Determination of the cDNA Sequence and In Silico Functional …philjournalsci.dost.gov.ph/images/pdf_upload/pjs2018/2... · 2018-05-18 · α-amylase (Amyl I) – which is unable

261

Philippine Journal of Science147 (2): 261-273, June 2018ISSN 0031 - 7683Date Received: 28 June 2017

Keywords: glucoamylase, in silico characterization, primer walking, protein structure, Saccharomycopsis fibuligera, yeast

Determination of the cDNA Sequence and In Silico Functional Analysis of a Glucoamylase Gene From

Saccharomycopsis fibuligera 2074

Dan Exerlin E. Bonete, Joel Hassan G. Tolentino, and Annabelle U. Novero*

College of Science and Mathematics, University of the Philippines Mindanao, Mintal, Tugbok District, Davao City 8022 Philippines

Saccharomycopsis fibuligera 2074 is a yeast strain used in producing tapuy, a traditional Philippine wine mix. A glucoamylase gene from this yeast was isolated and characterized in this study. Using primers designed via the primer walking method, the synthesized Sf 2074 cDNA (GenBank: KP068008.1) was found to contain 1531 bp and was homologous to glucoamylases deposited in the databases. Using bioinformatic tools, the predicted protein was found to possess 512 amino acids and a molecular weight of 56715.92. The conserved amino acid sequence Ala-Tyr-Thr-Gly similar to other amylases was located. The glucoamylase belongs to a superfamily of Glycoside Hydrolase 15 (GH 15), which are six-hairpin glycosidases with alpha/alpha toroid fold. This is the first report of a glucoamylase gene from S. fibuligera in the Philippines. Bioethanol cost of production could be markedly reduced if this amylolytic gene can be cloned in the brewer’s yeast Saccharomyces cerevisieae.

*Corresponding author: [email protected]

INTRODUCTIONEthanol is the most widely used liquid biofuel. The demand for ethanol is expected to rise to over 125 billion liters in 2017 (FAO 2008). It is fermented from sugars, starches, or from cellulosic biomass. Production of ethanol from starch is one way to reduce consumption of crude oil as well as environmental pollution. In view of continuously rising petroleum costs and dependence upon fossil fuel resources, considerable attention has been focused on alternative energy resources. Production of ethanol from biomass is one way to reduce both the consumption of crude oil and environmental pollution (DiPardo 2000; Bothast & Schlicher 2005; Dufey 2006; Schafer et al. 2007).

Amylases are enzymes that hydrolyze starch polymers yielding diverse products, including dextrins and smaller

polymers of glucose (Wong & Robertson 2002; Galdino et al. 2010). These enzymes are of great biotechnological interest with applications in the food industry and production of biofuels.

There are three types of amylases: alpha-amylases, glucoamylases, and beta-amylases. These amylolytic enzymes have similar function i.e., catalysis of hydrolysis of alpha-glucosidic bonds in starch and related saccharides, although they are quite different in terms of some structural and functional points of view (Horváthová et al. 2001). α-Amylase (E.C.3.2.1.1) catalyzes the hydrolysis of internal α-1,4-glycosidic linkages in starch create products like glucose and maltose (Sundarram & Murthy 2014). Because it is a calcium metalloenzyme, it is only active in the presence of the cofactor. Endo-hydrolase and exo-hydrolase are two types of hydrolases (Gupta et al. 2003). As the term implies, the endohyrolase acts inside the substrate whereas the exohydrolase targets the terminal

Philippine Journal of ScienceVol. 147 No. 2, June 2018

Bonete et al.: Saccharomycopsis fibuligera 2074 Glucoamylase

262

end of a molecule. The substrate of α-amylase is starch, which is composed of amylose and amylopectin polymers. Starch is about 20-25% amylose and 75-80% amylopectin. Amylose is a chain of repetitive glucose units in linear form linked by α-1,4-glycosidic linkage. Amylopectin – the linear successive glucose units – are also joined by α-1,4-glycosidic linkage, but there is branching every 15-45 glucose units bound by α-1,6 glycosidic bonds. The amount of hydrolysate produced after hydrolysis will depend on the efficiency of α-amylase, which is dependent on critical factors such as temperature and pH (de Souza & Magalhaes 2010).

β-Amylase (EC 3.2.1.2), an exoamylase, hydrolyzes α-1,4-glycosidic linkages of polyglucan chains at the non-reducing end. This reaction ensues to produce maltose (4-O-α-d-Glucopyranosyl-β-d-Glc; Kossman & Lloyd 2000). It has been reported that β-amylase has a significant role in transitory starch breakdown (Scheidig et al. 2002; Kaplan & Guy 2004; Wu et al. 2014). The accumulation of maltose may aid in the stabilization of the chloroplast stroma during acute temperature stress (Kaplan & Guy 2004).

Glucoamylase (α-1,4-glucan glucohydrolase, amyloglucosidase, EC 3.2.1.3) is invaluable in the food industry. It is used in saccharification of starch an in fermentation processes (Pavezzi et al. 2008). In the glucoamylolytic process, glucose is produced from the hydrolysis of α-1,4 glycosidic bonds from the non-reducing ends of the starch molecules (Mertens & Skory 2006).

Carbohydrate-binding molecules (CBM) are molecules that bring polysaccharides closer to a biocatalyst. Though CBM is non-catalytic, its role in carbohydrate recognition is vital to carbohydrate-catalyst interactions (Guillen et al. 2010). CBMs may be located either at the N- or C- terminal, or middle portion of a polypeptide chain (Shoseyov et al. 2006). Enzymes with CBM are structurally similar and share a common catalytic domain (Guillen et al. 2010). There are 81 different CBM families listed in the CAZy (Carbohydrate Active Enzyme) database (http://www.cazy.org/Carbohydrate-Binding-Modules.html). These are based on their amino acid sequences, substrate binding specificities, location in protein, and structures. According to Barchiesi and co-authors (2015), starch-binding domain (SBD) sequences that evolved to have the capability of disrupting their substrate’s surface can be highlighted.

Glycoside hydrolases (EC 3.2.1.-) are enzymes that hydrolyze glycosidic bond between two or more carbohydrates. It can also hydrolyze glycosidic bond between a carbohydrate and a non-carbohydrate moiety (CAZy 2017). There are 145 GH family members in CAZy (http://www.cazy.org/Glycoside-Hydrolases.html)

based on their substrate specificity and sometimes, on their molecular mechanism. α-Amylases, β-amylases, and glucoamylases were found in the families 13, 14, and 15, respectively. Both β-amylases and glucoamylases are found in the only one sequence-based family – family 14 and family 15, respectively (Henrissat & Bairoch 1993). α-Amylases, aside from acting as hydrolases, also act as transferases and isomerases from classes 2 and 5, respectively (Horváthová et al. 2000).

