthorapini

Ph443 Rhododendron ‘Capistrano’ Isolated from Finland and donated by Anna Poimala from theNatural Resources Institute Finland (Luke)

Noamplification

Phytophthoracambivora

BBA 21/95-K II

Chamaecyparis lawsoniana‘Columnaris’

Isolated from Germany and donated by Sabine Werres from JuliusKühn-Institut (JKI)

Noamplification

Phytophthoracinnamomi

BBA62660 Rhododendron sp. Isolated from Germany and donated by Sabine Werres from JuliusKühn-Institut (JKI)

Noamplification

Pythiumsylvaticum

ISO-VTJC Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland

Noamplification

Botrytis cinerea ISO-57C Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland

Noamplification

Colletotrichumacutatum

PCF753 Fragaria ananassa Isolated from Belgium and DNA donated by Jane Debode fromthe Institute for Agricultural, Fisheries and Food Research (ILVO)

Noamplification

Mucor hiemalis ISO-125-MKR

Fragaria ananassa Isolated from North Savo region of Finland by the University ofEastern Finland

Noamplification

Fusariumavenaceum

ISO2-125-MKR


Noamplification

Fusariumproliferatum

Tiste Koe25


Noamplification


their binding with template and limited knowledge isavailable about the phenomena which makes some RPAprimers overly reactive and some primers non-reactive.Moreover, in our RPA assay, the TwistAmp exo probewas designed with ROX as fluorophore and BHQ2 as

quencher, and we observed a slight rise in baseline fluor-escence upon addition of macerate. The fluorescencesignal rise wasn’t observed upon DNA addition. To com-bat the problem, we reduced the probe concentrationfrom the recommended volume of 0.6 μL per reaction to

Table 3 Field validation results

Rootlet sampleNo.

P. fragariae-specific RPAassay of this study

P. fragariae-specific SYBRGreen PCR assay

P. fragariae-specificTaqMan PCR assay

Sanger’ssequencingresults

Symptoms

98 PositiveOnset at ~ 5 min

30.7 Ct 34.6 Ct 100% identicalto JF771842

Wilting, stunting and redsteles













106 Negative No Ct No Ct No amplification Stunting




108 (co-infectedsample)

PositiveOnset at ~ 6 min


Wilting, stunting, red steles,and typical crown rot






112 Negative No Ct No Ct No amplification Apparently healthy

114 Negative No Ct No Ct No amplification Wilting and typical crown rot



Wilting and red steles


119 Negative No Ct No Ct No amplification Wilting






Minor wilting only (no redsteles)



Table 4 Soil results from baiting units

Baiting units Positive units Positive units Positive units Positive units Positive units Positive units

day 7 day 10 day 14 day 21 day 35 day 49

Hemp side soil 2/8 2/8 2/8 2/8 3/8 3/8

Pea side soil 0/8 1/8 1/8 2/8 2/8 2/8

Positive control unit 2/2 2/2

Negative control unit 0/2 0/2


0.5 μL or sometimes 0.45 μL. Labelling the probe withFAM did not have the same problem with increasingfluorescence in our previous P. cactorum assay (Muna-war et al. 2019), so we recommend labelling the Twis-tAmp exo probe with FAM/ BHQ1 and utilizing theoptimum concertation of probe for improving the assay’ssensitivity. Furthermore, a TwistAmp exo probe labelledwith FAM/ BHQ1 is less expensive than the one labelledwith ROX/ BHQ2.RPA is a rapid molecular biology technology for amp-

