CHARACTERIZING THE RETROVIRAL ENVELOPE GLYCOPROTEIN

CHARACTERIZING THE RETROVIRAL ENVELOPE

GLYCOPROTEIN MEMBRANE PROXIMAL EXTERNAL REGION

AND MEMBRANE-SPANNING DOMAINS FOR THEIR ROLES IN

HELICAL ALIGNMENT, FUSOGENICITY, AND

INCORPORATION INTO VIRAL PARTICLES

A dissertation presented to

the Faculty of the Graduate School

at the University of Missouri-Columbia

________________________________________________________________________

In Partial Fulfillment

Of the Requirements for the Degree

Doctor of Philosophy

________________________________________________________________________

By

DANIEL SALAMANGO

Dr. Marc C. Johnson, Dissertation Supervisor

DECEMBER 2015

The undersigned, appointed by the Dean of the Graduate School, have

examined the dissertation entitled

CHARACTERIZING THE RETROVIRAL ENVELOPE GLYCOPROTEIN

MEMBRANE PROXIMAL EXTERNAL REGION AND MEMBRANE-SPANNING

DOMAINS FOR THEIR ROLES IN HELICAL ALIGNMENT, FUSOGENICITY, AND

INCORPORATION INTO VIRAL PARTICLES

Presented by Daniel Salamango,

a candidate for the degree of Doctor of Philosophy,

and thereby certify that, in their opinion, it is worthy of acceptance

____________________________________________

Dr. Marc C. Johnson

____________________________________________

Dr. Donald H. Burke

____________________________________________

Dr. Bruce A. McClure

_____________________________________________

Dr. Michael J. Petris

ii

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my mentor Dr. Marc Johnson for all of the time

and effort he has put into my scientific development. I cannot thank him enough for giving

me the opportunity to join his lab after leaving another during the middle of my thesis. His

knowledgebase and problem solving abilities have helped me immensely to learn the craft

that we as graduate students attempt to master. I also need to thank him for his behind-the-

scenes effort in helping me find a fantastic postdoctoral research laboratory. I am truly in

debt to Marc for everything he has done for me, and for that I say thank you.

I would like to thank previous lab members Sanath Janaka and Devon Gregory. Their

feedback on my research has been phenomenal and I cannot thank them enough for their

time and effort.

I have to give a shout out to Terri Lyddon. Terri has been a great friend and resource in the

lab and I will miss our bantering conversations about topics on which we share the same

viewpoints (she knows what I mean).

I need to thank my boy Erik Ladomersky for unwavering support in the best of times and

the worst of times during our tenure together at Mizzou. We made a lot of great memories

and things would have been unbearable without him. I would like to thank my parents who

provided an immense amount of emotional support during the times when I struggled in

both science and in life. Last but nowhere near least I need to thank my beautiful,

intelligent, and compassionate girlfriend Mackenzie. I look forward to a fantastic future at

the University of Minnesota with her.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ............................................................................................. ii

LIST OF IMPORTANT ABBREVIATIONS ................................................................ v

LIST OF FIGURES AND TABLES ............................................................................... vi

1. INTRODUCTION......................................................................................................... 1

1.1 Retroviruses .......................................................................................................... 2

1.1.1 Retroviral Proteins and Genome ................................................................... 9

1.2 Retroviral Life Cycle .......................................................................................... 23

1.3 Retroviral Assembly ........................................................................................... 29

1.4 Recruitment of Env to viral particles ................................................................. 36

2. CHARACTERIZING THE MURINE LEUKEMIA VIRUS ENVELOPE

GLYCOPROTEIN MEMBRANE-SPANNING DOMAIN FOR ITS ROLES IN

INTERFACE ALIGNMENT AND FUSOGENICITY ............................................... 41

2.1 Summary ............................................................................................................ 42

2.2 Introduction ........................................................................................................ 43

2.3 Experimental Procedures.................................................................................... 45

2.4 Results ................................................................................................................ 48

2.5 Conclusions ........................................................................................................ 53

3. IN VIVO SELECTIONS REVEAL NOVEL PROTEIN DETERMINANTS FOR

MURINE LEUKEMIA VIRUS (MLV) ENVELOPE GLYCOPROTEIN

PSEUDOTPYING INTO HIV-1 PARTICLES ............................................................ 69

3.1 Summary ............................................................................................................ 70

3.2 Introduction ........................................................................................................ 71

3.3 Experimental Procedures.................................................................................... 74

3.4 Results ................................................................................................................ 79

3.5 Conclusions ........................................................................................................ 88

4. PROBING THE MEMBRANE PROXIMAL EXTERNAL REGION AND

MEMBRANE-SPANNING DOMAINS OF HIV-1 ENVELOPE FOR A ROLE IN

GLYCOPROTEIN INCORPORATION AND FUNCTION .................................... 105

4.1 Summary .......................................................................................................... 106

4.2 Body ................................................................................................................. 107

4.3 Future Directions .............................................................................................. 110

5. SUMMARY AND DISCUSSION ............................................................................ 116

iv

6. FUTURE DIRECTIONS .......................................................................................... 119

APPENDIX .................................................................................................................... 122

I. RECOMBINATION CAN LEAD TO SPURIOUS RESULTS IN RETROVIRAL

TRANSDUCTION WITH DUAL FLUORESCENT REPORTER GENES ........... 123

I.I Summary .......................................................................................................... 123

I.II Body ................................................................................................................. 123

II. IMMUNE SIGNALING COMPETENCY IS REGULATED BY LIGAND-

INDUCED ENDOCYTOSIS AND SUBSEQUENT DE NOVO SYNTHESIS OF

THE FLAGELLIN-RECEPTOR FLS2 ...................................................................... 136

II.I Summary .......................................................................................................... 136

II.II Introduction ...................................................................................................... 137

II.III Experimental Procedures .............................................................................. 139

II.IV Results .......................................................................................................... 141

II.V Conclusions ...................................................................................................... 148

III. CONTINUOUS FLG22 TREATMENT LEADS TO LIGAND-

DESENSITIZATION AND LOSS OF FLS2 PROTEIN ACCUMULATION ....... 167

III.I Summary .......................................................................................................... 167

III.II Introduction .................................................................................................. 167

III.III Experimental Procedures .............................................................................. 169

III.IV Results .......................................................................................................... 171

III.V Conclusions .................................................................................................. 178

III.VI FUTURE DIRECTIONS .............................................................................. 179

IV. IDENTIFYING ARABIDOPSIS EPSINR1 AS A REGULATOR OF FLG22-

INDUCED SIGNALING RESPONSES ...................................................................... 193

IV.I Summary .......................................................................................................... 193

IV.II Introduction .................................................................................................. 194

IV.III Experimental Procedures .............................................................................. 196

IV.IV Results .......................................................................................................... 199

IV.V Conclusions .................................................................................................. 208

IV.VI Future Directions .......................................................................................... 211

REFERENCES .............................................................................................................. 237

VITA............................................................................................................................... 274

v

LIST OF IMPORTANT ABBREVIATIONS

MLV: Murine Leukemia Virus

HIV: Human Immunodeficiency Virus

Env: Envelope

ER: Endoplasmic Reticulum

MSD: Membrane-spanning domain

MPER: Membrane proximal external region

SU: Receptor binding domain of Env

TM: Transmembrane domain of Env that has fusogenic activity

R-peptide: Regulatory peptide at the end of the cytoplasmic tail of Env

CTD: Cytoplasmic tail domain

RT: Reverse transcriptase

CA: Capsid

MA: Matrix

IN: Integrase

PR: Protease

Pseudotype: Recruitment of a glycoprotein to a non-native virus

vi

LIST OF FIGURES AND TABLES

Figure 1.1: Phylogeny of Retroviruses ............................................................................ 3

Figure 1.2: Genomic organization of retroviruses ......................................................... 5

Figure 1.3: Diagram of a retroviral particle. .................................................................. 7

Figure 1.4: Polyprotein Translational Mechanisms .................................................... 13

Figure 1.5: Illustration of an Env Trimer ..................................................................... 14

Figure 1.6: Biosynthesis and trafficking of Env ........................................................... 17

Figure 1.7: Cytoplasmic tail length of retroviral glycoproteins ................................. 19

Figure 1.8: Integrated HIV-1 proviral DNA genome .................................................. 21

Figure 1.9: Depiction of the HIV-1 life cycle ................................................................ 25

Figure 1.10: Reverse transcription mechanism............................................................ 27

Figure 1.11: Depiction of various retroviral assembly sites ........................................ 32

Figure 1.12: ESCRT involvement in HIV-1 and MLV virion budding ..................... 34

Figure 1.13: MLV Env active recruitment to foreign viral assembly sites ................ 39

Figure 2.1: Diagram of predicted trimer interfaces. ................................................... 57

Figure 2.2: Infectivity of full-length deletion glycoproteins in the +1L insertion

background. ..................................................................................................................... 59

Figure 2.3: Leucine insertions upstream and downstream of the respective glycine-

proline pairs do not display a phasing effect. ............................................................... 61

Figure 2.4: Truncation of the cytoplasmic tail restores abrogated infectivity of

certain deletion mutants. ................................................................................................ 63

Figure 2.5: The hydroxyl-containing amino acids in the MSD are crucial for

promoting cell-to-cell fusion........................................................................................... 65

Figure 2.6: Amino acid substitutions in the critical hydroxyl positions display

defective functionality. .................................................................................................... 67

Figure 3.1: Target region of mutagenesis and selection strategy. .............................. 91

Figure 3.2: NGS selection analysis. ............................................................................... 93

Figure 3.3: Two regions in the MPER and MSD are predicted to be important for

Env incorporation. .......................................................................................................... 95

Figure 3.4: Addition of the full-length cytoplasmic tail has a minimal effect on

mutant env functionality. ............................................................................................... 97

Figure 3.5: Several candidate mutants identified in the selection screen display

abrogated infectivity but not fusogenicity or cell surface expression. ....................... 99

vii

Figure 3.6: Specific point mutations in, or near, the membrane-proximal domain

display severely abrogated incorporation into HIV particles. .................................. 101

Figure 3.S1: Mutant Env infectivity is similar between MLV and HIV cores. ....... 103

Figure 4.1: Target region of mutagenesis and selection strategy. ............................ 112

Figure 4.2: Mutational landscape of the doped HIV-1 Env plasmid library .......... 114

Figure I.I: Transduction using retroviral vectors carrying a TdTomato reporter

resulted in two cellular populations with distinct fluorescent intensities. ............... 128

Figure I.II: Retroviral recombination occurs between distinct fluorescent proteins.

......................................................................................................................................... 130

Figure I.III: Fluorescence intensity is independent of TdTom genomic integration

sites. ................................................................................................................................ 132

Figure I.IV: Bimodal fluorescence intensity of the TdTom reporter occurs as a

result of a single nucleotide polymorphism between the TdTom genes. .................. 134

Figure II.I: PF22-induced degradation of endogenous FLS2 is ligand-, dose- and

time-dependent and is inhibited by cycloheximide. ................................................... 150

Figure II.II: Ligand-induced degradation of FLS2 is a means to desensitize cells to

stimuli. ............................................................................................................................ 152

Figure II.III: Ligand-induced de novo synthesis of FLS2 prepared cells for a new

round of PF22-perception. ........................................................................................... 154

Figure II.IV: Regulation of ligand-induced signaling competency of EFR is

regulated similar to PF22-FLS2. ................................................................................. 156

Figure II.S1: Prolonged activation of PF22-signaling in the presence of CHX is

RBOHD-dependent. ...................................................................................................... 158

Figure II.S2: PF22-signaling incompetency is PAMP-, time- and dose-dependent. 160

Figure II.S3: Recovery of signaling competency was due to PF22-induced de novo

synthesis of FLS2........................................................................................................... 162

Figure II.S4: Recovery of elf26-signaling competency using ROS production. ...... 165

Figure III.I: Continuous PAMP Treatment Desensitizes Cells to the Different

PAMPs. .......................................................................................................................... 182

Figure III.II: PAMP-Induced ROS Desensitization Occurs After Six Hours

Following Initial PAMP Treatment in Continuously Elicited Tissue. ..................... 185

Figure III.III: Elicitation using the avirulent bacterial strain Pseudomonas syringae

DC3000 hrcC- Results in a Similar Desensitization Pattern as Shown for PAMP-

peptides. ......................................................................................................................... 187

Figure III.IV: Syringe Infiltration Does Not Simulate Exogenous Continuous

Elicitation. ...................................................................................................................... 189

viii

Figure III.S1: Confirmation Syringe Infiltration of flg22 Elicited an Immune

Response......................................................................................................................... 191

Figure IV.I: EpsinR1 Functions as a Positive Regulator of Early-Induced flg22-

Signaling Responses. ..................................................................................................... 217

Figure IV.II: Role for EpsinR1 in Intermediate and Late-Induced flg22-Signaling

Responses. ...................................................................................................................... 219

Figure IV.III: BAK1-Dependent Signaling Mechanisms May be Disrupted in epsR1.

......................................................................................................................................... 221

Figure IV.IV: Morphological comparison of epsinR1 alleles at 8-days Post-

Germination................................................................................................................... 223

Figure IV.V: The epsR1 Alleles Display Defective Primary Root Cell Elongation and

Pavement Cell Expansion. ............................................................................................ 225

Figure IV.VI: Increased Stomatal Number and Clustering in epsR1 Alleles. ......... 227

Figure IV.S1: Leaf Tissue Display Decreased ROS Production and PAMPs Dose

Dependency. ................................................................................................................... 229

Figure IV.S2: EpsinR1 Functions as a Positive Regulator of Early-Induced flg22-

Dependent MAPK Activation. ..................................................................................... 231

Figure IV.S3: Increase in Stomata Number and Clustering is Independent of

Cellular Expansion........................................................................................................ 233

Table S1: Statistical Analysis of Cellular Pools from Abaxial Cotyledons. ............ 235

1

1. INTRODUCTION

2

1.1 Retroviruses

A retrovirus is an enveloped RNA virus that utilizes a process termed reverse

transcription and integrates a double-stranded DNA copy of its RNA genome into the host

cell chromosome. Reverse transcription is carried out by the viral enzyme reverse

transcriptase (RT) and is the characteristic by which retroviruses are defined. The retroviral

family is comprised of seven members subdivided into two categories (Figure 1.1). Alpha-

, Beta-, Gamma-, and Epsilon- retroviruses are classified as simple, whereas Delta-, Lenti-

, and Spuma- retroviruses are classified as complex. The distinction between simple and

complex retroviruses arises from the repertoire of genes encoded by the viral genome. Both

simple and complex retroviruses maintain three core genes: Gag, Pol, and Envelope (Env).

However, complex retroviruses encode additional accessory proteins that aid in viral

pathogenesis (Figure 1.2). Gag acts as the viral structural protein, Pol encodes genes with

enzymatic function, and Env produces the viral surface glycoproteins necessary for

initiating viral entry and targeting specific cell types (Figure 1.3). The viral accessory

proteins provide vital functions that support viral replication and/or pathogenesis. While

not all accessory genes are necessarily required for replication of the respective virus, some

are instrumental in the virus’ ability to overcome host cell restriction factors.

3

Figure 1.1: Phylogeny of Retroviruses

Depicted is an unrooted phylogenetic tree of the retroviral subfamilies. Simple and

complex classifications are designated based on the presence or absence of accessory genes

encoded from the viral genome. The full names of the abbreviated viruses are listed at left

and the complex or simple designation is listed next to the appropriate family.

4

Figure 1.1: Phylogeny of Retroviruses

5

Figure 1.2: Genomic organization of retroviruses

Figure 1.2 displays the genomic organization of the indicated viruses. Simple

retroviruses encode the three core viral genes of Gag, Pol, and Env, whereas complex

retroviruses encode multiple accessory proteins. Some accessory genes aide in viral

replication through facilitation of viral genome import and export to and from the nucleus

(ex. HIV tat and rev). Others aide in viral replication through suppression of host-cell

restriction factors (ex. HIV vif, vpr, vpu, and nef).

6

Figure 1.2: Genomic organization of retroviruses

7

Figure 1.3: Diagram of a retroviral particle.

All retroviral genomes encode at least three genes: gag, pol, and Env. The cleavage

products of gag, which are matrix (MA), capsid (CA), and Nucleocapsid (NC), are

primarily structural components of the viral particle and responsible for binding to the viral

genome. Pol encodes integrase (IN), protease (PR), and reverse transcriptase (RT). Env is

comprised of a receptor binding domain (SU) and a transmembrane domain (TM).

8

Figure 1.3: Diagram of a retroviral particle.

9

1.1.1 Retroviral Proteins and Genome

Human immunodeficiency virus (HIV) is the most well-studied, and well-

publicized, retrovirus since its discovery in 1983. Rightfully so, seeing as it has been linked

to over 30 million deaths in the past 30 years, with over 35 million people currently living

with the virus (W.H.O., 2013) . HIV, along with all other members of the retroviral family,

encodes three core genes in its viral genome: Gag, Pol, and Env.

HIV-1 Gag, which is the main structural component of the virus, is produced as a

single 55 kDa polyprotein that includes the N-terminal Matrix (MA), Capsid (CA), and

Nucleocapsid (NC) domains. MA targets the viral Gag polyprotein to the inner leaflet of

the plasma membrane during assembly and has been shown to utilize several mechanisms

to facilitate binding to lipids. For all retroviruses, the MA domain is post-translationally

modified by the addition of a myristoyl group at the second residue (glycine), which has

been shown to be critical for protein binding to membranes (1). MA also contains a PIP2

(Phosphatidylinositol 4,5-bisphosphate) binding motif that mediates membrane binding

through interaction with PIP2 lipid head groups. Additionally, a highly basic region (HBR),

consisting of multiple lysine residues, aides in binding MA to the negatively charged

phospholipid head groups of the membrane (2, 3). The viral CA protein forms the

protective cage-like structure surrounding the viral genome (4, 5). CA has an N-terminal

domain that is responsible for forming hexameric and pentameric rings and a C-terminal

domain that forms homodimers allowing for the formation of the core structure (6). The

final domain, NC, recognizes the genomic viral RNA and forms crucial interactions

between Gag molecules when forming the immature particle. Gag expression alone is

sufficient to promote formation of virus like particles (VLPs) that are released from cells.

10

In general, the Gag ORF is transcribed and translated as the Gag protein only,

however; occasionally, a ribosomal frameshift results in the translation of Gag-Pol (7). For

Murine Leukemia Virus (MLV), Gag-Pol production is achieved by stop codon

suppression or read-through (Figure 1.4). In the case of Beta- and Delta-retroviruses,

protease is encoded by a Gag and Pol independent ORF. In this case, two different

frameshifting events are required for production of protease. In rare instances, a non-AUG

initiation codon (CUG) can also be used to initiate translation upstream of Gag (8). In

MLV, this leads to a N-terminal extension of Gag that acts as a modified hydrophobic

signal-peptide that targets Gag to the endoplasmic reticulum (ER), where it is translocated

across the membrane and undergoes glycosylation. However, instead of being cleaved, the

N-terminal extension serves as a membrane anchor, with a majority of the protein

extending into the Lumen of the ER where it is glycosylated (9). Thus, these molecules are

referred to as glyco-Gag proteins.

Pol encodes the enzymatic protease (PR), reverse transcriptase (RT), and integrase

(IN) proteins. PR proteolytically cleaves the individual structural and functional domains

from Gag and Pol after undergoing a self-cleavage event that subsequently releases it from

the rest of the Pol protein. PR activation occurs during a process termed viral maturation,

which happens at, or immediately after, viral release from the host cell. RT is the enzyme

responsible for converting the viral RNA genome to cDNA, while IN is a crucial part of

the complex necessary for integrating a copy of the viral dsDNA genome into the host cell

chromosome (10).

The final core gene, Env, is responsible for producing the viral glycoprotein that

facilitates viral entry through recognition of a cell surface protein. Env is produced from

11

an independent spliced transcript as a polyprotein that is processed into a hetero-trimeric

transmembrane surface protein. Env is synthesized in the endoplasmic reticulum where it

trimerizes and is subsequently cleaved by a host-cell furin or furin-like protease in the

Golgi. Proteolytic cleavage results in the formation of SU, which is the receptor-binding

domain, and TM, which serves as the transmembrane anchor and contains fusogenic

activity (Figure 1.5). In the case of alpha-, gamma-, and deltaretroviruses, SU and TM are

covalently linked through a single disulfide bond (11-15), whereas lentiviruses and

betaretroviruses are non-covalently associated (16, 17). Upon receptor recognition by SU,

numerous molecular rearrangements ensue which promote co-receptor binding, and/or

remodeling of the host cell membrane by the TM fusion peptide. Following trimerization

in the ER, which is thought to be the rate limiting step in biosynthesis, Env undergoes

substantial N- and O-linked glycosylation while trafficking through secretory pathway (10,

18) (Figure 1.6).

Interestingly, lentiviral Env glycoproteins have a very long cytoplasmic tail domain

(CTD) compared to other retroviral Envs (Figure 1.7). It is thought that this may indicate

a functional significance, especially since it has been shown that truncation of the CTD

results in altered trafficking, viral incorporation, fusogenicity, and cell surface expression

(19-21). The CTDs of retroviral Env proteins also contain classical YxxΦ and dileucine

trafficking motifs, which are thought to maintain an optimal level of Env on the cell

surface. Tightly regulating the expression of Env at the cell surface, at least in the case of

HIV-1 Env, it is thought to limit the level of immunogenicity while allowing an adequate

number of trimers to incorporate into assembling particles. Mutations of the YxxΦ motif

for HIV, Human T-lymphotropic virus (HTLV), and MLV can result in aberrant Env

12

distribution and infectivity (22-24). The CTD of retroviral Env glycoproteins also contain

a consensus palmitoylation sequence that is thought to help promote association with

specific lipid microdomains in the membrane (25-27).

A unique feature of Beta- and Gamma-retroviral Envs is that they have a regulatory

peptide at the end of their CTD that negatively regulates fusogenicity. Cleavage of this

peptide (R-peptide) by the viral protease shortly after viral maturation results in

conformational changes within the Env trimer which activates fusogenicity.

The retroviral genome is a dimer of linear, positive-sense, single-stranded RNA

(ssRNA) monomers, each being 7 to 13 kb in length. Repetitive (R) nucleotide sequences

flank either end of the viral genome with untranslated regions residing downstream, and

upstream, of the 5’ and 3’ repeat sequences, respectively (termed U5 and U3). The

integrated proviral DNA contains U3-R-U5 elements at either end of the genome, termed

long terminal repeats (LTRs), which are formed following reverse transcription (Figure

1.6). The viral LTRs serve as a promoter and aide in transcription of viral genes encoded

from the genome. The genome also contains several cis-acting elements that are absolutely

essential for producing infectious particles. These elements are the dimerization

initiation/linkage sequence (DIS or DLS), primer binding site (PBS), which serves as the

initiation site of reverse transcription, a packaging element (Ψ) used by NC to encapsulate

genomic RNA, and a poly purine tract (PPT) used during reverse transcription. The dimeric

interaction between the RNA monomers is maintained by a self-complimentary sequence

(DLS or DIS) located at the 5’ end of the genome.

13

Figure 1.4: Polyprotein Translational Mechanisms

Gag and Gag-Pol expression occurs from the same RNA transcript. Translation of the full-

length poly protein occurs through ribosomal frameshifting, stop codon suppression, or

stop codon read-through. Depicted below the mechanisms that HIV and MLV use to

express Gag and Gag-Pol from a single transcript.

14

Figure 1.4: Polyprotein Translational Mechanisms

15

Figure 1.5: Illustration of an Env Trimer

Env has two domains: the receptor binding domain SU, and the transmembrane domain

TM, which contains fusogenic activity. Viral-to-cell membrane fusion is accomplished

through the fusion peptide located at the N-terminus of TM.

16

Figure 1.5: Illustration of an Env Trimer

17

Figure 1.6: Biosynthesis and trafficking of Env

Env is synthesized in the secretory pathway after translocation to the endoplasmic

reticulum (ER). Env undergoes trimerization in the rough ER and is subsequently trafficked

to the Golgi and trnas-Golgi network (TGN) where it is cleaved into SU and TM by a

cellular furin or furin-like protease. The final destination is the plasma membrane (PM)

where it is incorporated into assembling viral particles. Env is also trafficked from the PM

to early and late endosomal compartments where it is either recycled back to the PM or to

the lysosomes for degradation. Simultaneously, Gag (MA, CA, NC) is being synthesized

by the ribosomes in the cytoplasm as a soluble protein. Once biosynthesis is complete, Gag

is trafficked to the plasma membrane where it begins to multimerizes and for the viral

assembly site. Image from: (28)

18

Figure 1.6: Biosynthesis and trafficking of Env

19

Figure 1.7: Cytoplasmic tail length of retroviral glycoproteins

Lentiviruses have a much longer CTD compared to other retroviral families, which is

thought to impart an functional advantage. The retroviral glycoprotein CT lengths are

depicted below. Lentiviral Env CTs are grouped in one cluster and other retroviral Env

families are grouped in another.

20

Figure 1.7: Cytoplasmic tail length of retroviral glycoproteins

21

Figure 1.8: Integrated HIV-1 proviral DNA genome

Depiction of the integrated form of the DNA provirus from HIV-1. The DNA form contains

the U3-R-U5 long terminal repeats on either end of the viral genome which are absent in

the RNA form. The example used in the depiction is of a HIV-1 provirus with the indicated

core and accessory genes. Gag, Pol, and Env are the core genes and Vif, Vpr, Vpu, Nef are

accessory genes. Tat and Rev are components that are necessary for transportation of the

unspliced viral genome.

22

Figure 1.8: Integrated HIV-1 proviral DNA genome

23

1.2 Retroviral Life Cycle

The viral life cycle begins (or ends depending on one’s perspective) with the Env

glycoprotein binding to the appropriate cell surface receptor, which initiates entry events

(Figure 1.9). In some instances, receptor binding triggers co-receptor binding, as in the case

of HIV-1 Env, or directly leads to activation of the fusion mechanism. Retroviral Envs use

a type I fusion mechanism to fuse the target cell membrane with the viral membrane (29).

This process involves a hydrophobic stretch of amino acids at the end of the TM domain

called the fusion peptide, which embeds into the membrane of the target cell bringing both

membranes into close proximity to facilitate lipid mixing and formation of a fusion pore.

The viral capsid core utilizes the fusion pore to gain entry into the host cell cytoplasm

where reverse transcription of the viral genome takes place. Many of the details of reverse

transcription, capsid uncoating, and nuclear import are still poorly understood.

Initiation of reverse transcription is primed by a cellular tRNA molecule binding to

the PBS. During reverse transcription, several RNA/DNA intermediates are formed with

template switching occurring multiple times. Cis elements in the RNA genome serve as

guide elements during this process, such as the PPT. To synthesize the second strand of the

dsDNA genome, the PPT is used as the primer. RT binds to the PPT

The RNaseH domain of RT degrades these intermediates during the process of dsDNA

synthesis (30) (Figure 1.10).