Generally, α-amylases hydrolyze α-1,4-glycosidic linkages, randomly yielding dextrins, oligosaccharides, and monosaccharides. α-Amylases are endoamylases. Exoamylases hydrolyze the α-1,4-glycosidic linkage only from the non-reducing outer polysaccharide chain ends. Exoamylases include β-amylases and glucoamylases (γ-amylases, amyloglucosidases) (Wind 1997).

While α-amylase is an α-retaining enzyme, both β-amylase and glucoamylase use the α-inverting reaction mechanism. Structurally, alpha and beta amylases (β/α) eight-barrel enzymes (TIM-barrels) consist of eight parallel β- strands forming the inner β-barrel, which is surrounded by the outer cylinder composed of eight α-helices so that the individual β-strands and α-helices alternate and are connected by loops. Glucoamylases, on the other hand, adopts a helical (α/α) six-barrel fold, which consists of six mutually parallel α-helices forming an inner core (helical barrel mimicking the inner β-barrel of α-amylase and β-amylase), which is covered by a peripheral set of six further α-helices (Aleshin et al. 1992; Sevcík et al. 1998). In the retaining mechanism – exhibited by α-amylases involving the formation and hydrolysis of a covalent glycosyl-enzyme intermediate – the roles of the two active-site carboxylic acid residues are somewhat different in comparison with the inverting mechanism. One (playing the role of the nucleophile) attacks at the sugar anomeric centre to form the glycosyl-enzyme species, while the other acts as an acid/base catalyst, protonating the glycosidic oxygen in the first step (general-acid catalysis) and deprotonating the water in the second step (general-base catalysis) (Ly & Withers 1999).

The glucoamylase catalytic reaction utilizes the inversion mechanism. It uses a direct displacement mechanism, while the catalysis by retaining glycosidases proceeds via a two-step double displacement mechanism. In the inverting mechanism, the two active-site carboxylic acid residues are suitably oriented so that one assists as a general base to the attack of water, while the other serves as a general acid to cleavage of the glycosidic bond. This is also employed by beta-amylases (McCarter & Withers 1994; Sinnott 1990; Konstantinidis & Sinnott 1991; Tanaka et al. 1994).

Amylases capable of digesting raw starch are collectively



263

called as raw starch-digesting amylases (RSDA). There is a wide array of RSDA sources. Many fungal species are capable of producing this kind of enzyme, specifically glucoamylase under different fermentation conditions and techniques (Norouzian et al. 2005). The various fungal genera synthesizing RSDAs that are active at higher temperatures include Aspergillus, Mucor, Neurospora, Rhizopus (Pandey et al. 2000), and Arthrobotrys (Jaffar et al. 1993; Norouzian & Jaffar 1993). However, the industrial focus has been on RSDA from Aspergillus niger and Rhizopus oryzae. The employment of glucoamylase from these sources in the starch processing industries is due to their good thermostability and high activity at near neutral pH values (Frandsen et al. 1999; Reilly 1999). Fungi belonging to the genus Aspergillus have been most commonly employed for the production of α-amylase (Vihinen & Mantasala 1989). Among bacterial sources, Bacillus sp. is widely used for thermostable α-amylase production to meet industrial needs. Bacillus subtilis, B. stearothermophilus, B. licheniformis, and B. amyloliquefaciens are known to be good producers of α-amylase, and these have been widely used for commercial production of the enzyme for various applications (Vihinen & Mantasala 1989; Pandey et al. 2000).

Matsubara and co-workers (2004) cloned cDNA fragment that encodes an α-amylase (Amyl III) with raw starch- digesting activity from Aspergillus awamori KT-11. In addition, the cDNA fragments encoding for typical α-amylase (Amyl I) – which is unable to digest raw starch – and glucoamylase (GA I) were also cloned from the same strain. A heat-stable raw-starch-digesting amylase (RSDA) from Cytophaga sp. was generated through PCR-based site-directed mutagenesis. At 65°C, the half-life of this mutant RSDA which, compared with the wild-type RSDA, lacks amino acids R178 and G179, was increased 20-fold. While the wild type was inactivated completely at pH 3.0, the mutant RSDA still retained 41% of its enzymatic activity (Shiau et al. 2003).

The α-amylase AMY-CS2 capable of raw starch digestion from Cryptococcus sp. S-2 was found to have 611 amino acids, including a putative signal peptide of 20 amino acids, of its ORF of the cDNA (Iefuji et al. 1996). The amylase has similar N-terminal and C-terminal domains as that of the Taka-amylase of Aspergillus oryzae and glucoamylase G1 of A. niger. The C-terminal domain of this enzyme has been reported to show the ability to digest raw starch and cause thermostability. A mutation lacking this domain loses its raw starch digestion and thermostability. Also, Goyal and co-authors (2005) obtained RSDA from Bacillus sp. I-3. The obtained enzyme had an optimum temperature of 70°C using potato starch as substrate.

A molecular genetics approach has been chosen to find structural differences between two related glucoamylases, raw-starch-degrading Glm, and non-degrading Glu from the yeasts Saccharomycopsis fibuligera IFO 0111 and HUT 7212, respectively (Hostinová 2002). Results suggest that Glm, although possessing a good ability for raw starch degradation, did not show consensus amino acid residues to any SBD found in glucoamylases or other amylolytic enzymes. Raw starch binding and digestion by Glm must thus depend on the existence of a site(s) lying within the intact protein, which lacks a separate SBD (Hostinová 2002). Horváthová and co-authors (2004) tested the raw starch-digesting ability of Glm on corn starch and found out that the optimum concentration of glucoamylase was 33-75 U∙g-1 of starch.

Fungal strains belonging to Rhizopus (Fogarty & Kelly 1980) and Volvariella volvacea (Olaniyi et al. 2010) have been reported to synthesize β-amylase. Pullulanase appeared to positively stimulate hydrolytic activity of β-amylase from Bacillus polymyxa on raw corn starch (Sohn et al. 1996). Also, B. polymyxa No 26-1 has the ability to digest raw starch from its β-amylase (Ueda & Marshall 1980; Sohn et al. 1996). Bacillus cereus has also been found to have a β-amylase capable of raw starch digestion. It has been determined that this ability is associated with the C-terminal starch binding domain and additional maltose binding sites (Mikami et al. 1999).

Jabbour and co-authors (2012) was able to isolate an alpha-amylase from a pilot-plant biogas reactor operating at 55°C. The library was screened for starch-degrading enzymes, and one active clone was found. An open reading frame of 1,461 bp encoding an α-amylase from an uncultured organism was identified. The Amy13A gene was cloned in Escherichia coli, resulting in high-level expression of the recombinant amylase. Amy13A is one of the few enzymes that tolerate high concentrations of salt and elevated temperatures, making it a potential candidate for starch processing under extreme conditions.