lifying target nucleic acid, and it has potential to exped-ite plant diagnostics. RPA amplifies target nucleic acidfrom simple macerates and thereby eliminates the needfor time-consuming and problematic DNA extraction.Additionally, RPA runs for only 20–30min. Besidestime-saving aspect, RPA requires minimal laboratory set-tings. Being an isothermal nucleic acid amplificationtechnology, RPA does not require sophisticated thermo-cycler and it can be run with simple portable incubation/detection devices at field sites (Li et al. 2019). Regardingthe cost of RPA, it is comparable with the standard diag-nostic method of DNA extraction followed by TaqManPCR. The current price of RPA kit ‘TwistAmp exo’ for96 samples is 340 euros, while the RPA probe ‘Twis-tAmp exo probe (ROX/ BHQ2)’ at 200 nmol size waspurchased for 450 US dollars from LGC Biosearch Tech-nologies (United States) in 2017. The probe was enoughfor several RPA kits. Regarding the cost of the standarddiagnostic method, DNA extraction kit ‘DNeasy PlantMini kit’ (Qiagen, Germany) for 50 samples is currentlysold at 207 euros, and the TaqMan reaction mix ‘Lumi-naris Probe qPCR Master Mix’ (Thermo Fisher Scien-tific) for around 250 reactions is currently priced at 182euros. We acquired the TaqMan probe (5’FAM/ZEN/3’IBFQ quencher) at the smallest delivery amount (0.5nmol) from Integrated DNA Technologies (Belgium) ata price of 65 euros.Regarding maceration, several reagents have been ap-

plied to prepare plant crude macerates that can be directlyutilized in RPA reaction. Those reagents include TE buffer(Ahmed et al. 2018), NaOH (Karakkat et al. 2018; Qianet al. 2018), standard ELISA grinding buffer (Miles et al.2015), and commercial buffers GEB (Kumar et al. 2018),GEB 2 (Miles et al. 2015; Li et al. 2017), GEB 4 (Zhanget al. 2014) and AMP1 (Kalyebi et al. 2015; Ghosh et al.2018) from Agdia, Inc. In contrast, our investigation onstandard ELISA grinding buffer revealed that no compo-nent of the buffer was essential for obtaining RPA amplifi-cation. We repeated the investigations for our previouslydeveloped RPA assay targeting P. cactorum (Munawaret al. 2019) and found the RPA assay working equally wellwhen crown macerates were prepared with distilled water.The possibility of preparing macerate in water not onlysimplifies the process but also reduce cost.

Isolation of P. fragariae remains challenging even afterseveral decades of pathogen discovery and there is aneed for an efficient isolation method. In our project,over a hundred plates failed in the isolation of P. fragar-iae from red stele plants. Moreover, the traditional re-agent utilized for P. fragariae isolation, Teepol LDetergent (Montgomerie and Kennedy 1983; Georgeand Milholland 1986; Newton et al. 2010), showed nodifference when compared with the routine laboratorydisinfectant, 70% ethanol, in supressing the growth ofcontaminants on the Phytophthora selective agar.Collection of appropriate strawberry plant samples is

crucial in red stele diagnosis. As described by Ellis(2008), we observed the red stele disease first appearedin low or poorly drained sites of fields where plantsstarted wilting and stunting, and the affected area pro-gressively expanded. In most of the contaminated field,when we dug out tens of plants with early symptoms ofwilting or stunting and dissected several rat-tail roots,we found some red steles. Occasionally we didn’t findred stele in contaminated fields and only laboratory find-ings confirmed red stele disease. Similarly, we observedthat within an infected field, plants in well-drained re-gions of the field remained healthy and even negativewith the RPA assay. So, in the cases where affected sitesare not present, plant samples should be preferably col-lected from low or poorly drained areas of fields. Besidesappropriate plant sample collection, we recommendutilization of molecular assays when red steles are notobvious. In our observation, fine rootlets generate themost consistent results for molecular assays such asRPA or PCR. Major roots in an infected plant remainnegative unless containing red stele. So, sample collec-tion should focus on collecting a maximum of fine roots.Regarding sampling, another challenge is screening theplants already packed for sale or export. In such situa-tions, a few plants should be analysed from each box,but the process is extremely laborious.Soil testing is generally desired when a field is not

