CLC correlates with lymph node metastasis.pdf

8/10/2019 CLC correlates with lymph node metastasis.pdf

1/8

Annals of Oncology22: 18781885, 2011

doi:10.1093/annonc/mdr130

Published online 27 April 2011original article

The presence of circulating tumor cells (CTCs)

correlates with lymph node metastasis in nonresectable

squamous cell carcinoma of the head and neck region(SCCHN)

T. Hristozova1, R. Konschak1, C. Stromberger1, A. Fusi2, Z. Liu2, W. Weichert3, A. Stenzinger3,

V. Budach1, U. Keilholz2 & I. Tinhofer1*1Translational Radiobiology and Radiooncology Research Laboratory, Department of Radiotherapy, Charite Campus Mitte, Berlin; 2Department of Hematology and

Oncology, Campus Benjamin Franklin, Charite-Universitatsmedizin Berlin, Berlin; 3Institute of Pathology, University Hospital and National Center for Tumor Diseases

(NCT), Heidelberg, Germany

Received 7 October 2010; revised 14 February 2011; accepted 4 March 2011

Background: The mechanisms regulating tumor cell dissemination in locally advanced squamous cell

carcinoma of the head and neck region (SCCHN) are largely unresolved. We assessed the frequency of

circulating tumor cells (CTCs), their association with clinicopathologic parameters and their kinetics during

radiochemotherapy.

Patients and methods: Peripheral blood samples from 42 patients with locally advanced SCCHN were included.

CTCs were detected using flow cytometric analysis of CD452epithelial cell adhesion molecule+cytokeratin+cells and

results were validated by nested RT-PCR analysis of circulating epidermal growth factor receptor transcripts. The

association between the presence of CTCs and T stage, tumor volume, N stage and human papillomavirus status was

evaluated. The influence of radiochemotherapy on CTC numbers was determined.

Results:CTCs were detected in 18 of 42 SCCHN patients (43%), with a mean 6 standard deviation of 1.7 6 0.9

CTCs per 3.75 ml blood. We observed no significant correlation between the presence of CTCs and T stage or tumor

volume. However, a nodal stage of N2b or higher was associated with higher frequency of CTCs. Though concurrent

radiochemotherapy reduced their frequency, CTCs persisted during treatment in 20% of cases.

Conclusions: Detection of CTCs correlates with regional metastasis in inoperable SCCHN. Further follow-up isneeded to evaluate the prognostic significance of CTC detection, in addition to clinical staging of lymph nodes, for

regional or distant recurrence.

Key words: circulating tumor cells, head and neck cancer, prognostic marker, regional metastasis

introduction

A significant improvement in the locoregional control ofsquamous cell carcinoma of the head and neck region(SCCHN) has been achieved over the last decades by theintroduction of new surgical approaches andchemoradiotherapy [13] or bioradiation protocols [4].

Though the improvement in the clinical managementsignificantly increased survival rates, the latter are still offset bya significant number of distant failures [2]. Clinicopathologiccharacteristics such as tumor site, local (T stage) and regional(N stage) extension and histological grade have been shown tosignificantly influence the occurrence of distant metastases in

SCCHN [5, 6]. The molecular mechanisms regulating suchtumor cell dissemination, however, still remain largely elusive.

Presumably, distant metastases are the result ofhematogenous dissemination of tumor cells. Indeed, circulatingepithelial cells in the peripheral blood of patients with solidepithelial tumors including breast [7, 8], colorectal [9, 10] andprostate cancers [11, 12] have been associated with increasedrisk of local or distant metastases. A few studies using eitherRT-PCR-assisted detection of epithelial-cell-specific messengerRNA (mRNA) transcripts [1317] or immunocytochemicaldetection of cells expressing epithelial cell markers [17, 18]revealed the presence of circulating epithelial cells, supposedlyderived from the primary tumor, also in peripheral bloodsamples of SCCHN patients. The study with the largest patientcohort in this series included 36 patients with operable SCCHNand revealed a significant association between positive RT-PCRand distant metastasis-free and overall survival (OS) [17].

article

*Correspondence to: Dr I. Tinhofer, Translational Radiobiology and Radiooncology

Research Laboratory, Department of Radiotherapy, Charite Campus Mitte, Charite-

Universitatsmedizin Berlin, Chariteplatz 1, 10117 Berlin, Germany. Tel: +49-30-450-

527074; Fax: +49-30-450-527974; E-mail: [email protected]

The Author 2011. Published by Oxford University Press on behalf of the European Society for Medical Oncology.

