Collagenolytic Protease Expression in Cranial Cruciate Ligament

and Stifle Synovial Fluid in Dogs with

Cranial Cruciate Ligament Rupture

PETER MUIR, BVSc, MVetClinStud, PhD, Diplomate ACVS, NICHOLE A. DANOVA, DVM, DAVID J. ARGYLE, BVMS, PhD,PAUL A. MANLEY, DVM, MSc, Diplomate ACVS, and ZHENGLING HAO, BS, MS

Objective—To determine expression of collagenolytic genes and collagen degradation in stifle tis-sues of dogs with ruptured cranial cruciate ligament (CCL).Animals—Six dogs with CCL rupture and 11 dogs with intact CCL.Procedures—Gene expression in CCL tissue and synovial fluid cells was studied using reversetranscriptase-polymerase chain reaction (RT-PCR). Collagen degradation was studied using CCLexplant cultures and a synovial fluid bioassay.Results—Expression of matrix metalloproteases (MMP) was not found in young Beagles with intactCCL; however, increased expression of MMP-3 was found in CCL tissue from older hounds withintact CCL, when compared with young Beagles. In dogs with ruptured CCL, expression of MMP-2and -9 was increased in stifle tissues, when compared with dogs with intact CCL. Similar to MMP-9,expression of tartrate-resistant acid phospatase (TRAP) and cathepsin S was only found in stifletissues from dogs with ruptured CCL; in contrast, expression of cathepsin K was found in allruptured and intact CCL. Collagen degradation was increased in ruptured CCL, when comparedwith intact CCL.Conclusion—Rupture of the CCL is associated with up-regulation of expression of MMP-2 and -9(gelatinase A and B), TRAP, and cathepsin S, and increased degradation of collagen.Clinical Relevance—These findings suggest that MMP-2, -9, cathepsin S, and TRAP may beimportant mediators of progressive joint destruction in dogs with CCL rupture. These genes aremarkers for macrophages and dendritic cells. MMP and cathepsin S pathways may offer noveltargets for anti-inflammatory medical therapy aimed at ameliorating joint degradation associatedwith inflammatory arthritis.r Copyright 2005 by The American College of Veterinary Surgeons

Key words: cranial cruciate ligament rupture, inflammatory arthritis, matrix metalloproteases,cathepsin, tartrate-resistant acid phosphatase (TRAP), dog.

Supported by a grant from the American Kennel Club Canine Health Foundation, a Hohn-Johnson Research Award from the

Veterinary Orthapaedic Society, and an American College of Veterinary Surgeons Surgeon-in-training grant awarded to Dr. Danova. The

contents of this publication are the sole responsibility of the authors and do not necessarily represent the views of the American Kennel

Club Canine Health Foundation.

This work was presented at the 14th Annual American College of Veterinary Surgeons Symposium, Denver, CO, October 2004.

Address reprint requests to Dr. Peter Muir, BVSc, MVetClinStud, PhD, Diplomate ACVS, Department of Surgical Sciences, School

of Veterinary Medicine, University of Wisconsin-Madison, 2015 Linden Drive, Madison, WI 53706.

E-mail: muirp@svm.vetmed.wisc.edu.

Submitted March 2005; Accepted July 2005

From the Comparative Orthopaedic Research Laboratory, School of Veterinary Medicine, University of Wisconsin-Madison,

Madison, WI.

r Copyright 2005 by The American College of Veterinary Surgeons

0161-3499/04

doi:10.1111/j.1532-950X.2005.00073.x

482

Veterinary Surgery

34:482–490, 2005

INTRODUCTION

RUPTURE OF the cranial cruciate ligament (CCL)in most dogs is a degenerative condition associated

with development of inflammatory stifle arthritis.1–3 Stiflearthritis and associated mid-substance CCL rupture is animportant cause of lameness in the dog with poor long-term prognosis; progressive lameness and stifle osteo-arthritis usually develop, irrespective of surgicaltreatment.4–6 Dogs with CCL rupture typically have in-flammatory changes in the synovial intima, the epiliga-ment of the CCL, the core region of the CCL, andalterations to the cell population of the stifle synovialfluid.1,2,7 These inflammatory changes and the reductionin the structural properties of the CCL associated withchondroid degeneration of ligament fibroblasts that de-velops with aging in the dog8,9 may be important factorsthat mediate progressive tearing and then complete rup-ture of the CCL during normal activity. Synovitis is animportant factor that can promote structural degradationof the CCL experimentally in rabbits.10