under strawberry cultivation. Our results from plantingindicator plants in the fields confirm that solely relyingon symptoms of the indicator plants can be misleading.For instance, among the five indicator plants planted inthe field A’s active disease site, all the five had the dis-ease (RPA positives), but only one of the plants exhibitedthe typical symptom of red stele. Although coupling in-dicator or bait plants with molecular assay of RPA gavebetter results, a negative result cannot confirm the ab-sence of the pathogen. Field B had red stele disease afew years ago, and among the 10 randomly planted indi-cator plants, only one was positive with the P. fragariaeRPA assay. The indicator plant which caught the diseasemight be the only one that by chance got planted in aheavily infested site of the field B. We recommend that


indicator plants should be planted in lower or poorlydrained sites of a field and any site known for heavydamage during the previous strawberry cultivation. Theindicator plants should be planted in early or late sum-mer and well irrigated to provide the pathogen a favor-ing environment to infect.Regarding the soil testing, Duncan (1976) potted field

soils and their dilutions to bait P. fragariae with indica-tor plants. We found that field soil samples are often in-appropriate for potting indicator plants due to theirheavy texture. Moreover, preparing soil dilutions is la-borious. For these reasons, we developed a simple bait-ing system. The baiting system coupled with the RPAassay detected P. fragariae in some of the soil samplesbut didn’t turn all the soil samples positive within thetraditional baiting period of five weeks. While the num-ber of soil samples and duration of baiting are the fac-tors to be considered, the number of years elapsed fromactive infection may also influence the degree of patho-gen survival and reliability of the baiting system. We rec-ommend the collection of several soil samples, especiallytargeting sites with a history of heavy damage and thepoorly-drained ones. Moreover, keeping the experimenttemperature low at around 15 °C is crucial for P. fragar-iae infectivity. Finally, special care should be taken dur-ing field inspection and sampling to prevent human-assisted spread of Phytophthora across fields. Protectivemeasures include changing shoes cover and washing ofsample collection tools prior to moving to the next field.

ConclusionsIn this study, we developed a rapid, specific, and sensitivespecies-specific detection assay for P. fragariae utilizingRPA technology and targeting the Phytophthora mito-chondrial DNA intergenic marker located between atp9and nad9 genes. We believe that our rapid assay can assistin halting the spread of P. fragariae and preventing eco-nomic losses of red stele disease of strawberry. We alsodeveloped a simpler baiting system compared to the trad-itional Duncan’s baiting for detection of the pathogen insoil. Coupling the baiting with molecular assays such asPCR or RPA provides more reliable results.

MethodsIsolation of P. fragariaeRat-tail roots were dissected with a scalpel to observethe presence of red cores. Rat-tails with red cores werefurther peeled and red cores were surface disinfected,dried, and placed on Phytophthora selective agar (Drenthand Sendall 2001). The Phytophthora selective agar com-prised of corn meal agar (Sigma-Aldrich) supplementedwith final concentration of 250 μg/mL for ampicillin(Sigma-Aldrich), 25 μg/mL for benomyl (Sigma-Aldrich),10 μg/mL for pimaricin (Molekula, Germany), 10 μg/mL

for rifampicin (Duchefa Biochemie, Netherlands) and50 μg/mL for hymexazol (Alfa Aesar). Surface disinfest-ation of red stele plants was accomplished by incubatingin either 70% ethanol or Teepol L Detergent from Stra-tlab Ltd. UK. When using 70% ethanol, infected rootswere given a dip. For Teepol, infected roots were firstdipped in 50% Teepol L Detergent for 1 min and thendipped in three vials containing autoclaved distilledwater for 5–10 min per vial. Following surface disinfest-ation, roots were surface dried by placing them on filterpaper.