All rights reserved. For permissions, please email: [email protected]


2/8

The previously applied techniques for detection of circulatingtumor cells (CTCs) in SCCHN did not allow their detailedphenotypic characterization, which would help in theidentification of potential molecular targets for the preventionor treatment of distant disease. In the present study, a flowcytometric assay for the detection and phenotypiccharacterization of CTCs was developed and independentlyvalidated using nested RT-PCR analysis of epidermal growth

factor receptor (EGFR) transcripts [19]. Both protocols werethen applied to assess the correlation of CTCs withclinicopathologic parameters and the influence of definitivechemoradiation on their detection rate.

methods and materials

patients and controls

This study was approved by the local ethics committee. After informed

patient consent, 42 consecutive unselected patients with histologically

confirmed locally advanced inoperable SCCHN presenting at our clinical

department for treatment were included in this study. Clinicopathologic

characteristics of these patients are presented in Table 1. Staging was carried

out according to the TNM (tumornodemetastasis) classification system.

At the time point of the first blood sampling, none of the patients had

started definitive chemoradiation.

volumetric measurements

Delineation and volumetric measurements of the primary tumor and the

affected lymph nodes (gross tumor volume) were done on all axial

computed tomography slices, with a slice thickness of 3.75 mm, using the

Eclipse Treatment Planning Software (version 8.6; Varian, Palo Alto, CA)

or the iPlan RT Image 4.1 Software (BrainLAB AG, Feldkirchen, Germany).

detection of CTCs by flow cytometry

After discarding the first 2.5 ml of blood to avoid potential contaminationwith skin epithelial cells, peripheral blood samples (7.5 ml) were collected

into heparinized tubes (BD Biosciences Europe, Heidelberg, Germany).

Samples were stored at room temperature until further processing within 24

h after blood sampling. After lysis of erythrocytes, CTCs were enriched by

depletion of the CD45+leukocyte fraction using a magnetic bead separation

technique (EasySep; Stem Cells Technologies, Inc., Grenoble, France)

according to the manufacturers instructions. The remaining cell

suspension was split into two fractions each then containing a 3.75 ml

aliquot of the peripheral blood sample. These two aliquots were stained

with either a cocktail of specific antibodies to epithelial cell adhesion

molecule (EpCAM) (clone EBA-1, allophycocyanin labeled; BD

Biosciences), pan-cytokeratin (clone C-11, fluorescein isothiocyanate

labeled; Sigma-Aldrich GmbH, Munich, Germany) and CD45 (clone HI30,

phycoerythrin Cy7 labeled; BD Biosciences) or the relevant isotypecontrol antibodies (BD Biosciences). Using flow cytometry (FACSCanto II;

BD Biosciences), CTCs defined as EpCAM+cytokeratin+CD452 were

detected. A blood sample was considered CTC+ when at least one

EpCAM+cytokeratin+CD452 cell was detected. The absolute numbers of

CTCs per 3.75 ml blood were determined by recording all events in the 3.75

ml aliquot.

