D

CDA

ARRAA

KLP

1

ssSpsLpticiKtwnCw

siDa(

0d

Journal of Virological Methods 155 (2009) 122–125

Contents lists available at ScienceDirect

Journal of Virological Methods

journa l homepage: www.e lsev ier .com/ locate / jv i romet

etection of porcine parvovirus by loop-mediated isothermal amplification

hang-mu Chen, Shang-jin Cui ∗

ivision of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute of Chinesecademy of Agricultural Sciences, Harbin 15001, Heilongjiang, China

rticle history:eceived 17 June 2008eceived in revised form 1 October 2008

a b s t r a c t

Loop-mediated isothermal amplification is a novel method for rapid amplification of DNA. It has beenadopted widely for the detection of virus because of its simplicity, rapidity, and specificity. A loop-mediated

ccepted 7 October 2008vailable online 20 November 2008

eywords:oop-mediated isothermal amplificationorcine parvovirus

isothermal amplification assay was developed for the detection of porcine parvovirus. Four primers spe-cific for six regions of PPV non-structural protein 1 gene were designed with an online software. Afteramplifying at a constant temperature of 59–65 ◦C by Bst enzyme, a clear result was visible after 2.5%agarose gel electrophoresis. The sensitivity and specificity of this assay were evaluated by comparisonwith the polymerase chain reaction. The detection limit of the assay was shown to be equivalent to 5PPV copies/reaction. Due to its specificity and simplicity, the assay should be a useful diagnostic tool for

PV.

macnco2ooc

cutpntcppoa

epidemiologic studies of P

. Introduction

Porcine parvovirus (PPV) causes reproductive failure in pregnantows characterized by embryonic and fetal death, mummification,tillbirths, and delayed return to oestrus (Mengeling et al., 1991;oares et al., 1999). Although acute infection of postnatal, non-regnant pigs is usually subclinical, PPV has also been linked tokin lesions in piglets (Kresse et al., 1985; Whitaker et al., 1990;ager and Mengeling, 1994), interstitial nephritis in slaughter-agedigs (Drolet et al., 2002), and non-suppurative myocarditis in lac-ating piglets (Bolt et al., 1997). More recently, PPV has gainedmportance as an agent able to enhance the effects of porcineircovirus type 2 infection during the clinical course of postwean-ng multisystemic wasting syndrome (PMWS) (Allan et al., 1999;rakowka et al., 2000), a disease of significant economic impor-

ance worldwide (Segalés et al., 2005). Because of its associationith the above clinical and pathological conditions, PPV is recog-ized as an important cause economically of reproductive failure.onsequently, inactivated vaccines against this virus are marketedorldwide (Mengeling et al., 1991).

Clinical diagnosis of PPV infection is difficult because the mainigns of disease are similar to those of other diseases. Accord-

ngly, laboratory confirmation is required for suspected cases.etection of PPV has been based on virus isolation (VI), latexgglutination (LA), hemagglutination (HA), electron microscopyEM), enzyme-linked immunosorbent assay (ELISA), and poly-

∗ Corresponding author. Tel.: +86 139 460 577 80; fax: +86 451 827 331 32.E-mail address: cuishangjin@yahoo.com.cn (S.-j. Cui).

TpwtthDt

166-0934/$ – see front matter © 2008 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2008.10.004

© 2008 Elsevier B.V. All rights reserved.

erase chain reaction (PCR) (Hohdatsu et al., 1988). Although EMnd virus isolation are highly specific and sensitive, they are timeonsuming and expensive for routine use in a clinic. Latex aggluti-ation is rapid but lacks sensitivity. HA lacks reliability without aonfirmatory inhibition test, and has the additional disadvantagef requiring a continuous supply of fresh erythrocytes (Cho et al.,006). PCR has been used widely for laboratory diagnosis becausef its sensitivity and specificity. Although it is also rapid, requiringnly 2–4 h for detection of viral nucleic acid, it requires a thermalycler, which is not available to local veterinarians.