Although the cause of the synovial inflammation isunknown, recent work has shown that the synovial in-tima contains large numbers of dendritic cells and ma-crophage-like cells which express tartrate-resistant acidphosphatase (TRAP), together with increased immuno-globulin deposition.2,3,11,12 TRAPþ mononuclear cellswithin the synovium typically express many degradativecollagenolytic enzymes including cathepsin K, cathepsinS, and matrix metalloproteases (MMPs), such as MMP-9; the presence of TRAPþ mononuclear cells within thesynovium is a characteristic feature of inflammatory ar-thritis, and is considered a key factor promoting pro-gressive and irreversible articular cartilage and jointdestruction.13–17 Production of MMPs, cathepsins, andTRAP at sites of inflammation potentially all contributeto matrix degradation.14,16–18 Collagen is the major bio-logical substrate of cathepsin K; fragmentation of colla-gen occurs both outside and within cells duringpathologic matrix turnover.19,20 Although the specificfunction of TRAP in macrophages is not fully under-stood, TRAP is thought to have an important role inmacrophage and dendritic cell-induced inflammatory re-sponses, including phagocytosis.21,22 TRAP may alsohave a specific functional role in antigen presentationduring intracellular processing of MHC class II-contain-ing vesicles.21 TRAP can also fragment triple helical col-lagen by generation of reactive oxygen species.18 Dogswith CCL rupture typically have osteophyte formation atthe time of surgery; this suggests that synovitis has beenestablished for some time, as the synovial macrophage isthe key mediator of osteophyte development in arthriticjoints; degenerative changes are also commonly found inthe contralateral stifle of affected dogs.23,24 Increased

immunoglobulin deposition and expression of MHCclass II in the synovium of dogs with CCL rupture3,11

suggests that the associated inflammatory arthritis has animmune-mediated component. However, the antigenwhich acts as the trigger for persistent stifle synovitis isnot known; it is unlikely to be exposure of neo-epitopesof collagen.25

To further understanding of how inflammatory stiflearthritis may contribute to progressive CCL degradationand eventual rupture, we wished to determine the patternof collagenolytic gene expression in the CCL and the stiflesynovial fluid. We also wished to determine whether col-lagenolytic activity within the stifle joint was primarilycell associated. We hypothesized that the expression ofMMPs, cathepsins, and TRAP would be associated withCCL rupture and that this degradative activity would beprimarily cell associated.

MATERIALS AND METHODS

Dogs

Specimens of ruptured CCL and stifle synovial fluid werecollected from 6 dogs with cruciate disease during surgicaltreatment. In addition, CCL specimens were collected from 11normal dogs with intact CCL that were humanely euthanati-zed by intravenous administration of barbiturates for reasonsunrelated to our study. This group of both small young (5beagles) and large dogs (6 hounds) was selected as a baselinefor comparison with the CCL rupture group. Age, weight, andgender were recorded for each dog.

Reverse Transcriptase-Polymerase Chain Reaction

(RT-PCR)

Immediately after collection, a portion of each CCL tissueand stifle synovial fluid specimen was processed for RT-PCR.For RNA extraction, ruptured CCL were dissected and ho-mogenized in 1mL Trizol reagent (Invitrogen, Carlsbad, CA).Cell pellets from each stifle synovial fluid specimen were alsomixed with 1mL Trizol reagent. The cell-free fluid componentof the stifle synovial fluid was stored at �801C for use in anexplant culture experiment (see below). After incubation atapproximately 251C (room temperature [RT]) for 5 minutes,200mL chloroform (Sigma Chemical Co., St Louis, MO) wasadded and the mixture was shaken vigorously by hand for 15seconds and then incubated at RT for a further 10 minutes.The aqueous phase was separated by centrifugation at 41Cand 12,000 rpm for 15 minutes. The aqueous phase was thenmixed with 500mL of isopropyl alcohol (Fisher Scientific,Hannover Park, IL) in a new microtube. The mixture wasincubated at RT for 10 minutes and then centrifuged at 41Cand 12,000 r.p.m. for 10 minutes.The pellet was washed with1mL 75% isopropyl alcohol (Fisher Scientific) and centri-fuged at 41C, 8600 r.p.m. for 5 minutes. The pellet was then airdried for 10 minutes at RT and dissolved in 100mL of RNase-free water. Total RNA was further purified using a RNA

483MUIR ET AL

clean-up kit (Qiagen, Valencia, CA). cDNA was generatedfrom 0.2 to 1mg of total RNA by using the superscript IIIfirst-strand synthesis system for RT-PCR (Invitrogen).