detection of circulating EGFR transcripts by nested RT-

PCR

As an independent method for detection of CTCs, we used detection of

EGFR transcripts by nested RT-PCR as biomarker for CTCs [19, 20]. For

this analysis, 36 of 42 cases were available. Processing of blood samples for

mRNA analysis was carried out as described previously [21, 22]. Briefly,

a 7.5 ml aliquot of blood was centrifuged and the plasma was removed. The

remaining cell suspension was mixed with 5 ml of 4 M guanidine

isothiocyanate buffer and stored at 280C until RNA extraction. Total

cellular RNA was extracted using a guanidine isothiocyanatephenol

chloroform procedure together with Phase Lock Gel Heavytubes (5

Prime, Hamburg, Germany) and the High-Pure RNA isolation kit (Roche

Diagnostics, Mannheim, Germany). Synthesis of complementary DNA

(cDNA) (was carried out with Omniscript kit (Qiagen GmbH, Hilden,

Germany), according to the supplied protocol, using random hexamers

and oligo dT15 primers (Roche) and 2 lg of total RNA. The quality of RNA

was checked by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) PCR

and only samples positive for GAPDH transcripts were used for

EGFR-nested RT-PCR. In the first-round PCR, we used the forward

primer 1: 5#CTTCTTGCAGCGATACAGCTC3#and the reverse primer

1: 5#ATGCTCCAATAAATTCACTGC3# [20]. These primers amplify

a 440-bp fragment of the EGFR cDNA. The nested PCR was carried out by

using the forward primer 2: 5#CCCCACAGGCGCCTTGACTG3#and the

reverse primer 2: 5#TGCTTTGTGGCGCGACCCTT3#and the PCR

product was 398 bp in length. PCR was carried out in a reaction volume of

25 ll containing 2 ll cDNA, 2.5 ll 10PCR buffer, 2.5 mM MgCl2, 500 nM

of each primer, the four deoxynucleoside triphosphates (200 nM each) and

1 unit of InviTaq DNA polymerase (Invitek GmbH, Berlin, Germany).

PCR cycling was carried out on a Mastercyclerthermal cycler

(Eppendorf, Hamburg, Germany). After initial denaturation at 95C for 5

min, the reaction was carried out at 95C denaturation for 1 min, 60C

Table 1. Clinicopathologic characteristics of SCCHN patients

Parameters No. of patients (%)

Total number of cases 42 (100)

Sex

Male 35 (83)

Female 7 (17)

Age (years)

Median 62

Range 2983

Tumor site

Oropharynx 17 (40)

Oral cavity 9 (21)

Hypopharynx 7 (17)

Larynx 5 (12)

Nasopharynx 2 (5)

Others 2 (5)

T stage

T0 2 (5)

T1T2 6 (14)

T3T4 34 (81)

N stage

N0 12 (29)N1 5 (12)

N2 1 (2)

N2a 1 (2)

N2b 4 (10)

N2c 18 (43)

N3 1 (2)

M stage

M0 42 (100)

M1 0 (0)

SCCHN, squamous cell carcinoma of the head and neck region.

Annals of Oncology original article

Volume 22 | No. 8 |August 2011 doi:10.1093/annonc/mdr130| 1879


3/8

annealing for 30 s, and 72C elongation for 1 min for 30 cycles. The

extension was lengthened to 5 min during the last cycle. First-round PCR

product of 2.5 l l was used for the subsequent nested PCR, which was

carried out using the same cycling conditions but with 35 cycles in total.

Ten microliters of the PCR product was electrophoresed through a 1.5 %

NuSieveagarose gel. The gel was stained with Sybr Green (Sigma,

Lonza, Rockland, ME) for visualization of DNA. Nested RT-PCR was

carried out in triplicates and samples regarded as positive if at least one of

the triplicates was positive.

immunohistochemical analysis of p16INK4A expression

For the evaluation of p16INK4A expression in tumor tissue as surrogate

marker for human papillomavirus (HPV) positivity, tissue microarrays

(TMAs) were generated using a precision instrument (Beecher Instruments,

Silver Spring, MD). From each tissue specimen, hematoxylin- and eosin-

stained sections were generated and tumor areas marked by an experienced

pathologist. Two tissue cylinders of 1 mm diameter were punched from each

tumor-bearing donor block and were transferred to the recipient TMA block.