Loop-mediated isothermal amplification (LAMP) is an amplifi-ation method developed by Notomi et al. (2000). The techniqueses four to six primers that recognize six to eight regions ofhe target DNA, respectively, in conjunction with the enzyme Bstolymerase, which has strand displacement activity. The simulta-eous initiation of DNA synthesis by multiple primers makes theechnique highly specific. The test is carried out under isothermalonditions (60–65 ◦C) and produces large amounts of DNA. LAMProceeds when the forward inner primer (FIP) anneals to the com-lementary region (F2c) in the target DNA and initiates synthesisf the first strand. The outer forward primer (F3) then hybridisesnd displaces the first strand, forming a loop structure at one end.his single-stranded DNA serves as template for backward innerrimer (BIP)-initiated DNA synthesis and subsequent outer back-ard (B3)-primed strand displacement DNA synthesis, leading to

he formation of dumbbell-shaped DNA structures. The stem-loophus formed acts as a template, and subsequently one inner primerybridises to the loop on the product and initiates the displacementNA synthesis, forming the original stem loop and a new stem loop

hat is twice as long. The final products are stem-loop DNAs, which

C.-m. Chen, S.-j. Cui / Journal of Virological Methods 155 (2009) 122–125 123

Table 1The information of clinical samples.

Origin Number Statue Pooled samples

H borteS borteD borteH borte

hs

claemw

2

2

awHc(paVSpNtppICa

2

ptT

Fls(i

G

G

2

c4Tpiwtvs(−1ois

TtfM

2

arbin city 18 Aui Hua city 15 Aa Qin city 12 Ae Gang city 5 A

ave several inverted repeats of the target DNA and cauliflower-liketructures bearing multiple loops (Notomi et al., 2000).

LAMP has been used successfully for the detection of porcineircovirus type 2 (PCV2), pseudorabies virus (PRV), swine vesicu-ar disease virus (SVDV), influenza virus, human parvovirus B19,nd other viruses (Blomstrom et al., 2008; Chen et al., 2008; Ent al., 2008; Jayawardena et al., 2007; Yamada et al., 2006), but theethod has not been used to detect PPV. In this study, a LAMP assayas developed and evaluated for its potential to detect PPV.

. Materials and methods

.1. Viral strains and clinical samples

The PPV BQ strain used in the study was a field isolate fromn aborted fetus in the Hei Longjiang Province, China. The virusas cultured on swine testis cells (a cell line maintained in thearbin Veterinary Research Institute of Chinese Academy of Agri-ultural Science) for 30 generations and identified by sequencingGenBank no. EU790641). PCV2, PRV, porcine reproductive and res-iratory syndrome virus (PRRSV), classical swine fever virus (CSFV),nd swine influenza virus (SIV) were also maintained in the Harbineterinary Research Institute of Chinese Academy of Agriculturalciences, located in the Hei Longjiang Province. A recombinantlasmid pMD-18-PPV, which contained a 271-bp fragment of PPVS1 gene (1766–2036 bp) was constructed in the authors’ labora-

ory. The “U-LAMP® loop-mediated amplification universal kit” wasurchased from Mylab Corporation (Beijing, China). The “plasmidurification mini kit” was purchased from Watson Biotechnologies,

nc. (Shanghai, China). DNA polymerase was purchased from Takaraompany (Dalian, China). Field samples were collected from 50borted fetuses in Hei Longjiang (Table 1).

.2. Design and synthesis of the LAMP primers

With published PPV sequences as reference, two sets of LAMPrimers and a pair of PCR primers were designed with the help ofhe online software PrimerExporer V4 and Oligo6 software (Fig. 1).he sequences of the primers were as follows:

ig. 1. Primer design of LAMP. Six distinct regions are designated on the target DNA,abeled F3, F2, F1, B1c, B2c and B3c from the 5′ end. As c represents a complementaryequence, the F1c sequence is complementary to the F1 sequence. Two inner primersFIP and BIP) and outer primers (F3 and B3) are used in the LAMP method. FIP (BIP)s a hybrid primer consisting of the F1c (B1c) sequence and the F2 (B2) sequence.

