Conclusion

• We were successful in the design of the siRNA vector with AGT-1 insert and transformation of HT115 cells resulting in the silencing of AGT-1. • With AGT-1 being silenced in C.elegans, it caused numerous phenotypic effects compared to the wild type C.elegans. This could be due to alternating the DNA methylation status and changes to gene expression within the worms.

Future Research

Introduction

• Recent work has shown epigenetics, alterations in gene expression other than changes to DNA sequence, to be an important aspect of gene expression. In particular, an epigenetic mechanism such as DNA methylation has been shown to be important for alternating gene expression in many diseases including cancer (Rodriguez-Osorio et al. 2010).

• Methylation of CpG dinucleotides is through actions of a DNA methyltransferase, such as the O-6-methylguanine DNA methyltransferase gene, also known as the MGMT gene.

• MGMT gene plays a role in cytotoxicity and apoptosis by suppressing DNA mutations resulting from DNA alkylation (figure below). Active MGMT (methylated) has been shown to increase the survival rates within glioblastoma patients (Hau et al. 2007).

• By using NCBI BLAST software, the results showed C.elegans have a human gene homolog of MGMT identified as AGT-1. A homolog is a gene with similar DNA sequences and function in different organisms.

• C.elegans share many biochemical and physiological functions with higher organisms including humans, making them an excellent model organism.

• To determine the role a gene may play in an organism, it is possible to “knock out” gene expression and function within C.elegans by using siRNA technology.

Effects of “knocking out” AGT-1 gene in C.Elegans by RNAi mechanism

Monica Coulson, Department of Biology, York College

http://wormatlas.org

Methods

Literature Cited

1. Hau, P., Stupp, R., and Hegi, M.E.2007. MGMT methylation status: The advent of stratified therapy in glioblastoma. Disease Markers 23: 97-104.2. National Science Foundation (NSF). 2007. Silencing genome. Available from: http://www.silencinggenomes.org/. Accessed 2010 April 29.3. Rodriguez-Osorio, N., Wang, H., Rupinski, J., Bridges, S.M., and Memili, E. 2010. Comparative functional genomics of mammalian DNA methyltransferases. Reproductive BioMedicine Online 20:243-255.

http://www.alnylam.com/rnai_primer/rna-interference-pg5.htm

Results

Hau et al. 2007

Figure 3. Verification of AGT-1 siRNA fragment into PR244 vector. HT115 cells were transformed with PR244-AGT-1 plasmid. Colonies were picked and DNA was purified with AGT-1 primers as described in Figure 1.

Objectives

1. To identify a human gene homolog of MGMT in C.elegans.

2. To create a siRNA vector with AGT-1 gene insert.

3. To observe the developmental, behavioral, and phenotypic effects by knocking out AGT-1 gene expression in C.elegans.

Results

AGT-1 “knock down” phenotypePlace L4 C.elegans

onto plateMaintain the worms

for 3-4 days Record observations

Create siRNA vector

Miniprep for PR244

vector

BP Clonase

(Invitrogen)

Transform E.coli

Pick colonies & grow in LB/KAN

Plate E.coli on LB/KAN IPTG plate

Isolation and amplification of worm DNA

PCR- N2 worm DNA Gel Electrophoresis QI Aquick Gel Extraction

Identification of human gene homolog to MGMT

NCBI BLAST software

Creation of primers for AGT-1 gene

Forward: 5’ GGGG-ACA-AGT-TTG-TAC-AAA-AAA-GCA-GGC-TAA tccagatttctgaactggctt 3’ (ATTB)

Reverse:5’ GGGG-AC-CAC-TTT-GTA-CAA-GAA-AGC-TGG-GTA cggagctttgtgttggtttt 3’ (ATTP)

100bp Transformed Coloniesladder 1 2 3 4

100 bp C.elegans DNA ladder RXN 1 RXN 2

300bp

200bp

100bp

208 bp

Figure 1. PCR of N2 C.elegans DNA with AGT-1 primers. N2 DNA was amplified using AGT-1 primers (94 30”, 6030”,7230”) 30 cycles. Samples resolved on 2% agarose gel at 250 V for 12 minutes and imaged.

208bp

• AGT-1 primer design was successful in amplifying AGT-1 gene and producing expected size fragment (208bp) (Figure 1).

• AGT-1 siRNA fragment was inserted into PR244 vector (Figure 2) and HT115 cells successfully transformed because insert (208bp) was shown to be represented in transformants (Figure 3).

• AGT-1 siRNA exposed C.elegans showed numerous phenotypic differences from wild type (N2) C.elegans (Table 1).

Figure 2. PR244 vector with AGT-1 insert. AGT-1 inserted into vector by BP clonase reaction. HT115 bacteria were transformed with PR244 vector and grown under Kanomycin selection.

N2 worms siRNA AGT-1 worms

DevelopmentAdults had eggsLong and lean

Identifiable stages

Stages not identifiableSome long or short

Some lean or dumpy

BehaviorSinuousActive

Responsive

Some activeSome slowStationary

Abundance A lot of adults, L4’s, L2’s, and eggs were visible

No adultsNo eggs

L4 stage wormsA lot of dead worms

Table 1. Phenotypes of wild type (N2) and siRNA AGT-1 C.elegans

• Through RT-PCR, measure the mRNA levels in siRNA treated C.elegans to ensure AGT-1 gene was silenced in C.elegans.

• PCR of AGT-1 siRNA C.elegans DNA to test for decreased function of AGT-1 and increases in DNA methylation status.

Acknowledgement

I would like to thank Dr. Kaltreider and the Biology faculty for their assistance.

300bp200bp

100bp