Immunohistochemistry was carried out on 3-lm formalin-fixed paraffin-

embedded tissue sections of the TMA using a Dako autostainer (Dako,

Copenhagen, Denmark). Antigen retrieval was carried out by boiling slides

in buffer containing 6.5 mM sodium citrate (pH = 6.0) in a sealed pressure

cooker for 10 min. After antigen retrieval, sections were incubated withmouse-anti-p16INK4A antibody (BD Biosciences, clone G175-405, dilution

1 : 50). Detection was carried out using the EnVision+ system HRP anti-

mouse (Dako) with the 3-3#-diaminobenzidine chromogen (Dako). Slides

were counterstained with hematoxylin, dehydrated and mounted. Omission

of the primary antibody was used as a negative control. Tumors were

classified as either p16INK4A positive (defined as strong diffuse nuclear and

cytoplasmic staining in >10% of carcinoma cells [23]) or negative.

statistical analysis

The association of CTC+cases (defined by1 CTCs per 3.75 ml blood or

a specific product in the nested RT-PCR reaction) with clinical parameters

or p16INK4A positivity was assessed using Fishers exact test. This test was

also used to correlate the results from CTC detection by flow cytometry and

RT-PCR. For multivariate analysis with the presence of CTCs as thedependent variable, logistic regression was carried out. The level of

significance was set at P 0.999). Since the T stage notonly reflects tumor size but also its invasiveness intosurrounding tissue, we also determined the total tumor volumeand stratified patients into two cohorts using the median tumorvolume as a cut-off. No significant association between thetumor volume and the absolute numbers of CTCs (P =0.23)nor their frequency (P=0.35) was observed (Figure 3B).

correlation of CTC detection with locoregional

metastasisWe next assessed whether the presence of CTCs was correlatedwith lymph node metastasis. We grouped patients according totheir N stage and compared the frequency of CTC+ cases inthese groups. Although CTC+cases were also observed in theN0/N1 stage patient group, their frequency was significantlyincreased in patients with N stage 2b or higher (Figure 4A).Indeed, 4 CTC+cases of 19 cases (21%) could be observed inthe N0N2a group as compared with 14 CTC+cases of 23 cases(61%) in the N2b+group (P=0.013, Figure 4A). Thissignificant correlation between regional metastasis and presence

original article Annals of Oncology

1880| Hristozova et al. Volume 22 | No. 8 |August 2011


4/8

of CTCs could be also observed when analysis was carried out

by nested RT-PCR (P=

0.017, Figure 4B).We then carried out a logistic regression analysis in which weincluded T stage, N stage and tumor volume. As presented inTable 2, this analysis revealed that the association between thepresence of CTCs, either detected by flow cytometry (Table 2A)or nested RT-PCR (Table 2B) and the N stage remainedsignificant in the multivariate regression model.

interference of tumor localization and HPV status

with CTC detection

We then assessed whether the frequency of CTC detection wasinfluenced by the primary tumor site. As presented in Table 3,we observed the highest incidence of CTC+cases among

patients in whom the tumor was located in the oral cavityfollowed by the patient subgroup with oropharyngeal cancer.Since an increasing prevalence of HPV-associated cases hasrecently been reported mainly for these two sites and sinceHPV-associated SCCHN has to be regarded as a biologicallydistinct entity with significantly improved outcome, wewondered whether the frequency of CTC detection wasdependent on the HPV status. As surrogate marker forHPV, we used immunohistochemical analysis of HPV-associated p16INK4A expression. The overall frequency ofp16INK4A-positive cases in our cohort was 38%, with the

Figure 1. Detection of circulating tumor cells (CTCs) by flow cytometry and nested RT-PCR. (A) After enrichment of CTCs by immunomagnetic depletion

of blood leukocytes, CTCs defined as EpCAM+cytokeratin+CD452 were detected by flow cytometry. Spiking experiments using SW620 cells revealed

a detection limit of 5 EpCAM+cytokeratin+CD452 cells in 5 ml blood and linearity of CTC enumeration between 5 and 500 cells. (B) For an independent

validation of flow cytometry results, a nested RT-PCR protocol for detection of epidermal growth factor receptor (EGFR) transcripts was established. EGFR+

UD-4 cells (020 cells) were spiked into 10 ml blood from a healthy donor. Nested RT-PCR for detection of EGFR transcripts was carried out in triplicates.

From left to right: lane 1, 100-bp size marker; lanes 216, spiked UD-4 cells; lane 17, undiluted UD-4 complementary DNA as positive control; lane 18, aqua

destillata as negative control. (C and D) Detection of CTCs in peripheral blood samples from squamous cell carcinoma of the head and neck region patients

with nonresectable disease. Representative results for CTC+ cases identified by flow cytometry (C) or by nested RT-PCR (D) are presented. APC,

allophycocyanin; FITC, fluorescein isothiocyanate; PE, phycoerythrin; SSC, side scatter.