2PPor5aB2

2

bo22adf

d fetus Heart, liver, spleen, lung, kidney, lymph noded fetus Heart, liver, spleen, lung, kidney, lymph noded fetus Heart, liver, spleen, lung, kidney, lymph noded fetus Heart, liver, spleen, lung, kidney, lymph node

BIP: GGACTTTTAGAAGAAACTGAATGGCAGCCATTGTTGCTTG-TAAC;

FIP: TGGCAGTTTTCTGGTTAGGTTTCAGAACATACACAACCAATAA-AGA;

B3: GAATAGGATGCGAGGAAAGAC;F3: TCCCCAATGATGCATATAGCT;P1: GAATAGGATGCGAGGAAAGAC;P2: TCCCCAATGATGCATATAGCT.

.3. Preparation of template

The pMD-18-PPV plasmid was purified with the plasmid purifi-ation mini kit as indicated by the manufacturer. After elution with0 �l of sterile water, the plasmid was stored at −20 ◦C for later use.he genomic DNA of PPV was extracted with a method describedreviously (Sambrook and Russell, 2001). After freezing and thaw-

ng three times, 500 �l of the cell culture or the tissue samplesere digested with 1 �l of proteinase K at 50 ◦C for 1.5 h. The diges-

ion was extracted with an equal volume of phenol–chloroform (1:1/v). After the sample was centrifuged at 12,000 × g for 15 min, theupernatant was transferred to a new Eppendorf tube. Isopropanol200 �l) was added to each tube, and tubes were then incubated at20 ◦C for 1 h. This was followed by centrifugation at 12,000 × g for0 min. The supernatant was discarded, and the pellet was washednce with 75% ice-cold ethanol, after which it was dried in a lam-nar flow cabinet. The precipitate of DNA was dissolved in 50 �l ofterile water and then stored at −20 ◦C for later use.

Total RNA was extracted from PRRSV, CSFV, and SIV cultures withRIzol® reagent in accordance with the manufacturer’s instruc-ions. cDNA synthesis reaction was performed by PCR as describedor the Moloney murine leukemia virus reverse transcriptase (M-

LV RT, TaKaRa Co., China).

.4. PCR

PCR was carried out in a 25-�l reaction volume containing.5 mM of each deoxynucleoside triphosphate (dNTP), 5 �l of 10×CR buffer, 5 U of Taq polymerase, 10 �M each of primers P1 and2, and 1 �l of serial dilutions of 1, 5, 25, 125, 625, and 3125 copiesf DNA from recombinant plasmid pMD-18-PPV. The amplificationegime was 5 min at 94 ◦C; followed by 30 cycles of 94 ◦C for 45 s,5 ◦C for 30 s, and 72 ◦C for 30 s; with a final elongation for 7 mint 72 ◦C. PCR was carried out in the 2720 Thermal Cycler (Appliediosystems). PCR products were subjected to electrophoresis on a.5% agarose gel.

.5. LAMP reaction

The LAMP reaction was carried out in a conventional waterath by mixing 2.0 �M each of FIP and BIP primer, 0.2 �M eachf F3 and B3 primer, 10 �l of 2× U-LAMP Mix (40 mM Tris–HCl,

0 mM KCl, 20 mM (NH4)2SO4, 10 mM MgSO4, 0.2% Triton X-100,.4 mM dNTP), 3 �l of 25 mM MgCl2, 1.5 �l of Bst DNA polymerase,nd 1 �l of extracted template DNA or cDNA in a 0.5-ml Eppen-orf tube. The amplification reaction was performed at 59–65 ◦Cor 60 min and then terminated by heating at 80 ◦C for 10 min.

1 rological Methods 155 (2009) 122–125

Lg

2

PdrtosaBet

2

mwBs

3

3

5aessms

3

11t

Fig. 3. Specificity of LAMP assay. Lane M: DNA Marker DL2000 (TaKaRa); lane 1:LAMP products use PPV genome as template; lane 2: LAMP products use PCV2genome as template, lane 3: LAMP products use cDNA of PRV genome as template,luSt

wo

3

wumLnps

Ftr

24 C.-m. Chen, S.-j. Cui / Journal of Vi

AMP products were subjected to electrophoresis on a 2.5% agaroseel.