Following the completion of reverse transcription, the dsDNA genome needs to

enter the nucleus and integrate into the host cell chromosome. This process is completed

by the formation of a pre-integration complex (PIC). The PIC contains viral and cellular

24

proteins that are imported into the nucleus (as in the case of lentiviruses) or gain access to

the genome during mitosis, when the nuclear membrane dissipates. IN aides in integrating

the dsDNA into the cellular genome (31). The various viral transcripts are then trafficked

out of the nucleus to the cytoplasm to be translated by the host cell machinery. Unspliced

genomic RNA is also trafficked into the cytoplasm so that it can be recruited to the viral

assembly site and packaged into nascent virions.

25

Figure 1.9: Depiction of the HIV-1 life cycle

The viral surface glycoprotein binds to the receptor on the host cell which initiates

membrane fusion and creates a pore through which capsid is delivered. Once inside the

host cell reverse transcription is initiated and the dsDNA viral genome is delivered into the

nucleus where is undergoes integration into the host cell chromosome. Following

integration, the viral genes are transcribed and viral proteins are synthesized along with a

RNA copy of the viral genome. These components are then assembled to form new

particles. Image from: (http://www.daviddarling.info/encyclopedia/A/acquired

_immune_deficiency_syndrome.html)

26

Figure 1.9: Depiction of the HIV-1 life cycle

27

Figure 1.10: Reverse transcription mechanism

The complete process of reverse transcription is depicted. The steps of the process are

labeled at the left of the corresponding step. Reverse transcription is begins by a cellular

t-RNA binding to the PBS which initiates minus-strand DNA synthesis. RNasH then

degrades the RNA portion of the RNA-DNA hybrid which frees up the resulting short,

single-stranded DNA fragment. This product is then transferred to the other strand where

it hybridizes with the repeat sequence at the 3’ end of the genome. Synthesis then

continues along the RNA template which is subsequently degraded by RNasH. The PPT

serves as the primer for the plus strand which is then synthesized. The plus strand

synthesis goes until complete replication of the viral genome into DNA. Image from: (32)

28

Figure 1.10: Reverse transcription mechanism

29

1.3 Retroviral Assembly

Assembly of a nascent viral particle requires spatiotemporal coordination of the

viral RNA genome, Gag, Gag-Pol, and Env proteins to coalesce at the same site in the cell.

A brief overview of events is as follows: 1) Gag interacts with the viral RNA genome and

traffics it to the cell membrane where multimerization ensues. 2) Multimerization begins

to define the viral assembly site where Env is recruited. 3) The final step is the budding of

a complete viral particle with the help of cellular trafficking proteins (6, 33).

Nascent retroviral particles assemble in the cytoplasm (termed Intracellular

Cytoplasmic A Particles; ICAPs) or at the plasma membrane. Assembly that occurs on the

plasma membrane is termed C-type assembly, which begins by Gag multimerization at the

inner leaflet of the plasma membrane. Cytoplasmic assembly is termed B/D type and in

this case, Gag multimerizes in the cytoplasm. Although these assembly sites are in two

distinctly different locations in the cell, a point mutation in Mason Pfizer Monkey Virus

(MPMV) Gag changes assembly from B/D to C type assembly, suggesting that assembly

mechanisms might be similar (34). Other types have particles have also been observed

within the cell, such as the Intracisternal A-type particles (IAPs). IAPs predominantly

assemble endogenously due to defective components of Pol and Env (35) (Figure 1.11).

All retroviral particles bud in an immature form, which have a spherical core with an

electron-translucent center, while mature particles have a specific morphology with an

electron dense center. The morphology of the virus is defined by CA-CA interactions that

can also determine the size of the mature viral particle (5).

30

Multiple components of the virus must interact sequentially to form an immature

particle. Although the spatiotemporal timing of these interactions are not well understood,

assembly requires protein-protein, protein-lipid, and protein-RNA interactions to form an

infectious particle. For HIV-1, it has been shown that Gag interacts with the viral RNA

genome in the cytoplasm, forming lower order multimers. Higher order Gag multimers

have been observed on the plasma membrane (36). Gag binding to membrane occurs

through three mechanisms: 1) Interaction with the lipid head groups through the highly

basic region, 2) PIP2 interactions with MA, and 3) Myristoylation of Gag (37-41).

The exact site of HIV-1 assembly is debated. Some imaging studies depict virion

assembly at the inner leaflet of the plasma membrane (42-44), while others demonstrate

assembly at intracellular vesicles (45, 46). Although it is worth noting that these vesicles

were later shown to be continuous invaginations of the plasma membrane (47, 48). For C-

type assembly sites, it has been shown that the lipidome of HIV-1 virions contain an

enrichment of lipid-raft associated phospholipids (49-51). The HIV-1 phospholipid

envelope is enriched for cholesterol and sphingolipids, both of which cluster at ordered

microdomains. Cholesterol depletion in virus producing cells interferes with viral release,

structural stability, and infectivity (52-55). Interestingly, HIV-1 Env has been shown to

contain cholesterol binding domains in the MPER which have been shown to be important

for fusogenic activity. Additionally, some lipid raft associated proteins have been reported

to be incorporated into HIV-1 particles (56). Although a significant amount of correlative

evidence exists for HIV-1 association with lipid rafts, it is not entirely known where

assembly sites occur and if it is always in the same environment. It is plausible that the

presence of Gag multimerization at the plasma membrane induces the formation of specific

31

lipid microdomains that are required to form assembly sites that produce infectious

particles.

Regardless of the nature of the assembly site, the assembled virion needs to bud

from the host cell to complete the process. This process is completely dependent on late

endosomal host cell trafficking machinery, called ESCRTs. An ESCRT component,

Tsg101, is recruited to the viral assembly site through association with the PTAP motif in

p6, which is part of Gag. Most retroviral Gags possess a secondary PPxY motif in the p6

domain that may initiate activation of the ESCRT machinery to aide in budding. Mutation

of these motifs in the p6 domain results in an immature particle phenotype which cannot

complete the budding process (57-61) (Figure 1.12).

Spread of the HIV-1 virus has been shown to be more efficient in a cell-to-cell

manner, as opposed to cell-free viral spread, through formation of virological synapses (62,

63). The virological synapse serves as a secondary assembly site where Gag and Env are

recruited along with several other proteins such as CD4 and adhesion molecules (64, 65).

32

Figure 1.11: Depiction of various retroviral assembly sites

C-type assembly occurs at the inner leaflet of the plasma membrane, while B/D type

assembly occurs in the cytoplasm, followed by subsequent trafficking to the plasma

membrane for budding. IAPs assemble in the lumen of the ER. Image from: (33)

33

Figure 1.11: Depiction of various retroviral assembly sites

34

Figure 1.12: ESCRT involvement in HIV-1 and MLV virion budding

Diagram of the interacting proteins involved in HIV-1 and MLV nascent virion budding

from the host cell. The binding partners are shown with the indicated interaction motif in

the respective Gag protein.

35

Figure 1.12: ESCRT involvement in HIV-1 and MLV virion budding

36

1.4 Recruitment of Env to viral particles

Acquisition of viral Env glycoproteins during assembly is absolutely essential for

forming an infectious particle. Interestingly, retroviruses can incorporate foreign

glycoproteins from other retroviruses and from different viral families. This process is

termed pseudotyping and results in the formation of an infectious particle with an altered

cell tropism (66-68). This phenomenon has been capitalized on by researchers from

numerous fields, especially for applications such as gene therapy; however, very little is

known about the molecular mechanisms that govern this process. Env is synthesized in the

secretory pathway, where is trimerizes in the ER, is trafficked to the Golgi where it is

leaved into SU and TM by a cellular protease, and then is trafficked to the site of viral

assembly where it is incorporated into assembling viral particles.

Pseudotyping does not necessarily apply to all circumstances, it does have

restrictions. For example, some lentiviral glycoproteins are incompatible for incorporation

into non-native particles, presumably because of the steric hindrance of the CTD and the

Gag lattice. The solution to this problem, however, is not as simple as removal of the CTD.

In replication permissive cell lines, HIV-1 ΔCTD Env is incorporated into viral particles

to near normal levels. However, in peripheral blood mononuclear cells and monocyte

derived macrophages, HIV-1 ΔCTD Env is not incorporated into viruses efficiently and as

a result, these cell lines are non-permissive for viral replication. Interestingly, HIV-1

ΔCTD Env is processed normally and is fusogenically active (69-72). Ultimately, the

mechanistic differences for the requirements of the CTD of HIV-1 Env in these cell lines

is not well understood. In the case of MLV Env, removal of the CTD has no discernable

effect on Env incorporation to either native or foreign particles. However, in a competition

37

assay where both MLV and HIV particles are expressed in the same cell, full-length MLV

Env will exclusively partition to MLV particles. Removal of the CTD results in equal

incorporation of MLV Env to both types of particles (73, 74).

In some cases, studies suggest that Env can dictate the site of viral assembly. When

HIV-1 Env is expressed in MDCK cells, HIV viral assembly occurs on the basolateral

surface which may be a result of enrichment of negatively charged phospholipid

headgroups (22-24). In rat neuronal cells, both HIV and MLV Envs cause a redistribution

of their respective Gag molecules (75). MLV Env can also direct MLV Gag recruitment to

viral assembly sites in the virological synapse (76). Additionally, it has been demonstrated

that MLV Env can be actively recruited to non-native viral assembly sites (77). In the

absence of assembling virus, MLV Env displays a random distribution on the cell surface.

However, if assembling virus is present, either MLV or HIV, MLV Env localization

redistributed dramatically to the viral assembly sites (Figure 1.13).

Retroviral Env CTDs also have trafficking motifs that play roles outside of

regulating trafficking of Env, such as in directing virus assembly and pathogenesis. In

polarized epithelial cells, the tyrosine sorting motif determines basolateral targeting of Env

and allows Gag and Env to unite at the virological synapse, assisting in cell-to-cell

transmission of the virus (22-24, 78). An example of a cellular protein that can mediate

incorporation of HIV-1 Env to HIV particles is Tail Interacting Protein (TIP47). TIP47 has

been implicated in lipid biogenesis and protein sorting to those lipids, and has been

implicated as serving as a bridge between hiv-1 Env CTD and HIV-1 MA (79, 80).

However, these findings have been deemed somewhat controversial because of in vitro

studies that showed a non-requirement for TIP47 between HIV-1 Env CTD and HIV MA

38

binding. RNA mediated knockdown of TIP47 also showed no change in infectivity, virion

release, or Env incorporation into HIV-1 particles (81).

The main question we aimed to address in this work was to determine what protein

component(s) in the retroviral Env glycoprotein, specifically MLV Env, dictate

pseudotyping. Additional relevant questions that we would like to address in the future

would be:

Do all glycoproteins that exhibit pseudotyping utilize the same molecular

mechanism? Do these mechanisms differ for retroviral glycoproteins vs.

glycoproteins from other viral families?

If we can determine the protein components that dictate pseudotyping, can we then

engineer glycoproteins to pseudotype that normally do not exhibit that behavior?

For example, full length Rous Sarcoma Virus Env (RSV Env) glycoprotein does

not actively pseudotype with HIV-1 particles. Can we modify RSV Env’s protein

sequence so that it undergoes pseudotyping with HIV-1 particles?

Can we engineer host-cell proteins to pseudotype with HIV-1 particles? Our lab has

demonstrated, using multiple host-cell proteins, that pseudotyping typically only

occurs with viral glycoproteins. This application would be directly relevant for

lentiviral based gene therapy.

39

Figure 1.13: MLV Env active recruitment to foreign viral assembly sites

SEM imaging of the cell surface with immunogold labeled MLV Env. Images depict

localization of MLV Env in a cell not infected (Left), infected with RSV Gag (Middle), or

infected with HIV-1 Gag (Right). The images depict dramatic redistribution of MLV Env

in the presence of assembling viral particles. Image from: (77)

40

Figure 1.13: MLV Env active recruitment to foreign viral assembly sites

41

2. CHARACTERIZING THE MURINE LEUKEMIA VIRUS

ENVELOPE GLYCOPROTEIN MEMBRANE-SPANNING

DOMAIN FOR ITS ROLES IN INTERFACE ALIGNMENT

AND FUSOGENICITY

42

2.1 Summary

The membrane-proximal region of Murine Leukemia Virus Envelope (MLV Env)

is a critical modulator of its functionality. We have previously shown that the insertion of

one amino acid (+1 leucine) within the membrane-spanning domain (MSD) abolished

protein functionality in infectivity assays. However, functionality could be restored to this

+1 leucine mutant by either inserting two additional amino acids (+3 leucine), or by

deleting the cytoplasmic tail domain (CTD) in the +1 and +2 leucine background. We

inferred that the ectodomain and CTD have protein interfaces that have to be in phase with

each other, or with another protein component in Env, to be functional. Here, we made

single residue deletions to the +1 leucine Env background to restore the phasing (gain of

functionality) and therefore define the boundaries of the two interfaces. We identified the

glycine-proline pairs near the N-terminus (positions 147 and 148) and the C-terminus

(positions 159 and 160) of the MSD as being the boundaries of the two interfaces.

Deletions between these pairs restored function, but deletions outside of them did not.

However, the vast majority of the -1 deletions also regained function if the CTD was

deleted. The exceptions were four hydroxyl-containing amino acid residues (T139, T140,

S143, T144) in the membrane-proximal interface, which were all indispensable for

functionality. We hypothesize that these hydroxyl-containing residues could be a driving

force for stabilizing the ectodomain interface through formation of a hydrogen-bonding

network that directs orientation and oligomerization of the Env monomers to contribute to

glycoprotein trimer formation.

43

2.2 Introduction

Enveloped viruses require membrane-spanning cell surface glycoproteins to

coordinate fusion between viral and host cell membranes. Retroviral envelope (Env)

glycoproteins are produced as precursors that undergo trimerization in the endoplasmic

reticulum. Subsequently, the precursor trimer is cleaved into two subdomains: the receptor

binding surface domain (SU) and the fusion promoting transmembrane domain (82). This

cleavage process is mediated by a host-cell furin, or furin-like protease. In the case of

alpha-, gamma-, and deltaretroviruses, SU and TM are covalently linked through a single

disulfide bond (11-15), whereas lentiviruses and betaretroviruses are non-covalently

associated (16, 17). Upon receptor recognition by SU, numerous molecular rearrangements

ensue that promote co-receptor binding, and/or remodeling of the host cell membrane by

the TM fusion peptide (83).

In the case of Murine Leukemia Virus Envelope (MLV Env), fusogenicity is tightly

controlled by a short peptide (R-peptide) in the cytoplasmic tail domain (CTD) that

negatively regulates fusogenicity (84-87). Cleavage of the R-peptide by the viral protease

during or shortly after viral assembly results in isomerization of the disulfide bond between

SU and TM, subsequently activating fusogenic activity (88, 89). Recent cryo-electron

microscopy (EM) reconstruction data show that the ectodomain of MLV Env is held in a

tight conformation until cleavage of the R-peptide, wherein the TM legs are splayed,

allowing fusogenic activation of Env (90). Thus, R-peptide cleavage is thought to

potentiate fusogenic activation through molecular rearrangements in the MSD and in the

extracellular region of MLV Env.

44

Similarly, the membrane-proximal external region (MPER) and MSD of HIV-1

Env are crucial for promoting fusogenicity. Disruption of hinge regions or the tryptophan-

rich sequence in the MPER as well as polar residues within the MSD all result in non-

functional glycoproteins that are fusogenically inactive (91-96). These types of

mechanisms have parallels with MSDs of voltage-gated ion channels and G-protein-

coupled-receptors (GPCRs). Conformational changes in the transmembrane domains of

GPCRs allows for transmission of signals from the extracellular space to the intracellular

environment (97-101).

Recently, we demonstrated that leucine insertions in the MSD of MLV Env have a

significant effect on glycoprotein functionality. Insertion of +1 (+1L) or +2 leucines (+2L)

in the MSD abrogated function, whereas insertion of +3 leucines (+3L) restored infectivity

to levels comparable to wild-type Env. Interestingly, when the CTD was truncated in the

+1L background, infectivity was restored. Further study revealed that the loss of infectivity

in the +1L Env mutant was due to disruption of the fusion mechanism, and that +3L

restored fusogenicity and became constitutively active. All leucine insertion mutants were

incorporated into viral particles to similar levels compared to wild-type and all were

processed properly into SU and TM domains in cell lysates. We hypothesized that the CTD

forms a coiled-coil interface that disrupts the glycoprotein’s function if it is out of phase

with the trimer interface of the ectodomain. This hypothesis is supported by cryo-EM

reconstruction data wherein proper helical orientation would be required to promote the

molecular rearrangements necessary to release the ectodomain and activate fusogenicity.

Therefore, the +1L insertion would distort the helical orientation of the ectodomain and

CTD by approximately 103º, while the insertion of +3L would restore phasing by adding

45

almost a complete α-helical turn (Fig. 1). Restoration of function of the +1L Env in the

context of the CTD truncation suggested that removal of the CTD interface eliminated the

phasing conflict with the ectodomain, allowing for restoration of function. Here, we sought

to define the borders of these two interfaces by identifying gain-of-function mutations that

restored Env functionality in the +1L background.

2.3 Experimental Procedures

Plasmids and Cell Culture. The amino acid deletions and residue substitutions were

created using oligonucleotide-mediated mutagenesis. Constructs expressing the truncated

version of MLV Env were created by introduction of a stop codon after RLVQFVK, which

removes twenty-five residues from the cytoplasmic tail. Unless indicated, all MLV Env

expression constructs are HA-tagged (YPYDVPDYA) in a proline-rich region in SU (102).

Indicated deletion mutants with the truncated cytoplasmic tail and +1 leucine insertion

were cloned into an MLV genome that contained a puromycin gene upstream of the MLV

Env coding region driven by a cytomegalovirus (CMV) promoter. To ensure each protein

was expressed independently, a self-cleaving T2A peptide was inserted between the open

reading frames of the puromycin and MLV Env genes (103, 104). This construct also

contained a green fluorescent protein (GFP) tag inserted into a proline-rich region in SU.

For all infectivity, a NL4-3 derived HIV-CMV-GFP proviral vector, defective for Vif, Vpr,

Vpu, Nef, and Env, was used (Vineet Kewal-Ramani, National Cancer Institute). This

construct has a CMV immediate-early promoter driving a GFP reporter in place of Nef.

HEK-293FT (Invitrogen), 293T mCAT-1 (Walter Mothes, Yale University), and 293T

mCAT-1 cells stably expressing a tet-off Gaussia Luciferase (G. Luc.) promoter (102)

46

were maintained in DMEM supplemented with 10 % fetal bovine serum, 2 mM glutamine,

1 mM sodium pyruvate, 10 mM non-essential amino acids and 1 % MEM vitamins.

Infectivity Assay. 293FT cells were transfected in six well plate’s with 500 ng of HIV-

CMV-GFP and 500 ng of Env expression plasmid using 3 µg polyethylenimine (PEI) per

microgram of DNA (105). Media was changed 6 to 12 h post transfection to remove

residual transfection reagent. Supernatant was collected 24 h following media exchange

and frozen at -80ºC for at least 3 h to lyse any cells contained within the supernatant. After

thawing supernatants at 37ºC in a water bath, samples were centrifuged at 1,500 X g for 5

minutes to pellet any cellular debris. 500 µL of the supernatant was added to target cells

for 48 hrs. Cells were collected at 48 hrs, fixed with 4% paraformaldehyde, and analyzed

using an Accuri C6 flow cytometer.

Western Blotting. 293FT cells stably expressing the indicated Env proteins were

transfected with 500 ng of HIV-CMV-GFP plasmid in a six well plate following the same

procedure as described for infectivity assays. Viral samples were pelleted through a 20 %

sucrose cushion for 2 h at 20,000 X g at 4ºC. Residual supplement media and sucrose were

aspirated off of the sample pellet and samples were re-suspended in 6x SDS-PAGE loading

buffer. The equivalent of 1 mL of viral supernatant was analyzed by 10 % discontinuous

SDS-PAGE. Cell samples were detached using 10 mM EDTA/PBS solution and pelleted

at 500 x g for 10 minutes. Pellets were re-suspended in RIPA buffer (10 mM Tricl-Cl (pH

8.0), 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1%

SDS, and 140 mM NaCl) and 5-to-10 % of the lysate was combined with 6x SDS-PAGE

loading buffer and analyzed by 10 % discontinuous SDS-PAGE. Proteins were transferred

onto a 0.45 µm polyvinylidene difluoride (PVDF) membrane. The membrane was blocked

47

with 5 % nonfat dried milk in PBS containing Tween 20 (PBS-T) and probed with rabbit

anti-GFP antibody diluted 1:5000 (Sigma) and mouse anti-HIV p24 hybridoma media

diluted 1:500 (AIDS Research and Reference Program, Division of AIDS, NIAID, NIH;

HIV-1 p24 hybridoma [183-H12-5C]). Primary antibody incubations were performed

overnight, on a shaker, at 4ºC. Blots were washed with PBS-T and then probed with

horseradish peroxidase (HRP)-conjugated anti-rabbit and anti-mouse antibodies diluted

1:10,000 (Sigma) for probing Env and p24, respectively. Visualization of the membranes

was performed using Luminata Classico and Cresendo Western HRP chemiluminescence

reagents. Imaging was performed using a LAS3000 image analyzer from Fujifilm.

Cell-to-cell Fusion Assay. 293FT cells stably expressing the indicated Env protein were

transfected with 500 ng of tet-off expression plasmid in a six well plate. Media was changed

6 to 12 h post-transfection to remove residual transfection reagent. Transfected cells were

co-cultured with an equal number of 293T mCAT-1 TRE G. Luc. cells for 48 h (102).

Twenty microliters of sample supernatant from the co-cultured cells were assayed in

duplicate for G. Luc. content with 50 µL of 10 µM coelenterazine in 0.1M Tris (pH 7.4)

and 0.3M sodium ascorbate.

Surface Labeling. 293FT cells stably expressing the indicated Env protein were detached

using 10 mM EDTA/PBS. Cells were centrifuged at 500 X g for 10 minutes at 4ºC and re-

suspended in 1 % bovine serum albumin (BSA)/PBS blocking solution for 20 minutes.

After 20 minutes of blocking, cells were centrifuged at 500 X g for 10 minutes at 4ºC and

re-suspended in 10 mM EDTA/PBS, 1 % goat serum, and 1:1000 primary anti-GFP Alexa-

Fluor 647 antibody (Life Technologies) for 1 h. After primary antibody incubation, cells

were centrifuged at 500 X g for 10 minutes at 4ºC, re-suspended in 4 % paraformaldehyde,

48

and fixed for 20 minutes. Cells were then centrifuged at 500 X g for 10 minutes at 4ºC, re-

suspended in PBS, and analyzed using an Accuri C6 flow cytometer.

Statistical Analysis. Each experiment was done at least three independent times with

similar results. All statistics and graphs were done using Graph Pad Prism4 software.

2.4 Results

Identification of interface boundaries. We observed that proper helical

orientation of MLV Env trimers is crucial for infectivity (102). Disruption of the spacing

between the ectodomain and CTD caused by amino acid insertions within the MSD resulted

in loss of infectivity (102). We hypothesized that we could determine the boundaries of

these interfaces by identifying gain-of-function mutations that restored helical alignment

and, thus, function. In our previous study, we demonstrated that the insertion of a leucine

(+1L) between positions L154 and L155 in the MSD resulted in a non-functional

glycoprotein (Fig. 2.1) (102). If our hypothesis is correct and we perform a deletion scan

across the ectodomain, MSD, and CTD in the context of the +1L Env, we could identify

residues that restore infectivity (Fig. 2.2A). If a residue is located between the ectodomain

and CTD interfaces, removing it would offset the addition of the single leucine and restore

infectivity; however, if the residue is positioned within or beyond the interfaces

themselves, point deletions would not be expected to restore functionality. Furthermore, if

the CTD interface is destroyed, whether through truncation of the CT or deletion of critical

interfacial residues, we would also expect to see restoration of function because conflicting

interfaces would no longer exist. As shown in Fig. 2.2B, deletion of residues in the +1L

Env background upstream of P148, which is positioned within the MSD, did not restore

49

infectivity. However, deletion of residues between P148 and P160 restored infectivity

compared to the +1L Env control. Further, deletion of residues positioned downstream of

P160, within the CTD, did not restore function.

Interestingly, deletion of K171 or D172 in the CTD partially restored infectivity.

We have previously shown that point mutations in this region in the CTD could partially

restore function to a protein with the +1L in the MSD (102). Therefore, it is reasonable to

predict that these residues are critical to the CTD interface and that deleting them is

functionally similar to making truncations in the CTD (102).

Insertions outside of the glycine-proline pairs do not display a phasing effect.

If our hypothesis was correct and the glycine-proline pairs designated the end and

beginning of the ectodomain and CTD interfaces, respectively, then residue insertions

upstream or downstream of these glycine-proline pairs would not display the previously

observed phasing effect. Addition of +1 or +2 leucines between the glycine-proline pairs

abrogates infectivity; however, insertion of +3 leucines in this same region restored

function, presumably because this introduces one turn of an α-helix which effectively

restores helical alignment (Fig. 2.3; MSD insertions). We introduced +1, +2, or +3 leucines

at the N-terminus of the MSD, upstream of the G147/P148 pair, and assayed for infectivity.

As shown in Fig. 2.3, introduction of +1, +2, or +3 leucines upstream of G147/P148

completely abolished infectivity. Likewise, insertions of +1, +2, or +3 leucines in the CTD,

downstream of the G159/P160 pair, did not display a phasing effect (Fig. 2.3; CTD

insertions), suggesting the region between G147/P148 and G159/P160 does not have an

interface critical for function and can therefore tolerate the introduction of a turn of an α-

helix. Conversely, if the ectodomain and CTD have interfacial surfaces, introduction of

50

leucines in these regions would disrupt contacts between residues within the interfaces,

resulting in abrogated function (Fig. 2.3).

Discovery of residues in the MSD crucial for functionality. We previously

showed that deletion of the CTD restored functionality to both +1L and +2L MSD

insertions. Therefore, we sought to determine which of the residues within the ectodomain

and CTD interfaces were crucial for function even in the absence of the CTD. To

accomplish this, we made truncation mutants lacking the final 25 residues of the

cytoplasmic tail (Δ25CT). Truncation of the CTD resulted in restoration of function for

all of the deletion mutants examined except for hydroxyl-containing amino acids in the

ectodomain interface and P148 (Fig. 2.4). If the CTD had an interfacial surface, making

large truncations in this region would eliminate the conflict between trimer interfaces

because only the ectodomain interface would remain intact. As expected, all of the deletion

residues in the CTD displayed restored infectivity when the CT was truncated.

Hydroxyl-containing residues in the MSD are crucial for fusogenicity. Our

finding that P148 was crucial for function was expected since this residue most likely caps

the end of the ectodomain interface and acts as a molecular hinge within the trimer,

however, it was unexpected that the hydroxyl residues were also critical amino acids in the

membrane proximal ectodomain. The loss of functionality resulting from deletion of these

residues could be caused by many factors, therefore, we focused on determining the source

of the defect. To avoid inconsistences in expression levels of Env, we stably expressed the

hydroxyl-residue deletion mutants with CT truncations in 293FT cells. We also engineered

a green fluorescent protein (GFP) tag in the variable proline-rich region of SU for these

constructs. It has been shown that introduction of GFP, or peptides, into this proline-rich

51

variable region in SU is well tolerated with no discernable effects on Env function (106-

108). Additionally, deletions, insertions, or substitutions in, or near, the MSD of Env can

result in improper processing and aberrant trafficking (108). The GFP tag allowed for

visual confirmation of mutant Env expression and provided a conformation-independent

epitope for surface expression experiments. Surface expression studies revealed that all of

the truncated hydroxyl deletion mutants in the +1L background were expressed on the

surface relative to the truncated +1L Env positive control (Fig. 2.5A).