Figure 2. Frequency of circulating tumor cells (CTCs) in locally

advanced inoperable SCCHN. (A) Detection of CTCs in peripheral

blood samples from 42 squamous cell carcinoma of the head and neck

region patients was carried out by flow cytometry (FC). The frequency

of CTC+cases grouped according to the absolute number of CTCs per

3.75 ml is presented. (B) Analysis of a subgroup of 36 cases by FC and

nested RT-PCR revealed a significant correlation between the two

independent methods. The numbers of negative and positive cases

are presented in a contingency table and the Fishers exact Pvalue is

given.




5/8

frequency of p16INK4A-positive cases being higher in theoropharynx cancer (OPC) compared with the oral cavity cancer(OCC) subgroup (OPC 42% versus OCC 25%). No significantdifference in the frequency of CTC+cases was observed in thep16INK4A-negative compared with the p16INK4A-positivesubgroup (Fishers exact t-test: P=0.68).

influence of chemoradiation on CTC numbers

In order to evaluate whether chemoradiation can target tumorcells with a presumed metastatic potential, the influence of

treatment on the frequency of CTCs was assessed in 23 patients.Sequential samples collected before initiation of treatment andat an early time point (


6/8

The absolute numbers of CTCs per 3.75 ml blood detected inour study were low. This is in line with the very low CTC countsreported for other tumor models such as nonmetastatic breastcancer. Indeed, CTC analysis using the CellSearchsystem ina large cohort of Her2+patients revealed the presence of CTCs in22% of patients with 50% of them showing 1 CTC per 7.5 ml andonly 20% having >5 CTCs per 7.5 ml blood [33].

The size of the CTC pool was not simply a function of tumor

burden with larger tumors seeding more cells into the circulationthan smaller ones. Our results suggest that tumors of CTC+caseshave distinct pathological characteristics endowing them tomigrate from the primary site to regional lymph nodes and likelyto distant organs as well. Future studies will have to addresswhether there a continuum of CTC incidence from N0N1 toN2N3 as well as whether the observed correlation between CTCdetection and tumor localization can be confirmed in largerpatient cohorts. Previous studies support our hypothesis that thepresence of CTCs might predict the development of distantmetastases in SCCHN. Indeed, the N stage that was significantly

Table 2. Logistic regression analysis of clinicopathologic factors and the presence of CTCs in patients presenting with inoperable SCCHN

Clinical factor Univariate analysis P Multivariate analysis PCTC+(N)/total (N) Odds ratio (95% CI)

(A) Detection of CTCs by flow cytometry

T stage 0.93 0.35

T0T3 8/18 1.0

T4 10/24 0.4 (0.12.5)

N stage 0.013 0.014N0N2a 4/18 1.0

N2b+ 14/24 6.1 (1.425.7)

Tumor volume (ccm) 0.21 0.20

50 7/21 1.0

>50 11/21 3.0 (0.615.9)

(B) Detection of CTCs by nested RT-PCR

T stage >0.999 0.20

T0T3 4/16 1.0

T4 5/20 0.13 (0.012.9)

N stage 0.021 0.024

N0N2a 1/18 1.0

N2b+ 8/18 16.3 (1.4185.5)

Tumor volume (ccm) 0.18 0.13

50 3/19 1.0>50 6/17 10.4 (0.5224.6)

CTC, circulating tumor cell; SCCHN, squamous cell carcinoma of the head and neck region; CI, confidence interval.

Table 3. CTC frequency and primary tumor site

Tumor localization N CTC+ (N) CTC+(%)

Oropharynx 17 8 47

Oral cavity 9 6 67

Hypopharynx 7 2 28

Larynx 5 1 20

Nasopharynx 2 0 0

CTC, circulating tumor cell.