Collection of atp-nad9 sequencesP. fragariae isolates retrieved from different strawberryfields were grown in peptone glucose broth (Unestam1965) supplemented with pea broth (Zentmyer andChen 1969) for around a week at room temperature.The proportion of pea broth in the peptone glucosebroth was 5–10% (v/v). After growing P. fragariae iso-lates, hyphae were washed and dried overnight in anoven at 45 °C. DNA was extracted by E.Z.N.A. FungalDNA Mini Kit (Omega Bio-tek, United States). Similarly,fine rootlets were collected from strawberry plants whereP. fragariae was not isolated and DNA was then ex-tracted with the DNeasy Plant Mini kit (Qiagen) as permanufacturer’s recommendations.The P. fragariae atp9-nad9 marker was amplified and

Sanger sequenced as previously described (Martin andCoffey 2012; Bilodeau et al. 2014). The amplificationPCR was performed using DreamTaq Green PCR MasterMix (2X) (Thermo Fisher Scientific, United States) withan annealing temperature of 57 °C. Sanger sequencingwas accomplished at GATC Biotech, Germany.

RPA optimizationPrimer screening for specificity included five forwardprimers, 21 reverse primers, and one probe. The RPAprimers were obtained as standard desalted purified DNAfrom Integrated DNA Technologies, while the TwistAmpexo probe labelled with ROX fluorophore and BHQ2quencher, and purified with dual HPLC was obtainedfrom LGC Biosearch Technologies. Ready-to-use lyophi-lised RPA reactions ‘TwistAmp exo’ were obtained fromTwistDx Inc. (United Kingdom). Primer screening was ac-complished as per manufacturer’s recommendations. Forthe optimum primer pair, different ratios of forward andreverse primers were further evaluated. P. fragariae hyphalDNA of varying concentrations was utilized as template.RPA reaction incubation and fluorescence monitoringwere accomplished through T8-ISO (Axxin, Australia) orMx3000P QPCR System (Agilent, Germany). Reactionstrips were incubated at 39 °C for 20min with a manualagitation at the fourth minute. Results were reported asnegative, positive, and intermediate. The absence of


amplification was considered a negative result. Similarly,any amplification curve shorter or less steep than thecurve of 10 fg dilution, P. fragariae genomic DNA dilutionspiked with healthy rootlets macerate, was consideredintermediate. Intermediate results were rare, and theywere always repeated with new plant samples. Regardingpositive result criteria, any amplification curve equal ormore in terms of height and steepness compared to theamplification curve of 10 fg DNA was considered a posi-tive. In the T8-ISO settings, it is also possible to set mini-mum values for curve amplitude (height) and gradient(steepness) as criteria for positive results. We set a mini-mum gradient threshold at 7.0 mV/s and a minimumamplitude at 3000mV. We set ROX as the test channeland its LED PWM level at 30%.

SYBR green and TaqMan PCR assaysP. fragariae-specific SYBR Green and TaqMan PCR as-says described in Munawar et al. (2020) and Bilodeauet al. (2014) were utilized in this study. Those PCR as-says were also designed from atp9-nad9 marker. The P.fragariae SYBR Green PCR assay was done with forwardprimer ‘Phy_Gen_SeqF4’ (ACAACAAGAATTAATGAGAACTGC), reverse primer ‘Phy_Frag_PCRR4’ (TTTTTGTTTGAAAAGAGCTA) and LightCycler® 480 SYBRGreen I Master (Roche, Switzerland). The PCR programincluded a 10 min pre-denaturation at 95 °C and 40 ther-mal cycles, each cycle comprising 95 °C for 10 s, 58 °Cfor 20 s and 67 °C for 20 s. The P. fragariae TaqManPCR assay was done with forward primer ‘Phy_Gen_SeqF4’, reverse primer ‘Phy_Gen_SeqR8’ (GGTAAAATTTGTAATAAATATTGACT), TaqMan probe ‘PfraVf_nad9sp_TaqMan2’ (/56-FAM/ATC TCG TAA /ZEN/

TAG ATA TAT ATG TAT ATT TAA TAC GT/3IABkFQ/) and Luminaris Probe qPCR Master Mix(Thermo Fisher Scientific). The PCR included a 10minpre-denaturation at 95 °C and 45 thermal cycles, eachcycle comprising 95 °C for 15 s followed by 57 °C for 90s. Each primer concentration was kept at 500 nM whileTaqMan probe was 100 nM. Template volume was keptat 1 μL for the 1:10 serial dilution of hyphal DNA and0.5 μL for plant DNA.