PCR was performed using standard methods. A panel ofoligonucleotide primers was designed for the following colla-genolytic enzymes: MMP-1 (collagenase 1), MMP-2 (gelatin-ase A), MMP-3 (stromelysin 1), MMP-9 (Gelatinase B),MMP-13 (collagenase 3), TRAP, cathepsin K, and cathepsin S(Table 1). Primers were designed from known canine genesequences or regions of homology between the specific genesof other higher mammals. Glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) was used as the housekeeping gene.All PCR reactions were carried out in a final volume of 50mL,which contained 5mL 10 � magnesium-free PCR buffer (In-vitrogen), 1.5mL 50mM MgCl2 (Invitrogen), 1mL 10mMdNTPs (Invitrogen), 1mL 25mM forward primer, 1mL 25mMreverse primer, 1mL cDNA and 0.25mL platinum Taq po-lymerase enzyme (Invitrogen). cDNA synthesis was performedby denaturing the reaction mixture for 2 minutes at 941C.Thirty cycles of amplification (denaturizing at 941C for 30seconds, annealing at 551C for 30 seconds, and extension at721C for 90 seconds) were then performed. A final extensionwas then performed for 4 minutes at 721C with an end step at41C. PCR fragments were separated on 1.5% agarose gels,stained with ethidium bromide staining and observed usingUV light. PCR products were subsequently sequenced to con-firm production of the correct amplicon.

CCL Explant Culture and Synovial Fluid Bioassay

To assess collagen fragmentation in CCL tissue specimens,CCL explants were cultured in 12-well plates, each containing1mL of culture medium. Serum-free Dulbecco’s modified Ea-gle’s medium, supplemented with 20mM HEPES (DMEM

containing HEPES, Invitrogen) and antibiotic–antimycotic(streptomycin 100mg/mL, benzylpenicillin 100mg/mL, amp-hotericin 0.25mg/mL; antibiotic–antimycotic (100 � ) liquid, In-vitrogen), was used and explants were cultured for 2 days at371C in an atmosphere of 5%CO2. Collagenolytic activity in theextracellular component of stifle synovial fluid was determinedby using a piece of previously frozen patella tendon from anormal dog as a collagen substrate in a bioassay. Patella tendonwas incubated with a mixture of 50% synovial fluid and 50%culture medium for 48 hours. This assay was not performed forsmall dogs with intact CCL because the available volume ofsynovial fluid was insufficient for the assay to be performed.Supernatants were stored at �801C for further analyses.

Generation of collagen fragments in explant culture andbioassay supernatants was studied using immunoassays forepitopes from the triple helical region (/ 1(I) 620–633a helicalpeptide [HEL]) and the telopeptide regions (cross-linked car-boxyterminal telopeptide of type I collagen [ICTP], and thehydroxypyridinium collagen cross-link pyridinoline [PYD]) ofthe collagen molecule) (Metra Helical Peptide andMetra PYDELISA, Quidel Corporation; ICTP RIA, Diasorin).

Statistical Analysis

Differences between groups (dogs with CCL rupture,young dogs with intact CCL, large dogs with intact CCL) inweight and age were analyzed with an ANOVA and theKruskal–Wallis ANOVA test respectively; data were not nor-mally distributed for age. The Kruskal–Wallis ANOVA testwas used to determine whether differences in collagenolyticgene expression existed between groups. The Kruskal–WallisANOVA test was also used to determine whether there weredifferences in the generation of HEL, PYD, and ICTP frag-ments from CCL explants between groups; data were not

Table 1. Canine Oligonucleotide Primers for Reverse-Transcriptase Polymerase Chain Reaction

mRNA Targets Primer Type Olignonucleotides (5’–30) Amplicon Size (bp) Sequence References

MMP-1 Forward TTCGGGGAGAAGTGATGTTC 530 NM-002421 (human), NM-174112 (bovine)

Reverse GCAGTTGAACCAGCTATTAGC

MMP-2 Forward ATGGCAAATACGGCTTCTGC 288 AF177217 (canine)

Reverse TGCAGCTCTCATGCTTGTTG

MMP-3 Forward ACAGTGGTCCTGTCGTTGAA 269 AY183143 (canine)

Reverse AGTCACCTCCTTCCAGACAT

MMP-9 Forward CGCTATGGCTACACTCAAGT 217 AB006421 (canine)

Reverse AAGTGATGTCGTTGTGGTGC

MMP-13 Forward CTGAGGAAGACTTCCAGCTT 250 AF201729 (canine)

Reverse TTGGACCACTTGAGAGTTCG

TRAP Forward CAGCTGTCCTGGCTCAA 288 NM001611 (human), NM019144 (murine)