Figure 5. Influence of chemoradiation on circulating tumor cell (CTC)

frequency. Blood samples were collected before the initiation of definitive

chemoradiation (prior therapy, n =23), at a time point


7/8

correlated with the detection of CTCs in our study and by trendin the previous study of Partridge et al. [17] was one of thestrongest prognosticators of distant metastasis-free survival [25,26, 29, 34, 35]. These data suggest that detection of CTCs mightrepresent a novel noninvasive diagnostic tool for predicting theoccurrence of metastatic disease in SCCHN. Though CTC couldbe detected more frequently in patients with N2b or higher, therewere also CTC+ cases without clinically detectable lymph node

metastasis. Therefore, the presence of CTCs may provideprognostic information in addition to the clinical N stage,a question to be addressed with longer follow-up of our patientcohort and within the framework of prospective clinical trials.

Besides prognostic information of baseline CTC numbers,the analysis of their kinetics over time might provide additionalrelevant information since persistence of CTCs under treatmentcould allow the early identification of nonadequate treatmentmodalities and nonresponding tumors. Indeed, a significantcorrelation between treatment-related changes in CTC numbersor their persistence after treatment with progression-freesurvival and OS in metastatic colorectal [9] and prostate cancer[36] and with relapse-free survival in nonmetastatic breast

cancer [37] has been demonstrated. Of note, therapy-relatedchanges in CTC numbers provided additional prognosticinformation when combined with radiographic imaging incolorectal cancer [9] and had higher prognostic power thanassessment of changes in prostate-specific antigen titers inprostate cancer [36].

In our study of nonresectable SCCHN, we observeda reduction in the frequency of CTC+cases during the courseof chemoradiation already at an early time point at whichchemotherapy had not yet started. This implies a directinhibitory effect of radiotherapy alone on the migration oftumor cells to the peripheral blood. No further reduction inCTCs was apparent at later time points when three cycles ofchemotherapy on average have been given. This result was not

unexpected since addition of concomitant chemotherapy toradiotherapy though reducing the risk of locoregionalrecurrence only slightly reduced the risk of distant failure [38].However, patient numbers were limited and treatmentconditions slightly different in our study, which leaves theprognostic potential of CTCs persisting chemoradiation to beresolved by future therapy trials including larger cohorts ofpatients. The analysis of CTCs using the flow cytometricapproach established here seems feasible within the setting ofmulticenter trials since blood samples can processed afterstorage for up to 48 h without significant loss of sensitivity andspecificity. Indeed, using the single-cell based CellSearchsystem, the successful integration of CTC enumeration in

prospective multicenter clinical trials of breast cancer hasalready been demonstrated [33, 39]. We have thereforeintegrated the analysis of CTCs before and after treatment in anongoing multicenter randomized phase II clinical trial ofinoperable SCCHN in which the efficacy of docetaxel, cisplatin,5-fluorouracil induction chemotherapy followed bybioradiation will be compared with standard chemoradiation.

In conclusion, we identified the detection of CTCs by flowcytometry or nested RT-PCR as potential prognostic tools ininoperable SCCHN. Detailed phenotyping of CTCs that can bedone with the established flow cytometry method as opposed to

the PCR-based techniques previously applied for CTC analysisin SCCHN might help in identifying novel therapeutic targetsand increase our understanding of the molecular mechanismsresponsible for treatment resistance in nonresectable SCCHN.

acknowledgements

We are grateful to the patients for their participation in this

study and to the clinical team of our Radiotherapy departmentfor their continuous support in the collection of blood samples.

funding

Merck Pharma GmbH, Germany (to IT and UK) BerlinerKrebsgesellschaft, Germany (to IT).

disclosure

The authors declare no conflict of interest.

references

1. Harari PM. Promising new advances in head and neck radiotherapy. Ann Oncol2005; 16 (Suppl 6): vi13vi19.

2. Budach V, Stuschke M, Budach W et al. Hyperfractionated accelerated

chemoradiation with concurrent fluorouracil-mitomycin is more effective than

dose-escalated hyperfractionated accelerated radiation therapy alone in locally

advanced head and neck cancer: final results of the radiotherapy cooperative

clinical trials group of the German Cancer Society 95-06 Prospective

Randomized Trial. J Clin Oncol 2005; 23: 11251135.