Crude macerationStrawberry plant roots were washed in tap water with afinal rinse in autoclaved distilled water. Fine rootlets orroot tips weighing between 30 and 100 mg were col-lected, chopped and transferred into 2 mL round-bottomEppendorf tubes for maceration with plastic pestles. Ma-ceration was facilitated by initially adding only 100 μLfluid. Following maceration, additional fluid was supple-mented to prepare a final 1:10 (w/v) macerate. The ma-cerate was vortexed and left to settle for a few minutes.Then 1 μL of the supernatant was transferred to theRPA reaction.

Field soil collectionSoil samples from lower part of the field C were col-lected from around 3–5 m distances. Soil samples of vol-ume 10–15 L were collected with a shovel from arounda 25 cm depth. Soil samples were stored at 4 °C until thebaiting experiment was conducted in the autumn of2018. Before baiting, soil samples were mixed and thenfive litres of soil from each sample was moved to a cor-responding baiting container.

Fig. 4 Baiting unit used in this study for detection of P. fragariae. a Basic model of baiting unit. b, c Images of different baiting unit setups ina greenhouse


Baiting unitA baiting unit comprises a simple container of 10 to 20L volume. The bottom of the container is first filled withtest soil and then an equal volume of distilled water isadded. The container is topped with a tray of indicatorplants. The tray is a plastic pot block with porous bot-tom, and it was sown with indicator plant Fragaria vescavar. alpina (Baron Solemacher) seeds approximately twomonths prior experimentations. In the baiting unit, thelevel of the tray was set so that only the porous bottomof the tray was touching the water layer in the unit. Thewater layer was also aerated through air pump and tub-ing. Fig. 4 presents model and images of baiting units.The experiments were conducted in autumn or earlywinter in a greenhouse with the temperature set at 12–18 °C. All the units were filled with distilled water everysecond day to maintain an adequate water level.

Supplementary informationSupplementary information accompanies this paper at https://doi.org/10.1186/s42483-020-00069-4.

Additional file 1 Figure S1. Screenshots of Geneious alignment for theatp9-nad9 sequences of Phytophthora species provided by Miles et al.(2015). For the P. fragariae atp9-nad9 sequence, primers and probebinding regions are annotated.

AbbreviationsBSA: Bovine serum albumin; CABI: Centre for Agriculture and BiosciencesInternational; DIAPOPS: Detection of immobilized amplified product in aone-phase system; ELISA: Enzyme-linked immunosorbent assay;EPPO: European and Mediterranean Plant Protection Organization;EVIRA: Elintarviketurvallisuusvirasto or Finnish Food Safety Authority;GEB: General Extract Buffer; ILVO: Institute for Agricultural, Fisheries and FoodResearch; ITS: Internal transcribed spacer; JKI: Julius Kühn-Institut;LUKE: Natural Resources Institute Finland; PVP: Polyvinylpyrrolidone;RPA: Recombinase polymerase amplification

AcknowledgementsMost of the laboratory and field work was accomplished during the ‘Tautivoi ei!’ project funded by Euroopan maaseudun kehittämisenmaatalousrahasto (European Agricultural Fund for Rural Development/ EAFRD), Pohjois-Savon ELY-Keskus. The corresponding author also received per-sonal grants from Finnish Cultural Foundation and Olvi Foundation, Finlandto finalize this manuscript.

Authors’ contributionsMost of the lab work was completed by MM. Similarly, the design of the RPAassay was conceived by MM. The design of baiting unit was conceived byHK. The manuscript was written by MM, while all other co-authors have con-tributed in improving the manuscript. Funding was acquired by HK. All au-thors read and approved the final manuscript.

FundingThis work was supported by the European Agricultural Fund for RuralDevelopment (EAFRD), Pohjois-Savon ELY-Keskus.

Availability of data and materialsNot applicable.