Reverse TAGCCGTTGGGGACCTT

Cathepsin K Forward CAGTGTGGTTCCTGTTGGGCTTT 578 AY738221 (canine)

Reverse CACATCTTGGGGAAGCTGG

Cathepsin S Forward CGTCTCATCTGGGAAAAGAA 482 AY156692 (canine)

Reverse GCTTTGTAGGGATAGGAAGC

GAPDH Forward ACCACAGTCCATGCCATCAC 450 NM002046 (human), NM017008 (murine)

Reverse TCCACCACCCTGTTGCTGTA

MMP, matrix metalloproteinase; TRAP, tartrate-resistant acid phosphatase; GAPDH, glyeraldehyde-3-phosphate dehydrogenase.

484 GENE EXPRESSION IN RUPTURED CANINE CRUCIATE LIGAMENT

normally distributed. Student’s t-test for unpaired data wasused to determine whether there were differences in thegeneration of collagen fragments from the stifle synovialfluid bioassays. Differences were considered significant atPo.05.

RESULTS

Dogs with ruptured CCL were Golden retriever(n¼ 2), Labrador retriever (n¼ 1), Pit Bull Terrier(n¼ 1), Dobermann Pinscher (n¼ 1), and Bulldog(n¼ 1); mean (� SD) weight 36.0� 10.4kg and age,4.5� 2.7 years. Three dogs were ovariohysterectomizedfemales, 2 dogs were castrated males, and 1 dog wasmale. Lameness duration was 16� 9 weeks (range, 4–28weeks). In 1 dog, CCL rupture was associated with me-dial patella luxation. All dogs with CCL rupture hadpalpable instability of the stifle on physical examination.

All large dogs with intact CCL were female Hounds(weight, 23.4� 2.6 kg; age, 3.4� 0.9 years). All smalldogs with intact CCL were female Beagles (weight, 9.3�2.1 kg; age, 0.8 � 0.1 years). Body weight was significant-ly different between all 3 groups (Po.01). Beagles weresignificantly younger than the other 2 groups (Po.05).

Expression of MMPs was variable among groups ofdogs. In the young Beagles with intact CCL, expressionof MMPs was not detected in either CCL tissue or stiflesynovial fluid cells. In contrast, expression of MMP-3 inCCL tissue was significantly increased in large dogs withintact CCL (Po.05), compared with young Beagles withintact CCL; expression of MMP-1 in CCL tissue was alsofound. Expression of MMP-1 and -2 in stifle synovialfluid cells was also significantly increased in large dogswith intact CCL, when compared with small dogs withintact CCL (Po.05). In dogs with ruptured CCL, ex-pression of all MMP genes studied was detected in CCLtissue. In particular, expression of MMPs-2 and -9 wassignificantly increased in CCL tissue, when comparedwith both small and large dogs with intact CCL (Po.05);this change in gene expression was also seen in stiflesynovial fluid cells from dogs with ruptured CCL. Ex-pression of MMP-9 was only found with tissues fromdogs with ruptured CCL. Similarly, expression of MMP-13 was only found in ligament tissue from dogs with CCLrupture (Fig 1).

Similar to MMP-9, expression of TRAP and cathepsinS was only found in CCL tissue and stifle synovial fluidfrom dogs with ruptured CCL; expression of TRAP andcathepsin S was significantly increased in dogs with rup-tured CCL (Po.05). In contrast, expression of cathepsinK in CCL tissue and stifle synovial fluid cells was similarin all groups of dogs (Fig 1).

The generation of fragments from both the triplehelical HEL and telopeptide regions (ICTP, PYD) of the

collagen molecule was increased in ruptured CCLexplants, when compared with explants prepared fromintact CCL (Po.05). Although the concentrations ofHEL, ICTP, and PYD in the supernatants from thestifle synovial fluid bioassay experiment were muchhigher than for the CCL explant experiment, only ICTPconcentrations were increased in the synovial fluidbioassay supernatants from dogs with ruptured CCL,when compared with large dogs with intact CCL (Po.05;Fig 2).