Next, we wanted to determine if these mutants were fusogenically active. Each cell

line stably expressing the indicated Env mutant was transfected with a transcriptional

activating tet-off expression construct (102). Twenty four hours post transfection, an equal

number of cells from each mutant cell line were co-cultured with an equal number of 293T

mCAT-1 cells expressing TRE-driven Gaussia luciferase (Gluc). If the Env mutants are

fusogenic, the transfected cells fuse with the receptor-expressing cells and tet-off-

dependent induction of Gluc occurs (102). Reporter induction can then be correlated

between mutant Env and wild-type controls to assess fusogenic activity. Interestingly, our

results indicated that all four of the hydroxyl deletion mutants displayed reduced cell-to-

cell fusion activity (Fig. 2.5B). To determine if loss of fusogenicity was the sole basis for

the loss of infectivity, we examined incorporation of these mutants into HIV particles. As

shown in Fig. 2.5C, all of the hydroxyl deletion mutant glycoproteins were incorporated

into HIV particles to a similar level compared to the truncated +1L control, indicating loss

of infectivity was due to loss of fusogenicity. Additionally, all of the mutant glycoproteins

accumulated to similar levels in the stable cell lines compared to the +1LΔ25CT control

(Fig. 2.5C; Cell). Taken together, the results depicted in Fig. 2.4 indicated that the loss of

52

infectivity was due to the reduction of fusogenicity, and not due to gross defects in Env

processivity, trafficking, or incorporation into viral particles.

Hydrogen-bonding requirements and steric constraints of the hydroxyl-

containing residues. Polar residues located in MSDs of transmembrane helices have been

shown to be important contributors to protein packing, oligomerization, and TM

stabilization (109-114). To determine if the hydrogen-bonding capacity of the residues we

identified in the ectodomain interface was important for function, we made alanine

substitutions to the wild-type protein in both the presence and absence of the full-length

cytoplasmic tail. We were surprised to observe that only two of the residues, T139 and

S143, displayed greatly reduced infectivity when substituted to alanine (Fig. 2.6A).

We hypothesized that perhaps these residues were positioned in, or near, the core

of the trimer interface and that their ability to hydrogen-bond was crucial for monomer

orientation or trimer stabilization. If this hypothesis were correct, it would also suggest that

positions T139 and S143 would have greater steric restriction to amino acid side-chain size

because of their location toward the trimer core. Conversely, positions T140 and T144

would be able to tolerate amino acid side chains with greater bulk because of their

orientation toward the outside of the trimer. To test this hypothesis, we made substitutions

at these positions with amino acid side chains that were still polar but had increasing bulk.

As shown in Fig. 2.6B, increasing amino acid side-chain size at positions T139 and S143

resulted in a corresponding decrease in infectivity. However, increasing amino acid side-

chain size at positions T140 and T144 showed a minimal effect on infectivity, suggesting

that these positions have less steric restriction (Fig. 2.6B). It is important to highlight that

substitution of T139 and S143 with hydrogen-bonding side chains (asparagine, glutamine,

53

and to a lesser extent, tyrosine) restored function compared to the alanine substitution. This

suggests that the polarity of the side-chain at these positions is important for function.

Substitution of phenylalanine at all of these positions resulted in severely decreased

infectivity. Unlike the alanine substitution, which only eliminated hydrogen-bonding, the

phenylalanine substitution also introduced a bulky side-chain with no polar functional

group. Importantly, as highlighted in Figure 2.6B, tyrosine substitution at each position

significantly restored infectivity compared to the phenylalanine substitution. The only

molecular difference between these two amino acid side chains is the presence of the

hydroxyl group on the benzyl ring of tyrosine, further suggesting that hydrogen-bonding

at these positions is crucial for function.

2.5 Conclusions

We have previously shown that coordination of the membrane-proximal

ectodomain and CTD interfaces is a critical modulator of glycoprotein functionality (102).

Disruption of the helical phasing by the insertion of +1L within the membrane-spanning

domain resulted in conflicting alignment of the ectodomain and CTD interfaces (Fig. 2.1).

Truncation of the cytoplasmic tail restored functionality of the +1L Env by relieving the

conflict between interfaces through removal of a majority of the CTD. This study explored

the boundaries of the ectodomain and CTD interfaces as well as probed the role of this

region in promoting fusogenic activity.

Identifying the boundaries of the ectodomain and the CTD. We identified the

glycine-proline pairs positioned within the MSD as residues that facilitate the transition

from the ectodomain interface to the predicted interface located in the cytoplasmic tail.

54

This observation is consistent with the conformational properties of proline as well as

previous studies that examined positioning of glycine-proline pairs within MSDs and their

roles in forming molecular hinges, packing of TM helices, and inducing α-helical kinks

(97, 110, 115-117). Therefore, the glycine-proline pairs act as ideal interface caps due to

distortions in the secondary structure, and subsequently the tertiary structure, of the trimer.

In addition, mutations to introduce +1, +2, or +3 leucines either upstream or downstream

of the glycine proline pairs did not display a phasing effect (Fig. 2.3). This suggests that

insertion of +3 leucines, and consequently nearly a complete turn of an α-helix, between

the glycine-proline pairs is tolerated because no critical interfacial surface exists. However,

+3L insertions in the ectodomain and CTD are not tolerated because it may disrupt contacts

between residues in these domains (Fig. 2.3).

Hydroxyl-containing residues in the ectodomain are critical for fusogenicity.

To understand why the hydroxyl-containing residues were crucial for Env function, we

probed the role of these residues by creating substitutions that abrogated hydrogen-bonding

or introduced steric hindrance (Fig. 2.6). We were surprised to find that only two of the

positions showed decreased function when hydrogen bonding was disrupted (Fig 2.6A;

T139A and S143A). Interestingly, these two positions also displayed the greatest

sensitivity to polar side-chain substitution with increasing bulk size. These results are

consistent with the hypothesis that positions T139 and S143 are part of the trimer core

while T140 and T144 are peripheral. This interpretation could also explain why deletion of

residues L141 and I142 displayed restored infectivity when the CT was truncated. Deleting

either of these residues would retain the hydrogen-bonding network by shifting T144

towards the core. This model is consistent with a previous study that identified residues in

55

the CTD involved in forming a trimeric coiled-coil interface (118). Using the residues

predicted to reside in the CTD interface, we can determine the location of the hydrogen-

bonding residues T139 and S143 from the α-helical phasing. We predict that T139 and

S143 reside in close proximity to the predicted coiled-coil trimer interface in the

ectodomain.

We suggest that residue T139 and S143 not only contribute to the fusion

mechanism, but may also stabilize the TM trimer or aide in monomer orientation through

formation of an inter-helical hydrogen-bonding network. A previous study focusing on the

MSD of MLV Env and a role in membrane fusion discovered that a W137S point mutant

induced cell-to-cell fusion even in the presence of the full-length CT, which supports the

hypothesis that hydrogen-bonding in this region of Env contributes to the fusion

mechanism (119). Additionally, a recent study using a random peptide library produced in

E. coli. identified two consensus motifs of SxxxSSxxT and SxxSSxxT that drove helical

oligomerization of transmembrane peptides (109). The hydroxyl-containing residues

we’ve identified as being crucial for function reside at the N-terminus of the MSD as part

of a consensus sequence of SxxxTTxxST, which may participate in similar processes as

described above. Other γ-retroviral glycoproteins such as Feline Leukemia Virus and

Gibbon ape Leukemia Virus also have similar consensus sequences, suggesting it may be

a conserved mechanism used to drive trimer oligomerization amongst certain viral

glycoproteins. Interestingly, Vesicular Stomatitis Virus glycoprotein has a similar

sequence of SSxxSSxxS at the external membrane-proximal/MSD interface, suggesting

this mechanism may not be exclusive to only γ-retroviral glycoproteins. Although HIV Env

does not have serine-threonine clustering in this region, it does have a GxxxG helical

56

packing motif in the MSD. It is possible that some glycoproteins evolved to utilize serine-

threonine clustering as a means to not only drive oligomerization but to also contribute to

the fusion mechanism, as in the case of MLV Env, while others use packing motifs

specifically for trimer oligomerization.

Together, these data suggest that the glycine-proline pairs cap the ectodomain and

CTD interfaces and that the hydroxyl-containing residues within the ectodomain interface

contribute significantly to the cell-to-cell fusion mechanism.

57

Figure 2.1: Diagram of predicted trimer interfaces.

(Left) Depiction of ectodomain and CTD trimer interfaces highlighted as white segments

within the trimer core of wild-type MLV Env. (Middle) Depiction of the +1L insertion

within the MSD and the resulting disruption of the CTD interface by approximately 103º.

(97) Depiction of the +3L insertions within the MSD and the subsequent restoration of

phasing of the CTD interface. The introduction of 3 leucines almost completely restores

alignment of the CTD interface within the trimer core.

58

Figure 2.1: Diagram of Predicted Trimer Interfaces

59


background.

(A) Diagram of the extracellular, membrane-spanning, and cytoplasmic tail domains in

MLV Env targeted for the -1 deletion scan. The arrow indicates the insertion of +1L within

the MSD (B) Infectivity of the full-length +1L insertion is shown as a control and its

insertion position within the membrane-spanning domain is indicated with an arrow. All

filled bars are full-length Env in the +1L background with the indicted residue deleted. The

hashed open bar is full-length wild-type Env shown as a positive control. All data are

normalized relative to the wild-type Env control. The dashed line shown across the data

indicates the relative level of infectivity of the +1L Env. Data shown here are the average

of three independent experiments.

60


background.

61


proline pairs do not display a phasing effect.

(A) (Top) Diagram of the leucine insertions upstream of the glycine-proline pair positioned

at the N-terminus of the membrane-spanning domain and downstream of the glycine-

proline pair positioned at the C-terminus of the membrane-spanning domain. Leucine

insertions in the middle of the MSD, between the glycine-proline pairs, are shown as a

control. (Bottom) Infectivity of leucine insertion mutants shown relative to wild-type MLV

Env. Data shown in this figure are the average of three independent experiments.

62


proline pairs do not display a phasing effect.

63

Figure 2.4: Truncation of the cytoplasmic tail restores abrogated infectivity of certain

deletion mutants.

The cytoplasmic tail of the specified deletion mutants, in the context of the +1L

glycoprotein background, were truncated and infectivity was assessed. Filled bars indicate

full-length glycoprotein deletion mutants with +1L inserted in the MSD. Open bars indicate

glycoprotein deletion mutants with +1L in the MSD missing 25 residues of the CT. The

hashed open bar is wild-type Env Δ25CT shown as a positive control. The dashed line

between positions P148 and L157 indicates these residues were not tested in this

experiment. All data are normalized relative to the wild-type Env Δ25CT control. Data

shown here are the average of three independent experiments.

64

Figure 2.4: Truncation of the cytoplasmic tail restores abrogated infectivity of

certain deletion mutants.

65


promoting cell-to-cell fusion.

(A) Stable cell lines were created in 293FT cells expressing constructs for the indicated

Env mutants. Cells were surface labeled using an anti-GFP AlexaFluor 647 antibody

(Sigma) and analyzed via flow cytometry. Mean fluorescence intensity was normalized to

the +1L Δ25CT control. 293FT cells not expressing MLV Env were included as a negative

control in the labeling process and are indicated as Env (-). (B) Stable cell lines were

assayed for cell-to-cell fusogenicity. Stable cells lines were transfected with tet-off

expression plasmid and co-cultured with a permissive tre-G.Luc. cell line. Results are

depicted as relative light units normalized to the +1L Δ25CT control. 293FT cells not

expressing MLV Env were transfected with the tet-off expression plasmid and were

included in the cell-to-cell fusion assay as a negative control (Env (-)). (C) Western blot

analysis of Env incorporation into viral particles. Stable cell lines were transfected with

HIV GagPol and supernatants and cell lysates were analyzed for Env incorporation and

cellular expression, respectively.

66


promoting cell-to-cell fusion.

67

Figure 2.6: Hydroxyl substitutions display defective functionality.

(A) Infectivity of alanine substitutions in the context of full-length (filled bars) and

truncated Env (open bars) relative to wild-type. (B) Infectivity of amino acid substitutions

in the context of full-length Env relative to wild-type. The hydroxyl-containing positions

were substituted to either: N, asparagine; Q, glutamine; Y, tyrosine; A, alanine; or F,

phenylalanine and infectivity was assessed. Asterisks indicate a significant difference

between the infectivity of tyrosine and phenylalanine substitutions at all four positions

tested.

68

Figure 2.6: Amino acid substitutions in the critical hydroxyl positions display

defective functionality.

69

3. IN VIVO SELECTIONS REVEAL NOVEL PROTEIN

DETERMINANTS FOR MURINE LEUKEMIA VIRUS

(MLV) ENVELOPE GLYCOPROTEIN PSEUDOTPYING

INTO HIV-1 PARTICLES

70

3.1 Summary

Enveloped viruses utilize membrane-spanning cell surface glycoproteins to

mediate fusion between viral and host cell membranes. In a process termed pseudotyping,

glycoproteins from diverse families exhibit incorporation into non-native viral particles by

means of an unknown mechanism. For example, Murine Leukemia Virus envelope (MLV

Env) glycoprotein actively incorporates into foreign viral particles both in the presence,

and absence, of its C-terminal tail. To identify the region(s) of MLV Env required for

efficient incorporation into assembling particles, we developed an in vivo selection system

coupled with Illumina next generation sequencing (NGS) to generate comprehensive

libraries of mutant glycoproteins which were 1) enriched in viral particles, 2) able to

promote viral infection, and 3) fusogenically active. We created a large cell library

(approximately 4x105 cells) with each cell stably expressing a unique MLV Env viral

amplicon with randomly mutagenized membrane-proximal external region (MPER) and

membrane-spanning domains (MSD). NGS analysis revealed that a large number of

incorporation defective substitutions clustered within two regions: A 26 amino acid region

spanning the MSD into the MPER (P136-I162) and a 3 amino acid region in the MPER

(W127-E129). These substitutions had abrogated infectivity but displayed normal

fusogenic activity, suggesting that these regions are important for MLV Env incorporation.

Direct testing of a panel of mutants selected from these two regions identified W127R,

W137L, and I142R as defective for Env incorporation, all of which correlated with the

NGS analysis. Our data suggest that these two regions are essential for dictating Env

recruitment to assembling viral particles.

71

3.2 Introduction

Retroviral particle assembly requires a symphony of viral and host cell proteins

to coordinate in a spatial and temporal manner to form an infectious particle. Typically,

this is an exclusive process wherein viral components only assemble with viral components

from the same or closely related viruses, such as HIV-1 and -2 (120-124). However, an

exception to this typical exclusivity is the incorporation of viral glycoproteins. This

phenomenon is termed pseudotyping, which is defined as the ability of foreign

glycoproteins to incorporate into non-native viral particles (125-127). Researchers from

numerous fields have capitalized on the ability to manipulate viral tropism by exploiting

glycoprotein pseudotyping; however, very little is known about the molecular mechanisms

that govern this process.

There have been at least four models proposed to describe the pseudotyping

mechanism (67, 77). The first model suggests that glycoprotein incorporation is random

and that all surface expressed proteins would be passively incorporated into assembling

particles barring steric hindrance. In this case, viral glycoproteins would be randomly

distributed at the plasma membrane both in the presence and absence of viral assembly

sites. We recently demonstrated that vesicular stomatitis virus glycoprotein (VSV-G) and

murine leukemia virus envelope glycoprotein (MLV Env) are actively recruited to foreign

viral assembly sites (73, 77). This indicates, at least in the case of these two viral surface

proteins, that passive incorporation is not the mechanism used for pseudotyping.

72

The second model, similar targeting, proposes that all viral structural and surface

glycoproteins are independently targeted to specific microdomains at the plasma

membrane, such as lipid rafts. Lipid rafts have been implicated as assembly sites for some

viruses and could serve as a common platform to facilitate viral pseudotyping (125).

However, a surface glycoprotein commonly used for pseudotyping, VSV-G, is not raft

associated (128). Additionally, clustering of MLV Env and VSV-G observed when

assembling particles are present in the cell does not occur in the absence of assembling

virus, suggesting that similar targeting is not the mechanism used for pseudotyping these

viral proteins.

The third model proposes that viral structural proteins directly contact viral

glycoproteins and subsequently recruit them to viral assembly sites. It is unlikely that

pseudotyped glycoproteins form direct physical contacts during incorporation, particularly

because many glycoproteins can be incorporated into virions in the absence of their C-

terminal domains. However, Incorporation of native glycoproteins likely involves specific

interactions between the cytoplasmic tail (CT) of Env and the viral gag protein. A well

characterized example of this is between the CT of HIV-1 and the N-terminal membrane-

binding matrix (MA) domain of HIV-1 gag (129-132). Not only do the CT of HIV-1 Env

and the MA domain of HIV-1 gag interact, but this interaction seems to be required for

efficient Env incorporation into viral particles (133-135). In the case of MLV Env, it has

been shown that: 1) interactions between the CT and MLV gag are required for polarized

budding (78) and 2) a cleavable portion of the CT has been found in association with viral

cores (136). Additionally, we have shown that the CT of MLV Env contains a protein

component that dictates specific recruitment of MLV Env to MLV assembly sites. When

73

both MLV and HIV particles are expressed in the same cell, full-length MLV Env will

exclusively partition to MLV assembly sites. However, if Env is truncated, it is equally

recruited to both HIV and MLV cores (73). This suggests that the CT of MLV Env

modulates a specific recruitment mechanism which results in exclusive partitioning to

MLV cores. In the absence of the CT, Env undergoes generic pseudotyping into foreign

viral particles.

The final model suggests indirect interactions drive incorporation of viral

glycoproteins into assembling particles through a cellular intermediate. We have

previously shown that active recruitment of MLV Env into assembling viral particles

occurs robustly in the absence of the CT, suggesting that an alternative protein

component(s) specifies this recruitment mechanism (73). It has been demonstrated that the

cholesterol recognition amino acid consensus (CRAC) domain in the membrane-proximal

external region (MPER) of HIV Env has a propensity to interact with cholesterol rich

domains in the plasma membrane (137-141). It has been postulated that this region has a

role in remodeling of the HIV-1 lipid membrane to facilitate fusion (95, 96, 142) and

regulates HIV Env lateral sorting (143). We hypothesized that the MPER, and even

membrane-spanning domain (MSD), of MLV Env may be involved in similar behaviors.

Importantly, these domains may be the protein determinants that facilitate Env recruitment

to viral assembly sites though interactions with lipid microdomains that form during viral

assembly. Here, we coupled large-scale in vivo selections with next generation sequencing

(NGS) of a combinatorial mutagenic library of MLV Env glycoproteins to identify mutants

that could 1) be incorporated into viral particles, 2) promote viral infectivity, and 3) retain

fusogenic activity. In addition to probing novel aspects of Env, we suggest that this

74

selection strategy could be applied to other targets under diverse selection pressures and

may minimize difficulties associated with targets highly sensitive to traditional

mutagenesis.

3.3 Experimental Procedures

Plasmids and Cell Culture. The amino acid substitutions were created using

oligonucleotide-mediated mutagenesis. Constructs expressing the truncated version of

MLV Env were created by introducing a stop codon after the sequence encoding

RLVQFVK, which removes twenty-five residues from the cytoplasmic tail. For HIV

infectivity, a NL4-3 derived HIV-CMV-GFP proviral vector, defective for Vif, Vpr, Vpu,

Nef, and Env, was used (Vineet Kewal-Ramani, National Cancer Institute). This construct

has a CMV immediate-early promoter driving a GFP reporter in place of Nef. Creation of

the tet-off/TRE-Gluc system is described here (102). Briefly, the gene encoding the tTA

(tet-off) protein was cloned into pQCXIP vector downstream of the CMV immediate early

promoter. The TRE-driven Gluc-inducible expression system was created by introduction

of the Gluc gene into the retro-tight-X-hygro retroviral transfer vector.

HEK-293FT (Invitrogen), 293T mCAT-1 (Walter Mothes, Yale University), 293T TVA,

and 293T mCAT-1 cells stably expressing a tet-off Gaussia Luciferase (G. Luc.) promoter

(102) were maintained in DMEM supplemented with 10 % fetal bovine serum, 2 mM

glutamine, 1 mM sodium pyruvate, 10 mM non-essential amino acids and 1 % MEM

vitamins.

75

Infectivity Assay. 293FT cells were transfected in six well plates with 700 ng of HIV-

CMV-GFP, or 500 ng of CMV-MLV-GagPol and 200 ng CMV-GFP-MLV Genome, and

500 ng of Env expression plasmid using 3 µg polyethylenimine (PEI) per microgram of

DNA (105). Media was changed 6 to 12 h post-transfection to remove residual transfection

reagent. Supernatant was collected 24 h following media exchange and frozen at -80ºC for

at least 3 h to lyse cells contained within the supernatant. After thawing supernatants at

37ºC in a water bath, samples were centrifuged at 1,500 X g for 5 minutes to pellet any

cellular debris. 500 µL of the supernatant was added to target cells for 48 hrs. Cells were

collected at 48 hrs, fixed with 4% paraformaldehyde, and analyzed using an Accuri C6

flow cytometer.

For infectivity using stable cell lines expressing the indicate MLV Env, cells were

transfected with 700 ng of HIV-CMV-GFP, or 500 ng of CMV-MLV-GagPol and 200 ng

CMV-GFP-MLV genome. Following transfection, the above procedure was used to assess

infectivity. In the case of the stable cell lines expressing both Env and HIV-GagPol,

supernatant was collected, frozen at -80ºC for at least 3 h, and 500 µL was added to target

cells.

Western Blotting. 293FT cells stably expressing the indicated viral proteins were used for

Western Blotting analysis. Viral samples were pelleted through a 20 % sucrose cushion for

2 h at 20,000 X g at 4ºC. Residual supplement media and sucrose were aspirated off of the

sample pellet and samples were re-suspended in 6x SDS-PAGE loading buffer. The

equivalent of 1 mL of viral supernatant was analyzed by 10 % discontinuous SDS-PAGE.

Cell samples were detached using 10 mM EDTA/PBS solution and pelleted at 500 x g for

10 minutes. Pellets were re-suspended in RIPA buffer (10 mM Tricl-Cl (pH 8.0), 1 mM

76

EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, and 140

mM NaCl) and 5-to-10 % of the lysate was combined with 6x SDS-PAGE loading buffer

and analyzed by 10 % discontinuous SDS-PAGE. Proteins were transferred onto a 0.45 µm

polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5 % nonfat

dried milk in PBS containing Tween 20 (PBS-T) and probed with rabbit anti-GFP antibody

diluted 1:5000 (Sigma) and mouse anti-HIV p24 hybridoma media diluted 1:500 (AIDS

Research and Reference Program, Division of AIDS, NIAID, NIH; HIV-1 p24 hybridoma

[183-H12-5C]). Primary antibody incubations were performed overnight, on a shaker, at

4ºC. Blots were washed with PBS-T and then probed with horseradish peroxidase (HRP)-

conjugated anti-rabbit and anti-mouse antibodies diluted 1:10,000 (Sigma) for probing Env

and p24, respectively. Visualization of the membranes was performed using Luminata

Classico and Cresendo Western HRP chemiluminescence reagents. Imaging was

performed using a LAS3000 image analyzer from Fujifilm.

Cell-to-cell Fusion Assay. 293FT cells stably expressing the indicated Env protein were

transfected with 500 ng of tet-off expression plasmid in a six well plate. Media was changed

6 to 12 h post-transfection to remove residual transfection reagent. Transfected cells were

co-cultured with an equal number of 293T mCAT-1 TRE Gluc cells for 48 h. Twenty

microliters of sample supernatant from the co-cultured cells were assayed in duplicate for

Gluc. content with 50 µL of 10 µM coelenterazine in 0.1M Tris (pH 7.4) and 0.3M sodium

ascorbate.

Surface Labeling. 293FT cells stably expressing the indicated Env protein were detached

using 10 mM EDTA/PBS. Cells were centrifuged at 500 X g for 10 minutes at 4ºC and re-

suspended in 1 % bovine serum albumin (BSA)/PBS blocking solution for 20 minutes.

77

After 20 minutes of blocking, cells were centrifuged at 500 X g for 10 minutes at 4ºC and

re-suspended in 10 mM EDTA/PBS, 1 % goat serum, and 1:1000 primary anti-GFP Alexa-

Fluor 647 antibody (Life Technologies) for 1 h. After primary antibody incubation, cells

were centrifuged at 500 X g for 10 minutes at 4ºC, re-suspended in PBS, and analyzed

using an Accuri C6 flow cytometer.

RNA harvesting and cDNA synthesis. Cells grown on 10 cm culture dishes were

harvested from each of the four libraries using 10 mM EDTA/PBS. Cells were pelleted at

500 x g for 10 minutes at 4ºC and re-suspended in Trizol reagent (Sigma). Following a 5

minute incubation period, 200 µL chloroform was added per 1 mL Trizol and vortexed.

After a 3 minute incubation period at room temperature, samples were centrifuged for 15

minutes at 12,000 x g at 4ºC. The upper phase was then transferred to a new

microcentrifuge tube and combined with 500 µL isopropanol per 1 mL Trizol overnight at

4ºC. Samples were then centrifuged 15 minutes at 12,000 x g at 4ºC. RNA pellets were

washed one time using 1 mL of 75% ethanol for every 1 mL Trizol. Following a 20 minute

ethanol incubation, samples were centrifuged for 5 minutes at 7,500 x g at 4ºC. Pellets were

air dried and re-suspended in RNA/DNAase free water.

For cDNA synthesis, 2 µg of the purified RNA was mixed with 1 µL of 100 µM poly dT

primers and incubated at 70ºC for 5 minutes, chilled on ice, and combined with 4 µL

reverse transcription reaction buffer (Promega), 1 µL of 10 mM dNTP mix, 2 µL of 25 mM

MgCl2, 0.5 µL of 40 U/µL RNase inhibitor (Promega), and 1 µL of 200 U/µL M-MLV

reverse transcriptase. The reaction was incubated at 42ºC for 2 h and then 85ºC for 5

minutes.

78

Illumina sequencing and analysis. cDNA libraries were diluted 1:2 with RN/DNase free

water and 5 µL of the diluted samples were used as template for PCR amplification to

introduce Illumina adapters and sequencing indices for multiplexing. Samples were

analyzed using Illumina MiSeq (University of Missouri DNA Core Facility) 2 x 150 nt

paired-end reads. Reads were paired using FLASh (http://ccb.jhu.edu/software/FLASH/).