From our institution, Fronteras and Bullo (2017) reported amylolytic activity from Saccharomycopsis fibuligera 2074 (Sf 2074) of a fungal isolate from bubod, a Philippine rice wine starter mix. The isolate preferred raw sago starch as substrate over the gelatinized one based on their enzymatic activity. Sf 2074 registered its maximum amylase production from a 36-h culture when 1% sago starch was used as carbon source. This isolate was the source of glucoamylase gene reported in this study. Glucoamylases from this species belong to Glycoside Hydrolase 15 family. Most of the currently characterized family members have a two-domain structure, the small domain playing the role of binding the enzyme to starch, allowing the larger catalytic doamin to hydrolyze the starch substance (Sevcík et al.



264

2006). GH 15 family comprises enzymes with several known activities: glucoamylase (EC 3.2.1.3); alpha-glucosidase (EC 3.2.1.20); and glucodextranase (EC 3.2.1.70) (CAZY database; Henrissat 1991).

This study elucidated the putative function of Sf 2074 cDNA. This is an initial step towards its functional characterization and eventual cloning and expression in Saccharomyces cerevisiae for the conversion of raw starch into bioethanol using a single microorganism.

MATERIALS AND METHODS

Sample PreparationA pure strain of Saccharomycopsis (Endomycopsis) fibuligera [Accession Number: 2074] was obtained from the Philippine National Collection of Microorganisms, University of the Philippines, Los Banos, Laguna. The cells were grown in Yeast Extract-Malt-Peptone-Starch (YMPS) medium. A loopful of yeast was inoculated into 100 mL YMPS Broth in 250-mL flask. The cultures were incubated in 30°C in a shaking incubator. Cells harvested after 72 h of incubation (optimum and experimentally determined) were used for RNA extraction.

Isolation of Total mRNA Total mRNA of Sf 2074 was isolated using the PureLink® RNA Mini Kit (Invitrogen, USA) with some modifications, that mainly include lysis of the yeast cells (amount of enzyme and incubation time for lysis to occur). Appropriate amount of zymolyase digestion buffer depended on the weight of the pellets collected (2 U: 3 mg pellets; 0.1 U • µL-1). The solution was incubated at 30°C for 90 min. Twenty five (25) µL of RNAse-free water was added during the final elution step. The elution step was repeated once and the RNA sample dissolved in the centrifuge tube was stored at -80°C.

All obtained samples were visualized using agarose gel electrophoresis to check for the presence and purity of nucleic acids in the sample. The UN-SCAN-IT gel automated digitizing system v6.1 (Silk Scientific Corp, USA) was used to quantify the sample.

Primer DesignThe primers (Table 1) were designed based on gene sequences deposited in Genbank/NCBI (http://blast.ncbi. nlm.nih.gov/Blast.cgi; Ye et al. 2012; Table 2) using the software Primer-BLAST available at the same site. To check the compatibility and annealing position of the designed primers, they were aligned with the design template by using ClustalΩ software (http://www.ebi.

ac.uk/Tools/msa/clustalo/; Sievers et al. 2011; McWilliam et al. 2013).

First Strand cDNA SynthesisFor synthesis and amplification of cDNA, the following were prepared: 1 µL of 10 mM of dNTP mix, 1 µL of the RNA sample and sterile distilled water up to 13 µL. One (1) µL of 2 pmol reverse primer was used for FS-cDNA synthesis (5’ – AGCCAAAGCCTTGACCTTAT – 3’; designated as P1-R). The mixture was heated at 65°C for 5 min then placed on ice for at least 1 min. It was then centrifuged at 10,000 x g at 4°C for 1 min before adding the following: 4 µL 5X first strand buffer, 1 µL 0.1 dithiothreitol, and 1 µL of 200 units • µL-1 Superscript™ reverse transcriptase (Invitrogen, USA). After mixing gently, the mixture was incubated in 55°C for 1 h. The reaction was then deactivated at 70°C for 15 min.

Second Strand SynthesisOptimized PCR conditions for second strand synthesis was prepared using a concentration of MgCl2: 4.0 mM, 5 μL colorless buffer; 1.0 μL dNTP; 2 μL of the first strand cDNA; 1.0 μL each of the forward and reverse primers; 0.2 μL Taq polymerase; and sterile nanopure water. Volume was made up to 25 µL.

The PCR reaction ran under the following conditions (Looke et al. 2011): predenaturation at 94°C for 2 min for 1 cycle; 30 cycles of denaturation (at 94°C for 10 s), annealing and extension (at 72°C for 90 s), and final extension at 72°C for 90 s. The generated optimal annealing temperature was at 55°C was used for all PCR trials. The PCR products were characterized using agarose gel electrophoresis.

Using optimized conditions for amplification, one PCR primer pair (P1-F and P1-R) and four primer walking pairs (PA-F and PB-R, PA-F and PC-R, PD-F and P1-R, PE-F) were utilized to yield the desired gene from the isolated

Table 1. Primers designed for the amplification of glucoamylase gene from S. fibuligera.

Primer designation Sequence (5’ – 3’)

Length (bases) Tm (°C)

P1-F ATTGCTTATCGTGAAGGCCA 20 44.6

P1-R AGCCAAAGCCTTGACCTTAT 20 44.6

PA-F TTCCGTCTTTGCTCGTATTGT 21 45.3

PB-R TGTAGTACTCAACTGCCTTGT 21 47.3

PC-R TGCCTTGGTTTTCCTCCCAA 20 46.7

PD-F TTTTGACGACGGCGACTTTG 20 46.7

PE-F TGGTCACATTCGGTGATTCC 20 46.7



265

mRNA. Mass amplification was done in order to produce enough amount of sample for sequencing (45 µL).

Nucleotide Sequence AnalysisSamples were sent to the Philippine Genome Center – DNA Core Sequencing Facility for direct sequencing. DNA chromatograms were generated containing the complete sequence of the genes tested. The obtained DNA sequences have undergone data clean up using FinchTV software (Geospiza, Inc.). In this process, the unnecessary sequences within the chromatogram were eliminated depending on the peaks shown within the chromatogram and the Quality Value (QV). QV is an established metric for determining quality sequencing data. QV>20, which typically is considered acceptable, means the probability that the base was miscalled is no greater than 1% (Jankowski 2007). Peaks with low heights and small values for QV imply non-significance of that certain sequence. Contig assembly was done based on forward and reverse primers and trimmed of low quality bases using BioEdit software (Ibis BioSciences). Another round of contig assembly was done in order to assemble the complete sequence of the desired gene using the initial contigs generated as starting sequences. Assessment using the nucleotide Basic Local Alignment Search Tool (BLASTn; Altschul et al. 1997, 2005) from NCBI (http://www.ncbi.nlm.nih.gov/) was employed. Further analysis was done using Clustal Omega website (http://www.ebi.ac.uk/Tools/msa/clustalo/), which is used for multiple sequence alignment and phylogenetic tree construction, employing iterative progressive alignment using Hidden Markov Models. This type of alignement refines an initial progressive multiple alignment by iteratively dividing the alignment into two profiles and realigning them (Sievers et al. 2011). The genes used for analysis were grabbed from the GenBank of the NCBI.