Ethics approval and consent to participateNot applicable.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Author details1Department of Environmental and Biological Sciences, University of EasternFinland, 70211 Kuopio, Finland. 2United States Department of Agriculture,ARS, Salinas CA-93905, USA.

Received: 14 May 2020 Accepted: 20 August 2020

ReferencesAhmed FA, Larrea-Sarmiento A, Alvarez AM, Arif M. Genome-informed

diagnostics for specific and rapid detection of Pectobacterium species usingrecombinase polymerase amplification coupled with a lateral flow device. SciRep. 2018;8:15972.

Amouzou-Alladaye E, Dunez J, Clerjeau M. Immunoenzymatic detection ofPhytophthora fragariae in infected strawberry plants. Phytopathology. 1988;78:1022–6.

Bilodeau GJ, Martin FN, Coffey MD, Blomquist CL. Development of a multiplexassay for genus- and species-specific detection of Phytophthora based ondifferences in mitochondrial gene order. Phytopathology. 2014;104:733–48.

Bonants P, Hagenaar-de Weerdt M, van Gent-Pelzer M, Lacourt I, Cooke D,Duncan J. Detection and identification of Phytophthora fragariae Hickman bythe polymerase chain reaction. Eur J Plant Pathol. 1997;103:345–55.

Bonants PJM, van Gent-Pelzer MPE, Hooftman R, Cooke DEL, Guy DC, Duncan JM.A combination of baiting and different PCR formats, including measurementof real-time quantitative fluorescence, for the detection of Phytophthorafragariae in strawberry plants. Eur J Plant Pathol. 2004;110:689–702.

Camele I, Marcone C, Cristinzio G. Detection and identification of Phytophthoraspecies in southern Italy by RFLP and sequence analysis of PCR-amplifiednuclear ribosomal DNA. Eur J Plant Pathol. 2005;113:1–14.

Cooke DE, Duncan JM. Phylogenetic analysis of Phytophthora species based onITS1 and ITS2 sequences of the ribosomal RNA gene repeat. Mycol Res. 1997;101:667–77.

Dai T, Hu T, Yang X, Shen D, Jiao B, Tian W, Xu Y. A recombinase polymeraseamplification-lateral flow dipstick assay for rapid detection of the quarantinecitrus pathogen in China, Phytophthora hibernalis. PeerJ. 2019a;7:e8083.

Dai T, Yang X, Hu T, Xu Y, Zheng X, Jiao B, Shen D. Comparative evaluation of anovel recombinase polymerase amplification-lateral flow dipstick (RPA-LFD)assay, LAMP, conventional PCR, and leaf-disc baiting methods for detectionof Phytophthora sojae. Front Microbiol. 2019b;10:1884.

Drenth A, Sendall B. Practical guide to detection and identification ofPhytophthora. CRC for Tropical Plant Protection. Brisbane: Australian Centerfor International Agricultural Research (ACIAR); 2001.

Drenth A, Wagels G, Smith B, Sendall B, O’Dwyer C, Irvine G, et al. Developmentof a DNA-based method for detection and identification of Phytophthoraspecies. Australas Plant Pathol. 2006;35:147–59.

Duncan JM. The use of bait plants to detect Phytophthora fragariae in soil. TransBr Mycol Soc. 1976;66:85–9.

Duncan JM. A technique for detecting red stele (Phytophthora fragariae) infectionof strawberry stocks before planting. Plant Dis. 1980;64:1023–5.

Ellis MA. Red stele root rot of strawberry. 2008. https://ohioline.osu.edu/factsheet/plpath-fru-34. Accessed 12 Jan 2020.

EPPO/CABI. Quarantine Pests for Europe. 2nd ed. Wallingford: CAB International;1997.

EVIRA. Finnish Food Safety Authority. New plant pests in horticultural productioncame as a surprise in 2012. 2013. https://gd.eppo.int/reporting/article-2636.Accessed 12 Jan 2020.