Data processing was performed using a locally installed FASTX-Toolkit

(http://hannonlab.cshl.edu/fastx_toolkit/). Fastx clipper was used to trim the 3’ constant

region from sequences and a stand-alone script was used to trim 5’ constant regions. During

this process, sequences shorter than 150 nucleotides, or non-trimmed sequences, were

discarded. Trimmed sequences were then filtered for high-quality reads using FASTQ

quality filter. Sequences with a Phred quality score less than 30 (99.9% base calling

accuracy) at any position were eliminated. Finally, nucleotide sequences were translated to

amino acid sequences using the TranSeq program in a locally installed EMBOSS package

(www.ebi.ac.uk/Tools/st/emboss_transeq).

Pre-processed sequences were then further analyzed using the FASTAptamer toolkit (144).

FASTAptamer-Count was used to count the number of times each sequence was sampled

from the population. Each sequence was then ranked and sorted based on overall

abundance, normalized to the total number of reads in each population, and directed into

FASTAptamer-Enrich. FASTAptamer-Enrich calculates the fold-enrichment ratio from a

starting population to a selected population by using the normalized reads-per-million

value for each sequence. After generating the enrichment file, nucleotide changes in each

sequence were determine by using FASTAptamer-Distance, which identifies how many

mutations each sequence has relative to a WT input sequence. Sequences with less than 5

http://ccb.jhu.edu/software/FLASH/

http://hannonlab.cshl.edu/fastx_toolkit/

http://www.ebi.ac.uk/Tools/st/emboss_transeq

79

RPM in the starting population, or with greater than 6 nt mutations were filter removed

from the population. Only sequences with a single non-synonymous amino acid

substitution with up to 6 nt substitutions were considered for the final analysis. The fitness

index for each substitution was determine by taking the average enrichment or depletion

value of all sequences with that specific mutation and plotting it as a heat map (Figure 2).

Maximal enrichment was set to that of WT for the specific selection and was colored gold.

Maximal depletion was set to the average fitness index of all of the randomly introduced

stop codons that occurred in the MPER or MSD for the specific selection and was set to

blue.

3.4 Results

Creating a stable cell library expressing mutant MLV Envelopes. To determine

if the MPER or MSD of MLV Env contribute to selective recruitment of MLV Env to viral

assembly sites, we generated a highly dense mutagenic library targeting 50 contiguous

amino acid positions through random mutagenesis (Figure 3.1A). The goal was to disrupt,

and subsequently identify, motifs or amino acids necessary for Env incorporation. We

achieved random mutagenesis by synthesizing and assembling oligonucleotide primers that

contained a positional mutation rate of 3%, correlating to approximately 4.5 nucleotide

changes per assembled amplicon. Double stranded DNA templates of the randomized

region were generated by primer extension and the sequence was subcloned in the retroviral

amplicon illustrated in Fig. 3.1B using unique restriction sites that flank the randomization

region. The amplicon was then transformed into E. coli and between 105-106 colonies were

harvested. This amplicon was engineered with a puromycin selection cassette, complete

80

RNA packaging components, and flanking LTRs. Therefore, this amplicon can be used to

generate stable cells lines through retroviral transduction. Transduced cells not only

produce the mutant glycoprotein, but also the packageable RNA encoding that

glycoprotein. The amplicons isolated from the pooled library were transfected into 293FT

cells along with plasmids expressing viral packaging components (MLV Gag/GagPol) and

the promiscuous viral glycoprotein VSV-G. Media from this transfection was used to

transduce fresh 293FT cells at a multiplicity of infection (MOI) <0.1. Because a low MOI

was used, 99 % of transduced cells would be infected only once, and therefore express only

a single mutant MLV Env. Following transduction, the cells were selected using

puromycin to create the cell library used in subsequent experiments described below.

It is important to note that the amplicon was constructed with a version of MLV

Env with a truncated CTD for two reasons: 1) we have previously shown that the

cytoplasmic tail of MLV Env contains a protein component that dictates exclusive

recruitment of MLV Env to MLV assembly sites (73) thus, removal of this sequence

ensures that we are only studying the pseudotyping mechanism, and 2) removal of these

residues results in a constitutively active glycoprotein population due to the loss of the

negative regulation provided by the R-peptide (89, 145, 146), allowing for study of

fusogenic activity.

Mutant library selection and next generation illumina sequencing. We coupled

next generation illumina sequencing to large scale biological selections to identify mutant

glycoproteins defective for incorporation into viral particles. Our library was subjected to

three independent selection procedures (described in each section) where the amplicon

sequence was maintained only if the mutant MLV Env that it encoded met the particular

81

criteria. Following these biological selections, the sequence containing the randomized

sequence were recovered and sequenced by Illumina MiSeq analysis using paired-end 2 x

150 read parameters. The population of sequences present following selection was

compared with that of sequences prior to selection to determine the fitness of each mutant

glycoproteins.

Fitness was determined as follows. First, mutations with a low number of input

sequence counts (< 5 reads per million) in the pre-selection library were discarded. Many

of these rare sequences were likely the result of sequencing errors and could skew results.

Second, sequences that contains greater than 6 nucleotide mutations per sequence were

also removed. Amplicons with numerous mutations tended to be quite unfit and were less

informative than amplicons with few mutations. We calculated a fitness index for each

non-synonymous point mutation based on the average of the enrichment or depletion

values that occurred for all of the sequences with that specific substitution. To avoid

complications from compensatory mutations, which may occur in sequences that contained

more than one non-synonymous amino acid substitution, we focused on sequences with

only one altered amino acid. In all cases, there were multiple sequences in the library

representing each individual non-synonymous change. For instance, the starting cell

library contained 108 different amplicons that produced a protein with no amino acid

changes (i.e. only silent mutations). For each unique sequence, the ratio of sequence

density in reads per million between the starting library and the selected library was

calculated. The ratios of all of the unique sequences that led to each single amino acid

change was then averaged. Maximal enrichment values for each sequence were adjusted

to the wild-type Env enrichment for the specified selection. In output illustrations (Fig 3.2

82

and 3.3) sensitivity values were colored so that substitutions detrimental to the biological

selection were colored blue, and substitutions that had no effect on the biological selection

were colored gold. Shown above each of the selections is the maximal sensitivity value for

each position and the location of randomly introduced stop codons (Figure 3.2A-C).

Functional selection. The first and most rigorous selection was for fully functional

MLV Env. For this selection the cell library was transfected with a plasmid expressing the

viral packaging components, but not a viral glycoprotein. In this situation, infectious

particles were produced only if the glycoprotein encoded in the amplicon was able to

perform this function. Media from this transfection were collected and used to transduce

293T mCAT cells, which express the receptor for MLV Env. Following transduction and

selection, the mutant region was recovered by PCR and deep sequenced. In this selection

scheme the wildtype sequences had an average enrichment of ~3.0, whereas sequences that

introduced a stop codon prior to the MSD had enrichment of 0.06. The fact that

introduction of stop codons resulted in dramatic and consistent loss of sequence following

selection criteria provided validation that the selection procedure was effective.

This selection was the most stringent of the three we examined. Every single

residue displayed at least one change that noticeably reduced functionality. The least

sensitive sequence was the last 5 amino acids of the protein. As one would expect,

introduction of a charged residue (R, K, E or D) anywhere in the membrane spanning

domain completely impaired function. The MPER was less sensitive to change than the

MSD, but there were clear hot spots that were very sensitive to change.

Fusion Selection. To identify mutants that retained fusogenic activity, the starting

library was co-cultured with mCAT cells that expressed resistance to hygromycin. Because

83

the library of Env mutants was constructed with a truncated CT, the R-peptide was no

longer able to negatively regulate fusogenicity, which resulted in a constitutively fusogenic

glycoprotein population. Therefore, any cells expressing mutant MLV Env that could

promote cell-to-cell fusion would form syncytia with the mCAT cells and express

resistance to both puromycin and hygromycin. After co-cultured cells were dually treated

with both puromycin and hygromycin antibiotics, the mutagenized region was recovered

using PCR and deep sequenced. The wildtype sequences had an average enrichment of

~1.2, while sequences with a stop codon preceding the MSD had an enrichment value of

0.75. Again, in this instance, introduction of a stop codon resulted in depletion of these

sequences from the selected population, confirming that the selection was successful.

In general, many of the substitutions in the selected fusion population had a

minimal impact on fusogenic activity. However, some residues in the MSD displayed

greatly reduced fusogenic activity. Interestingly, the substitutions that showed the greatest

decrease in fusogenicity were the hydroxyl-containing residues and the proline near the N-

terminus of the MSD.

Incorporation Selection. To select for mutant glycoproteins that were

incorporated into viral particles, the starting library was transfected with expression

constructs for MLV packaging components and VSV-G. Our approach was to utilize a viral

ELISA (147) to identify MLV Env mutants that were incorporated into viral particles.

Briefly, an ELISA plate adsorbed with anti-GFP antibody was used to immobilize virus

that had incorporated GFP-tagged MLV Env mutants. Importantly, viral particles were also

pseudotyped with VSV-G, allowing for the transduction of 293FT cells that were overlaid

on the immobilized virus. This approach generated a selectable cell population that could

84

be used for the extraction of the mutant region, which was subsequently amplified using

PCR and deep sequenced. Wildtype sequence had an enrichment of ~2.0, while sequences

with a stop codon preceding the MSD had an enrichment value of 0.2. Consistent with the

previous selections, introduction of stop codons in this region resulted in sequence

depletion in the selected population, validating the selection.

Analysis of the selected incorporation population revealed that mutations resulting

in the greatest reduction of Env incorporation clustered within the MSD and in two

segments in the MPER from W127-E129 and R134-W137.

NGS analyses identify regions in Env important for incorporation. Our

selection strategy allowed for correlation of mutant fitness across multiple biological

selections. The most informative mutants would retain fusogenic activity (suggesting the

mutation was not detrimental to overall protein folding, surface expression, or

processivity), abrogate infectivity (suggesting the mutant was not incorporated into viral

particles), and exhibit decreased incorporation into viral particles. We hypothesized that

by filter removing mutant sequences from our analysis that did not fulfill these criteria, we

would reliably identify residues in Env important for incorporation. We focused on

substitutions with the lowest functional fitness indices, and then overlaid the fitness indices

from the incorporation and fusion selections at those positions, respectively (Figure 3.3).

This identified two regions where substitutions that fulfilled all three criteria clustered: 3

amino acids from W127-E129 and 46 amino acids from P136-I162. Importantly, these

results correlated well with the results for the maximal sensitivity value from the

incorporation selection (Figure 3.3, top).

85

Characterizing mutants that displayed striking phenotypes based on NGS

analysis. We selected 14 substitutions that covered a range of performances based on the

NGS analysis in Figure 3. Our aim was to identify substitutions from both regions (W127-

E129 and P136-I162) that were incorporation defective, but to also validate that this

method of data analysis remained accurate. Initially, point mutants were transiently

expressed in 293FT cells and assayed for their ability to promote viral infectivity. We have

previously reported that the length of the CT can impact infectivity and influence Env

incorporation into MLV particles (73). With this in mind, we wanted to assess the ability

of the mutants to promote viral infectivity in both the presence and absence (Δ25 CT) of

the full-length cytoplasmic tail (Figure 3.4). Addition of the full-length cytoplasmic tail

had a minimal impact on infectivity for all of the candidates except for T139A.

Surprisingly, the presence of the full-length cytoplasmic tail resulted in a dramatic

restoration of infectivity for this particular point mutant (Figure 3.4).

In general, these single-round infectivity data largely recapitulated the results from

the functional biological selection; however, two of the point mutants, W127R and I142R,

displayed an opposite phenotype when compared to the functional NGS analysis (Figure

3.2 and Figure 3.3). Based on our analysis from Figure 3.3, we reasoned that perhaps these

point mutants were defective for incorporation yet retained fusogenic activity, but because

of high expression levels at the cell surface, they were non-specifically incorporated into

viral particles. To test this hypothesis, we generated 293FT cell lines that stably expressed

the indicated point mutation and assayed their ability to promote viral infectivity (Figure

3.5A). As we expected, W127R and I142R displayed abrogated infectivity, suggesting that

these mutants were likely defective for their ability to incorporate into viral particles.

86

As discussed previously, mutants that disassociate incorporation from fusogenic

activity would display abrogated infectivity. Because we identified several mutants from

our NGS analyses that displayed decreased infectivity, we tested whether any of these

mutants still retained fusogenic activity. Since these mutants have a truncated cytoplasmic

tail, they remain constitutively active and could be tested for fusogenic activity. Briefly,

each cell line stably expressing the indicated Env mutant was transfected with a tet-off

expression construct and was co-cultured with an equal number of 293T mCAT-1 cells

expressing TRE-driven Gaussia luciferase (Gluc) (102). If the Env mutants retain

fusogenic activity, the transfected cells fuse with the receptor-expressing cells induction of

Gluc. occurs in a tet-off dependent manner. Gluc. induction can then be correlated between

mutant Env and wild-type Δ25CT controls to assess fusogenic activity (Figure 3.5B). It is

important to note that the fusogenic activity of these mutants generally reproduced the

trends found in the NGS analysis for the fusion selection (Figure 3.2B). Interestingly, we

identified three point mutations, W127R, W137L, and I142R, that displayed fusogenic

activity but had abrogated infectivity, suggesting that these mutants might be defective for

incorporation into viral particles. To ensure all mutants were similarly on the cell surface

compared to wild-type Δ25CT, stable cell lines were surface labelled and analyzed using

flow cytometry. As depicted in Figure 3.5C, there were no significant differences observed

between the surface expressions of the mutants compared to controls.

Identification of mutants defective for incorporation into viral particles. Next,

we wanted to test whether any of our candidate mutants were defective for incorporation

into viral particles. However, Figures 3.4 and 3.5 show that viral protein expression levels

have a significant effect on mutant Env phenotypes. Therefore, we stably expressed HIV

87

GagPol in the cell lines that also stably expressed the Env mutants. To ensure that the MLV

Env mutants behaved similarly when using HIV cores compared to MLV cores, we

transfected the stable Env cell lines with 500 ng of either HIV or MLV GagPol expression

constructs (Supp. Figure 3.S1A). The results show no discernable difference in infectivity

between HIV and MLV cores. Thus, creating a stable cell line expressing both Env and

HIV GagPol can reproduce previously observed phenotypes. To confirm that cells stably

expressing both Env and HIV GagPol were producing viral particles, media was collected

and used to transduce 293T mCAT-1 cells (Figure 3.S1B). The infectivity results shown in

Figure 3.S1B closely resembled previous infectivity data shown in Figures 3.5A and Figure

S.1A.

After verifying that these cells were producing infectious particles, we collected

viral supernatants and cell lysates to assess mutant Env incorporation into viral particles

via western blotting. In the case of W127R, W137L, and I142R there was a significant

reduction in the amount of gp70 present in viral particles (Figure 3.6A, Virus). MLV Env

is produced as a gp85 precursor protein and is processed by a cellular protease into gp70

(SU) and p15E (TM) (148). Analysis of cell lysates revealed that the reduction of gp70 in

viral pellets for W127R, W137L, and I142R was not due to a reduction of processed gp70

(Figure 3.6A, Cell). To verify that these mutants had a reproducible reduction of

incorporation into viral particles, several independent Western Blots were quantified and

the results are shown in Figure 6B. These data indicate that all three mutants reproducibly

display severely reduced incorporation into viral particles.

.

88

3.5 Conclusions

We have previously shown that MLV Env is actively recruited to HIV-1 assembly

sites (77) and that the CTD is dispensable for this mechanism (73). Additionally, further

studies to probe the hydrophobicity of the MSD as a protein component necessary for

active recruitment have shown no correlation between hydrophobic index and

incorporation (102). Attempts to characterize the domains in gag necessary to facilitate

active incorporation have also been obscure. Interestingly, the MA domain of gag is not

required for active Env recruitment to assembly sites (74). Studies to identify host-cellular

factors that influence glycoprotein recruitment to viral assembly sites have indicated that

membrane composition is a crucial determinant for infectivity and fusogenicity (96, 137-

140, 143). For HIV-1 Env, these studies indicate that the MPER retains critical protein

determinants necessary for Env fusogenicity. Here, we evaluated the role of MPER and

MSD of MLV Env for facilitating pseudotyping into HIV-1 particles.

Identification of residues in the MSD crucial for infectivity and fusogenicity.

We provide evidence that the MSD of MLV Env contributes to fusogenicity. Introducing

specific amino acid substitutions at positions T139, T140, S143, and P148 reduced both

infectivity (over 95% decrease) and fusogenicity (70-98% decrease) (Figures 3.3 and 3.4).

Position T144 had a similar effect, displaying decreased infectivity (90% decrease) and

moderately decreased fusogenicity (40% decrease). In the case of P148, it is possible that

this residue, in combination with glycine at position 147, forms a molecular hinge that

allows for a conformational change within the TM stalk during activation of the fusion

mechanism (97, 110, 115, 116, 149). Recent cryo-electron microscopy imaging data

89

indicates that the CTD of MLV Env holds the ectodomain in a tight conformation;

however, cleavage of the R-peptide results in a conformational rearrangement in TM

wherein the trimer helices are splayed apart, allowing for fusogenic activation of Env (90).

It is possible that the glycine-proline pair (residues 147 and 148) at the N-terminus of the

MSD facilitates the molecular reordering of TM during this process. The hydroxyl-

containing residues located in the same region (T139, T140, S143, and T144) may also

contribute to this mechanism by creating a hydrogen-bonding network that potentially

stabilizes the TM trimer (109-111, 149-151). It is possible that these residues form

hydrogen bonds inter-helically within the trimer, resulting in stabilization of the TM

domain. This stabilization may allow for the conformational change necessary for

transmitting the signal of R-peptide cleavage up the TM stalk. It could also be that these

hydrogen-bonds aide in orientation of the monomers within the trimer, establishing a

helical interface (112, 117, 152, 153). Importantly, mean surface fluorescence and protein

blotting analysis indicate that processivity and trafficking of these mutants are not

impaired, supporting the idea that the loss of infectivity is due to the loss of the fusogenicity

and not due to an overall gross defect in protein folding (Figures 3.4 and 3.5).

Identification of residues in the MPER and MSD that affect Env pseudotyping.

Substitutions W127R, W137L, and I142R were defective for infectivity but remained

fusogenically active (Figure 3.5). This suggested that these mutations would display

reduced incorporation into viral particles, which would be consistent with the analyses in

Figure 3.3. Protein blotting analysis showed that mutants W127R, W137L, and I142R had

significantly decreased gp70 incorporation into viral particles (Figure 3.5A and 3.5B), but

accumulated to wild-type levels in cell lysates (Figure 3.5, lysate). As shown in Figures

90

1A and 3, a majority of the MPER in our target region is predicted to be unstructured,

except for a short helical stretch from positions F128-L131. Perhaps this region folds

towards the membrane and interacts with specific lipids that cluster at the viral assembly

site once Gag begins to multimerizes. If this were the case, this region, along with the

region from P136-I162, could act in concert to direct Env trimers to the assembly site

through interactions with the lipid environment. Both of these regions are primarily

hydrophobic, and two of the residues that we directly tested and demonstrated as

incorporation defective were tryptophan residues. Studies performed on the MPER of HIV-

1 Env, show that the tryptophan residues in this region play a crucial role in Env

functionality through direct interactions with cholesterol molecules that cluster at the

assembly site. Further, it has been shown that a molecular hinge region in the MPER of

HIV-1 Env consists of a pair of molecular helices that immerse themselves in the lipid

environment (93). Therefore, it is reasonable to suggest that the tryptophan residues that

we identified could engage in similar molecular interactions. Taken together, our data

suggest that the MSD has a role in MLV Env fusogenicity, and that two regions from

positions W127-E129 and P136-I162 are important for Env incorporation into assembling

viral particles.

Our selection strategy can be applied to other targets under diverse selection

pressures. It will be particularly valuable in minimizing difficulties associated with

targets highly sensitive to traditional mutagenesis, such as the viral capsid protein.

Coupling next-generation sequencing technologies with in vivo selection allows

generating large data sets capable of sampling entire selected populations, providing

insight into previously unidentified features of viral protein biology.

91

Figure 3.1: Target region of mutagenesis and selection strategy.

(A) Diagram of the region in MLV Env targeted by random mutagenesis. The 50 amino

acid cassette depicted above was randomly mutagenized at a rate of three percent,

correlating to an average of 4.5 nucleotide mutations per individual Env mutant. The

sequence upstream of the target cassette was maintained as wild-type sequence, while the

cytoplasmic-tail has a truncation removing 25 amino acids if the cytoplasmic tail. (B)

Strategy used for creating the stable mutant cell population and in vivo selection

procedures.

92


93

Figure 3.2: NGS selection analysis.

Blue indicates a non-synonymous substitution at the indicated position was detrimental to

the specific selection while gold indicates the substitution had no effect. The panel

indicated as stop depicts the location of randomly introduced stop codons for each of the

libraries. Maximal sensitivity displays the lowest fitness index for each position within the

indicated library. (A) Analyzed NGS results from the large-scale infectivity selection. (B)

Analyzed NGS results from the large-scale cell-to-cell fusion selection. (C) Analyzed NGS

results from the large-scale incorporation selection.

94

Figure 3.2: NGS selection analysis.

95


Env incorporation.

Depicted are substitutions that were defective for incorporation and function but not

fusion. NGS results were first filtered for the substitutions that were most detrimental to

infectivity. The incorporation and fusion fitness indices were then plotted for each of

those functionally defective substitutions. The incorporation fitness index is shown fist

and the fusion index is shown second for each of the substitutions above. The dashed line

represents the locations with the largest concentration of substitutions that resulted in

fulfillment of the aforementioned criteria. The predicted secondary structure is shown

above the heat map with the maximal fitness values from the incorporation selection

shown above that. Blue indicates that a substitution was detrimental to the selection while

gold indicates no effect

96


Env incorporation.

97

Figure 3.4: Effect of C-terminal tail on infectivity of 14 selected mutants.

Infectivity results from 293FT cells transfected with 500 ng of the indicated Env mutant

and 500 ng of MLV GagPol expression plasmids. Filled bars represent Envs with the full-

length tail and open bars indicated Envs with a truncated cytoplasmic tail. Infectivity is

shown relative to the appropriate wild-type (WT) control. Data is a composite from three

independent experiments.

98

Figure 3.4: Addition of the full-length cytoplasmic tail has a minimal effect on

mutant env functionality.

99


abrogated infectivity but not fusogenicity or cell surface expression.

(A) 293FT cell lines stably expressing the indicted point mutant were transfected with

MLV GagPol and a MLV-CMV-GFP genome and assayed for infectivity. Infectivity is

shown relative to WT Δ25CT Env. (B) 293FT cell lines stably expressing the indicated

point mutant were assayed for cell-to-cell fusion activity. Cell lines were transfected with

a tet-off expression plasmid and co-cultured with a permissive cell line expressing a

Gaussia luciferase reporter. Luminescence output is depicted as percent relative to WT

Δ25CT Env. 293FT cells not expressing MLV Env were transfected with the tet-off

expression plasmid and were included in the cell-to-cell fusion assay as a negative control

(Env (-)). (C) Surface expression of Env point mutants. Cells stably expressing the

indicated Env mutant were surface labeled using an anti-GFP Alexa-Fluor 647 antibody

and analyzed via flow cytometry. Mean fluorescent intensify is shown relative to WT

Δ25CT Env. 293FT cells not expressing MLV Env were included as a negative control in

the labeling process and are indicated as Env (-). Data shown for all three figure panels are

the average of three independent experimental replicates.

100


abrogated infectivity but not fusogenicity or cell surface expression.

101


display severely abrogated incorporation into HIV particles.

(A) (Top) Immnoblot analysis of HIV particles pseudotyped with the indicated MLV Env

point mutant. Particles were collected from supernatants of 293FT cells stably expressing

HIV GagPol and the indicated Env mutant. (Bottom) Immunoblot analysis of cell lysates

stably expressing both HIV GagPol and the indicated MLV Env point mutant. (B)

Immunoblot quantification of four independent replicates of Env incorporation into HIV

particles. Particles were isolated from supernatants of cells stably expressing HIV GagPol

and the indicated Env mutant. The gp70 signal was normalized to the corresponding capsid

p24 band and are shown as the average of all four experiments relative to the WT Δ25CT

normalized signal. Data shown here are representative of at least three independent

experiments

102


display severely abrogated incorporation into HIV particles.

103

Figure 3.S1: Mutant Env infectivity is similar between MLV and HIV cores.

(A) Stable cell lines expressing the indicated Env mutant were transfected with either

MLV (Open Bars) or HIV (Grey Bars) cores and infectivity was assessed. Infectivity is

shown relative to WT Δ25CT controls of the appropriate core. (B) Infectivity output from

cells stably expressing the indicated Env mutant and HIV GagPol. Infectivity shown

relative to WT Δ25CT controls. Data shown in both figure panels are the average of three

independent replicates.

104

Figure 3.S1: Mutant Env infectivity is similar between MLV and HIV cores.

105

4. PROBING THE MEMBRANE PROXIMAL EXTERNAL

REGION AND MEMBRANE-SPANNING DOMAINS OF

HIV-1 ENVELOPE FOR A ROLE IN GLYCOPROTEIN

INCORPORATION AND FUNCTION

106

4.1 Summary

Enveloped viruses utilize transmembrane surface glycoproteins to mediate fusion

between viral and host cell membranes. However, the acquisition of these glycoproteins

into assembling viral particles is not well understood. Molecular studies on the MPER and

MSD have partially defined the roles of these regions in infectivity and fusogenicity, but

are deficient regarding protein determinants necessary for incorporation. Here, we created

a cell library (approximately 6x104 unique mutants) stably expressing a replication

competent NL4-3 derived proviral construct with mutagenized HIV-1 Env. The MPER and

MSD of HIV-1 Env were targeted for random mutagenesis at a rate of 3%, which correlates

to approximately 3 nucleotide mutations per glycoprotein. The cell library will be

independently selected for mutant Envs that are able to promote infectivity and are

incorporated into viral particles. These selected populations will be subjected to NGS

analysis and compared to the starting population to determine which mutants were not

capable of fulfilling selection.

107

4.2 Body

For HIV-1 Env, it has been demonstrated that a molecular hinge region in the

MPER, consisting of a pair of structurally conserved helices that immerse themselves in

the lipid environment, play a crucial role in fusogenicity (93). Disruption of this region

through mutational analysis, or through application of neutralizing antibodies, which are

predicted to disrupt the hinge region’s ability to interact with the lipid environment,

abrogates fusogenicity (93, 154, 155). The MPER also contains a tryptophan-rich region

that has been shown to interact with cholesterol molecules (137, 139, 142). Deletions,

insertions, or substitutions within this tryptophan rich region abrogated the ability of HIV-

1 Env to facilitate membrane fusion, but maintained normal processivity and trafficking

(95). It has been proposed that the tryptophan-rich region in HIV-1 Env destabilized the

HIV-1 envelope allowing promotion of membrane fusion and it has been shown that

depletion of cholesterol in target cell membranes, in specific cell types, reduced their

susceptibility to membrane fusion by HIV-1 Env (96, 138, 156). It has further been

postulated that the tryptophan-rich region induces formation of these cholesterol-

containing lipid environments (140, 141, 157). The MSD has also been implicated in

promoting fusogenicity. Substitutions in the core of the MSD, or chimeric mutants that

exchange the HIV-1 Env MSD with another viral glycoproteins MSD, result in a

fusogenically inactive Env (91, 92, 158). Interestingly, none of these studies implicates the

MPER or MSD of HIV-1 Env as being important for glycoprotein incorporation into

assembling particles. One study demonstrated that the tryptophan-rich region of HIV-1 Env

is important for lateral sorting and oligomerization of HIV-1 Env (143).