In Silico Analysis of Protein StructureTranslated protein sequences were used for characterization using tools in the ExPASy Biointformatics Tool Portal (http://www.expasy.org/structural_bioinformatics). Using

Phyre2 (Kelley et al. 2015), identity and protein folding and secondary characteristics were deduced. Using the Protein Model Portal (Haas et al. 2013), protein parameters such as molecular weight, pI, N-terminal sequence, and estimated half-life were determined. Predicted binding sites were determined using the 3DLigandSite (Wass et al. 2010).

RESULTS

Analyses of Amplicons and cDNA SequencesThe actual contig sizes were smaller than those of the estimated ones except for PA-F/PB-R and PE-F/P1-R (Table 3). These differences were attribted to sequence clean up applied to the data. The sequences were removed of unnecessary bases generally located on both the 5- and 3- ends. These sequences had low quality value (QV) and low peak heights (data not presented).

The gel profile of the amplicons revealed thick and sharp bands in each lane (Figure 1). This indicates that the conditions for amplification were successfully optimized. Moreover, there were no secondary products amplified.

The contig sequences were able to assemble a gene containing 1,531 bases. The open reading frame (ORF) contains 510 amino acid residues (Figure 2). These

Table 3. Primer pairs, their expected amplicon sizes and actual contig sizes obtained from Sf 2074.

Primer Pair Estimated Amplicon Size (bp)

GeneratedContig Size (bp)Forward Reverse

P1-F P1-R 1,500 1,096

PA-F PB-R 350 356

PA-F PC-R 700 636

PD-F P1-R 750 621

PE-F P1-R 150 181

Table 2. S. fibuligera glucoamylase genes used in the primer design.

Organism (Scientific Name) Name of AmylaseNCBI Accession

NumberSize(bp) Type Reference

Saccharomycopsis fibuligera Glu 0111 AJ311587 1548 complete cds Hostinová et al. (2003)

Saccharomycopsis fibuligera PD70 - JF751023 1476 partial sequence Li et al. (2011)

Saccharomycopsis fibuligera R64 GII1 HQ415729 1476 partial sequence Natalia et al. (2011)

Saccharomycopsis fibuligera GLU1 L25641 1848 complete cds Itoh et al. (1987)

Saccharomycopsis fibuligera - X58117 1881 complete cds Hostinová et al. (1991)

Saccharomycopsis fibuligera GLZ AJ628041 2892 complete cds Hostinová et al. (2005)



266

resulting nucleotide sequences were similar to four glucoamylase genes of different S. fibuligera strains (Table 4). This sequence has been deposited in GenBank/NCBI with the assigned accession number KP068008.1.

Phylogenetic AnalysisThe phylogenetic tree shows that the determined gene sequence for Sf 2074 glucoamylase gene is most closely related to GLU 1 glucoamylase gene (Accession number: L25641.1; Figure 3). Two glucoamylase genes from Sf PD70 and R64 (HQ415729.1 and JF751023.1, respectively) are in one group, being ~99% homologous to one another (Table 4). Moreover, they are of the same size, comprising of 1,476 bases.

In Silico Analysis of Protein StructureThe translated protein sequence was identified as glucoamylase belonging to the Glycoside Hydrolase 15 (GH 15) family of amylases and possesses a (α/α) six-barrel fold (Figure 5), closely similar to that of the catalytic domain of Aspergillus awamori and T. thermosaccharolyticum (Solovicová et al. 1999), with the active site at the narrower end of barrel. Ninety-six percent (96%) of the sequence comprising 492 residues had been modelled by Phyre2 software with 100% confidence. The protein was also found to possess the following properties: contains 512 amino acids, a molecular weight of 56,715.92 Da, and pI of 4.33. The N-terminal is considered to be serine and the protein’s estimated half-life is >20 h in vivo. Figure 6 shows the glucoamylase molecular model and predicted structural binding sites.

DISCUSSION Cellular disruption is the first step in RNA isolation and one of the most critical steps affecting yield and quality of the isolated RNA. Typically, cell disruption needs to be fast and thorough. Slow disruption may result in RNA degradation by endogenous RNases released internally. Incomplete disruption may also result in decreased yield because some of the RNA in the sample remains trapped in intact cells and therefore, is unavailable for subsequent purification (Farrell 2009). Yeast cells can be extremely difficult to disrupt because their cell walls may form capsules or nearly indestructible spores. In this study, an enzymatic method using zymolyase successfully lysed yeast cells using the proportion 2U zymolyase: 3 mg pellet: 0.1 U uL-1 buffer. Among three enzymes tested on S. cerevisiae and Pichia pastoris, Burden (2008) found that zymolyase had the greatest activity by forming 100% protoplasts within 10 min, when used at 300 U/ml. The effectivity of this enzyme is genus-dependent. Each genus

Figure 1. Agarose gel profile of PCR amplicons obtained from primer pairs using total RNA from Sf 2074. Bands shown in both (A) and (B) are from the following primer pairs: (1) PA-F and PB-R, (2) PA-F and PC-R, (3) PD-F and P1-R, (4) PE-F and P1-R, and (5) P1-F and P1-R.

Figure 2. Nucleotide and deduced amino acid sequence of the cDNA generated from Sf 2074. Pairs of basic amino acid residues (Lys-Arg) and potential N-glycosylation sites are boxed in red and black, respectively. Sequence “Ala-Tyr-Thr-Gly” preceding Trp-160 that is identical with that preceding alpha-amylase (Taka-amylase) from Aspergillus oryzae is boxed in green.



267

Figure 4. Alignment of the determined glucoamylase gene from Sf 2074 to a glucoamylase gene with accession number L25641.1 (NCBI).

Figure 3. Phylogenetic tree showing relationships between Sf 2074 glucoamylase gene and the other S. glucomaylases of different strains. Indicated are the source of glucoamylase and their corresponding accessions numbers in NCBI.

Table 4. Percent identity matrix of Sf 2074 glucoamylase gene compared to other S. fibuligera glucoamylases of different strains.

Accession Number (NCBI) A (%) B (%) C (%) D (%) E (%) F (%) G (%)

HQ415729.1 (A) - 60.57 99.53 41.81 98.92 98.98 98.92

AJ311587.1 (B) 60.57 - 60.44 41.23 60.61 60.49 60.78

JF751023.1 (C) 99.53 60.44 - 41.88 99.12 99.19 99.12

AJ628041.1 (D) 41.81 41.23 41.88 - 42.27 42.20 42.08

L25641.1 (E) 98.92 60.61 99.12 42.27 - 98.59 100.00

X58117.1 (F) 98.98 60.22 99.19 42.20 98.59 - 98.69

KP068008.1 (G) 98.92 60.78 99.12 42.08 100.00 98.69 -



268

has a designated enzyme concentration in order for cellular disruption to be effective.