.6. Sensitivity and specificity of LAMP

The detection limit of LAMP was tested and compared withCR by using the same templates at identical concentrations. Serialilutions of 1, 5, 25, 125, 625, and 3125 copies of DNA from theecombinant plasmid pMD-18-PPV were used in this assay. In addi-ion, 50 clinical samples were tested by LAMP and the sensitivityf detection was compared between LAMP and PCR. To assess thepecificity of LAMP, potential cross-reactions with DNA of PCV2nd PRV, and cDNA of PRRSV, CSFV, and SIV were examined. PPVQ strain genomic DNA was used as the positive control, and DNAxtracted from healthy swine tissues was used as the negative con-rol.

.7. DNA sequencing

PCR products were cloned into a pMD-18 vector and then sub-itted to the TakaRa Company for sequencing. DNAStar softwareas applied to align the sequences, and BLAST searching of Gen-ank was used to assess homology with the known NS1 geneequences of PPV.

. Results

.1. The optimal temperature for PPV LAMP assay

A successful LAMP reaction with PPV-specific primers at9–65 ◦C for 60 min produces many bands of different sizes upongarose electrophoresis because the LAMP products consist of sev-ral inverted-repeat structures. The amplification of PPV by LAMPhowed a ladder-like pattern, whereas the PCR product was apecific DNA band. Because LAMP of PPV produced brighter, andore distinct bands at 63 ◦C than at other temperatures, 63 ◦C was

elected as the optimal temperature for PPV LAMP.

.2. Sensitivity of the LAMP

To evaluate the sensitivity of PPV LAMP, serial dilutions of 1, 5, 25,25, 625, and 3125 copies of DNA from recombinant plasmid pMD-8-PPV were used as template at 63 ◦C. The result indicated thathe detection limit of the LAMP of PPV was five copies per reaction

3

L(

ig. 2. Sensitivities of LAMP and PCR for the detection of pMD-18-PPV lane M: DNA mao LAMP(3125, 625, 125, 25, 5 and 1 copies/tube, respectively); lanes 8–13: different pMDespectively); lane 7: blank.

ane 4: LAMP products use cDNA of CSFV genome as template, lane 5: LAMP prod-cts use cDNA of PRRSV genome as template, lane 6: LAMP products use cDNA ofIV genome as template, lane 7: LAMP products use DNA from pig healthy tissues asemplate.

hereas that of PCR was also five copies (Fig. 2). The detection limitf LAMP was therefore equivalent to that of conventional PCR.

.3. Specificity of the LAMP

DNA extracted from tissues of healthy animals; pigs infectedith PCV2, PPV, or PRV; and cDNA from PRRSV, CSFV, or SIV weresed as templates for PPV LAMP to evaluate the specificity of theethod. Agarose gel electrophoresis analysis indicated that PPV

AMP did not detect PCV2, PRV, PRRSV, CSFV, or SIV, and gave aegative reaction with tissues from healthy swine. The PPV LAMPrimer set gave a positive reaction only with DNA of the PPV BQtrain (Fig. 3).

.4. Diagnosis of PPV by LAMP

Field samples were collected from 50 aborted fetuses in the Heiongjiang Province. From each fetus, tissues from various organsheart, liver, spleen, lung, kidney, and lymph node) were pooled

rker DL2000 (TaKaRa); lanes 1–6: different pMD-18-PPV copy numbers subjected-18-PPV copy numbers subjected to PCR (3125, 625, 125, 25, 5 and 1 copies/tube,

rologi

ta(sfLpnar

3

aNS

4

i11ettao

bhiTtaibsi

ctbttLsmoc

wimC

5

c

si

A

iapP

R

A

A

B

B

C

C

D

E

H

J

K

K

K

L

M

N

S

S

S

W

C.-m. Chen, S.-j. Cui / Journal of Vi

o form one sample. The location of the city within the provincend the number of samples were as follows: Harbin (18), Sui Hua15), Da Qin (12), and He Gang (5). The samples were subjectedimultaneously to routine PCR and LAMP. Thirteen were positiveor PPV by both LAMP and PCR, and 34 were negative by bothAMP and PCR. Two samples that were negative by LAMP wereositive by PCR while one sample that was positive by LAMP wasegative by PCR. Compared with the routine PCR, the specificitynd sensitivity of LAMP were 93.3% (13/14) and 97.1% (34/36),espectively.