108

Here, we randomly mutagenized the MPER and MSD of HIV-1 Env to identify any

amino acids or motifs necessary for Env incorporation into viral particles, as well as to

further define their roles in promoting infectivity. We targeted 36 residues in this region

for random mutagenesis (Figure 4.1A). To accomplish this, we assembled oligonucleotide

primers with a mutation rate of 3%, which correlates to approximately 3 nucleotide

mutations per amplicon. These amplicons were cloned into a NL4-3 derived proviral

plasmid defective for Vif, Vpr, and Nef. In the place of Nef, a blasticidin resistance gene

driven by a CMV promoter was introduced. Our goal was to create a large cell library

stably expressing these proviral constructs with mutagenized HIV-1 Env. We would then

collect viral particles released into the supernatant and test them for mutants that could still

promote infectivity, and determine which mutants were still incorporated into viral

particles. After selecting these libraries, we would submit the samples for next generation

sequencing to identify mutants that could, or could not, fulfill selection (Figure 4.1B).

The advantage of this approach is that the NL4-3 derived provirus is replication

competent, therefore, the first round of mutant Envs that were selected for infectivity can

be continually passaged to determine how the library changes over time. Additionally,

different target cell types can be used to determine whether the selected population changes

due to cell type specificity. This can be done for the initial infectivity selection, or, become

part of the study for passaging the library over time.

For this study, the mutagenized HIV-1 Env assembled amplicons were cloned into

the NL4-3 derived proviral plasmid and subjected to 2 x 150 nt paired-end Illumina MiSeq

analysis. The resulting NGS analysis was filtered based on sequence read representation in

the plasmid population (< 3 reads per million were filter removed from the population),

109

and the substitutions were cataloged based on position within the target region (Figure 4.2).

293FT cells were transfected with the mutagenized NL4-3 derived plasmid library along

with MLV Env and viral supernatant was collected. These viral particles were used to

infect 293T mCAT-1 cells, which are permissive to viral particles that contain MLV Env.

Once the cells had been infected with the pseudotyped lentiviral library, the cells were

treated with blasticidin. Any cells not infected with the viral particles are then removed

from the population, resulting in a pure cell population expressing the NL4-3 derived

genome. The following future directions section will outline the experiments that will be

performed to utilize the mutagenic cell library to accomplish the goals of this study.

110

4.3 Future Directions

1.) Identify mutants that survive a single round of infectivity. This selection is

simple. Because the proviral construct is replication competent, the stable cell

library will continuously produce virus that can be collected and used to infect

permissive cell lines. A limitation of the cell type selection is that the provirus is

defective for Vif and Nef, so cell type selection will play a role because of host cell

restriction factors. To ensure a single round of infection, a reverse transcription

inhibitor would be used to inhibit spread of the selected virus. Once these have

been addressed, the cells can be selected with blasticidin and prepared for NGS

analysis.

2.) Identify mutants that are still incorporated into viral particles. The stable cell

library would be transfected with Rous Sarcoma Virus (RSV) Env ΔCTD. This

glycoprotein would co-package with the HIV-1 Env mutants into the viral

particles. The viral supernatant would then be used in a viral ELISA based assay

to determine which mutant HIV-1 Envs are still incorporated into viral particles.

Briefly, anti-HIV antibodies would be adsorbed to an ELISA plate so that any

virions that contain a mutant HIV-1 Env would be immobilized. Because RSV Env

ΔCTD pseudotypes into HIV particles, it would be present in the virion as well.

Therefore, a RSV Env permissive cell line can be overlaid onto the virus and the

cells become infected. After selection, the cells can be prepared for NGS analysis

and mutant HIV-1 Envs that could, and importantly, could not fulfill selection can

be identified.

111

3.) Passaging the library on permissive cell lines. This experiment will collect virus

produced by the primary cell library and use it to infect a permissive cell line. Once

that line is infected and selected with blasticidin to select a pure population and

inhibit super infection, it will begin to produce replication competent virus. The

viral particles produced by the primary selected population can then be used to

infect another round of permissive cells. Repeating this cycle will assess how the

functional mutant population changes over time. Each round, as well as the starting

population, can be deep sequenced and analyzed to identify global, and local,

changes in the population.

4.) Identify mutants that can and cannot fulfill selection. Once the library has been

selected for both initial and passaged function and incorporation, the NGS results

will be analyzed to identify interesting residues or motifs. Once candidate

substitutions have been identified, they would then be cloned into expression

vectors and tested to ensure reproducibility. Single round infectivity assays and

western blotting of viral particles and cell lysates to assess incorporation would be

used to test mutant glycoproteins. One important modification would be that,

ideally, mutants would be cloned into a replication incompetent provirus, which

makes these experiments much safer and easier to perform.

112


(A) Diagram of the region in HIV Env targeted by random mutagenesis. The 36 amino acid

cassette depicted above was randomly mutagenized at a rate of three percent, correlating

to an average of 3 nucleotide mutations per individual Env mutant. The sequence upstream,

and downstream, of the target cassette was maintained as wild-type sequence. The

mutagenesis was performed in the presence of the full-length cytoplasmic tail (B) Strategy

used for creating the stable mutant cell population and in vivo selection procedures. The

NL4-3 derived construct is depicted with the indicated accessory genes deleted. Nef has

been replaced with a blasticidin resistance gene driven by a CMV promoter. The red

asterisk indicates the location of the mutations in HIV Env.

113


114

Figure 4.2: Mutational landscape of the doped HIV-1 Env plasmid library

Depiction of the introduced substitutions at each position within the HIV Env target

cassette. Filled (Grey) boxes indicate the presence of that specific substitution in the HIV

Env doped plasmid library. Depicted above are the locations of randomly introduced stop

codons within the target cassette.

115

Figure 4.2: Mutational landscape of the doped HIV-1 Env plasmid library

116

5. SUMMARY AND DISCUSSION

117

Retroviruses readily form pseudotyped particles with a diverse panel of viral glycoproteins

from similar and unrelated families (73, 77). This phenomenon has been exploited by

researchers from various fields for manipulation of retroviral vectors to target specific cell

types. Lentiviral vectors can infect both dividing and non-dividing cells and therefore, are

appealing for use in gene therapy. One limitation, however, is that very little is known

about the pseudotyping mechanism. If we can gain insight into the molecular mechanism

of this process, then potentially non-viral surface proteins could be engineered to

incorporate into viral particles. This could greatly broaden the range of cell types that could

be specifically targeted by lentiviral gene delivery vectors. My work has shown that the

MSD of MLV Env has critical protein components necessary for fusogenicity and that the

MPER and MSD both contribute to MLV Env incorporation into viral particles.

Previous work showed that insertion of a leucine residue in the MSD of MLV Env

resulted in a non-functional glycoprotein, while insertions of 3 leucine residues restored

function. Suspecting that this observation had to do with alignment of interfaces within the

ectodomain and CTD of the trimer, mutational analyses were performed to identify the

boundaries of these potential interfaces. This approach lead to the identification of the

boundaries of these potential interfaces and also indicated that fusogenicity is greatly

influences by the hydroxyl-containing residues at the N-terminus of the MSD. Further

study revealed that these residues may be part of a SxxxTTxxS motif previously observed

to influence oligomerization of membrane helices (109). Interestingly, other gamma-

retroviral glycoproteins such as FLV and GaLV Env also have this serine/threonine

clustering. The same motif can also be found in VSV-G and in many different strains of

the influenza virus, both A and B. Interestingly, these glycoproteins all have a mechanism

118

to negatively regulate fusogenic activity. In the case of the gamma-retroviruses, that is

achieved by the presence of the R-peptide at the end of the CTD. In the case of VSV-G and

Influenza glycoproteins, fusogenicity is regulated by the pH of the surrounding

environment. It is plausible that this motif has an evolutionary advantage to aide in

regulation fusogenic activity.

To better understand the protein determinants in MLV Env dictate pseudotyping,

we randomly mutagenized the MPER and MSD to identify residues or motifs necessary

for incorporation. Previously, our lab established that the CTD is dispensable for this

recruitment, seeing as in the complete absence of the CTD Env is still actively recruited to

HIV-1 assembly sites (73). Because of this, we hypothesized that the driving force for

recruitment was located in the MPER and MSD. Our large scale biological selection study

revealed that two regions in the MPER and MSD showed increased sensitivity to mutation

and were predicted to be crucial for Env incorporation into viral particles. After directly

testing mutants identified in our screen, we demonstrated that W167R, W137L, and I142R

were incorporation defective. The phenotypes of all three of these substitutions matched

our NGS analysis and correlate with both regions that we identified. We hypothesize that

these regions interact with the lipid environment during viral assembly. It is plausible that

the multimerization of Gag creates a specific lipid environment that interacts with these

two domains in Env, thus resulting in active incorporation.

119

6. FUTURE DIRECTIONS

120

The body of work described in this dissertation provides a basis for further studies. With

the creation of distinct cell libraries that stably express both MLV and HIV Env mutants,

we are in possession of unique tools that can be used to understand multiple facets of Env

biology. In addition, each biological selection performed from either the MLV or HIV

starting library can be maintained and put under another type of selective pressure as the

need arises. Importantly, this methodology can be applied to various targets under diverse

selection pressures. This is particularly useful for manipulating proteins sensitive to

traditional mutagenesis, such as capsid, or in defining protein-protein interfaces, such as

between Vif and the host cell restriction factor APOBEC.

It will be interesting to determine if HIV-1 Env incorporation follows a similar

mechanism that we have discovered for MLV Env. Selection of the HIV-1 Env

mutagenized library for glycoproteins that are unable to incorporate into viral particles will

shed some light on this mechanism. It has been shown that there are short helical segments

in the HIV-1 MPER that fold towards the lipid membrane and interact with membrane

lipids. Although these studies did not define a role for this region in Env incorporation, it

may be that the MSD is also involved in this process and that by leaving it intact it can

compensate for the loss of the MPER hinge region. Our study will provide an answer for

this hypothesis, and hopefully will determine if these regions are important for

incorporation.

If it is determined that the recruitment mechanism is similar between MLV and

HIV it would be useful to attempt and apply this to glycoproteins known to be incompatible

for pseudotyping, such as full length RSV Env. Or, to apply these findings to host cell

proteins in an effort to induce incorporation into assembling viral particles. Progress in this

121

area will bring retroviral based gene therapy one step closer to achieving the goal of being

able to target any desired cell type will minimal off target effects. With these hopes for

future applications, this dissertation is, thus, concluded.

122

APPENDIX

123

I. RECOMBINATION CAN LEAD TO SPURIOUS RESULTS IN RETROVIRAL

TRANSDUCTION WITH DUAL FLUORESCENT REPORTER GENES

I.I Summary

Fluorescent proteins are routinely employed as reporters in retroviral vectors. Here,

we demonstrate that transduction with retroviral vectors carrying a tandem-dimer Tomato

(TdTom) reporter produces two distinct fluorescent cell populations following template

jumping due to a single nucleotide polymorphism between the first and second Tomato

genes. Template jumping also occurs between repeated sequences in the Tomato and green

fluorescent protein (GFP) genes. Thus proper interpretation of the fluorescence intensity

of transduced cells requires caution.

I.II Body

Fluorescent reporter proteins are frequently used in retroviral vectors for

identifying transduced cells (159-162). The fluorescent proteins green fluorescent protein

(GFP) and tandem-dimer tomato (TdTomato) are particularly useful because they are very

amenable to detection by flow cytometry. These two proteins are derivatives of genes

acquired from organisms of the genera Aequorea (163) and Discosoma but as a

consequence of its development as a molecular tool, TdTomato (as well as many other

fluorescent proteins) contains short segments of GFP sequence at its N- and C- terminus

(164-166). We have observed that transduction of cells with retroviral vectors containing

TdTomato results in two distinct populations with either bright or dim fluorescent

intensities, as detected by fluorescent light microscopy (Fig. 1A) and flow cytometry (Fig

124

1B). This phenomenon was observed using both gammaretroviral and lentiviral vectors

and was not dependent on the MOI of transduction (data not shown).

Retroviral recombination occurs during reverse-transcription of the retroviral

genome due to template-switching at stretches of homologous nucleotide sequence (167,

168). Recombination also occurs frequently in retroviral vectors containing short stretches

of repeated nucleotide sequences (169-172), such as the repeated sequences at the N- and

C- termini of TdTomato. To determine if the bimodal distribution of the distinct fluorescent

populations arose from one of the copies of Tomato being deleted due to template jumping,

we generated a retroviral vector with only the first copy of the Tomato gene (Fig. 1C). This

construct produced a single population of transduced cells (Fig. 1C and 1D), which was

distinctly brighter than the dim population produce from the TdTomato vectors depicted in

Fig. 1A. Thus, the dim fluorescent population did not appear to arise simply from the

deletion of one copy of the TdTomato gene as a result of recombination.

We next wished to determine if the dim Tomato fluorescent population resulted

from alterations in the Tomato gene itself, or alternatively from variations in Tomato

mRNA expression. To address this, we generated a TdTomato vector that also expressed

GFP from the downstream internal ribosomal entry site (IRES) in place of the puromycin

resistance gene (Fig. 2A). If the dim Tomato fluorescence resulted from alterations in the

Tomato gene itself, we expected the dim Tomato expressing cells to display normal GFP

expression levels (Fig. 2A, left panel). If the dim Tomato fluorescence resulted from

differences in mRNA expression, we expected the dim Tomato expressing cells to also

express dim GFP (Fig. 2A, center panel). Surprisingly, we did not observe dominant cell

populations of either of these phenotypes, but instead observed various fluorescent

125

populations with various combinations of Tomato and GFP fluorescence, including cells

expressing only GFP and cells expressing only Tomato (Fig. 2A, right panel). To

determine the nature of these single fluorescent populations, we sorted the fluorescent

green-only and red-only cells by flow cytometry, and then recovered the reporter sequences

by PCR and sequenced them. The results showed that differential fluorescent populations

resulted from template jumping between various locations in the vector where short

stretches of homologous sequence were present (Fig. 2B-E). Notably, template jumping

occurred between the short identical sequences at both the N-terminal and C-terminal

sequences in GFP and Tomato (Fig. 2C-E). This result implies that template jumping is

very prevalent in this system, as might be expected from the principles of viral reverse

transcription, but fails to fully explain the nature of the dim fluorescent Tomato population.

To determine the cause of the bright and dim Tomato fluorescent populations, we

performed single cell isolations of bright and dim red fluorescent cells by limiting dilution

(Fig 3A). It is well established that retroviral integration often occurs near regions of

chromatin associated with active transcription (173-177). To rule out genomic integration

as a contributing factor for the differential fluorescent intensity observed in Fig. 1A, we

analyzed bright and dim fluorescent single-cell isolates for TdTomato integration position

within the genome. Genomic DNA was extracted from the six populations and integration

locations were determined using the genome walker technique (Clontech) for five of these

populations. No obvious correlation was observed between integration site and gene

brightness (Fig. 3B). Next, we recovered the Tomato sequence of the bright and dim

populations to assess any alterations in the Tomato gene. All three of the dim Tomato

populations expressed a single copy of Tomato, and notably, in each case it was the second

126

copy of the Tomato gene (Fig. 3B). Some versions of the TdTomato gene have a single

nucleotide polymorphism in which an adenine is substituted with a guanine, subsequently

resulting in a histidine to arginine mutation within the second Tomato gene (Fig. 3C). This

polymorphism arose from a PCR mutation during the creation of TdTomato but was

initially overlooked because it did not appear to alter the phenotype of Tomato (N. Sharer,

Personal communication).

To confirm that the polymorphism was responsible for the Tomato dimness, we

generated a retroviral vector with only the second copy of Tomato (Fig. 4E). This construct

indeed produced dim red transduced cells (Fig. 4F). A parallel vector that expressed

TdTomato without the polymorphism did not change the brightness of Tomato, suggesting

that the polymorphism is detrimental only if expressed alone (Fig. 4G and 4H). Finally,

because sequence homology directly influences retroviral recombination (171, 178), we

also tested if the dim red population could be eliminating by reducing the sequence

homology between the two copies of Tomato. To accomplish this, we produced a

TdTomato gene where the codons in the first copy of Tomato were changed so that the

amino acid sequence was not changed, but the nucleotide homology with the second copy

of Tomato was dramatically reduced (Fig. 4I and 4J). This vector produced only bright red

cells.

In summary, we have shown that retroviral recombination among and between

fluorescent genes can lead to spurious phenotypes. Although template jumping is a well-

known phenomenon in retroviruses and retroviral vectors, short stretches of sequence

homology such as those found in fluorescent proteins are not always taken into

consideration when vectors are designed. Lack of attention to possible template jumping

127

could lead to misinterpretation of results, particularly when multiple reporters are used to

study retroviral phenomenon such as latency (179, 180). This potential problem can be

prevented by eliminating all repeated sequence, for example by scrambling the codon

sequence in the regions where amino acid sequences are repeated (Fig. 4J).

128


resulted in two cellular populations with distinct fluorescent intensities.

(A and B) TdTomato was cloned into the Murine Leukemia Virus (MLV) transfer vector

pQCXIP (Clontech) and used to generate non-clonal stable cell lines form HEK 293FT

cells. (A) Fluorescent images of the stable cell line transduced with TdTomato, white

arrows highlight bright (top) and dim (bottom) cells. (B) Total cell populations depicted in

(A) were analyzed using flow cytometry to confirm the presence of two distinct fluorescent

populations. (C and D) Parallel analysis of cells expressing a monomeric Tomato gene.

129


resulted in two cellular populations with distinct fluorescent intensities.

130


(A) Schematic of double-labeled reporter. The left and center flow plot panels depict

expected distributions of transduced cells if dimness was due to a transcriptional defect or

a gene specific defect, respectively. The right flow panel depicts observed flow cytometry

results following transduction of HEK 293FT cells. (B-E) Red-only and green-only cells

were sorted by flow cytometry. DNA was extracted from sorted cells and the region

between the CMV promoter and the end of GFP was PCR amplified and sequenced.

Control PRCs were performed on the parent plasmid to ensure the observed changes were

not caused by PCR. Template jumping observed within populations of green-only (B and

C) and red-only (D and E) populations are shown. Underlined regions indicate areas of

homologous nucleotide sequence.

131


132


sites.

(A) Cell pellets of bright and dim fluorescent single-cell isolated from HEK 293FT cells

transduced with MLV carrying the TdTom reporter. Cells transduced with the tandem-

dimer tomato (TdTom) and monomeric-tomato (mTom) reporters are included for

reference, along with non-transduced HEK 293FT cells (-). (B) Genomic DNA from bright

and dim fluorescent single-cell isolates, depicted in (A), was extracted and analyzed to

determine genomic integration sites and Tomato gene alteration. (C) Schematic

representation of the nucleotide and corresponding amino acid polymorphism between the

first and second Tomato gene within the TdTomato reporter.

133


sites.

134

Figure I.IV: Bimodal fluorescence intensity of the TdTom reporter occurs as a

result of a single nucleotide polymorphism between the TdTom genes.

(A-J) HEK 293FT cells were infected with MLV carrying the modified retroviral Tomato

reporters depicted in the left column. Resulting cell populations were analyzed by flow

cytometry to assess fluorescent cell populations and are depicted in histograms. Dashed

vertical lines in the right column highlight fluorescence intensity of the bright and dim

fluorescent cell populations present following transduction with virus carrying the

TdTomato reporter.

135

Figure I.IV: Bimodal fluorescence intensity of the TdTom reporter occurs as a result

of a single nucleotide polymorphism between the TdTom genes.

136

II. IMMUNE SIGNALING COMPETENCY IS REGULATED BY LIGAND-

INDUCED ENDOCYTOSIS AND SUBSEQUENT DE NOVO SYNTHESIS OF THE

FLAGELLIN-RECEPTOR FLS2

II.I Summary

FLAGELLIN-SENSING 2 (FLS2) is the plant cell surface receptor for the

perception of the bacterial pathogen-associated molecular pattern (PAMP) flagellin or

flg22 peptide. Flg22 recognition initiates immune signaling responses that contribute to

bacterial growth restriction. However, flg22 elicitation also leads to ligand-induced

endocytosis and degradation of FLS2 within 1 hour. Why plant cells remove an important

receptor precisely at the time during which its function is required remains mainly

unknown. To address this question, we assessed flg22- signaling competency of

endogenous FLS2 in the context of ligand-induced endocytic degradation of FLS2. Within

the first hour, cells were unable to re-elicit two independent flg22- signaling responses in

a ligand-, time- and dose-dependent manner. These experiments indicate that flg22-

induced degradation of FLS2 is a means to desensitize cells to stimuli, likely by removing

FLS2 receptors from the site of stimulus perception and to attenuate continuous flg22-

signaling. At later times (> 2hr) after flg22-treatment, de novo protein synthesis restored

signaling-competent FLS2 receptors, suggesting that new synthesis of FLS2 protein

functions in preparing cells for a new round of PAMP perception. Similar mechanisms

applied for regulating signaling competency of EF-TU receptor (EFR), an unrelated plant

PAMP receptor, in response to its bacterial ligand. Our study supports the hypothesis that

ligand-induced endocytic degradation of FLS2, and other defense-related perception

mechanisms, functions in preventing potential detrimental effects of prolonged immune

137

signaling on growth and development. Subsequent flg22-induced new synthesis of FLS2

restores receptor levels to enable cells to monitor its environment for the continued

presence of flg22-containing pathogens.

II.II Introduction

Eukaryotic host cell surface receptors are key components of innate immunity in

that they act as the first line of defense against invading microbial pathogens (181, 182).

These receptors detect extracellular pathogen-associated molecular patterns (PAMPs) as

“non-self” to alert host cells of these microbes. PAMP perception activates host immune

responses that ultimately contribute to cessation of microbial infection. In plants, the best

studied PAMP-triggered immunity (PTI) system is perception of bacterial flagellin or its

active peptide-derivative flg22 by FLAGELLINSENSING 2 (FLS2) (181, 183, 184). FLS2

is the plasma membrane (PM) localized receptor-like kinase (RLK) detecting apoplastic

flg22 through its extracellular leucine-rich repeat (LRR) domain (185, 186). Flg22

perception initiates downstream immune responses including production of reactive

oxygen species (ROS), activation of mitogen-activated protein kinases (MAPKs) and

transcriptional changes including up-regulation of FLS2 mRNA (183, 184), and these

responses fall into multiple parallel pathways rather than a single linear pathway (184, 187,

188). FLS2-induced responses are important for plant immunity as the absence of

functional FLS2 leads to impaired flg22-signaling and contributes to enhanced

susceptibility to bacterial infection (189). FLS2 is one of only few plant RLKs shown to

undergo ligand-induced endocytosis and subsequent degradation by mostly undefined

mechanism(s) (190-192). Based on a live cell imaging study (191), elicitation with active

138

flg22 (derived from Pseudomonas syringae; PF22), but not inactive flg22 (from

Agrobacterium tumefaciens; AF22) or elf26, a bacterial PAMP recognized by the plant

EF-TU receptor (EFR) (193), results in internalization and degradation of ectopically

expressed FLS2-tagged green fluorescent protein (FLS2-GFP). So far, only a limited

number of components are known to affect endocytosis and degradation of FLS2 (192,

194, 195). These observations lead to an apparent paradox whereby a functional FLS2 is

required for a full immune response, yet perception of the ligand removes FLS2 from the

cell surface at the time during which PAMP perception is required.

Constitutive activation of immune signaling diverts valuable resources from

growth and development to defense mechanisms, thus termination of PAMP-signaling

must be tightly controlled. Signal attenuation is likely achieved by diverse mechanisms

that include regulating activity or abundance of FLS2 itself and of components functioning

in PF22-signaling (192, 196-198). In animals, one of the established roles of ligand-

induced endocytosis is to down-regulate receptors from the site of perception to desensitize

cells to stimuli, thereby preventing continuous initiation of signaling (182, 199); but so far,

it is unclear whether this also holds true for Toll-Like Receptor 5 (TLR5), the mammalian

receptor of flagellin. In plants, ligand-induced endocytic degradation of RLKs has not been

formally investigated as a mode of regulating PAMP signaling (199, 200). Comparison

between endocytosis of FLS2 and another well-studied LRR-RLK, the brassinosteroid

receptor BRI1, highlights differences in endocytic regulation or mechanisms between plant

RLKs. FLS2 undergoes ligand-induced endocytic degradation that is relatively fast (~ 0.5

hr) (191) and requires functional BRI1-associated kinase BAK1 (192, 194). In contrast,

139

BRI1 is endocytosed constitutively and comparatively slow (> 5 hrs) in a ligand- and

BAK1-independent manner (201, 202).

To examine potential regulatory roles of ligand-induced down-regulation of FLS2

in PF22- signaling, we establish here re-elicitation assays to correlate FLS2 signaling

competency with receptor abundance. Our results indicate that PF22-induced degradation

of FLS2 serves as a means to desensitize cells to stimuli. In addition, subsequent PF22-

elicited de novo FLS2 protein synthesis prepares cells for a new round of PF22-perception.

Similar patterns of signaling competencies were observed in response to elf26, the

unrelated bacterial PAMP perceived by EFR (193), suggesting that such desensitization

mechanisms may be a conserved strategy for plant RLKs involved in PAMP perception.

II.III Experimental Procedures

Chemicals and PAMPs. Unless otherwise specified, all chemicals were from Fisher

Scientific (St. Louis, MO). Cyclohexamide (CHX; Sigma, St. Louis, MO) was used at a

final concentration of 50µM for Col0 leaves and 100µM for Ler seedlings at indicated

times. PAMP peptides (187) were made by GenScript (Scotch Plains, NJ) and used at

indicated concentrations and times.

Plant Material and Growth. Arabidopsis seedling and plant growth was at 22.C as

described (186) except that plants were grown in an 8-h light/16-h dark cycle. fls2-24 is in

Ler background (203); fls2., efr-2 and rbohD are in Col0 background (193, 204, 205).

Immunoblot Analysis and Antibodies. For sample elicitation for immunoblot analysis,

three leaf disks (each 1.5cm2; cut into 5 strips) of 4-5 week old plants or 7-8 d-old seedlings

were floated on 1 mL dH2O overnight at 22.C in continuous light to reduce wounding

140

response. Samples were elicited with indicated concentrations of specified PAMP for 45-

50 min, washed twice with 1mL dH2O to remove excess PAMP and incubated in dH2O at

22.C until flash frozen in liquid nitrogen at indicated times. For re-elicitation of MAPK

phosphorylation, samples were initially elicited and washed as indicated above, but then

incubated with the indicated PAMP for an additional 10 minutes prior to freezing. All

samples were stored at -80ºC. Sample preparation and immunoblot analyses of total

proteins using antibody concentrations were done as described (204). An exception is that

aP-p44/42 MAPK (1:3000) (#4370; Cell Signaling Tech, Danvers, MA) was used to detect

phosphorylated MAPKs.