Taking particular care when optimizing PCR conditions can provide rewards in several ways. An optimized PCR run will improve both product yield and reproducibility between reactions, while reducing amplification of non-specific products. When electrophoresed on an agarose

gel, an optimized reaction will give a brighter product band with minimal background. When developing a protocol for PCR amplification of a new target, it may be important to optimize all parameters including reagent concentrations, cycling temperatures, and cycle number (Kainz 2000). In this study, two variables were manipulated for the optimization process: annealing temperature and MgCl2 concentration. For both parameters, primer pair P1-F and P1-R was used. This is so since these primers are believed to amplify the desired glucoamylase gene from Sf 2074. Good PCR products were generated at 50°C, demonstrating that an addition of nearly 5°C to the established annealing temperature could amplify the desired gene. In general, annealing temperature above the predicted melting temperatures of the primers creates a more restrictive and selective amplification of the target. High annealing temperature is used if non-specific products are present (Judelson 2000).

Another variable that has undergone optimization is MgCl2 concentration. Magnesium is required as a co-factor for thermostable DNA polymerase. Taq polymerase is a magnesium-dependent enzyme and determining the optimum concentration to use is critical to the success of the PCR reaction. A concentration of 0.5 mM MgCl2 was not enough to yield acceptable products because presumably, a significant reduction in MgCl2 concentration prevented a sufficient number of enzyme molecules from being in the correct conformation for an efficient amplification to occur (Markoulatos et al. 2002). Conversely, primers that bind to incorrect template sites are stabilized in the presence of excessive magnesium concentrations and so results in decreased specificity of the reaction (Kramer & Coen 2006). In effect, a substantial increase in secondary products is produced by non-specific priming (Kainz 2000). This effect was shown by using MgCl2 concentrations of 2.0 mM, 3.0 mM, and 4.0 mM as smears are visible near the crisp band and at the bottommost part of the wells. The optimum magnesium chloride concentration at 1.0 mM was wherein a single crisp band was evident.

The resulting contig sequences amplified from Sf 2074 that were able to assemble a gene sequence containing 1,531 bases and was able to identify with four glucoamylase genes of different S. fibuligera strains in the Genbank database. The phylogenetic tree generated from alignment data via Clustal-Omega (EMBL-EBI), supports the results. Two glucoamylase genes from Sf PD70 and R64 (HQ415729.1 and JF751023.1, respectively) are into one group due to the fact that they are ~99% homologous with each other. Moreover, they are of the same size having 1,476 bases. These two genes are highly homologous to the gene with Accession No. X58117.1, yet it branched out into a separate clade, perhaps due to its shorter size (405

Figure 5. Structural model of the Sf 20174 glucoamylase protein using Pyre2. Image colored by rainbow N to C terminus; model dimensions (Å): x:64.667 y:60.387 z:60.380.

Figure 6. Sf 2074 molecular model and predicted structural view of the binding sites.



269

bases). A strain of S. fibuligera amylase (AJ311587.1) has a separate clade since it belongs to a different family as it is reported as an alpha-glucosidase (Itoh 1987).

Interestingly, an S. fibuligera amylase gene (AJ628041.1) having relatively low homologies to all other genes of the same species and AJ311587.1) have their own group. This has been reported as a glucoamylase gene from another strain of S. fibuilgera, but its structure was altered such that it is without a separate starch-binding domain (Hostinová 2002).

Ultimately, the tree shows that the determined gene sequence for Sf 2074 glucoamylase gene is most closely related, still to GLU 1 glucoamylase gene (Accession No. L25641.1). To further support this, an alignment of the amino acid sequence of these two is shown on Figure 4. Both genes exhibit 100% homology with each other. The high level of homology (~99%) of Sf 2074 with most S. fibuligera glucoamylases (5 of 7) indicates that this gene is highly conserved.

Although homology was high, the ORF – which had 510 amino acid residues – did not contain a start codon (ATG) and a stop codon (TAA, TAG, or TGA), an indication that the sequence generated does not code for a complete gene. Instead, it started with serine (TCC) and ended with alanine (GCT). In order to identify the possible missing sequence, the determined sequence was aligned to the glucoamylase gene (GLU1; accession number L25641) in a S. fibuligera strain. Aside from this is its closest in terms of phylogeny, his gene contains a complete sequence having a start codon and stop codon. Using this, it can be deduced that an initial 5’ end sequence of 20 bases (5’ - ATGAAATTCGGTGTTTTATT – 3’) is lacking. The same premise is supported with the alignment of the amino acid sequence of both genes. As shown on Figure 4, Sf 2074 glucoamylase gene lacks initial 5‘ end sequence of 7 amino acids (5‘ – MKFGVLF – 3‘). At the 3’ end, it shows the sequence only lacks the stop codon alone 5’ – TAA – 3’. The most probable cause for this was the clean-up done to the sequence data. This process probably removed the above mentioned sequence. If the end bases were able to generate enough peak heights and high quality value in the chromatogram, then a complete cDNA sequence could have been obtained.

Bioinformatic analysis of protein structure identified the protein as a glucoamylase with potential N-glycosylation sites. Asparagine residues were found in the protein mainly due to the presence of consensus sequence required for N-glycosylation, which is “Asn – Xxx - Ser/Thr/Cys”, where Xxx can be any amino acidexcept proline (Mellquist et al. 1998). However, even if a consensus sequence has been identified for a post-translational modification, the presence of such a sequence motif

only indicates the possibility, not the certainty that the modification actually occurred (Medzihradszky 2008).

As per the findings of Itoh and co-workers (1987), S. fibuligera glucoamylase gene suggested that sequences surrounding the conserved tryptophan residue near the short peptide sequence allow the formation of β-turn conformation in all glucoamylases. In Sf 2074 glucoamylase, all six tryptophan residues are located at highly conserved positions in the five segments, suggesting that some of these tryptophan residues are likely to be essential for enzymatic activities. However, the S. fibuligera HUT 7212 glucoamylase gene (Glu gene; which is 100% homologous to the reported gene), adsorbs to, but does not digest raw starch as reported by Solovicová and co-authors (1999). The glucomaylases from A. niger and A. awamori prefer longer malt-oligosaccharides as substrates, which is also the case for S. fibuligera glucoamylase.

In a study by Sevcík and co-authors (2006), Glu was compared to Glm, a glucoamylase from S. fibuligera IFO 0111. Comparison of the key residues in the starch binding site between the two (Tyr464 in Glu vs Phe 461 in Glm) at relatively and structurally equivalent positions confirmed that the Glu structure lacked the independent starch binding domain, while the catalytic domain was similar to other GH 15 family members. They have also found out that for Glu, two acarbose molecules (on the active site and on a site remote from the active site) are bound and the latter is curved along Tyr 464 residue. Mutation of this specific binding site have greatly reduced starch binding properties. This residue is shown to be present in the reported gene.