DISCUSSION

Although it has been recognized for some time thatinflammation within the synovium of the stifle is typicallyfound in dogs with CCL rupture, the importance of thispathologic feature in the mechanism that leads to pro-gressive rupture of the CCL and the development of se-vere stifle arthritis remains controversial. Key features ofthe synovial inflammation include the presence of largenumbers of dendritic cells expressing MHC Class II,3 andthe presence of TRAPþ macrophage-like cells that ex-press cathepsin K in both the synovium and the CCLepiligament.1,2,12 In the present study, we detected ca-thepsin K, cathepsin S, and TRAP mRNA within theCCL and associated synovial intima; expression of thesegenes is consistent with an inflammatory arthritis with animmune-mediated component.14–16,21,22

We only found expression of TRAP and cathepsin SmRNA in the stifles of dogs with CCL rupture. In con-trast, cathepsin K mRNA appeared constitutively ex-pressed in stifle tissues from both dogs with ruptured andintact CCL. Detection of cathepsin K in all stifle tissues isnot surprising, as the main biological substrate for ca-thepsin K is triple helical collagen, and cathepsin K isknown to have an important role in normal connectivetissue remodeling,19,26 as well as in pathologic degrada-tion of connective tissue.14,15,20,27

The critical role of cathepsin S in antigen presentationhas only recently been recognized. In activated macroph-ages and dendritic cells, cathepsin S mediates the degra-dation of the MHC class II invariant chain Ii duringantigen presentation.28,29 Therefore, it is not surprisingthat both expression of cathepsin S mRNA, TRAPmRNA,21,22 and MHC class II protein3 is found in stiflesfrom dogs with ruptured CCL. Detection of cathepsin Sexpression in macrophage-like synovial cells suggests thatcathepsin S may have dual functions of antigen presen-tation and matrix degradation in inflamed synovium.15

Detection of cathepsin S expression in stifles of dogs withCCL rupture supports the hypothesis that the synovialinflammation is, at least in part, immune-mediated. Thisis an important finding, as inhibition of cathepsin S

485MUIR ET AL

Fig. 1. Effect of cranial cruciate ligament rupture (CCL) on expression of a panel of collagenolytic genes in CCL tissue and stifle

synovial fluid cells. Gene expression was determined using reverse transcriptase-polymerase chain reaction. Within a tissue type,

columns with differing letters are significantly different; columns without letters are not significantly different. For comparison

of pairs of columns within a tissue type which are marked with an �, P¼ .06.

486 GENE EXPRESSION IN RUPTURED CANINE CRUCIATE LIGAMENT

in vivo can ameliorate immune-mediated inflamma-tion.28,30 The antigens within the stifle joint that maystimulate expression of cathepsin S and contribute to theinitiation and progression of the inflammatory stifle ar-thritis are unknown. This is a key gap in knowledge,given our general working hypothesis that inflammationof the stifle joint precedes and eventually precipitatesrupture of the CCL in many dogs.

Although the role of TRAP in the development ofjoint inflammation is not fully understood, expression ofTRAP is associated with the production of many otherdegradative enzymes in synovial macrophage-like cells.16

Therefore, it is not surprising that we found that expres-sion of TRAP in stifle tissues from dogs with rupturedCCL is also associated with MMP-2 and -9; 2 metallo-proteases that are known to be expressed in joints af-fected with inflammatory arthritis, and in synovialmacrophage-like cells.16,17,31 Although MMP-1 and -3are considered important mediators of joint destructionin rheumatoid arthritis,32 expression of these metallopro-teases was found in both dogs with CCL rupture anddogs with intact CCL. Expression of MMP-13 was onlyfound in ruptured CCL tissue; this MMP has also beenimplicated in joint degradation in rheumatoid arthritis.32

The pattern of metalloprotease expression we found inruptured canine CCL is similar to that found in rupturedhuman anterior cruciate ligament.33 The finding of in-creased MMP expression in the intact CCL of olderhounds, when compared with young Beagles is interest-ing; matrix turnover is known to be increased in intactLabrador Retriever CCL, a breed with increased kneelaxity that is predisposed to CCL rupture, when com-pared with Greyhounds, a breed that is not predis-posed.34 Taken together, these findings suggest thatchanges in the expression of collagenolytic enzymes with-in the CCL influence the development of subtle cranialcaudal laxity over time; this may play an important roleon the development of progressive CCL rupture.34

Although it is likely that upregulation of both theMMP/cathepsin and the cathepsin K/glycosaminoglycancollagenolytic pathways contribute to most of the colla-gen degradation within the CCL in both the intra- andextracellular compartments,19,20 the relative importanceof each of these pathways remains unknown; both ofthese pathways are potential targets for drug therapy.Upregulation of cathepsin S and TRAP may also con-tribute to the milieu of degradative enzymes that frag-ment collagen13,15,18 and contribute to progressivedestruction of the stifle. Although production of colla-gen fragments in the stifle synovial fluid bioassay exper-iment was much greater than in the CCL explant study, itis likely that much of this collagen degradation occurredwithin the stifle joints before the assay was set up, as theconcentration of these collagen fragments was similar to