Apoplastic ROS Production. Half of a cut leaf disk (1.1cm2) of 4-5 week old plants were

used for individual ROS production measurements using a luminol-based assay (204). For

ROS re-elicitation, samples were first elicited for 40 minutes with indicated PAMP at

specified concentration, washed twice with 150µL of dH2O, and placed at 22.C under

continuous light until indicated times of re-elicitation. To allow for correct comparison,

ROS experiments shown within the same figure were set-up at the same time and

performed in the same 96-well plate. Although absolute values of ROS production

[displayed as Relative Light Units; RLUs] varied from experiment to experiment, the actual

trends were always the same.

Quantitative Real-time PCR Analysis. For pulse elicitation, four leaf disks (each 1.1cm2,

cut into 5 strips) of 4-5 week old plants were elicited with 1µM PF22 for 40 min, washed

twice and kept in dH2O at 22ºC until flash frozen in liquid nitrogen at indicated times.

Total RNA was isolated and real-time PCR reactions were performed and analyzed as

described in (187, 206) with FLS2-f 5’-TCTGATGAAACTTAGAGGCAAAGCG-3’ and

141

FLS2-r 5’-CGTAACAGAGTTTGGCAAAGTCG-3’ primers using the expression of

At2G28390 (SAND family protein gene) to normalize all qRT-PCR results (187, 206).

Statistical Analysis. Each experiment was done at least 3 independent times with similar

results. Statistical significances based on unpaired two sample t-test were determined with

Graph Pad Prism4 software.

II.IV Results

Endogenous FLS2 undergoes ligand-induced degradation that is ligand-,

time- and dose-dependent. A previous live-cell imaging study using emerging young

leaves (191) showed that in response to 10 µM PF22, FLS2-GFP is internalized from the

PM into small vesicles at 30 min followed by loss of FLS2-GFP fluorescence at 60 min,

consistent with ligand-induced endocytosis and subsequent degradation of FLS2-GFP. To

eliminate the possibility that reduced FLS2-GFP signal was due to cleavage of GFP from

FLS2-GFP followed by degradation of GFP alone or to a change in local pH affecting

GFP’s ability to fluoresce (207), we confirmed first that endogenous, non-tagged FLS2

underwent PF22-induced degradation. Furthermore, a recent report underlines the

importance in studying endogenous proteins for functional analyses of RLK-based events

because C-terminal tags can affect RLK functions (208). Using Arabidopsis ecotypes

expressing functional endogenous FLS2 (209), we assessed FLS2 accumulation using an

αFLS2-peptide antibody that detects FLS2 in wild-type (WT) but not fls2∆ plants (187,

204). When wild-type Ler seedlings were treated with 10 µM PF22, concentration used in

the live-cell imaging study (191), FLS2 levels decreased after 40 min of PF22-elicitation

(Fig. 1A) consistent with PF22-induced degradation of endogenous FLS2. In contrast, fls2-

24 seedlings expressing FLS2 mutant protein impaired in PF22-binding and signaling

142

(209) did not show altered FLS2 levels (Fig. 1A), confirming the specificity of the

degradation response. Similarly, FLS2 underwent ligand-induced degradation in a dose-

dependent manner in 4-5 week old Col0 leaves (Fig. 1C), a developmental tissue stage

commonly used for PF22-signaling and pathogen infection assays. Importantly, FLS2

degradation occurred at a concentration as low as 0.1 µM, commonly used for PF22-

signaling response assays (187, 194, 204). Confirming the specificity for the ligand-

receptor pair, FLS2 degradation was specific to active flg22 (PF) but not to water, inactive

flg22 (186) or the unrelated bacterial PAMP elf26 (E) (Fig. 1A-C). Protein levels of

Mitogen-Associated Protein Kinase 6 (MPK6; M6) or the ER membrane-bound calnexin

(Caln) were not significantly altered by any treatment (Fig. 1A-D). These results

demonstrate that endogenous, non-tagged FLS2 underwent PF22-induced degradation in a

ligand-, dose- and time-dependent manner in tissues of different developmental stages.

Cycloheximide treatment blocks ligand-induced degradation of FLS2 and

attenuation of PF22-signaling. PF22-elicitation resulted in a significant decrease but not

complete loss of FLS2 protein accumulation (Fig. 1). Because PF22 induces FLS2 mRNA

accumulation at 1 h (189, 210) (see below), Col0 leaf strips were treated with the protein

translation inhibitor cycloheximide (CHX) to examine whether FLS2 detected at 1 h after

PF22-elicitation represented newly synthesized FLS2. We consistently noticed, however,

that in the presence of CHX, FLS2 did not undergo significant ligand-induced degradation

at 1 h in response to PF22 (Fig. 1D). Similar results were obtained for Ler seedlings

(Supporting information Fig. S1A). CHX treatment also inhibited attenuation of PF22-

signaling responses. MAPKs remained phosphorylated at 60 min post-PF22-elicitation in

the presence (+CHX/+PF) but not the absence of CHX (-CHX/+PF) (Fig. 1D; Fig. S1A).

143

Similarly, the duration of PF22-induced ROS production was greatly prolonged in the

presence (Fig. 1F) but not absence of CHX (Fig. 1E). Treatment with CHX alone did not

significantly induce MAPK phosphorylation or ROS production (Fig 1D or Fig 1F,

respectively). In contrast to duration, the amplitude of PF22-induced MAPK activation or

ROS production was not significantly affected. Elevated ROS levels after treatment with

PF22+CHX were not observed in rbohD null mutant plants (Fig. S1B) lacking functional

RBOHD, the PM- located NADPH oxidase responsible for PAMP-dependent extracellular

ROS production (211). Thus, prolonged ROS production in CHX-treated tissue was

unlikely due to cell death-associated ROS production. Our results indicate that de novo

synthesis of yet unknown protein(s) contribute to ligand-induced degradation of FLS2. It

is unclear whether the block in ligand-induced degradation of FLS2 directly or indirectly

affects attenuation of PF22-signaling responses. Our data are consistent with the hypothesis

that ligand-induced degradation of FLS2 may serve as a means to attenuate constitutive

signaling of innate immune responses. We cannot exclude, however, the possibility that

distinct de novo synthesized proteins such as phosphatases (212) and/or factors involved

in superoxide radical detoxification contribute to attenuation of these PF22-induced

responses.

Ligand-induced degradation of FLS2 desensitized cells to stimulus. To address

whether PF22-dependent degradation of FLS2 is a means to desensitize host cells to PF22,

we utilized two independent PF22-signaling responses (ROS production and MAPK

activation) because a) they are implicated in two parallel PF22-signaling pathways (184)

and b) both responses are rapid and transient, in that PF22-induced activities peak 10-15

144

min post-elicitation and return to nearly basal levels within 40-60 min (Fig. 2A-D). Leaf

tissue was first treated at 0 min with the indicated PAMP, incubated for 45-50 min and

washed to remove excess ligand. To evaluate PAMP-signaling competency, the same

samples were re-elicited with specified PAMPs at 60 min. Responses were monitored at

indicated times post-elicitation. After the initial fast and transient PF22-induced ROS

response (Fig. 2A), re-elicitation of the same tissue with PF22 at 60 min did not result in

significant ROS production (Fig. 2A). Thus, at 60 min post-elicitation, these cells were

PF22-signaling incompetent. Loss of PF22-induced signaling at 60 min correlated with

PF22-induced degradation of FLS2 at that time (Fig 1C). In contrast, re-elicitation with

elf26 led to ROS production indicating that cells treated initially with PF22 were capable

of mounting PAMP-dependent ROS responses at 60 min per se (Fig. 2B). Cells initially

elicited with inactive flg22 (186) (Fig. 2C) or the unrelated elf26 (E) (Fig. S2A) remained

signaling competent for PF22, consistent with FLS2 not being degraded in response to

these peptides (Fig. 1C). We conclude that the inability to re-elicit cells with PF22 was

specific to the receptor-ligand pair FLS2-PF22. PF22-signaling incompetency was

observed as early as 20 min after the initial PF22- treatment (Fig. S2B); but re-elicitation

with elf26 resulted in significant ROS production at these times (Fig. S2B). This argues

against the possibility that this PF22-signaling incompetency between 20 and 60 min may

be solely due to an extended refractory period of cellular components required for PAMP-

induced ROS production such as RBOHD. Loss of PF22 signaling competency at 60 min

was dose-dependent, in that the amplitude of the re-elicitation ROS response was

dependent on the initial PF22-concentration to which cells were exposed to at 0 min. Cells

treated first with 0.001 or 0.01 µM PF22 remained signaling competent to 0.1 µM PF22 at

145

60 min (Fig. S2C or S2D). In contrast, cells initially exposed to 0.1 µM or 1 µM PF22 were

PF22-signaling incompetent at 60 min (Fig. S2E or S2F). The dose-dependency of the re-

elicitation response showed an inverse correlation with the dose-dependent degradation of

FLS2 in response to PF22 (Fig. 1C). Thus, concentrations between 0.1-1 µM PF22 were

used in subsequent experiments.

To assess the cell’s ability to re-elicit an independent PAMP-response, namely

MAPK activation, samples were collected at 0 and 60 min as well as 10 min post-elicitation

treatments (10 and 70 min, respectively) with indicated PAMPs and analyzed for

phosphorylated MAPKs (7, 26). Consistent with ROS results, cells initially treated with

PF22 were PF22-signaling incompetent at 60 min (Fig. 2D; PF/PF, 70*; P-M6, P-M3) but

remained signaling competent to elf26 (PF/E, 70*). The inability to re-elicit PF22-

dependent MAPK phosphorylation was not due to reduced MAPK protein levels at any

times (Fig. 2D; M6). Taken together, re-elicitation data using two independent PAMP-

signaling assays support the hypothesis that ligand-induced degradation of FLS2 is a

regulatory reponse to desensitize host cells to the stimulus.

PF22-induced de novo synthesis of FLS2 is a means to prepare cells for a new

round of PF22-perception. Using quantitative real-time (qRT)-PCR (Fig. S3A), we

confirmed previous microarray studies showing that PF22-elicitation leads to an increase

in FLS2 gene expression at 1 h (189, 210). It is, however, unknown whether an increase in

FLS2 mRNA correlates with increased FLS2 protein accumulation and, if so, whether

newly synthesized receptors are signaling competent. To this end, samples were pulse-

treated with PF22 for 45-50 min and incubated for up to 24 h in the absence of ligand. After

the initial PF22-dependent FLS2 degradation (1h), FLS2 protein levels began to be restored

146

until reaching pre-treatment levels at 24 h (Fig. 3A). No protein of similar apparent

molecular weight was detected in fls2. null mutants (Fig. S3B), confirming that the re-

appearing protein is FLS2. To verify that FLS2 accumulation at later times was due to de

novo protein synthesis, we adjusted our experimental design because CHX inhibited PF22-

degradation of FLS2 (Fig. 1D). Tissue was first incubated with PF22 for 1 hr in the absence

of CHX. At 1 h post-elicitation corresponding to the time at which FLS2 was mostly

degraded, samples were incubated for an additional 2 h in the absence (- ) or presence (+)

of CHX. When comparing FLS2 protein accumulation at 3h (Fig. S3C), CHX-treated

samples (+CHX/+PF) did not accumulate additional FLS2 protein whereas in the absence

of CHX (- CHX/+PF), FLS2 protein levels increased at 3 h post-elicitation. These results

are in agreement with PF22-treatment leading to de novo FLS2 protein synthesis at later

times after an initial ligand-induced degradation of FLS2 (1 h).

To assess whether newly synthesized FLS2 was signaling competent, samples were

first elicited at 0h with PF22 for 45 min, washed and kept in water until 1, 2, 3, 4 or 24 h.

For MAPK activation, control samples (only 1st elicitation) were collected at indicated

times after initial PF22 elicitation. Samples from tissue re-elicited with PF22 were

collected 10 min after the second elicitation. A 10 min sample (i.e. initial 10 min response

to PF22) served as a positive control. Consistent with Fig. 2D, MAPK phosphorylation was

detected at 10 min after the 1st elicitation (Fig. 3A, 10m) but only minimally upon re-

elicitation at 1h (1h+10m). In contrast, PF22 was able to re-elicit strong MAPK

phosphorylation at later times between 2 and 24 h, and the intensity of MAPK

phosphorylation correlated with increased FLS2 protein accumulation. Using a similar

experimental design for ROS re-elicitation, tissue that was initially treated with PF22 also

147

displayed significant PF22-induced ROS production after re-elicitation at 3 and 16 h (Fig.

3C-D). This gradual increase in ROS production over time, reflecting recovery of PF22-

signaling competency, is highlighted in Fig. S3D. No ROS production was observed in

fls2. (Fig. S3E) or rbohD (Fig. S3F) null mutants indicating that ROS re-elicitation

responses were dependent on functional FLS2 and RBOHD. The RBOHD requirements

also confirmed that ROS detected at later times were not due to other mechanisms of ROS

production. In conclusion, results from two independent re-elicitation assays correlated

restoration of PF22-signaling competency with increased accumulation of newly

synthesized FLS2. Our results are consistent with the hypothesis that after the initial PF22-

dependent endocytic degradation of FLS2 (at 1 h), ligand-induced de novo synthesis of

FLS2 at later times (> 1 h) is a means to prepare cells for a new round of PF22-perception.

Early ligand-induced desensitization and subsequent re-establishment of

signaling competency extends to elf26-EFR. Next, we examined whether the principles

of desensitization in immune-signaling may hold as a general paradigm for other bacterial

PAMP-RLKs. We focused on elf26, the bacterial PAMP perceived by EFR, because it

initiates PAMP-responses similar to PF22 (183, 193). After elf26-elicitation at 0 h, Col0

was unable to re-elicit elf26-dependent ROS and MAPK activation at 1 h (Fig. 4A and 4C)

indicating that the initial elf26 treatment led to desensitization of EFR to its ligand. In

contrast, tissue treated first with elf26 was able to re-elicit subsequent PF22-dependent

responses (Fig. 4B-C) showing that samples were able to mount PAMP-responses per se.

Signaling competency to elf26 was not impaired when samples were first treated with PF22

(Fig. 2B) confirming that the inability to re-elicit with elf26 was specific to the ligand-

receptor elf26-EFR pair combination. EFR signaling competency to elf26 recovered over

148

time as assessed by MAPK phosphorylation (Fig. 4D) and ROS production (Fig. S4A-E).

In control experiments for ROS-re-elicitation, re-establishment of EFR signaling

competency was EFR- and RBOHD-dependent (Fig. S4D-E). At least for ROS production,

signaling recovery appeared to occur more slowly compared to that to PF22. Such variation

may be due to the fact that requirements for receptor biosynthesis, glycosylation and

trafficking through the secretory pathway are different for FLS2 and EFR (197, 198, 213,

214).

II.V Conclusions

We provide evidence that endogenous, non-tagged FLS2 protein was degraded in

a ligand-, time and dose-dependent manner followed by a subsequent de novo protein

synthesis of FLS2. Re-elicitation assays for two independent PAMP-responses allowed us

to correlate FLS2 signaling competency with receptor accumulation. Our results indicate

that at early times (< 2h) after initial elicitation, PF22-induced degradation of FLS2 serves

as a means to desensitize cells to stimuli, possibly by removing FLS2 receptor molecules

from the site of stimulus perception and helping to prevent continuous initiation of PF22-

signaling responses. Elicitation with PF22 resulted consistently in a significant decrease

but not a complete loss in FLS2 protein accumulation at 60 min in a dose-dependent

manner (Fig. 1). Based on our signaling- competency data, a subset of FLS2 molecules

may be in an altered conformational state or sequestered to a subcellular location that

prevents these receptors from perceiving PF22 and/or inducing PF22-events. In the latter

scenario, FLS2 may be present in endocytic vesicles en route for protein degradation or in

parts of the secretory pathway en route to the PM, the site of flg22 perception. Consistent

149

with this hypothesis, lack of signal initiation at 20 min after PF22- elicitation correlated

with the time at which FLS2 is reported in intracellular vesicles (191).

At later times (>2h) after PF22-treatment, increased accumulation of de novo

synthesized FLS2 protein correlated with time-dependent recovery of signaling

competency. We propose that new synthesis of FLS2 protein serves as a means to prepare

cells for a new round of PF22- perception. This hypothesis is congruent as cells are likely

to encounter flagellated bacteria multiple times throughout their lifecycle. During an initial

encounter, ligand-induced degradation of FLS2 may aid in preventing continuous PF22-

signaling known to be detrimental for plants because it diverts valuable cellular resources

from growth and development to signaling. Subsequent replenishment of signaling

competent FLS2 is conceivable because cells unable to reinstate degraded receptors with

newly synthesized FLS2 would lose their ability to perceive flagellin and initiate immune

responses during subsequent infections. In agreement, cells lacking functional FLS2

exhibit enhanced susceptibility to bacterial infection (189). Such replenishment scenario

may provide insight into why pathogenic bacteria evolved mechanisms to inject effectors

into the host cell that target components of the FLS2 receptor complex for degradation

(190, 215, 216), thus suppressing establishment of host PTI (217). Because effector

delivery is assumed to occur after PTI response initiation (217), effectors that target the

FLS2-complex components may interfere with the re-establishment of PF22-signaling

competency of cells rather than with the initial detection of bacteria and PF22-response

initiation. Furthermore, our results using an unrelated bacterial PAMP elf26 suggest that

similar mechanisms may apply for regulating signaling competency of other plant PAMP-

receptors in response to their ligands.

150

Figure II.I: PF22-induced degradation of endogenous FLS2 is ligand-, dose- and time-

dependent and is inhibited by cycloheximide.

(A) Time-dependency and specificity in Ler seedlings. Ler WT and fls2-24 seedlings were

elicited in the presence (+) or absence (-) of 10μM PF22 or in (B) with 1μM PAMPs for

indicated times. (C) Dose- and ligand-dependency in Col0 leaves. Col0 leaf strips were

elicited with indicated μM concentration (+) or without (-) specified PAMP for 0 or 60

min. (D) Cycloheximide (CHX) inhibits PF22-induced degradation of FLS2 and

attenuation of MAPK activation. Col0 leaf strips were elicited in plus (+) or minus (-) 1μM

PF22 or 50μM CHX for indicated times in minutes. For immunoblot analyses (A-D), total

protein extracts were probed with αFLS2 or αP-p44/42 MAPK to assess FLS2 protein

degradation or phosphorylation of MPK6 (P-M6), MPK3 (P-M3) and an unknown MKP

(P-M?). Individual MAPKs were identified by mass. Immunoblots probed with αCalnexin

(Caln) or αMPK6 served as loading controls or confirmed MPK6 accumulation. (E-F) Col0

leaf disk halves (n=20/ treatment) were elicited plus (+) or minus (-) 0.1μM PF22 or 50μM

CHX at 0 minutes. ROS production was monitored over 40 minutes shown as Relative

Light Units (RLU). To allow for correct comparisons, ROS experiments in (E-F) were

performed in the same 96-well plate at the same time. Values are mean ± SE. PF, PF22;

AF, AF22, E, elf26.

151

Figure II.I: PF22-induced degradation of endogenous FLS2 is ligand-, dose- and time-

dependent and is inhibited by cycloheximide.

152


stimuli.

(A-C) Specificity of ROS re-elicitation. For first elicitation, Col0 leaf disks (n=20/

treatment) were elicited with 0.1μM of indicated PAMP at 0 min, washed and re-elicited

with indicated PAMP at 60 min (arrow) (n=20/ treatment). ROS experiments in (A-C) were

set-up in the same 96-well plate at the same time. (D) Specificity of re-elicitation of MAPK

phosphorylation. Col0 leaf strips were first elicited with 0.1μM PF22 for 0, 10 or 60

minutes. Samples denoted 70* were re-elicited at 60 min for 10 min with 0.1μM PAMP.

Total protein extracts were probed as in Fig 1. Values are mean ± SE. PF, PF22; AF, AF22;

E, elf26; RLU, Relative Light Unit.

153


stimuli.

154


round of PF22-perception.

(A) Increased PF22-induced FLS2 protein accumulation and recovery of MAPK-signaling

competency. After a 1st elicitation with 0.1 μM PF22 at 0 min for 45-50 min, Col0 leaf

strips were washed and incubated in the absence of PF22 until indicated times [in min (m)

or hours (h)]. For reelicitation (2nd), samples were elicited with 0.1 μM PF22 at indicated

hours for 10 min. Immunoblot analysis of total protein extracts was done as in Fig. 1. (B-

D) Recovery of ROS signaling competency. Col0 leaf disk halves were pulsed with 0.1 μM

PF22 at 0h for 45 min (n=60/treatment), washed and re-elicited with 0.1 μM PF22 at 1, 3

or 16 h (n=20/treatment). Arrows indicate times of second elicitation. Bar graph

representation shows RLU at peak (10-12 min) after elicitation at indicated hr. ROS

experiments in (B-D) were set-up in the same 96-well plate. Values are mean ± SE. PF,

PF22; RLU, Relative Light Unit.

155


round of PF22-perception.

156

Figure II.IV: Regulation of ligand-induced signaling competency of EFR is regulated

similar to PF22-FLS2.

(A-B) Specificity of ROS re-elicitation. At 0 min, Col0 leaf disks (n=20) were treated with

0.1μM elf26, washed after 40-45 min and re-elicited with indicated PAMP at 60 min

(arrow) (n=20/treatment). (C) Specificity of re-elicitation of MAPK phosphorylation. Col0

leaf strips were first elicited with 0.1μM E for 0, 10, or 60 min. Samples denoted by 70*

were re-elicited at 60 min for an extra 10 min with indicated 0.1μM PAMP. (D) Elf26-

induced recovery of MAPK-signaling competency at later times. Ability to induce MAPK-

phosphorylation at different times after first elicitation was assessed as described in Fig.

3A except that 0.1μM elf26 was used as eliciting PAMP. ROS experiments in (A-B) were

set-up in the same 96-well plate at the same time. Values are mean ± SE. PF, PF22; E,

elf26.

157

Figure II.IV: Regulation of ligand-induced signaling competency of EFR is

regulated similar to PF22-FLS2.

158


RBOHD-dependent.

(A) Prolonged PF22-induced MAPK phosphorylation in Ler seedlings. Ler WT seedlings

were elicited in the presence (+) or absence (-) of 10μM PF22 or 100μM CHX at the

indicated times in minutes. Immunoblot analyses, total protein extracts were probed with

αFLS2, αP-p44/42 MAPK or αMPK6 antibodies. αMPK6 served as loading controls and

confirmed MPK6 accumulation. PF, PF22; min, minutes. (B) Prolonged PF22-induced

ROS production is RBOHD-dependent. Col0 and rbohD leaf disk halves were elicited with

(+) or without (-) 0.1μM PF22 in the presence or absence of 50μM CHX at 0 min

(n=10/treatment). In this bar graph representation, ROS production is shown at the peak of

ROS production 10-12 min postelicitation. ROS experiments were performed in the same

96-well plate at the same time. Values are mean ± SE. PF, PF22; P-M6 or P-M3,

phosphorylated MPK6 or MPK3, respectively; CHX, cycloheximide; min, minutes, RLU,

Relative Light Units. Each experiment was done at least 3 times with similar results.

159


RBOHD-dependent.

160

Figure II.S2: PF22-signaling incompetency is PAMP-, time- and dose-dependent.

(A) PAMP-dependency of ROS-re-elicitation. Col0 leaf disk halves (n=48) were elicited

at 0 min (1st), washed at 45 min and reelicited (2nd) at 60 min with 0.1μM of indicated

PAMP (n= 48/ treatment). ROS production is shown at peak elicitation (10-12 min post-

elicitation). (B) Signaling competency between 20 and 60 min. Col0 leaf disk halves (n=96)

were elicited at 0 min (1st) for 15 min with 0.1μM PF22. Tissue was then washed and re-

elicited (2nd) at 20, 40 or 60 min, respectively, with 0.1μM of indicated PAMP (n=

16/treatment). ROS production is shown at peak elicitation (10-12 min post-elicitation).

(C-F) PF22-signaling incompetency is dose-dependent. For their first elicitation (1st), Col0

leaf disk halves were elicited with the indicated concentration of PF22 at 0 min

(n=24/treatment), washed and re-elicited at 60 minutes (arrow) with 0.1μM PF22

(n=24/treatment). PF, PF22; E, elf26; min, minutes; RLU, Relative Light Units. To allow

for comparisons, all ROS experiments in (A), (B), and (C-F), respectively, were performed

in the same 96-well plate at the same time. Values are mean ± SE and each experiment was

done at least 3 independent times with similar results.

161

Figure II.S2: PF22-signaling incompetency is PAMP-, time- and dose-dependent.

162


synthesis of FLS2.

(A) PF22-induced expression levels of FLS2 mRNA. Col0 leaf strips were elicited for 40-

45 min with 1μM PF22, washed and incubated in the absence of PF22 until indicated time

(hours). Samples were processed for qRT-PCR using At2g28390 as the reference gene. For

each timepoint, results of at least three independent experiments containing one biological

and three technical repeats are shown. (B) Increased PF22-induced FLS2 protein

accumulation. After a 1st elicitation with 0.1 μM PF22 at 0 min for 45 min, Col0 or fls2Δ

leaf strips were washed and incubated in the absence of PF22. Samples were collected at

indicated times in hours. (C) PF22-induced de novo synthesis of FLS2. Col0 leaf strips

were treated for 40 min with 1μM PF22 and washed to remove access ligand. At 60 min, a

subset of samples were treated with (+) or without (-) 50μM CHX for an additional 2 hours

(3h). Samples were collected at indicated times. For immunoblot analyses in (B-C), total

protein extracts were probed with αFLS2 or αMPK6 to assess FLS2 protein accumulation

or MPK6 protein levels as a loading control. (D) Time-dependent recovery of ROS

signaling competency in response to PF22. In a first elicitation (1st), Col0 leaf disk halves

were pulsed with 0.1 μM PF22 at 0h for 45 min (n=60). Samples were washed to remove

access ligand and then re-elicited (2nd) with 0.1 μM PF22 at indicated times

(n=10/treatment). Bar graph representation shows RLU at peak (10-12 min) after elicitation

at indicated hour (h). (E-F) Recovery of ROS signaling competency is FLS2-and RBOHD-

dependent. Samples of WT (Col0), fls2 and rbohD plants were treated as in (D) at indicated

times. ROS experiments shown in the same graph were set-up in the same 96-well plate.

163

Values are mean ± SE. PF, PF22; h, hours; m, min; RLU, Relative Light Unit. Each

experiment was done at least 3 independent times with similar results.

164


synthesis of FLS2.

165

Figure II.S4: Recovery of elf26-signaling competency using ROS production.