The catalytic machinery of the reported gene is shown on Figure 2. In the glucoamylase from A. awamori and A. niger structures Glu179 was indentified as the general acid and base responsible for catalysis. Superposition of these genes to glucoamylase complexes of S. fibuligera shows that the same residues are also found. In the case of the reported gene, it is found in Glu230, general acid, and Glu476, general base (Aleshin et al. 1994ab; Harris et al. 1993; Sierks et al. 1990; Svensonn et al. 1990).

The claim above supports that S. fibuligera glucomaylases, including the reported one, might have evolved a starch binding site on the catalytic domain that is quite distinct from that seen in other members of the GH 15 family. This is further supported by the constructed phylogenetic tree (Figure 3). Glu and the reported gene are grouped together in a single clade and has evolved most recently in contrast to other S. fibuligera glucoamylases (highly homologous). Glm from S. fibuligera IFO 0111 is far distantly related to Glu on the clade, implying that Glm may be likely the ancestor of Glu.



270

CONCLUSION This study determined the presence of glucoamylase gene sequence coded by Sf 2074, a native strain used in fermenting rice wine. The cDNA was successfully synthesized by the following approach: cell wall lysis to produce good quality RNA, primers designed by primer walking, and optimization of MgCl2concentration and annealing temperature of primers. Bioinformatic analyses confirmed the putative gene as a glucoamylase. Tryptophan residues that are likely involved in enzymatic activities, as well as a specific sequence serving as a marker for the formation of β-turn conformation in all glucoamylases, were identified. These may lead to a possible characterization of the gene as a raw-strach digesting amylase.

Characterization methods can also be done to obtain more information on the nature of Sf 2074 glucoamylase. This may include assays on glucoamylase activity, protein concentration, and colony PCR. Furthermore, manipulations in the gene/protein can be conducted to characterize this glucoamylase. Induced mutations like insertion and deletion within the gene can be done to both hasten and improve the glucoamylase activity of the enzyme, if possible. Lastly, transformation into S. cerevisiae can be explored to assess this gene‘s potential application in direct ethanol fermentation.

ACKNOWLEDGMENTSFunds from this study were obtained from the Department of Science and Technology - Philippine Council for Energy and Emerging Technology Resources Research and Development (DOST-PCIEERD) and the University of the Philippines Mindanao. The technical assistance of Mr. Kevin Labrador is also gratefully acknowledged.

REFERENCES ALESHIN AE, HOFFMAN C, FIRSOV LM &

HONZATKO RB. 1994a. Crystal structure of glucoamylase from Aspergillus awamori var. X100–2.2 A ˚ resolution. J Mol Biol 238: 575-591.

ALESHIN AE, FIRSOV LM & HONZATKO RB. 1994b. Refined structure for the complex of acarbose with glucoamylase from Aspergillus awamori var. X100–2.4 A ˚ resolution. J Biol Chem 269: 15631-39.

ALESHIN A, GOLUBEV A, FIRSOV LM, HON- ZATKO RB. 1992. Crystal structure of glucoamylase from Aspergillus awamori var. X100 to 2.2-A

resolution. J. Biol. Chem. 267: 19291-98

ALTSCHUL SF, WOOTON JC, GERTZ EM, AGARWALA R, MORGULIS A, SCHAFFER AA, YU YK. 2005. Protein database searches using compositionally adjusted substitution matrices. FEBS J272: 3389-3402.

ALTSCHUL SF, MADDEN TL, SCHAFFER AA, ZHANG J, ZHANG Z, MILLER W, LIPMAN DJ. 1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acid Res 25: 3389-3402.

BARCHIESI J, HEDIN N, GOMEZ-CASATI DF, BALLICORA MA, BUSI MV. 2015. Functional demonstrations of starch binding domains present in Ostreococcus tauri starch synthases isoforms. BMC Research Notes 8: 613.

BOTHAST RJ, SCHLICHER MA. 2005. Biotechnological processes for conversion of corn into ethanol. Appl MicrobiolBiotechnol 67: 19-25.

BURDEN D. 2008. Comparison: zymolyase™ vs. lyticase & glusulase. Retrieved from http://www.amsbio.com/brochures/Zymolyase_Comparison.pdf on 31 Mar 2015.

[CAZy] Carbohydrate Active Enzymes. 2017. Retrieved from http://www.cazy.org.

DE SOUZA PM, MAGALHAES PDO. 2010. Application of microbial α-amylase in industry – A review. Braz J Microbiol. 41(4): 850-861.

DIPARDO J. 2000. Outlook for biomass ethanol production and demand. Energy Information Administration, Washington, D.C.

DUFEY A. 2006. Biofuels production, trade and sustainable development: Emerging issues. International Institute for Environment and Development, London.

FARRELL RE, JR. 2009. Resilient Ribonucleases. In: RNA Methodologies: Laboratory Guide for Isolation and Characterization. 4th ed. Retrieved from http://books.google.com.ph/books?id=ERdmQGrAtTQC&dq=RNases+are+said+to+be+very+stable+and+active&hl=fil&source=gbs_navlinks_s on 22 Aug 2013.

FOGARTY WM, KELLY CT. 1980. Amylases, Amyloglucosidase and related Glucanases. In: Microbial enzymes and Bioconversion, 4th ed. Academic press, London: p. 115-170.

[FAO] Food and Agriculture Organization. 2008. FAO, The State of Food and Agriculture, Biofuels: Prospects, Risks and Opportunities, Chap 4. FAO, United Nations. 47p.

FRANDSEN TP, FIEROBE HP, SVENSSON B. 1999. In:



271

Alberghin L, ed. Engineering specificity and stability in glucoamylase from Aspergillus niger in protein engineering in industrial biotechnology. Amsterdam Harwood Academic. p. 189-206.

FRONTERAS JP, BULLO LLR. 2017. Raw starch-digesting amylase from Saccharomycopsis fibuligera 2074 isolated from bubod starter. Phil J Sci 46 (1): 27-35.

GALDINO AS, SILVA R, LOTTERMANN MT, ALVARES ACM, DE MORAES LMP, TORRES FAG, DE FREITAS SM, ULHOA CJ. 2010. Biochemical and structural characterization of Amy1: An alpha-amylase from Cryptococcus flavus expressed in Saccharomyces cerevisiae. Creative Commons Attribution License. p. 1-7.

GOYAL N, GUPTA JK, SONI SK. 2005. A novel raw starch digesting thermostable α-amylase from Bacillus sp. I-3 and its use in direct hydrolysis of raw potato starch. Enzyme Microb Technol 37: 723-734.

GUILLEN D, SANCHEZ S, RODRÍGUEZ-SANOIA R. 2010. Carbohydrate-binding domains: multiplicity of biological roles. Applied Microbiology and Biotechnology 85(5): 1241-49.