3. Ang KK. Multidisciplinary management of locally advanced SCCHN: optimizing

treatment outcomes. Oncologist 2008; 13: 899910.

4. Bonner JA, Harari PM, Giralt J et al. Radiotherapy plus cetuximab for

locoregionally advanced head and neck cancer: 5-year survival data from

a phase 3 randomised trial, and relation between cetuximab-induced rash and

survival. Lancet Oncol 2010; 11: 2128.

5. Spector GJ. Distant metastases from laryngeal and hypopharyngeal cancer. ORL

J Otorhinolaryngol Relat Spec 2001; 63: 224228.6. Garavello W, Ciardo A, Spreafico R, Gaini RM. Risk factors for distant metastases

in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg

2006; 132: 762766.

7. Bidard FC, Vincent-Salomon A, Gomme S et al. Disseminated tumor cells of

breast cancer patients: a strong prognostic factor for distant and local relapse.

Clin Cancer Res 2008; 14: 33063311.

8. Bidard FC, Mathiot C, Delaloge S et al. Single circulating tumor cell detection and

overall survival in nonmetastatic breast cancer. Ann Oncol 2010; 21: 729733.

9. Cohen SJ, Punt CJ, Iannotti N et al. Relationship of circulating tumor cells to

tumor response, progression-free survival, and overall survival in patients with

metastatic colorectal cancer. J Clin Oncol 2008; 26: 32133221.

10. Miller MC, Doyle GV, Terstappen LW. Significance of circulating tumor cells

detected by the CellSearch system in patients with metastatic breast colorectal

and prostate cancer. J Oncol 2010; 2010: 617421.

11. Ghossein RA, Scher HI, Gerald WL et al. Detection of circulating tumor cells inpatients with localized and metastatic prostatic carcinoma: clinical implications. J

Clin Oncol 1995; 13: 11951200.

12. Danila DC, Heller G, Gignac GA et al. Circulating tumor cell number and

prognosis in progressive castration-resistant prostate cancer. Clin Cancer Res

2007; 13: 70537058.

13. Brakenhoff RH, Stroomer JG, ten Brink C et al. Sensitive detection of squamous

cells in bone marrow and blood of head and neck cancer patients by E48 reverse

transcriptase-polymerase chain reaction. Clin Cancer Res 1999; 5: 725732.

14. Chaubal S, Wollenberg B, Kastenbauer E, Zeidler R. Ep-CAMa marker for the

detection of disseminated tumor cells in patients suffering from SCCHN.

Anticancer Res 1999; 19: 22372242.

original article Annals of Oncology

1884| Hristozova et al. Volume 22 | No. 8 |August 2011


8/8

15. Lin JC, Chen KY, Wang WY et al. PCR detection of circulating tumor cells in

nasopharyngeal carcinoma patients with distant metastasis: effect of enzyme

and sampling. Head Neck 2002; 24: 591596.

16. Gradilone A, Gazzaniga P, Silvestri I et al. Detection of CK19, CK20 and EGFR

mRNAs in peripheral blood of carcinoma patients: correlation with clinical stage

of disease. Oncol Rep 2003; 10: 217222.

17. Partridge M, Brakenhoff R, Phillips E et al. Detection of rare disseminated tumor

cells identifies head and neck cancer patients at risk of treatment failure. Clin

Cancer Res 2003; 9: 52875294.

18. Wirtschafter A, Benninger MS, Moss TJ et al. Micrometastatic tumor detection inpatients with head and neck cancer: a preliminary report. Arch Otolaryngol Head

Neck Surg 2002; 128: 4043.

19. De Luca A, Pignata S, Casamassimi A et al. Detection of circulating tumor cells

in carcinoma patients by a novel epidermal growth factor receptor reverse

transcription-PCR assay. Clin Cancer Res 2000; 6: 14391444.

20. Mitsuhashi A, Tanaka N, Suzuka K et al. Detection of epidermal growth factor

receptor mRNA in peripheral blood of cervical cancer patients. Gynecol Oncol 2003;

89: 480485.

21. Keilholz U, Willhauck M, Rimoldi D et al. Reliability of reverse transcription-

polymerase chain reaction (RT-PCR)-based assays for the detection of circulating

tumour cells: a quality-assurance initiative of the EORTC Melanoma Cooperative

Group. Eur J Cancer 1998; 34: 750753.