.5. Sequencing of amplified DNA

The sequence analyses of products with 188 bp from the PCRmplified NS1 gene of PPV showed high homology (100%) with theS1 sequence of PPV Kresse strain (accession number NC 001718).equencing was done at least twice to avoid artifacts.

. Discussion

PPV (porcine parvovirus) has had a serious impact on the pigndustry because it causes reproductive failure (Thomas et al.,985), is associated with lesions on piglets (Kelly and William,994), and appears to enhance PMWS (Allan et al., 1999; Krakowkat al., 2000). Thus, the development of a simple and rapid diagnosticool that could detect PPV and differentiate it from other viruses inhe same samples (PCV2, PRV, CSFV, PRRSV, and SIV) would be valu-ble for epidemiological surveillance and prediction of the severityf PPV infection in swine herds.

To identify PPV infection, several methods have been developedased on the genome or the characteristic antigen of the virus. Theaemagglutination inhibition (HI) test, neutralization test (NT), and

ndirect ELISA are available for the detection of antibody to PPV.hese serological techniques, however, cannot determine whetherhe vaccine or a wild-type virus is the inducer of the antibody. VInd PCR also have been used by several researchers to identify PPVnfection but, as noted in the Introduction, these methods cannote used easily in local veterinary clinics. In contrast, LAMP is quiteimple, requiring only a conventional water bath or heat block forncubation under isothermal conditions.

The NS1 gene located on the left half of the genome is highlyonserved and serves as a useful and specific target gene for detec-ion of PPV (Ana et al., 1989). Several detection methods haveeen developed based on the NS1 gene (Soares et al., 1999). Forhe LAMP assay in the current study, four primers correspondingo six distinct regions of NS1 gene were used. The specificity ofAMP was higher or equivalent to that of routine PCR. The presenttudy demonstrates that the LAMP is an effective and time-savingethod for detecting PPV. Because it does not require expensive

r sophisticated equipment, LAMP can be performed easily in alinic.

Of the 50 field samples in this study, 14 were positive for PPVhen assayed by PPV LAMP, indicating a high prevalence of PPV

nfection. No PPV was detected from the other samples, whichight be infected by other pathogens, such as PRRSV, PRV, and

SFV that need to be convinced by other methods.

. Conclusion

In summary, a PPV LAMP assay was developed for detecting theonservative region of PPV. PPV LAMP was found to be a simple,

T

Y

cal Methods 155 (2009) 122–125 125

ensitive, rapid, and a reliable method for the diagnosis of PPVnfection.

cknowledgements

The authors thank Mr. Chao-fan Zhang for his help in collect-ng samples and Mr. Yong-shen Liu for his constructive suggestionsbout the design of this research. The study was supported inart by funding from the National High-tech R&D Program (863rogram-2007AA100606).

eferences

llan, G.M., Kennedy, S., McNeilly, F., Foster, J.C., Ellis, J.A., Krakowka, S.J., Meehan,B.M., Adair, B.M., 1999. Experimental reproduction of severe wasting diseaseby co-infection of pigs with porcine circovirus and porcine parvovirus. J. Comp.Pathol. 121, 1–11.

na, I.R., Juan, J.M., Esmeralda, D.A., Josi, I.C., 1989. Porcine parvovirus: DNA Sequenceand Genome Organization. J. Gen. Virol. 70, 2541–3255.

lomstrom, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belak, S., Berg, M.,2008. A one-step reverse transcriptase loop-mediated isothermal amplificationassay for simple and rapid detection of swine vesicular disease virus. J. Virol.Methods 147, 188–193.