(A-C) Timecourse of ROS re-elicitation. For the first elicitation, Col0 leaf disks (n=60)

were elicited with 0.1μM elf26.at 0 min, washed at 40 min and re-elicited with 0.1μM elf26

at 1, 3, or 16 h (n=20/treatment). (D) Recovery of elf26-signaling-competency is EFR-

dependent. (E) Recovery of elf26-signaling-competency is RBOHD-dependent. Re-

elicitation assays in (E-F) were done as in (A-C) except that in addition to Col0, efr-2 or

rbohD leaf disks, respectively, were used and that data are shown in bar graph format at

12-14 min post-elicitation. ROS experiments were set-up in the same 96-well plate at the

same time for (A-C), (D) or (E), respectively. Values are mean ± SE. PF, PF22; E, elf26;

min, minutes; h, hours, RLU, Relative Light Units.

166

Figure II.S4 Figure II.S4: Recovery of elf26-signaling competency using ROS

production.

167

III. CONTINUOUS FLG22 TREATMENT LEADS TO LIGAND-

DESENSITIZATION AND LOSS OF FLS2 PROTEIN ACCUMULATION

III.I Summary

In plants, innate immune signaling is the primary mechanism for defense against

invading microbial pathogens. Perception of microbial pathogens occurs through

recognition of conserved microbial features by plant cell-surface receptors. In the best

studied plant PAMP-receptor interaction system, the cell surface receptor Flagellin

Sensitive 2 (FLS2) perceives bacterial flagellin (or a conserved peptide derivative, flg22).

Perception of flg22 by FLS2 leads to activation of a multitude of downstream innate

immune signaling responses. However, these signaling responses must be tightly regulated

due to a limited pool of cellular signaling components shared between immune signaling

and developmental signaling pathways. Here, using two independent pathogen-associated

molecular patterns (PAMP)-ligands flg22 and elf26 I demonstrate continuous PAMP-

stimulation results in ligand-desensitization. Continuous treatment using flg22 at time

points greater than 8h resulted in decreased reactive oxygen species production and

decreased FLS2 protein accumulation. Furthermore, I compare the commonly utilized

syringe-infiltration technique to continuous exogenous application of flg22-peptide and

determine that syringe-infiltration does not recapitulate exogenous PAMP treatment.

III.II Introduction

Cell surface receptors are the front-line sentries that defend against pathogen

invasion and initiate innate immunity in both plants and animals. Perception of microbial

PAMPs initiates a multitude of downstream signaling events which trigger immunity and

168

inflammation to halt microbial infection (181, 218, 219). In the best studied plant PTI-

system, the host cell surface receptor Flagellin Sensitive 2 (FLS2) perceives bacterial

flagellin (or its peptide derivative flg22) leading to activation of immune responses which

contribute to restriction of pathogen growth (189, 220). FLS2 is a plasma membrane

leucine-rich repeat receptor-like kinase which perceives apoplastic flg22 through its

extracellular leucine-rich repeat domain (185, 214). We, and others, have demonstrated

that the cell surface PAMP-receptor FLS2 undergoes ligand-induced degradation

following perception of its cognate ligand, which likely occurs through endocytic

trafficking of activated receptor to a degradative compartment, possibly the vacuole (191,

221) (Salamango et al, in prep.). Recently, our lab demonstrated ligand-induced

degradation of FLS2 may serve as a means to desensitize cells to the flg22 stimulus

(Salamango et al, in prep.). Constitutive immune signaling redirects valuable resources

from growth and developmental pathways to sustain immune signaling pathways;

therefore, strict regulation of immune signaling amplitude and duration must be maintained

for activated immune signaling pathways. Several reports have established that prolonged

innate immune signaling has detrimental effects on organism fitness; and therefore,

activated innate immune signaling mechanisms require tight regulation (222-225).

We previously developed re-elicitation assays using ROS production and MAPK

phosphorylation to correlate FLS2 degradation, and subsequent ligand-induced new

synthesis of FLS2, with cellular signaling competency (Salamango et al, in prep.). Utilizing

these assays, we established that initial FLS2 degradation (~1h following ligand

perception) correlated with desensitizing cells to a stimulus (active flg22) and that over-

time, newly synthesized FLS2 protein accumulation restored cellular signaling competency

169

to near initial elicitation levels (~24h following initial elicitation) (Salamango et al, in

prep.). This type of pulse-chase assay was performed by eliciting tissues with a specific

PAMP for 45-50 minutes, washing with dH2O to remove excess PAMP-ligand, and re-

eliciting with the same PAMP at subsequent time points. This experimental approach

allowed for correlation of FLS2 activation, degradation, and subsequent de novo

accumulation to cellular signaling competency. However, this experimental approach

unlikely reflects what occurs during a natural bacterial infection wherein cells are exposed

to the flagellin-flg22 epitope continuously. Thus, it is unlikely that cessation of PAMP-

induced signaling would occur after 45-50 minutes due to persistence of bacterial infection;

therefore, I sought to determine cellular signaling competency after continual PAMP

stimulation.

III.III Experimental Procedures

Immunoblot Analysis and Antibodies. For sample elicitation, three leaf disks (each

1.5cm2; cut into 5 strips) of 4-5 week old plants were floated on 1 mL dH2O overnight at

22◦C in continuous light to reduce wounding response. The following day, samples were

elicited with indicated concentrations of flg22, or with 1x108 CFU Pseudomonas syringae

DC3000 HcrC- in dH2O. For pulse treatment, elicitations were performed for 45-50 min,

then the tissue was washed twice with dH2O to remove excess PAMP ligand, and flash

frozen at the indicated time. For continuous treatment, samples were elicited in the same

manner with the exception that PAMP solution was not removed after 45-50 min and tissue

was continuously exposed to the same PAMP solution. Samples were flash frozen at the

indicated time point. Sample preparation and immunoblot analyses of total proteins using

antibody concentrations were done as described (204).

170

Apoplastic ROS Production. Half of a cut leaf disk (1.1cm2) of 4-5 week old plants were

used for individual ROS production measurements using a luminol-based assay (204). For

pulse ROS re-elicitation, samples were first elicited for 40 minutes with indicated PAMP

at specified concentration, washed twice with 150μL of dH2O, and placed at 22◦C under

continuous light until indicated times of re-elicitation. For continuous ROS re-elicitation,

samples were treated as described for pulse samples; however, samples were not washed

after the initial elicitation and remained in the presence of PAMP until re-elicited using

new PAMP solution at the indicated time. For syringe-infiltrated ROS re-elicitation, Col0

adult leaf tissue was syringe infiltrated with 1μM flg22 solution until leaves were saturated.

After ~1h when the leaf tissue had dried, leaf disk punches were taken (1.1cm2) from the

center of the infiltrated area and leaf disk halves were floated on 150μL dH2O to allow

wounding responses to subside before re-elicitation at 24h. To allow for direct comparison,

ROS experiments shown within the same figure panel were initiated at the same time and

performed in the same 96-well plate. Although absolute values of ROS production

[displayed as Relative Light Units; RLUs] varied from experiment to experiment, the actual

trends were always the same.

Bacterial Preparation and ROS Elicitation. Pseudomonas syringae DC3000 hrcC- was

grown for two days on agar plates under rifamycin selection. On the third day, bacteria

were transferred to a new plate to ensure elicitation was performed using actively growing

bacteria. At the time of elicitation, bacteria were isolated, washed in dH2O, and used for

elicitation at an optical density of 0.1 at 600nm wavelength (approximately1x108 CFU) for

171

elicitation. For the bacterial wash, bacteria were suspended in dH2O and centrifuged for 5

minutes at 3000xg. Col0 cut leaf disks were floated on bacterial solution and ROS

production was monitored using a luminol-based assay (204) at 0h. Samples were either

washed twice with dH2O (pulse), or left in bacterial solution until the time of re-elicitation

(continuous). For re-elicitation, samples were treated with 100nM flg22 solution and ROs

production was monitored.

Callose Deposition. For syringe infiltration, adult leaf tissue 4 to 5 weeks in soil was

syringe infiltrated using 1μM flg22 or dH2O and collected directly into 95% ethanol

solution 24 hours post-infiltration. After overnight incubation in 95% ethanol, tissue was

rinsed in 50% ethanol and incubated in 67 mM potassium phosphate (K2HPO4; pH 12)

buffer for 1 hour. Tissue was stained using 0.01% analine blue/potassium phosphate buffer

solution for 1h in the dark at room temperature. Stained tissue was mounted in 70%

glycerol, 30% 67mM K2HPO4 solution (204).

Plant Material and Growth. Arabidopsis plant growth was at 22◦C as described (204)

except that plants were grown in an 8-h light/16-h dark cycle.

III.IV Results

Continuous PAMP-Signaling Desensitizes Cells to the Stimulus. To determine

if continuous PAMP stimulation resulted in negative regulation of cellular signaling

responses, I compared pulse and continuous elicitation of Col0 leaf tissue at 1, 3, and 16

hours following an initial PAMP-treatment at 0h. Four-to-five week old cut leaf disks of

172

wild-type Arabidopsis plants (Col-0) were elicited using 100nM flg22. ROS production

was monitored for 40 minutes using a luminol based assay and is shown as relative light

units (RLU) (Figure 1A, 10-12 minutes post-elicitation). At 45-50 minutes following

treatment, tissue was either washed twice with dH2O (pulse treatment; P), or retained in

PAMP-containing solution (continuous treatment; C). For re-elicitation, both pulsed and

continuously treated tissue was exposed to fresh PAMP-elicitation solution at indicated

times. Lack of significant ROS production for pulsed and continuously treated tissues re-

elicited at 1h correlated with previous findings that FLS2 protein is degraded at this time

(Figure 1A; P, C, 1h) (191) (Salamango et al, in prep.). Recovery of cellular signaling

competency after re-elicitation of pulsed and continuously treated tissues at 3h using

100nM flg22 correlates with our previous findings that ligand-induced de novo synthesis

of FLS2 protein accumulates in a signaling competent state (Figure 1A; P, C, 3h)

(Salamango et al, in prep.). Interestingly, continuously treated cut leaf tissue re-elicited at

16h using 100nM flg22 exhibited almost no ROS production, while pulsed tissue

demonstrated nearly full recovery of signal amplitude (Figure 1A; P, C, 16h). Lack of

cellular signaling competency at 16h for continuously treated tissues suggests FLS2 protein

may be degraded, or in a signaling-incompetent conformation. To assess FLS2 protein

accumulation in continuously treated tissues, I used immunoblot analysis on cut Col0 4-to-

5 week old leaf strips to determine FLS2 protein accumulation following treatment using

100nM flg22. As depicted in Figure 1B, Col0 cut leaf strips continuously treated (C) with

flg22 (+) show almost no FLS2 protein accumulation 8h following flg22 treatment

compared to pulse-treated samples. This preliminary experiment correlates the lack of

cellular responsiveness towards flg22-peptide with decreased FLS2 protein accumulation.

173

To determine if lack of cellular signaling competency at 16h was specific to

FLS2-flg22 signaling pathways, I continuously treated tissue using elf26, an independent

PAMP-ligand for the cell-surface receptor EFR (193). Following the treatment procedure

described for flg22, I initially elicited cut Col0 leaf disks with 100nM elf26 and re-elicited

tissue at 1, 3, and 16h with the same stimulus (Figure 1B). Re-elicitation of pulsed and

continuously treated leaf tissue at 1h using elf26 resulted in low amounts of ROS

production, similar to levels previously described for flg22 re-elicitation at 1h. This may

suggest EFR receptor undergoes ligand-induced degradation in a similar fashion as

previously described for FLS2 (191) (Salamango et al, in prep.). However, we also cannot

rule out the possibility that EFR is sequestered to the plasma membrane in a signaling

incompetent state. To verify decreased ROS production following re-elicitation of

continuously stimulated tissue was specific to the PAMP-receptor combination, we

continuously elicited Col0 leaf tissue with independent ligands AF (an inactive flg22

peptide derivative), flg22, or elf26 and assessed FLS2 signaling competency 16h following

initial treatment. As shown in Figure 1C, continuous elicitation with a non-specific peptide

had no effect on FLS2 signaling competency following re-elicitation at 16h. Tissues

continuously treated with elf26 were re-elicited using flg22 and, although ROS production

was slightly decreased compared to initial treatment (0h), FLS2 signaling competency was

significantly higher compared to tissues continuously treated with flg22, indicating

desensitization is specific to the ligand-receptor combination. This suggests decreased

FLS2 signaling competency in elf26 continuously treated tissue could be the result of

depletion of common signaling component(s), and/or signaling mechanisms, utilized

between EFR and FLS2

174

Ligand-desensitization during continuous treatment occurs after 6h following

initial PAMP-treatment. Examination of cellular responsiveness following PAMP-

treatment was assessed at time points between 3 and 16h following initial treatment to

determine when ligand-desensitization began to occur. Pulsed and continuously treated

tissue was re-elicited using 100nM flg22 every 2h spanning 4-to-14h after initial treatment

at 0h with 100nM flg22. I consistently observed ligand-desensitization following re-

elicitation of continuously treated tissue after 6h compared to pulsed samples (Figure 2A).

To ensure continuously treated cells had not undergone cell death and were capable of

responding to stimuli in general, I elicited 14h samples using 100nM elf26 following 14h

flg22 re-elicitation. I observed an increased ROS production in both pulsed and

continuously treated tissues following elicitation with 100nM elf26 at 14.5h compared to

elicitations at 14h using 100nM flg22 (Figure 3A; 14.5h) indicating continuously treated

cells were able to perceive PAMP-ligands other than flg22. Tissue continuously treated

using elf26 demonstrated a similar re-elicitation profile compared to flg22 re-elicitations

(Figure 2B), indicating observed results may be due to a common desensitization

mechanism. This strategy may be employed to negatively regulate immune signaling

pathways in situations wherein continuous signaling is occurring, effectively averting

depletion of crucial nutrients required for growth and development.

Continuous Avirulent Bacterial Treatment Leads to Ligand-Desensitization.

Next, I wanted to determine if ligand-induced desensitization could be recapitulated

utilizing the bacterial strain Pseudomonas syringae DC3000 hrcC- as a stimulus in lieu of

flg22 and elf26 peptides. Pto DC3000 hrcC- mutant is deficient in its type III secretion

system (T3SS). This bacterial strain was used specifically because it lacks a T3SS and is

175

unable to deliver bacterial effectors; therefore, pathogen recognition exclusively generates

a PAMP-triggered immune response in the absence of bacterial effectors known to target

PAMP-recognition receptors including FLS2 and EFR (226). Col0 cut leaf disks were

initially incubated with 1x108 CFU Pto DC3000 hcrC- for 1h and ROS production was

monitored. At 65-70 minutes following bacterial application, tissue was either washed

twice with dH2O (pulse), or left in elicitation solution containing bacteria (continuous) until

the indicated time of re-elicitation. For re-elicitation, pulsed and continuously treated

tissues were re-elicited with 100nM flg22 and ROS production was monitored. As shown

in Figure 3A, initial ROS amplitude produced following incubation with Pto DC3000 hrcC-

at 0h was lower compared to previous elicitations performed using 100nM flg22 peptide.

For the mammalian bacterial pathogen Caulobacter cresentus, the flagellin-epitope is not

exposed to the external environment until after the bacterial flagellum is shed (227).

Therefore, low ROS amplitude could be attributed to low levels of available flg22-epitope

in my experimental setup. Flg22 re-elicitation of pulsed and continuously treated tissue

over time generated a similar signaling profile as described previously. At 8h following

initial treatment, continuously treated samples began to display decreased ROS production

compared to time-matched pulsed samples. Ten-hours following initial bacterial

incubation, the ROS profile of continuously treated tissue resembled ligand desensitization

previously described for flg22 and elf26 treatments in that it was significantly decreased

compared to pulse treated samples. To determine if the desensitization to flg22-peptide at

8h was due to lack of FLS2 protein accumulation, I continuously treated Col0 cut leaf strips

with 1x108 CFU Pto DC3000 hrcC- and collected tissue for immunoblot analysis at the

indicated times (Figure 3B). In my preliminary experiments, samples continuously treated

176

with (+) Pto DC3000 hcrC- for 1h displayed significant FLS2 protein degradation

compared to samples at 0h. Analysis of samples collected at 4 and 6h following initial

bacterial treatment indicated FLS2 protein accumulated to similar levels compared to

untreated tissue, while continuously treated tissue displayed significantly decreased FLS2

protein accumulation 8h following initial treatment (Figure 3A; C, 8h). These results

indicate flg22-desensitization occurring in tissues continuously incubated in the presence

of the avirulent bacteria DC3000 hrcC- correlate to lack of FLS2 protein accumulation.

Syringe-Infiltration Does Not Recapitulate Ligand-Desensitization

Demonstrated for Continuous Exogenous PAMP-Treatment. A common strategy used

to assess PAMP-triggered immunity is to inoculate plant tissue via syringe- or vacuum-

infiltration of PAMP-containing solution directly into the apoplastic environment, during

which the ligand is assumed to be present continuously for the duration of the experiment.

I wanted to compare ROS re-elicitation and FLS2 protein accumulation using flg22-

infiltration with my previously used methods in which flg22-containing solution is added

to leaf strips either as a pulse for 1h (P) or continuously for 24h (C) to determine if ligand-

desensitization could be recapitulated in syringe-infiltrated tissues. Col0 4 to 5 week old

leaf tissue was cut into leaf disks and leaf disk halves were floated on 150μL dH2O for 24h

to allow for wounding responses to subside. After 24h, the cut leaf disks were elicited using

1μM flg22 while simultaneously, Col0 4 to 5 week old leaves were syringe-infiltrated with

the same 1μM flg22 containing solution (IPF), or with dH2O (IH2O). After 1h of flg22-

treatment, Col0 cut leaf disks were either washed twice with dH2O, or retained in PAMP

solution. At the same time, infiltrated leaf tissue was cut into leaf disk halves and floated

on 150μL dH2O in the same ROS plate containing the elicited cut leaf disks. Because all

177

tissues perceived flg22-peptide at the same time, all were re-elicited using 1μM flg22 24 h

after initial treatment. As shown in Figure 4A, ROS production following re-elicitation

using 1μM flg22 at 24h for cut leaf disks syringe-infiltrated with either 1μM flg22 or with

dH2O showed no significant difference compared to pulse treated Col0 cut leaf disks

elicited at 0h . However, re-elicitation of continuously treated Col0 cut leaf disks using

1μM flg22 at 24h displayed significantly decreased ROS production compared to pulse

treated and syringe-infiltrated cut leaf disks. To ensure syringe-infiltrated flg22 was

perceived and capable of generating PAMP-triggered immune responses in infiltrated Col0

leaf tissue, a sampling of the syringe-infiltrated tissues used for the ROS experiment

depicted in Figure 4A were collected and analyzed for callose deposition 24h after flg22-

infiltration (i.e. at the same time of the 24h re-elicitation time point shown for ROS

production). Leaf tissues syringe-infiltrated with 1μM flg22 displayed strong callose

deposition 24h following infiltration (at the same time of ROS re-elicitation), whereas

tissue infiltrated with dH2O exhibited almost no callose deposition (Fig S1), indicating

flg22-ligand was perceived in flg22-infiltrated leaf tissue. To determine if signaling

competency at 24h correlated with FLS2 protein accumulation, I compared pulsed or

continuously treated tissue against syringe-infiltrated tissue 24h following initial treatment.

In preliminary experiments, immunoblot analysis revealed that FLS2 protein accumulated

to almost pre-elicitation levels (0h; - PF) for both pulsed leaf strips and syringe-infiltrated

leaves but not in continuously treated leaf strips. These results suggest that desensitization

mechanism responsible for loss of ROS signaling competency is specific to continuous

exogenous PAMP-treatment.

178

III.V Conclusions

Previously, we developed re-elicitation techniques utilizing flg22-peptide to

correlate cellular signaling competency with FLS2 protein accumulation. We demonstrated

that treatment with concentrations of flg22 ranging from 0.1-10μM resulted in ligand-

induced degradation of FLS2 protein 1h following treatment. We were able to correlate

degradation of FLS2 protein with the loss of cellular signaling-competency in response to

flg22 peptide during this period. Furthermore, were could demonstrate that accumulation

of ligand-induced new synthesis of FLS2 protein resulted in restoration of cellular-

signaling competency following flg22-peptide treatment over time (Salamango et al, in

prep.). Here, I build on those methods and probe the effects of continuous PAMP-

stimulation on signaling competency and receptor protein accumulation over extended

periods of treatment to simulate the persistence of bacterial infection. Continuous PAMP-

stimulation resulted in ligand-desensitization at time points after 6h following initial

PAMP-treatment at 0h, which in preliminary experiments correlated with lack of

accumulation of FLS2 receptor. Utilizing two independent PAMP-ligands, namely, flg22

and elf26, which recognize different PRRs, I demonstrated that ligand-induced

desensitization mechanisms may be utilized by multiple PAMP-receptors to avert

continuous signaling. This desensitization mechanism could be used as a means to conserve

vital cellular signaling components used for both innate immune signaling and

developmental pathways. I also show that Col0 leaf tissue treated with 100nM elf26 at 0h

displays a lack of cellular signaling competency following re-elicitation using 100nM elf26

at 1h for ROS production. It is unknown whether EFR undergoes ligand-induced endocytic

trafficking and degradation as described for FLS2. It is possible that cellular desensitization

179

to elf26-ligand at 1h parallels a similar mechanism described for FLS2 trafficking wherein

activated receptor undergoes endocytic degradation. However, I cannot rule out the

possibility that EFR is sequestered to the plasma membrane in a signaling-incompetent

conformation. Interestingly, continuous bacterial treatment of Col0 leaf strips recapitulated

PAMP-peptide ligand-induced desensitization (Figure 3A) as well as the correlation to the

level of receptor accumulation (Figure 3B). To further explore PAMP-induced continuous

signaling and ligand-desensitization, I compared syringe-infiltration to continuous

exogenous PAMP-treatment. Syringe-infiltration did not demonstrate ligand-

desensitization or lack of FLS2 protein accumulation at 24h (Figure 4A and 4B) compared

to continuous exogenous PAMP treatment (Figure 4A and 4B). It may be that ligand-

induced desensitization observed in tissues continuously treated with exogenous PAMP

arises from the quantity of flg22 peptide present in the elicitation solution. Syringe-

infiltration allows for only a finite amount of flg22-containing solution to be introduced

into the apoplastic space of the leaf tissue; however, the Col0 cut leaf disks used in these

experiments are floated on a much greater volume of elicitation solution containing flg22-

peptide. Therefore, even though the concentration of flg22-peptide is held constant for both

experimental approaches, the molar amount of flg22-peptide present in continuous

exogenous treatment is much greater, which may result in the ligand-desensitization

described here.

III.VI Future Directions

An interesting question that arises from these data is what is the molecular

mechanism responsible for FLS2 degradation at 8h following continuous stimulation using

180

flg22? Two very plausible and testable hypotheses are that: 1) FLS2 mRNA is degraded,

possibly through small interfering RNA (228), after extended periods of continuous

stimulation, and 2) FLS2 is post-translationally targeted to degradative organelles in a

manner that it prevents de novo synthesis to accumulate FLS2 protein that is in a signaling

competent state.

Decreased FLS2 mRNA would eventually lead to decreased FLS2 protein

accumulation because of ligand-independent trafficking and degradation of FLS2

associated with generalized plasma membrane turnover. A straightforward method to test

this hypothesis would be to pulse and continuously elicit Col0 leaf tissue using 100nM

flg22. At 0, 1, 3, 6, 9, and 12h post-treatment leaf disks would be collected for both qPCR

and immunoblot analysis. This would ensure for a direct comparison between FLS2 protein

levels and transcript accumulation of FLS2 mRNA. Although this would not answer if

siRNA was involved per se, it would give weight to the idea that there is an active

mechanism down-regulating activated receptor, rather than a potential artifact of the

treatment. It would also be interesting to screen Arabidopsis mutants such as argonaut-1

and -2 and dicer-like-1 since both are known contributors to siRNA mediated pathways

and argonaut-2 has been implicated in regulating innate immune signaling pathways (229,

230).

Unfortunately, it may be more difficult to directly determine if FLS2 is being

actively degraded following continuous stimulation. We, and others, have shown that

ligand-induced degradation of FLS2 is extremely sensitive to pharmacological inhibitors

(191, 221). For instance, co-treatment of flg22 with 50μM cyclohexamide, a protein

181

translational inhibitor, results in the disruption of FLS2 degradation through unknown

mechanisms (Salamango et al, in prep.).

182


PAMPs.

(A) and (C) Continuous PAMP treatment results in desensitization to the stimuli. For the

first elicitation (0h), Col0 4 to 5 week old cut leaf disks were elicited with either 100nM

flg22 (open bar) or 100nM elf26 (grey bar with horizontal stripes) and ROS production

was monitored using a luminol based assay. For subsequent elicitations (filled black bars),

samples were either washed with dH2O after 40 min of treatment ( P; pulse) or

continuously elicited with PAMP ( C; continuous). At the indicated time point, both sample

treatments were re-elicited with the same fresh aliquot of the respective 100nM PAMP

solution (1h, 3h, and 16h). (experimental, n>3; samples, n=16) (B) ROS desensitization

correlates with a loss of FLS2 protein accumulation. Col0 4 to 5 week old cut leaf strips

were elicited (+) with 1μM flg22, or without ( (-); dH2O) and either washed after 40

minutes using dH2O, or left in the presence of flg22 to simulate continuous treatment.

Samples were flash frozen at 8h post treatment and total proteins were isolated and

subjected to immunoblot analysis. Blots were probed with αFLS2 to assess FLS2 protein

accumulation, or αMPK6 to assess equal loading. h, hours; PF, flg22; P, pulse; C,

continuous, RLU; relative light units. (experimental, n=1). (D) Desensitization is specific

to the PAMP used. For the first elicitation (0h), Col0 4 to 5 week old cut leaf disks were

elicited with 100nM AF (inactive flg22 peptide derivative), PF (active flg22 peptide), or E

(elf26 peptide) and ROS production was monitored. Samples were continuously elicited

with indicated PAMP-solution (cont. elicitation). For re-elicitation, all samples were

exposed to 100nM flg22 at 16 hours post-initial treatment. Open bars represent flg22

treatment, grey bars with horizontal strips represent elf26 treatment, diagonal stripes

183

represent AF treatment, and filled black bars represent re-elicitation with flg22. ROS peaks

(10-12 minutes post-elicitation) are shown for all indicated measurements. The respective

ROS measurements within the individual figure panels were performed on the same 96-

well ROS plate for direct comparison. h, hours; AF, inactive peptide; PF, flg22; E, elf26,

RLU; relative light units, P; pulse, C; continuous. (experimental, n=3; samples, n=32)

184


PAMPs.

185

Figure III.II: PAMP-Induced ROS Desensitization Occurs After Six Hours Following

Initial PAMP Treatment in Continuously Elicited Tissue.

(A) and (B) ROS desensitization in continuously elicited samples occurs after six hours

following initial PAMP treatment. For the first elicitation (0h), Col0 4 to 5 week old cut

leaf disks were elicited with either 100nM flg22 (open bar) or 100nM elf26 (grey bar with

horizontal stripes) and ROS production was monitored using a luminol based assay. For

subsequent elicitations (filled black bars), samples were either washed with dH2O after 40

min of treatment ( P; pulse) or continuously elicited with indicated PAMP ( C; continuous).