Fig. 2. Effect of cranial cruciate ligament rupture disease

status (CCL) and collagenolytic activity of the extracellular

component of stifle synovial fluid on production of collagen

fragments. Production of collagen fragments by CCL explants

and a stifle synovial fluid bioassay was determined using

ELISA for epitopes from the triple helical region (/ 1(I) 620–

633a helical peptide [HEL]) and the telopeptide regions (cross-

linked carboxyterminal telopeptide of type I collagen [ICTP],

and the hydroxypyridinium collagen cross-link pyridinoline

[PYD]) of the collagen molecule. Within a tissue type, columns

with differing letters are significantly different; columns with-

out letters are not significantly different. For comparison

of pairs of columns within a tissue type which are marked with

an �, P¼ .06.

487MUIR ET AL

that found in stifle synovial fluid from dogs with bothruptured and intact CCL.35 Differences in production ofcollagen fragments between dogs with ruptured CCL anddogs with intact CCL were more apparent in the CCLexplant experiment, when compared with the stifle syno-vial fluid bioassay experiment. This finding suggests thatcollagenolytic activity is primarily cell- or tissue associ-ated, and indirectly suggests that the presence of inflam-matory cells expressing degradative enzymes within thesynovium2 and CCL epiligament1 may be an importantfactor promoting weakening and rupture of the CCL,10

and that the intra-articular location of the CCL, per se, isless important.

This study has several limitations. We used relativelysimple RT-PCR methods to study gene expression inCCL tissue from a small number of dogs. Use of quan-titative PCR methods in a larger population of dogswould further understanding of the extent to which spe-cific MMP and cathepsin genes are upregulated duringdevelopment of inflammatory arthritis. However, weconsider our methods adequate for the purpose of thepresent study. Quantification of collagen fragments is nota specific assay for different matrix turnover pathways.Variations in collagenolytic activity and collagen cross-linking within the patella tendon substrate may also haveinfluenced release of collagen fragments, although thetreatment of the substrate was the same for each assayperformed. Further study of the relative contribution ofMMPs, cathepsin K, cathepsin S, and TRAP to degra-dation of collagen within the CCL is warranted. All ofthe dogs with inflammatory arthritis we studied hadcomplete rupture of the CCL and palpable instability ofthe stifle. As gene expression of cathepsin S, TRAP, andMMP-9 in stifle synovial fluid cells mirrors expression ofthese genes within the CCL tissue, further studies of stiflesynovial fluid from dogs with mechanically stable stiflesand early arthritis would help to determine whether ex-pression of these genes of interest could be used as aspecific biomarker for the early diagnosis of joint inflam-mation, before progressive degradation of the CCL leadsto the development of stifle instability. However, in futurework, it would also be important to determine whetherexpression of these genes is present in joints affected withless severe inflammatory changes and osteoarthritis.

Identification of a clinically relevant biomarker forinflammatory arthritis of the stifle will facilitate diagnosisof dogs with early disease for anti-inflammatory medicaltherapy, and allow changes in gene expression to bestudied over time. As rupture of the CCL is known tobe predisposed to certain breeds,36,37 identification of abiomarker for stifle joint inflammation would alsohelp understanding whether CCL metabolism and stiflejoint inflammation may be influenced by genotype orphenotype.

Surgical treatment of dogs with CCL rupture is one ofthe most common surgical procedures in canine ortho-pedics. However, despite the use of various surgical pro-cedures, including tibial plateau leveling osteotomy, limbfunction after surgery is relatively poor.4 This is not sur-prising, given the findings in the present study and otherrelated studies.1–3,7,9,11,31,35 The association between ca-thepsin S expression and CCL rupture, in particular,warrants further investigation. Progressive rupture of theCCL should be considered an idiopathic disease at thepresent time, the cause of which is unknown. Rupture ofthe CCL can occur from overt trauma, but this is notcommon.38 Although, the relationship between develop-ment of joint inflammation and development of stifle in-stability and CCL rupture remains controversial, there isnow a growing body of evidence from several differentresearch groups1–3,7,11,12,25,35 which suggests that im-mune-mediated inflammatory changes within the stifleare an important factor that could explain the clinicalfindings of chronic lameness, bilateral disease, and estab-lished osteoarthritis at the time of clinical diagnosis, thatare found in most patients.4–6 Fundamental understand-ing of the mechanism that initiates and maintains in-flammation of the stifle in dogs with CCL rupture iscritical to our understanding of this important caninedisease. Development of improved clinically relevant di-agnostic tests for joint inflammation should help to con-firm which develops first; synovial inflammation, or stifleinstability and CCL rupture.