22. Schuster R, Max N, Mann B et al. Quantitative real-time RT-PCR for detection of

disseminated tumor cells in peripheral blood of patients with colorectal cancerusing different mRNA markers. Int J Cancer 2004; 108: 219227.

23. Lassen P, Eriksen JG, Hamilton-Dutoit S et al. Effect of HPV-associated

p16INK4A expression on response to radiotherapy and survival in squamous cell

carcinoma of the head and neck. J Clin Oncol 2009; 27: 19921998.

24. Balm AJ, Hageman PC, van Doornewaard MH et al. Cytokeratin 18 expression in

squamous cell carcinoma of the head and neck. Eur Arch Otorhinolaryngol 1996;

253: 227233.

25. Merino OR, Lindberg RD, Fletcher GH. An analysis of distant metastases from

squamous cell carcinoma of the upper respiratory and digestive tracts. Cancer

1977; 40: 145151.

26. Leemans CR, Tiwari R, Nauta JJ et al. Regional lymph node involvement and its

significance in the development of distant metastases in head and neck

carcinoma. Cancer 1993; 71: 452456.

27. Kotwall C, Sako K, Razack MS et al. Metastatic patterns in squamous cell cancer

of the head and neck. Am J Surg 1987; 154: 439442.

28. Senft A, de Bree R, Hoekstra OS et al. Screening for distant metastases in head

and neck cancer patients by chest CT or whole body FDG-PET: a prospective

multicenter trial. Radiother Oncol 2008; 87: 221229.

29. Alvi A, Johnson JT. Development of distant metastasis after treatment of

advanced-stage head and neck cancer. Head Neck 1997; 19: 500505.

30. de Bree R, Deurloo EE, Snow GB, Leemans CR. Screening for distant metastases

in patients with head and neck cancer. Laryngoscope 2000; 110: 397401.

31. Kim MY, Oskarsson T, Acharyya S et al. Tumor self-seeding by circulating cancercells. Cell 2009; 139: 13151326.

32. Gath HJ, Heissler E, Hell B et al. Immunocytologic detection of isolated tumor

cells in bone marrow of patients with squamous cell carcinomas of the head and

neck region. Int J Oral Maxillofac Surg 1995; 24: 351355.

33. Riethdorf S, Muller V, Zhang L et al. Detection and HER2 expression of

circulating tumor cells: prospective monitoring in breast cancer patients

treated in the neoadjuvant GeparQuattro trial. Clin Cancer Res 2010; 16:

26342645.

34. Cerezo L, Millan I, Torre A et al. Prognostic factors for survival and tumor control

in cervical lymph node metastases from head and neck cancer. A multivariate

study of 492 cases. Cancer 1992; 69: 12241234.

35. Jeremic B, Milicic B. Pretreatment prognostic factors influencing distant

metastasis-free survival in locally advanced squamous cell carcinoma of the

head and neck treated with radiation therapy with or without concurrentchemotherapy. Am J Clin Oncol 2009; 32: 483487.

36. Scher HI, Jia X, de Bono JS et al. Circulating tumour cells as prognostic markers

in progressive, castration-resistant prostate cancer: a reanalysis of IMMC38 trial

data. Lancet Oncol 2009; 10: 233239.

37. Pachmann K, Camara O, Kavallaris A et al. Monitoring the response of circulating

epithelial tumor cells to adjuvant chemotherapy in breast cancer allows detection

of patients at risk of early relapse. J Clin Oncol 2008; 26: 12081215.

38. Pignon JP, le Maitre A, Maillard E, Bourhis J. Meta-analysis of chemotherapy in

head and neck cancer (MACH-NC): an update on 93 randomised trials and

17,346 patients. Radiother Oncol 2009; 92: 414.

39. Fehm T, Muller V, Aktas B et al. HER2 status of circulating tumor cells in patients

with metastatic breast cancer: a prospective, multicenter trial. Breast Cancer Res

Treat 2010; 124: 403412.



Documents

CLC correlates with lymph node metastasis.pdf