George SW, Milholland RD. Growth of Phytophthora fragariae on various clarifiednatural media and selected antibiotics. Plant Dis. 1986;70:1100–4.

Ghosh DK, Kokane SB, Kokane AD, Warghane AJ, Motghare MR, Bhose S, et al.Development of a recombinase polymerase based isothermal amplificationcombined with lateral flow assay (HLB-RPA-LFA) for rapid detection of"Candidatus Liberibacter asiaticus". PLoS One. 2018;13:e0208530.

Hao W, Miles TD, Martin FN, Browne GT, Förster H, Adaskaveg JE. Temporaloccurrence and niche preferences of Phytophthora spp. causing brown rot ofcitrus in the central valley of California. Phytopathology. 2018;108:384–91.


https://doi.org/10.1186/s42483-020-00069-4https://doi.org/10.1186/s42483-020-00069-4https://ohioline.osu.edu/factsheet/plpath-fru-34https://ohioline.osu.edu/factsheet/plpath-fru-34https://gd.eppo.int/reporting/article-2636

Ioos R, Laugustin L, Schenck N, Rose S, Husson C, Frey P. Usefulness of singlecopy genes containing introns in Phytophthora for the development ofdetection tools for the regulated species P. ramorum and P. fragariae. Eur JPlant Pathol. 2006;116:171–6.

Kalyebi A, Aisu G, Ramathani I, Ogwang J, McOwen N, Russell P. Detection andidentification of etiological agents (Liberibacter spp.) associated with citrusgreening disease in Uganda. Uganda J Agric Sci. 2015;16:43–54.

Karakkat BB, Hockemeyer K, Franchett M, Olson M, Mullenberg C, Koch PL.Detection of root-infecting fungi on cool-season turfgrasses using loop-mediated isothermal amplification and recombinase polymeraseamplification. J Microbiol Methods. 2018;151:90–8.

Kumar PV, Sharma SK, Rishi N, Ghosh DK, Baranwal VK. An isothermal basedrecombinase polymerase amplification assay for rapid, sensitive and robustindexing of citrus yellow mosaic virus. Acta Virol. 2018;62:104–8.

Li J, Macdonald J, von Stetten F. Review: a comprehensive summary of a decadedevelopment of the recombinase polymerase amplification. Analyst. 2019;144:31–67.

Li R, Fuchs MF, Perry KL, Mekuria T, Zhang S. Development of a fast AmplifyrpAcceler8 diagnostic assay for grapevine red blotch virus. J Plant Pathol. 2017;99:657–62.

Maas JL. Compendium of strawberry diseases. 2nd ed. St. Paul: APS Press; 1998.Martin FN, Abad ZG, Balci Y, Ivors K. Identification and detection of Phytophthora:

reviewing our progress, identifying our needs. Plant Dis. 2012;96:1080–103.Martin FN, Coffey MD. Mitochondrial haplotype analysis for differentiation of

isolates of Phytophthora cinnamomi. Phytopathology. 2012;102:229–39.McGrew JR. Strawberry diseases. US Government Printing Office; 1889.Miles TD, Martin FN, Coffey MD. Development of rapid isothermal amplification

assays for detection of Phytophthora spp. in plant tissue. Phytopathology.2015;105:265–78.

Miles TD, Martin FN, Robideau GP, Bilodeau GJ, Coffey MD. Systematicdevelopment of Phytophthora species-specific mitochondrial diagnosticmarkers for economically important members of the genus. Plant Dis. 2017;101:1162–70.

Mohan SB. Cross-reactivity of antiserum raised against Phytophthora fragariaewith other Phytophthora species and its evaluation as a genus-detectingantiserum. Plant Pathol. 1989;38:352–63.

Montgomerie IG, Kennedy DM. An improved method of isolating Phytophthorafragariae. Trans Br Mycol Soc. 1983;80:178–83.

Munawar MA, Martin F, Toljamo A, Kokko H, Oksanen E. RPA-PCR couple: anapproach to expedite plant diagnostics and overcome PCR inhibitors.BioTechniques. 2020;69(4). https://doi.org/10.2144/btn-2020-0065 .