ACKNOWLEDGMENT

The author’s would like to thank all members of the Uni-

versity of Wisconsin-Madison Veterinary Medical Teach-

ing Hospital who have assisted with collection of tissue

samples from dogs with CCL rupture.

REFERENCES

1. Muir P, Hayashi K, Manley PA, et al: Evaluation of tartrate-

resistant acid phosphatase and cathepsin K in ruptured

canine cranial cruciate ligament in dogs. Am J Vet Res

63:1279–1284, 2002

2. Muir P, Schamberger GM, Manley P, et al: Localization of

cathepsin K and tartrate-resistant acid phosphatase in

synovium and cranial cruciate ligament in dogs with cruci-

ate disease. Vet Surg 34:239–246, 2005

3. Lemburg AK, Meyer-Linenberg A, Hewicker-Trautwein M:

Immunohistochemical characterization of inflammatory

cell populations and adhesion molecule expression in syno-

vial membranes from dogs with spontaneous cranial cruci-

ate ligament rupture. Vet Immunol Immunopathol 97:231–

240, 2004

4. Conzemius MG, Evans EB, Besancon MF, et al: Effect of

surgical technique on limb function after surgery for rup-

488 GENE EXPRESSION IN RUPTURED CANINE CRUCIATE LIGAMENT

ture of the cranial cruciate ligament in dogs. J Am Vet Med

Assoc 226:232–236, 2005

5. Innes JF, Bacon D, Lynch C, et al: Long-term outcome of

surgery for dogs with cranial cruciate ligament deficiency.

Vet Rec 147:325–328, 2000

6. Vasseur PB, Berry CR: Progression of stifle osteoarthrosis

following reconstruction of the cranial cruciate ligament in

21 dogs. J Am Anim Hosp Assoc 28:129–136, 1992

7. Griffin DW, Vasseur PB: Synovial fluid analysis in dogs with

cranial cruciate ligament rupture. J Am Anim Hosp Assoc

28:277–281, 1992

8. Hayashi K, Frank JD, Manley PA, et al: Histologic changes

in ruptured canine cranial cruciate ligament. Vet Surg

32:269–277, 2003

9. Vasseur PB, Pool RR, Arnoczky SP, et al: Correlative

biomechanical and histologic study of the cranial

cruciate ligament in dogs. Am J Vet Res 46:1842–1854,

1985

10. Goldberg VM, Burstein A, Dawson M: The influence of an

experimental immune synovitis on the failure mode and

strength of the rabbit anterior cruciate ligament. J Bone Jt

Surg 64A:900–906, 1982

11. Lawrence D, Bao S, Canfield PJ, et al: Elevation of immuno-

globulin deposition in the synovial membrane of dogs with

cranial cruciate ligament rupture. Vet Immunol Immuno-

pathol 65:89–96, 1998

12. Klocke NW, Snyder PW, Widmer WR, et al: Detection of

synovial macrophages in the joint capsule of dogs with

naturally occurring rupture of the cranial cruciate ligament.

Am J Vet Res 66:493–499, 2005

13. Reddy VY, Zhang Q-Y, Weiss SJ: Pericellular mobiliz-

ation of the tissue-destructive cysteine proteinases,

cathepsins B, L, and S by human monocyte-derived

macrophages. Proc Natl Acad Sci USA 92:3849–3853,

1995

14. Hou W-S, Li Z, Gordon RE, et al: Cathepsin K is a critical

protease in synovial fibroblast-mediated collagen degrada-

tion. Am J Pathol 159:2167–2177, 2001

15. Hou W-S, Li W, Keyszer G, et al: Comparison of

cathepsins K and S expression within the rheumatoid

and osteoarthritic synovium. Arthritis Rheum 46:663–674,

2002

16. Tsuboi H, Matsui Y, Hayashida K, et al: Tartrate-resistant

acid phosphatase (TRAP) positive cells in rheumatoid

synovium may induce the destruction of articular cartilage.