G U P TA R , G I G R A S P, M O H A PAT R A H , G O S WA M I V K , C H A U H A N B . 2 0 0 3 . Microbia l α -amylases : a b iotechnological perspective. Process Biochemistry 38(11): 1599-1616.

HAAS J, ROTH S, ARNOLD K, KIEFER F, SCHMIDT T, BORDOLI L, SCHWEDE T. 2013. The Protein Model Portal - a comprehensive resource for protein structure and model information. Database bat031

HARRIS EMS, ALESHIN AE, FIRSOV LM & HONZATKO RB. 1993. Refined structure for the complex of 1-deoxynojirimycin with glucoamylase from Aspergillus awamori var. X100–2.4 A ̊ resolution. Biochemistry 32: 1618-26.

HENRISSAT B. 1991. A classification of glycosyl hydrolases based on amino-acid sequence similarities. Biochem. J. 280: 309-316.

HENRISSAT B, BAIROCH A. 1993. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 293: 781-788.

HORVÁTHOVÁ V, SLAJSOVÁ K, STURDÍK E. 2004. Evaluation of the glucoamylase Glm from Saccharomycopsis fibuligera IFO 0111 in hydrolysing the corn starch. Biologia Bratislava 59: 361-365.

HORVÁTHOVÁ V, JANEČEK S, STURDÍK E. 2001. Amylolytic enzymes: molecular aspects of their properties . Gen Physiol Biophys. 20(1): 7-32.

HORVÁTHOVÁ VS, JANEČEK S, STURDÍK E. 2000. Amylolytic enzymes: their specificities, origins and properties. Biologia Bratislava 55/6: 605-615.

HOSTINOVÁ E. 2002. Amylolytic enzymes produced by the yeast Saccharomycopsis fibuligera. Biologia, Bratislava. Suppl. 11: 247-251.

HOSTINOVÁ E, BALANOVÁ J, GASPERÍK J. 1991. The nucleotide sequence of the glucoamylase gene GLA1 from Saccharomycopsis fibuligera KZ. FEMS Microbiol Lett 83(1):103-108.

HOSTINOVÁ E, SOLOVICOVÁ A, DVORSKY R, GASPERÍK J. 2003. Molecular cloning and 3D structure prediction of the first raw-starch-degrading glucoamylase without a separate starch-binding domain. Arch Biochem Biophys 411: 189-195.

HOSTINOVÁ E, SOLOVICOVÁ A, GASPERÍK J. 2005. Cloning and expression of a gene for an alpha-glucosidase from Saccharomycopsis fibuligera homologous to family GH31 of yeast glucoamylases. Appl Microbiol Biotechnol 69(1): 51-56.

IEFUJI H, CHINO M, KATO M, IMURA Y. 1996. Raw-starch-digesting and thermostable α-amylase from the yeast Cryptococcus sp. S-2: Purification, characterization, cloning, and sequencing. Biochem J 318(3): 989-996.

ITOH T, OHTSUKI I, YAMASHITA I, FUKUI S. 1987. Nucleotide sequence of the glucoamylase gene GLU1 in the yeast Saccharomycopsis fibuligera. J Bacteriol 169(9): 4171-76.

JABBOUR D, SORGER A, SAHM K, ANTRANIKIANG. 2012. A highly thermoactive and salt-tolerant α-amylase isolated from a pilot-plant biogas reactor. Appl Microbiol Biotechnol 97(7): 2971-78.

JAFFAR MB, BHARAT RP, NOROUZIAN D, IRANI SD, SHETTY P. 1993. Production of glucoamylase by nematophagus fungi Arthrobotrys species. Indian J Exp Biol 31: 87-89.

JANKOWSKI P, VENNEMEYER E, HUNKAPILLER K, SHAH P, VADAPALLI A. 2007. Direct sequencing quality control: A novel software approach to reducing researcher labor. Retrieved from http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_039259.pdf

JUDELSON H. 2000. Guidelines for designing primers. Retrieved from https://oomyceteworld.net/protocols/primer%20designing2.pdf

KAINZ P. 2000. The PCR plateau phase- towards an understanding of its limitations. Biochem Biophys Acta 1494: 23-27.



272

KAPLAN F, GUY CL. 2004. β-Amylase Induction and the Protective Role of Maltose during Temperature Shock. Plant Physiol. 135(3): 1674-84.

KELLEY LA, MEZULIS S, YATES CM, WASS MN, STERNBERG MJ. 2015. The Pyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10(6): 845-858.

KONSTANTINIDIS A, SINNOT ML. 1991. The interaction of 1-fluoro-d-glucopyranosyl fluoride with glucosidases. Biochem J 279: 587-593.

KOSSMANN J, LLOYD J. 2000. Understanding and influencing starch biochemistry. Crit Rev Biochem Mol Biol 35: 141-196.

KRAMER MF, COEN DM. 2006. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr Protoc Cytom, Appendix 3K.

LI Z, JIANG N, WEI P, CHENG H, HE P, LU D. 2011. Cloning and characterization of a glucoamylase gene from the dimorphous yeast Saccharomycopsis fibuligera. Direct submission. NCBI Accession Number JF751023. https://www.ncbi.nlm.nih.gov/nuccore/JF751023.

LOOKE M, KRISTJUHAN K, KRISTJUHAN A. 2011. Extraction of Genomic DNA from Yeasts for PCR-Based Applications. Biotechniques 50(5): 325-328.

LY HD, WITHERS S. 1999. Mutagenesis of glycosidases. Annu. Rev. Biochem. 68: 487-522.

MATSUBARA T, AMMAR YB, ANINDYAWATI T, YAMAMOTO S, ITO K, IZUKA M, MINAMIURA N. 2004. Molecular cloning and determination of the nucleotide sequence of raw starch-digesting α-amylase from Aspergillus awamori KT-11 J Biochem Mol Biol 37(4): 429-438.

MCCARTER JD, WITHERS SG. 1994. Mechanisms of enzymatic glycoside hydrolysis. Curr Opin Struct Biol 4: 885-892.

MCWILLIAM H, LI W, ULUDAG M, SQUIZZATO S, PARK YM, BUSO, N, COWLEY, AP, LOPEZ R. 2013. Analysis Tool Web Services from the EMBL-EBI. Nucleic Acids Res 41(Web Server issue): W597-600.

MARKOULATOS P, SIAFAKAS N, MONCANY M. 2002. Multiplex polymerase chain reaction: a practical approach. J Clin LabAnaly 16(1): 47-51.

MEDZIHRADSZKY KF. 2008. Characterization of site-specific N-glycosylation. Meth Mol Biol 446: 293-316.

MELLQUIST JL, KASTURI L, SPITALNIK SL, SHAKIN-ESHLEMAN SH. 1998. The amino acid following an asn-X-Ser/Thr sequence is an important

determinant of N-linked core glycosylation efficiency. Biochem 37(19): 6833-37.