Munawar MA, Toljamo A, Martin FN, Kokko H. Recombinase polymeraseamplification assay for fast, sensitive and on-site detection of Phytophthoracactorum without DNA extraction. Eur J Hortic Sci. 2019;84:14–9.

Newton AC, Duncan JM, Augustin NH, Guy DC, Cooke DEL. Survival, distributionand genetic variability of inoculum of the strawberry red core pathogen,Phytophthora fragariae var. fragariae, in soil. Plant Pathol. 2010;59:472–9.

Niemi J, Väre M. Agriculture and food sector in Finland 2019. Helsinki: Naturalresources institute Finland; 2019. http://urnfi/URN:ISBN:978-952-326-771-8Accessed 24 July 2020.

Pohto A. Survey for Phytophthora fragariae var. fragariae in Finland. Bull OEPP.1999;29:159–62.

Qian W, Lu Y, Meng Y, Ye Z, Wang L, Wang R, et al. Field detection of citrushuanglongbing associated with ‘Candidatus Liberibacter Asiaticus’ byrecombinase polymerase amplification within 15 min. J Agric Food Chem.2018;66:5473–80.

Ristaino JB, Madritch M, Trout CL, Parra G. PCR amplification of ribosomal DNAfor species identification in the plant pathogen genus Phytophthora. ApplEnviron Microbiol. 1998;64:948–54.

Rojas JA, Miles TD, Coffey MD, Martin FN, Chilvers MI. Development andapplication of qPCR and RPA genus-and species-specific detection ofPhytophthora sojae and P. sansomeana root rot pathogens of soybean. PlantDis. 2017;101:1171–81.

Stammler G, Seemüller E. Specific and sensitive detection of Phytophthorafragariae var. rubi in raspberry roots by PCR amplification. J Plant Dis Prot.1993;100:394–400.

Unestam T. Studies on the crayfish plague fungus Aphanomyces astaci I. somefactors affecting growth in vitro. Physiol Plant. 1965;18:483–505.

Werres S. Enzyme-linked immunosorbent assay (ELISA) as a method for detectionof Phytophthora fragariae Hickman in strawberry roots. Nachrichtenbl DtschPflanzenschutzdienstes (Braunschweig, Germany) 1988 (in German).

Yu J, Shen D, Dai T, Lu X, Xu H, Dou D. Rapid and equipment-free detection ofPhytophthora capsici using lateral flow strip-based recombinase polymeraseamplification assay. Lett Appl Microbiol. 2019;69:64–70.

Zentmyer GA, Chen DW. Production of sporangia by Phytophthora cinnamomi inpure culture. California Avocado Society, Yearbook, vol. 53; 1969. p. 103–7.

Zhang S, Ravelonandro M, Russell P, McOwen N, Briard P, Bohannon S, et al.Rapid diagnostic detection of plum pox virus in Prunus plants by isothermalAmplifyRP® using reverse transcription-recombinase polymeraseamplification. J Virol Methods. 2014;207:114–20.


https://doi.org/10.2144/btn-2020-0065http://urn.fi/URN:ISBN:978-952-326-771-8

AbstractBackgroundResultsIsolation of P. fragariae and sequencing of atp9-nad9 markerOptimum RPA assaySensitivity and specificity of RPA assayMaceration bufferField validationSoil testing

DiscussionConclusionsMethodsIsolation of P. fragariaeCollection of atp-nad9 sequencesRPA optimizationSYBR green and TaqMan PCR assaysCrude macerationField soil collectionBaiting unit

Supplementary informationAbbreviationsAcknowledgementsAuthors’ contributionsFundingAvailability of data and materialsEthics approval and consent to participateConsent for publicationCompeting interestsAuthor detailsReferences

Documents

Development and evaluation of a recombinase polymerase … · 2020. 9. 2. · RESEARCH Open Access Development and evaluation of a recombinase polymerase amplification assay for rapid