Ann Rheum Dis 62:196–203, 2003

17. Dreier R, Grassel S, Fuchs S, et al: Pro-MMP-9 is a specific

macrophage product and is activated by osteoarthritic

chondrocytes via MMP-3 or a MT1-MMP/MMP-13 cas-

cade. Exp Cell Res 297:303–312, 2004

18. Halleen JM, Raisanen S, Salo JJ, et al: Intracellular frag-

mentation of bone resorption products by reactive

oxygen species generated by osteoclastic tartrate-resis-

tant acid phosphatase. J Biol Chem 274:22907–22910,

1999

19. Li Z, Yasuda Y, Li W, et al: Regulation of collagenase ac-

tivities of human cathepsins by glycosaminoglycans. J Biol

Chem 279:5470–5479, 2004

20. Konttinen YT, Takagi M, Mandelin J, et al: Acid attack and

cathepsin K in bone resorption around total hip replace-

ment prosthesis. J Bone Miner Res 16:1780–1786, 2001

21. Hayman AR, Bune AJ, Bradley JR, et al: Osteoclastic tar-

trate-resistant acid phosphatase (Acp 5): its localization in

dentritic cells and diverse murine tissues. J Histochem

Cytochem 48:219–227, 2000

22. Bune AJ, Hayman AR, Evans MJ, et al: Mice lacking tar-

trate-resistant acid phosphatase (Acp 5) have disordered

macrophage inflammatory responses and reduced clear-

ance of the pathogen Staphylococcus aureus. Immunology

102:103–113, 2001

23. Blom AB, Van Lent PLEM, Holthuysen AEM, et al: Syno-

vial lining macrophages mediate osteophyte formation in

experimental osteoarthritis. Osteoarthritis Cartilage

12:627–635, 2004

24. Steffey MA, Miura N, Todhunter RJ, et al: The potential and

limitations of cartilage-specific (VþC)� fibronectin and

cartilage oligomeric matrix protein as osteoarthritis bio-

markers in canine synovial fluid. Osteoarthritis Cartilage

12:818–825, 2004

25. de Rooster H, Cox E, van Bree H: Prevalence and relevance

of antibodies to type-I and -II collagen in synovial fluid of

dogs with cranial cruciate ligament rupture. Am J Vet Res

61:1456–1461, 2000

26. Everts V, Hou WS, Rialland X, et al: Cathepsin K deficiency

in pycnodysostosis results in accumulation of non-digested

phagocytosed collagen in fibroblasts. Calcif Tissue Int

73:380–386, 2003

27. Konttinen YT, Mandelin J, Li T-F, et al: Acidic cysteine

endoproteinase cathepsin K in the degeneration of the

superficial articular hyaline cartilage in osteoarthritis. Ar-

thritis Rheum 46:953–960, 2002

28. Nakagawa TY, Brissette WH, Lira PD, et al: Impaired in-

variant chain degradation and antigen presentation and

diminished collagen-induced arthritis in cathepsin S null

mice. Immunity 10:207–217, 1999

29. Beers C, Honey K, Fink S, et al: Differential regulation of

cathepsin S and cathepsin L in interferon g-treated ma-

crophages. J Exp Med 197:169–179, 2003

30. Saegusa K, Ishimaru N, Yanagi K, et al: Cathepsin S inhib-

itor prevents autoantigen presentation and autoimmunity.

J Clin Invest 110:361–369, 2002

31. Volk SW, Kapatkin AS, Haskins ME, et al: Gelatinase ac-

tivity in synovial fluid and synovium obtained from healthy

and osteoarthritic joints of dogs. Am J Vet Res 64:1225–

1233, 2003

32. Muller-Ladner U, Gay S: MMPs and rheumatoid synovial

fibroblasts: Siamese twins in joint destruction? Ann Rheum

Dis 61:957–959, 2002

33. Foos MJ, Hickox JR, Mansour PG, et al: Expression of ma-

trix metalloprotease and tissue inhibitor of metalloprotease

genes in human anterior cruciate ligament. J Orthop Res

19:642–649, 2001

34. Comerford EJ, Tarlton JF, Innes JF, et al: Metabolism and

composition of the canine anterior cruciate ligament relate

to differences in knee joint mechanics and predisposition

to ligament rupture. J Orthop Res 23:61–66, 2005

489MUIR ET AL

35. Muir P, Manley PA, Hao Z: Collagen fragmentation in rup-

tured canine cranial cruciate ligament explants. Vet J, 2005,

in press

36. Duval JM, Budsberg SC, Flo GL, et al: Breed, sex, and body

weigh as risk factors for rupture of the cranial cruciate liga-

ment in young dogs. J Am Vet Med Assoc 215:811–814,

1999

37. Whitehair JG, Vasseur PB, Willits NH: Epidemiology of

cranial cruciate ligament rupture in dogs. J Am Vet Med

Assoc 203:1016–1019, 1993

38. Hayashi K, Manley PA, Muir P: Cranial cruciate ligament

pathophysiology in dogs with cruciate disease: a review. J

Am Anim Hosp Assoc 40:385–390, 2004

490 GENE EXPRESSION IN RUPTURED CANINE CRUCIATE LIGAMENT