olt, D.M., Hani, H., Muller, E., Waldvogel, A.S., 1997. Non-suppurative myocarditisin piglets associated with porcine parvovirus infection. J. Comp. Pathol. 1172,107–118.

hen, H.T., Zhang, J., Sun, D.H., Chu, Y.F., Cai, X.P., Liu, X.T., Luo, X.N., Liu, Q., Liu, Y.S.,2008. Rapid detection of porcine circovirus type 2 by loop-mediated isothermalamplification. J Virol Methods 149, 264–268.

ho, H.S., Kang, J.I., Park, N.Y., 2006. Detection of canine parvovirus in fecal sam-ples using loop-mediated isothermal amplification. J. Vet. Diagn. Invest. 18, 81–84.

rolet, R., D’Allaire, S., Larochelle, R., Magar, R., Ribotta, M., Higgins, R., 2002. Infec-tious agents identified in pigs with multifocal interstitial nephritis at slaughter.Vet. Rec. 150, 139–143.

n, F.X., Wei, X., Jian, L., Qin, C., 2008. Loop-mediated isothermal amplificationestablishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39.

ohdatsu, T., Baba, K., Ide, S., Tsuchimoto, M., Nagano, H., Yamagami, T., Yamagishi,H., Fujisaki, Y., Matumoto, M., 1988. Detection of antibodies against poreine par-vovirus in swine sera by enzyme linked immunosorbent assay. Vet. Microbiol.17, 11–19.

ayawardena, S., Cheung, C.Y., Barr, I., Chan, K.H., Chen, H., Guan, Y., Peiris, J.S., Poon,L.L., 2007. Loop-mediated isothermal amplification for influenza A (H5N1) virus.Emerg. Infect. Dis. 13, 899–901.

elly, M.L., William, L.M., 1994. Porcine parvovirus associated with cutaneous lesionsin piglets J. Vet. Diagn. Invest. 6, 357–359.

rakowka, S., Ellis, J.A., Meehan, B., Kennedy, S., McNeilly, F., Allan, G., 2000.Viral wasting syndrome of swine: experimental reproduction of postwean-ing multisystemic wasting syndrome in genotobiotic swine by coinfectionwith porcine circovirus 2 and porcine parvovirus. Vet. Pathol. 37, 254–263.

resse, J.I., Taylor, W.D., Stewart, W.W., Eemisse, K.A., 1985. Parvovirus infection inpigs with necrotic and vesicle-like lesions. Vet. Microbiol. 10, 525–531.

ager, K.M., Mengeling, W.L., 1994. Porcine parvovirus associated with cutaneouslesions in piglets. J. Vet. Diagn. Invest. 6, 357–359.

engeling, W.L., Lager, K.M., Zimmerman, J.K., Samarikermani, N., Beran, G.W., 1991.A current assessment of the role of porcine parvovirus as a cause of fetal porcinedeath. J. Vet. Diagn. Invest. 3, 33–35.

otomi, T., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000.Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, 63.

ambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd edi-tion. Cold Spring Harbor Laboratory Press, New York.

egalés, J., Allan, G.M., Domingo, M., 2005. Porcine circovirus diseases. Anim. HealthRes. Rev. 6, 119–142.

oares, R.M., Durigon, E.L., Bersano, J.G., Richtzenhain, L.J., 1999. Detection of porcineparvovirus DNA by the polymerase chain reaction assay using primers to thehighly conserved nonstructural protein gene, NS-1. J. Virol. Methods 78, 191–198.

hitaker, H.K., Neu, S.M., Pace, L.W., 1990. Parvovirus infection in pigs with exuda-

tive skin disease. J. Vet. Diagn. Invest. 2, 244–246.

homas, W.M., Han, S.J., Marc, S.C., 1985. Identification and characterization of aporcine parvovirus nonstructural polypeptide. J. Virol. 55, 554–559.

amada, Y., Itoh, M., Yoshida, M., 2006. Sensitive and rapid diagnosis of human par-vovirus B19 infection by loop-mediated isothermal amplification. Br. J. Dermatol.155, 50–55.