MERTENS JA, SKORY CD. 2006. Isolation and characterization of a second glucoamylase gene without a starch binding domain from Rhizopus oryzae. Enzy. Microbia. Technol. 40: 874-880.

MIKAMI B, ADACHI M, KAGE T, SARIKAYA E, NANMORI T, SHINKE R, UTSUMI S. 1999. Structure of raw starch-digesting Bacillus cereus beta-amylase complexed with maltose. Biochem 38(22): 7050--61.

NATALIA D, VIDILASERIS K, SATRIMAFITRAH P, ISMAYA WT, PURKAN H, PERMENTIER H, FIBRIANSAH G, PUSPASARI F, NURACHMAN Z, DIJKSTRA BW, SOEMITRO S. 2011. Biochemical characterization of a glucoamylase from Saccharomycopsis fibuligera R64. Biol66(1): 27-32.

NOROUZIAN D, JAFFAR MB. 1993. Immobilization of glucoamylase produced by fungus Arthrobotrys amerospore. Indian JExp Biol 31: 680-681.

NOROUZIAN D, AKBARZADEH A, SCHARER JM, YOUNG MM. 2005. Fungal glucoamylases. Elsevier: p. 80-83.

OLANIYI OO, AKINYELE BJ, AROTUPIN DJ. 2010. Purification and characterization of beta amylase from Volvariella volvacea. Nigerian J Microbiol 24(1): 1976-82.

PANDEY A, NIGAM P, SOCCOL CR, SOCCOL VT, SINGH D, MOHAN R. 2000. Advances in microbial amylases. Biotechnol Appl Biochem 31: 135-152.

PAVEZZI FC, GOMES E, DA SILVA R. 2008. Production and characterization of glucoamylase from fungus Aspergillus awamori expressed in yeast Saccharomyces cerevisiae using different carbon sources. Braz J Microbiol 39(1): 108-114.

PRIMER-BLAST [Computer software]. n/d. US National Center for Biotechnology Information. Retrieved from http://www.ncbi.nlm.nih.gov/tools/primer-blast

REILLY PJ. 1999. Protein engineering of glucoamylase to improve industrial properties; a review. Starch 51: 269-274.

SCHAFER T, BORCHERT TW, NIELSEN VS, SKAGERLIND P, GIBSON K, WENGER K. 2007. Industrial enzymes. Adv BiochemEng/Biotechnol 105: 59-131.

SCHEIDIG A, FRÖHLICH A, SCHULZE S, LLOYD JR, KOSSMANN J. 2002. Downregulation of a chloroplast-targeted beta-amylase leads to starch-excess phenotype in leaves. Plant J 30: 581-591.



273

SHIAU RJ, HUNG HC, JEAN CL. 2003. Improving the thermostability of raw-starch-digesting amylase from Cytophaga sp. by site-directed mutagenesis. Appl. Environ. Microbiol. 69(4): 2383-85.

SEVCÍK J, SOLOVICOVÁ A, HOSTINOVÁ E, GASPERÍK J, WILSON KS, DAUTER Z. 1998. Structure of glucoamylase from Saccharomycopsis fibuligera at 1.7 A resolution. Acta Crystallogr. D54: 854-866.

SEVCÍK J , HOSTINOVÁ E, SOLOVICOVÁ A, GASPERÍK J, DAUTER Z, WILSON KS. 2006. Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain. FEBS J. 273(10): 2161-71.

SHOSEYOV O, SHANI Z, LEVY I. 2006. Carbohydrate binding modules: biochemical properties and novel applications. Microbiol Mol Biol Rev. 70(2): 283-95.

SIERKS MR, FORD C, REILLY PJ, SVENSSON B. 1990. Catalytic mechanism of fungal glucoamylase as defined bymutagenesis of Asp176, Glu179, and Glu180 in the enzyme from Aspergillus awamori. Protein Eng 3: 193-198.

SIEVERS F, WILM A, DINEEN D, GIBSON TJ, KARPLUS K, LI W, LOPEZ R, MCWILLIAM H, REMMERT M, SODING J, THOMPSON JD, HIGGINSDG. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol SystBiol 7: 539.

SINNOTT ML. 1990. Catalytic mechanism of enzymic glycosyl transfer. Chem Rev 90: 1171-1202.

SOHN CB, LEE SM, KIM MH, KO JH, KIM KS. 1996. Purification and characterization of β-amylase from Bacillus polytnyna No 26-1. J Food Sci 61: 230-234.

SOLOVICOVÁ A, CHRISTENSEN T, HOSTINOVÁ E, GASPERÍK J, SEVCĬK J, SVENSSON B. 1999. Structure-function relationships in glucoamylases encoded by variant Saccharomycopsis fibuligera genes. Eur J Biochem. 264(3): 756-64.

SUNDARRAM A, MURTHY TPK. 2014. α-Amylase Production and Applications: A Review. Journal of Applied & Environmental Microbiology 2(4): 166-175.

SVENSSON B, CLARKE AJ, SVENDSEN I, MOLLER H. 1990. Identification of carboxylic acid residues in glucoamylaseG2 from Aspergillus niger that participate in catalysis and substrate binding. Eur J Biochem 188: 29-38.

TANAKA Y, TAO W, BLANCHARD JS, HEHRE EJ. 1994. Transition-state structures for the hydrolysis of alpha-dglucopyranosyl fluoride by retaining and

inverting reactions of glycosylases. J Biol Chem 269: 32306-12.

UEDA S, MARSHALL JJ. 1980. Raw starch digestion of Bacillus polymyxa bet amylase. Starch/Starke 32: 122-125.

VIHINEN M, MANTASALA P. 1989. Microbial amylolytic enzymes. Critic Rev Biochem Mol Biol 24: 329-418.

WASS MN, KELLEY LA, STERNBERG MJ. 2010. 3DLigandSite: predicting ligand-binding sites using similar structures. Nar 38:469-73.

WIND RD. 1997. Starch-converting Enzymes from Thermophilic Microorganisms, PhD thesis, ISBN 90-9010859-9, Ponsen & Looijen BV, Wageningen, the Netherlands.

WONG DWS, ROBERTSON GH. 2002. Beta-amylases. In: Handbook of Food Enzymology. Whitaker JR, Voragen AGJ, Wong DWS eds. Marcel Dekker: New York; Chapter 57.

WU AC, RAL JP, MORELL MK, GILBERT RG. 2014. New Perspectives on the Role of α- and β-Amylases in Transient Starch Synthesis. PLoS ONE 9(6): e100498.

YE J, COULOURIS G, ZARETSKAYA I, CUTCUTACHE I, ROZEN S, MADDEN TL 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinf 13: 134.

Documents

Determination of the cDNA Sequence and In Silico Functional …philjournalsci.dost.gov.ph/images/pdf_upload/pjs2018/2... · 2018-05-18 · α-amylase (Amyl I) – which is unable