At the indicated time point, both sample treatments were re-elicited with fresh aliquots of

the same100nM PAMP used for the initial elicitation (4h, 6h, 8h, 10h, 12h and 14h). In

(A), the 14h flg22-treated samples were re-elicited using 100nM elf26 at 14.5h post-initial

elicitation to demonstrate samples were able to generate ROS in response to elicitation

using an independent PAMP ligand. ROS peaks (10-12 minutes post-elicitation) are shown

for all indicated measurements. (experimental, n=3; samples, n=8).

186

Figure III.II: PAMP-Induced ROS Desensitization Occurs After Six Hours Following

Initial PAMP Treatment in Continuously Elicited Tissue.

187



peptides.

(A) ROS production displays desensitization following continuous treatment using P.

syringae DC3000 hrcC-. For the first elicitation (0h), Col0 4 to 5 week old cut leaf disks

were elicited using 1x108 CFU P. syringae DC3000 HrcC-, and ROS production was

monitored using a luminol based assay (at peak, 30-40 minutes following addition of

bacterial solution) . For subsequent elicitations (filled black bars), samples were either

washed with dH2O after 40 min of treatment ( P; pulse) or continuously elicited with P.

syringae DC3000 HrcC- ( C; continuous). At the indicated time point, both sample

treatments were re-elicited with the same 100nM flg22 solution ( 4h, 6h, 8h, and 10h).

(experimental, n=3; samples, n=12) (B) FLS2 protein accumulation correlates with ROS

desensitization. Col0 4 to 5 week old cut leaf strips were elicited (+) with 1x108 CFU

HrcC-, or without ( (-); dH2O) and either washed after 40 minutes using dH2O, or left in

the presence of P. syringae DC3000 HrcC- to simulate continuous treatment. Samples were

flash frozen at the indicated time post treatment. Total proteins were isolated and subjected

to immunoblot analysis. Blots were probed with αFLS2 to assess receptor accumulation,

or αMPK6 to assess equal loading. RLU; relative light units, h; hour, PF; flg22, HrcC-; P.

syringae DC3000 HrcC-, P; pulse, C; continuous. (experimental, n=1)

188



peptides.

189


Elicitation.

(A) ROS desensitization does not occur in leaf tissue syringe infiltrated with flg22.

Representative tissue from Col0 4 to 5 week old leaves were cut into leaf disks and floated

on dH2O overnight. After ~24h, the leaf disks were elicited with 1μM flg22 and monitored

for ROS production (P; 0h, and C; 0h). Simultaneously at the same time of elicitation for

ROS production, Col0 leaf tissue was syringe infiltrated with the same 1μM flg22

elicitation solution used to generate ROS. After 40 minutes, a subset of the leaf disks used

in the ROS assay were washed with dH2O (P; pulse), or left in elicitation solution (C;

continuous). At 1h post-infiltration, once the leaf tissue had dried, leaf disks were removed

from the center of the infiltrated leaf tissue and cut in half and placed into the ROS plate

containing the 0h cut leaf disk samples. Twenty-four hours later, all tissue samples were

re-elicited with 1μM flg22 and monitored for ROS production (P; 24h, C; 24h, IPF; 24h,

and IH2O; 24h). (experimental, n=3; samples, n=24) (B) FLS2 protein accumulation is not

reduced at late time points in tissues syringe infiltrated with flg22. During each treatment

described in (A), a subset of tissue was flash frozen for immunoblot analysis. Total proteins

from those samples were isolated and probed with αFLS2 to assess protein accumulation

24h after initial exposure to its cognate ligand, and αMPK6 to determine equal loading.

RLU; relative light units, h; hour, P; pulse, C; continuous, PF, flg22 (experimental, n=1)

190


Elicitation.

191

Figure III.S1: Confirmation Syringe Infiltration of flg22 Elicited an Immune

Response.

(A) Callose deposition from samples obtained during the experimental approach described

in Figure 4. Samples were taken from the same syringe infiltrated plants used for ROS

production to confirm that the infiltration using 1μM flg22 induced an immune response.

At about 24h post-infiltration, leaf disks from leaves infiltrated with flg22 or with water

were processed to visualize callose deposition using analine blue stain. (experimental, n=2)

192

Figure III.S1 Confirmation Syringe Infiltration of flg22 Elicited an Immune

Response.

193

IV. IDENTIFYING ARABIDOPSIS EPSINR1 AS A REGULATOR OF FLG22-

INDUCED SIGNALING RESPONSES

IV.I Summary

Cell surface receptors are the front-line sentries which contribute to defending

against microbial pathogen invasion and initiate innate immunity in both plants and

animals. In plants, perception of conserve features harbored on whole classes of microbial

pathogens activates pathogen-associated molecular pattern (PAMP)-triggered immunity

(PTI). In the best studied plant PTI-system, perception of bacterial flagellin (or its active

peptide derivative flg22) by the host cell surface receptor flagellin sensitive 2 (FLS2) leads

to activation of immune-signaling pathways contributing to restriction of pathogen growth.

Previously in collaboration with Scott Peck (Univ. of Missouri-Columbia), the Heese Lab

identified EpsinR1 as novel protein phosphorylated in response to flg22. Here, I provide

evidence that EpsinR1 has a role(s) as a positive regulator of early, intermediate, and late

flg22-induced parallel signaling responses using two independent epsinR1 mutant alleles.

Furthermore, I identified two morphological phenotypes in epsR1 alleles indicating that in

addition to its function in flg22-signaling, EpsinR1 has roles as a general cellular signaling

and vesicular trafficking component.

194

IV.II Introduction

In plants, innate immune signaling is the primary defense against invading

microbes. Unlike mammalian organisms, plants do not possess a known acquired immune

system and therefore rely on perception of microbes through recognition of conserved

pathogen-associated molecular patterns (PAMPs) or pathogen-effector proteins to initiate

immunity. Activation of PAMP-triggered immunity occurs through cell surface receptors

which recognize molecular structures conserved in whole classes of microbial pathogens.

Microbial recognition mediated by these PAMP-recognition receptors initiates a plethora

of downstream immune signaling cascades which cause cessation of microbial infection

(181, 219, 231). In the best studied plant PAMP-receptor interaction, a conserved region

of the bacterial flagellum is perceived by the extracellular leucine-rich repeats of the

PAMP-recognition receptor Flagellin Sensitive 2 (FLS2) (185, 214). Perception of flagellin

(or its 22-amino acid peptide derivative flg22) by FLS2 leads to activation of several

parallel immune signaling pathways which contribute to restriction of pathogen growth

(185, 220, 232, 233). Within seconds after ligand perception, FLS2 rapidly hetero-

dimerizes with another receptor-like kinase BAK1 (Brassinosteroid insensitive-1

associated kinase) (194, 204, 234). In the absence of BAK1, all early and late flg22-induced

signaling responses are strongly impaired (194, 204). BAK1 has also been shown to be

required for signaling of additional cell-surface receptors including EF-Tu (or its peptide

derivative elf26) (185, 193, 215), and the brassinosteroid receptor BRI (235, 236). Recent

reports have established that FLS2 undergoes ligand-induced endocytosis through early

195

and late endosomes to a degradative compartment, most likely the vacuole (191, 221).

Endocytic vesicle formation requires recruitment of specific coat and accessory proteins to

initiate membrane invagination and facilitate vesicle scission from the target membrane.

Mammalian and yeast Epsins function at two distinct subcellular locations, the plasma

membrane and trans-golgi network (TGN). Plasma membrane localized Epsins participate

in cargo selection and recruitment of vesicle coat-forming components such as clathrin and

AP-complexes to initiate the internalization step of endocytosis (237-239). Epsins

localized to the TGN initiate clathrin-coated vesicle budding and trafficking of cargo to the

lysosome/vacuole for degradation. Epsin proteins utilize the epsin N-terminal homology

(238) domain for membrane targeting and induction of membrane curvature (237-239).

Binding of PIP(4,5)2 to the ENTH domain stimulates folding of an N-terminal amphipathic

helix, which intercalates into the target membrane to induce invagination and recruitment

of vesicle forming components (237, 240).

In Arabidopsis, three genes encode for Epsin-related proteins (AtEpsinR1, R2, and

R3), which is comparative to yeast and most vertebrate organisms which contain at least 2

epsin paralogs (241, 242). In plants however, there is a paucity of knowledge regarding the

role of Epsin proteins in regulating temporal and spatial recruitment of components

required for clathrin-coated vesicle formation and subsequent trafficking. Arabidopsis

EpsinR1 has been shown to localize to the TGN/PVC and is suggested to have a role in

soluble protein trafficking to the vacuole (243). In collaboration with Scott Peck (Univ. of

Missouri-Columbia), our lab had previously identified EpsinR1 in a large scale phospho-

proteomics screen as a novel vesicular trafficking component phosphorylated in response

196

to flg22-treatment. Prior to my starting to work on the EpsinR1 project, the Heese lab had

isolated two independent mutant alleles containing T-DNA insertions in EpsinR1 in the

Arabidopsis thaliana ecotype Columbia (Col0) background. More specifically, epsR1-2 is

a knock-out, null mutant line (SAIL_394G02, insertion in the fourth intron of the gene)

and epsR1-1 is a knock-down mutant line (SALK_049204, insertion in the EPSINR1

promoter region). Two different peptide-specific antibodies were produced and used to

show that epsR1-2 mutant plants did not accumulate any full-length EpsinR1 proteins

whereas epsR1-1 accumulated reduced levels of full length EpsinR1 protein.

Here, I utilize these two independent mutant alleles to investigate a possible role of

EpsinR1 in flg22-responses. I provide evidence that epsinR1 knock-out and knock-down

mutant alleles show reduced flg22-elicited immune signaling responses. Furthermore, I

identified defective cellular elongation, expansion, and stomatal patterning in epsinR1

alleles.

IV.III Experimental Procedures

Immunoblot Analysis and Antibodies. For sample elicitation, 8-to-10 seedlings which

were 8-days old were floated on 1 mL dH2O overnight in continuous light at 22◦C to reduce

wounding response. The following day, samples were elicited with indicated

concentrations of specified PAMP for 45-50 min, then flash frozen in liquid nitrogen at

indicated times. Sample preparation and immunoblot analyses of total proteins using

antibody concentrations were done as described (204). An exception is that αP-p44/42

MAPK (1:3000) (#4370; Cell Signaling Tech, Danvers, MA) was used to detect

phosphorylated MAPKs. For assessment of EpsinR1 protein accumulation primary

antibodies αEpsin1 #131 were used at a concentration of 1:1000. For PR1 protein

197

accumulation, a polyclonal rabbit antibody raised against a synthetic peptide

(QDSPQDYLRVHNQARC) of the amino terminus of the Arabidopsis PR1 protein (kindly

provided by Xinnian Dong, Duke Univ.) was used at a concentration of 1:1000.

Plant Material and Developmental Measurements. Arabidopsis seedling and plant

growth was at 22◦C as described (204), except that plants were grown in an 8-h light/16-h

dark cycle. epsR1-1, epsR1-2, and bak1-4 are in Col0 background. For primary root length

measurements, seedlings were imbibed in dH2O for three days prior to plating on 0.5% MS

1% sucrose plates. Seedlings were grown horizontally for the indicated number of days in

continuous light. To directly compare developmental measurements, plant genotypes

indicated in respective figure panels were grown on the same plates to eliminate the

possibility of nutrient inconsistencies. 8-day old seedlings were gently removed from MS-

plates, and primary roots were aligned vertically and measured using a ruler. Seedlings

used for primary epidermal root cell length, cotyledon pavement cell expansion, stomata

number and clustering, and cell-type quantification were grown as indicated above except

whole seedlings were stained with Toluidine blue. Overall primary root length, primary

epidermal root cell length, stomata number and clustering, and cellular pools were

quantified using ImageJ and plotted using Graph Pad Prism4 software. Cotyledon

pavement cell expansion was quantified using both Image J and Graph Pad Prism4

software. Morphological phenotypes were imaged using an Olympus vanox upright

microscope with DIC. PAMP-induced callose measurements were imaged using a Leica

stereomicroscope with a ultra-violet filter.

198

Toluidine Blue O (TBO) Staining. Whole seedlings were fixed in 9:1 ethanol:acetic acid

solution at room temperature, in the dark, overnight. After ~24 hours, tissue was washed

in consecutive ethanol at 85% and 70% concentration for 30 minutes each. Ethanol was

replaced with TBO (0.5% w/v TBO; Sigma #198161 in 50% ethanol) stain for 3 minutes.

Stained tissue was washed several times with 30% ethanol solution and mounted in 15%

glycerol solution.

Apoplastic ROS Production. For seedling elicitations, cotyledons were cut into two,

roughly equal, pieces and placed into one well of a 96-well plate. For leaf tissue elicitations,

half of a cut leaf disk (1.1cm2) of 4-5 week old plants was placed into one well of a 96-

well plate. Samples were assayed for individual ROS production measurements using a

luminol-based assay (204). Although absolute values of ROS production [displayed as

Relative Light Units; RLUs] varied from experiment to experiment, the actual trends were

always the same.

Callose Deposition. 8-day old seedlings were removed from 0.5 MS 1% sucrose plates

and floated in dH2O overnight to reduce wounding responses. After 24 hours, dH2O was

exchanged with dH2O containing the appropriate concentration of indicated PAMP.

Seedlings were incubated in PAMP solution for 24 hours before being placed directly into

95% ethanol overnight at room temperature. For syringe infiltration, adult leaf tissue of 4

to 5 weeks plants grown in soil were syringe infiltrated using 10nM flg22, 10nM AF

(inactive flg22 peptide derivative), or with dH2O, and collected directly into 95% ethanol

solution 24 hours post-infiltration. After the 95% ethanol incubation, tissue was rinsed in

50% ethanol and incubated in 67 mM potassium phosphate (K2HPO4; pH 12) buffer for 1

199

hour. Tissue was stained using 0.01% analine blue/potassium phosphate buffer solution for

1h in the dark at room temperature. Stained tissue was mounted in 70% glycerol, 30%

67mM K2HPO4 solution.

Quantitative Real-time PCR Analysis. For sample elicitation, 8-to-10 seedlings which

were 8-days old were floated on 1 mL dH2O overnight at 22◦C in continuous light to reduce

wounding response. Samples were elicited with 10nM flg22 for 1 or 4hours, then flash

frozen in liquid nitrogen. Total RNA was isolated and real-time PCR reactions were

performed and analyzed as described in (206) using the following primers WRKY29-f 5’-

AAGGATCTCCATACCCAAGGAGT-3’ and WRKY29-r 5’-

TCGACTTGTTTTCTTGCCAAACAC -3’ and FRK1-f 5’-

ATCTTCGCTTGGAGCTTCTC -3’ and FRK1-r 5’-TGCAGCGCAAGGACTAGAG -3’

primers using the expression of At2G28390 (SAND family protein) SAND-f 5’-

AACTCTATGCAGCATTTGATCCACT-3’ and SAND-r 5’-

TGATTGCATATCTTTATCGCCATC-3’ to normalize all qRT-PCR results (206).

Statistical Analysis. Statistical significances based on unpaired two sample t-test were

determined with Graph Pad Prism4 software.

IV.IV Results

EpsinR1 is a Positive Regulator of Early-Induced flg22-Signaling Responses.

Before testing whether EpsinR1 was required for flg22-induced signaling responses I first

needed to confirm that in my hands both epsR1 mutant lines were impaired in EpsinR1

protein accumulation. Using immunoblot analysis, 8-day old seedling total proteins were

200

analyzed to determine the amount of EpsinR1 protein accumulation. No full length

EpsinR1 protein was detectable in epsR1-2 seedlings, and protein accumulation was greatly

reduced in epsR1-1 seedlings, compared to Col0 (Figure 1A). These results are consistent

with a previous report which determined EpsinR1 protein accumulation in epsR1-1 mature

leaf tissue to be roughly ~10-20% of wild-type EpsinR1 levels (243).

To delineate the role(s) of EpsinR1 in flg22-induced signaling pathways, we

examined well characterized early, intermediate, and late responses in epsR1-1 and epsR1-

2 alleles. Early (~10 minutes post-elicitation) flg22-induced signaling responses were

assessed by monitoring reactive oxygen species (ROS) production and mitogen-activated

protein kinase (MAPK) phosphorylation. Using a luminol-based assay, I monitored ROS

production for 40 minutes following 10nM flg22-treatment of 8-day old cut cotyledons. As

depicted in Figure 1B, peak ROS production (10 minutes post-elicitation) was significantly

decreased in both epsR1 alleles. A similar trend was confirmed in 4 to 5 week old leaf

tissue (Fig S1A). Elicitation using dosages of flg22 and elf26 peptides (an independent

ligand for the PAMP receptor EFR) as low as 1nM on 8-day old cut epsR1-2 cotyledons

indicated significantly decreased ROS production compared to Col0 (Fig S1B and S1C).

Phosphorylation of MAPKs 6 and 3 in epsR1 alleles was also decreased following flg22-

treatment. We examined MAPK phosphorylation in response to flg22 elicitation using a

αP-p44/42 MAPK antibody, which detects only phosphorylated forms of MPK 6 and 3.

PAMP-induced MAPK phosphorylation is transient, with peak phosphorylation occurring

about 10 minutes post-elicitation, and de-phosphorylation occurring from 30-60 minutes

post-elicitation (232). Immunoblot analysis using total proteins isolated from 8-day old

201

seedlings indicated decreased MAPK phosphorylation in both epsR1 alleles 10 minutes

following flg22-treatment (Figure 1C, lanes 2, 4, and 6; P-MPK panel). Preliminary results

indicate this was not due to a shift in peak MAPK-phosphorylation. As indicated by Fig

S2A, flg22-treated Col0 seedlings displayed peak MAPK-phosphorylation 10-15 minutes

following treatment, with significant de-phosphorylation occurring by 30 minutes.

However in epsR1-2 seedlings, no well-defined peak occurred following flg22-treatment,

rather, it appeared there was only a slight increase in flg22-stimulated MAPK-

phosphorylation. Additionally, we determined that the lack of strong MAPK-

phosphorylation was not due to decreased MPK6 protein accumulation by using an anti-

MPK6 antibody as a loading control (Figures 1C and S1A, MPK6 panels).

Role for EpsinR1 in Intermediate and Late-Induced flg22-Signaling

Responses. Further investigation revealed that downstream flg22-induced signaling

responses display decreased activation in both epsR1 alleles. Preliminary analysis of flg22-

induced gene induction using two independent downstream markers of MAPK-cascade

activation revealed that inducible expression was decreased in both mutant alleles

compared to wild-type (232, 244, 245). WRKY29 has been previously reported to have

induced mRNA expression ~1h following flg22-treatment, while FRK1 is reported to have

induced expression ranging from 2-4 hours following flg22-treatment (232). To maintain

consistency with our previous findings, we treated Col0, epsR1-1, and epsR1-2 8-day old

seedlings with 10nM flg22 to examine both WRKY29 and FRK1 mRNA transcript

accumulation. As shown in Figures 2A and 2B, both epsR1 mutant alleles demonstrated

highly significant decreases in WRKY29 and FRK1 transcript accumulation in response to

202

flg22-elicitation. These results are consistent with our previous findings in which MAPK

phosphorylation is significantly decreased in epsR1 mutant alleles following flg22-

treatment and suggests signal abrogation occurs upstream of MAPK 6 and 3 in the absence

of EpsinR1.

Preliminary results also indicate callose deposition and PR1 protein accumulation,

which are significantly induced ~24 hours following PAMP-perception in Col0, are

decreased in the absence of EpsinR1. These assays were performed through syringe-

infiltration of 100nM flg22 directly into the apoplastic space of 4 to 5 week old adult leaf

tissue. ROS results indicated flg22-induced signaling responses displayed decreased

amplitude in epsR1 adult leaves compared to Col0, recapitulating phenotypic results

obtained from experiments utilizing seedling tissues (Fig S1A). Callose is a β-1,3-glucan

polymer which is believed to serve as a matrix for antimicrobial deposition at the apoplast-

extracellular environment interface during pathogen infection (246). Using aniline blue

stain, which is visualized as punctate bodies, we detected significantly decreased callose

accumulation in epsR1-2 leaf tissue 24 hours following infiltration using 10nM flg22

compared to Col0 (Figure 2C). Controls infiltrated with 10 nM AF, an inactive flg22-

peptide derivative, displayed little-to-no callose deposition in either genotype (data not

shown). The plasma membrane callose synthase PMR4 is thought to be responsible for a

majority of callose synthesis and deposition in response to bacterial and fungal pathogens

in Arabidopsis (247-249). Although the mechanism of signal transduction is not fully

understood, callose deposition may be downstream of ROS production based on the fact

that rbohD mutants exhibit fewer callose deposits after flg22 treatment (250). Therefore,

203

decreased flg22-induced callose deposition is consistent with decreased ROS production

shown in Figure 1A.

SA-signaling leads to transcript accumulation of PR genes, and is considered to be

an important molecular signal for PTI and systemic resistance against pathogens. Mutants

deficient in SA-biosynthesis, or PR gene-product accumulation, display increased

susceptibility against bacterial infection (251-253). Considerable PR1 protein

accumulation occurs as early as ~24 hours following PAMP-perception (254), with

significant transcript accumulation occurring at ~12 hours (255). We wanted to determine

whether PR1 protein accumulation is impaired following flg22-treatment in epsR1 mutant

alleles leading up to 24 hours post flg22-treatment. Immunoblot analysis probing total

proteins from 4 to 5 week old epsR1-2 leaf tissues that were syringe-infiltrated with 100nM

flg22 detected decreased PR1 protein accumulation using a synthetic peptide raised against

a N-terminal portion of PR1 compared to Col0 (Figure 2D). We were able to detect slight

PR1 protein accumulation as early as 16 hours in Col0 leaf tissue, with increase PR1

accumulation at 24 hours post-infiltration. However, preliminary results using epsR1-2

infiltrated leaves indicated almost no PR1 protein accumulation until approximately 20

hours post-infiltration.

BAK1-Dependent, but not BAK1-Independent Signaling Mechanisms

Disrupted in epsR1. To determine if decreased flg22-induced signaling responses were

due to lack of FLS2 protein accumulation in epsR1 alleles, we assessed total FLS2 protein

accumulation using 8 day old seedlings. Immunoblot analysis using total proteins from 8-

204

day old seedling samples displayed similar levels of steady-state FLS2 protein

accumulation in epsR1-2 compared to Col0 (Figure 3A). These results indicate that

decreased flg22 signaling responses are not due to reduced, or lack of, FLS2 protein

accumulation in the absence of EpsinR1. To further understand the mechanism(s)

attributing to decreased flg22-induced signaling responses in epsR1 seedlings, I compared

signaling competency of independent bacterial and fungal PAMP receptors FLS2, EFR and

CERK1. EFR perceives the bacterial PAMP EF-Tu (or its peptide derivative elf26) and

signals primarily through BAK1-dependent mechanisms (193), whereas CERK1, which

recognizes the fungal PAMP chitin (256, 257), signals through BAK1-independent

mechanisms. Preliminary results shown in Figure 3B demonstrate decreased MAPK

phosphorylation using 8-day old epsR1-2 and bak1-4 seedlings following treatment with

10nM flg22, but not after treatment with 100μg/mL chitin, compared to 8-day old Col0

seedlings. As a positive control, bak1-4 null seedlings were included to compare relative

strength of PAMP-induced MAPK phosphorylation. To determine if this same trend

occurred in an independent signaling pathway, we performed experiments focused on

callose deposition. Examination of callose deposition using 8-day old cotyledons treated

with 10nM flg22, 10nM elf26, or 100μg/mL chitin revealed results consistent with MAPK-

phosphorylation (Figure 3C; controls treated with an inactive peptide show no deposition,

data not shown). Both flg22 and elf26-induced callose deposition were decreased in epsR1-

2 and bak1-4 compared to Col0; however, callose deposition in response to chitin

elicitation appeared increased compared to flg22- and elf26-treatments (Figure 3C). These

results suggest epsR1 mutants may be compromised in PAMP-induced-BAK1-dependent

signaling pathways, but not in BAK1-independent signaling pathways. Because BAK1

205

serves as the co-activator of both FLS2 and BRI1, a defect in BAK1 functionality would

result in decreased BR-induced-signaling subsequently inhibiting cellular elongation and

expansion, as well as changing stomatal patterning. Additionally, flg22- and elf26-induced

signaling pathways would display decreased activation following PAMP treatment.

Abrogated Cellular Elongation and Expansion Revealed in epsR1 Mutant

Alleles. To ensure tissue surface areas exposed to flg22-peptide were relatively similar

between epsR1 and Col0 seedlings, we examined various facets of growth and development

for gross morphological alterations. Initial observations revealed no significant differences

in cotyledon size and weight when comparing Col0, epsR1-1, and epsR1-2 8-day old

seedlings (Figure 4A, and data not shown). However, closer examination revealed epsR1

seedlings displayed significantly stunted primary root lengths when grown on horizontal

plates. Seedlings were imbibed in water for 3 days, plated on 0.5% MS 1% sucrose plates,

and grown horizontally for 8 days in 24 hour light. At 8-days post-germination, seedlings

were extracted and primary root lengths were compared. As shown in Figures 4B and 4C,

epsR1-1 and epsR1-2 seedlings displayed significantly reduced primary root lengths

compared to Col0 controls. Primary root length stunting in epsR1-1 seedlings was not as

severe as epsR1-2, most likely due to low levels of EpsinR1 protein accumulation.

Importantly, our flg22-induced signaling assays primarily utilized seedling cotyledons at a

developmental stage shown in Figure 4A. As shown, cotyledon surface area exposed to

flg22 peptide appeared similar between mutant and wild-type seedlings.

206

To gain a better understanding of how epsR1 seedlings developed over time, we performed

time course analyses focusing on root and aerial tissue development. Comparative analysis

between Col0, epsR1-2, and epsR1-1 seedlings at 5, 7, and 10 days post-germination

revealed primary root length stunting may be due to a defect in cellular elongation and

tissue expansion. To ensure results were not biased by variations in nutrient content of

plates used throughout the growth period, epsR1 and Col0 seedlings were grown on the

same plates and extracted at the indicated number of days post-germination. As depicted

in Figures 5A and 5B, analysis of primary epidermal root cell lengths over time indicated

that epsR1-2 and epsR1-1 root cells did not elongate as extensively as Col0 controls.

Interestingly, epsR1-2 and epsR1-1 primary epidermal root cells displayed differential

phenotypes at 5 days post-germination, which is most likely attributed to low levels of

EpsinR1 protein accumulation in the epsR1-1 mutant allele. At 7 days post-germination,

epsR1-1 primary root lengths displayed significant stunting compared to Col0. This growth

pattern was documented multiple times and may suggest the requirement for EpsinR1 is

necessitated during this growth period, and regardless of low level EpsinR1 accumulation,

cells fail to undergo appropriate cellular elongation. Loss of EpsinR1 may constrain

movement of specific components, or cargoes, required for adequate signal propagation

within these pathways; nevertheless, restricted root cell elongation would cumulatively

result in global primary root length stunting observed in Figures 4B and 4C.

To determine if similar developmental abnormalities occurred in aerial tissues,

seedlings used for primary epidermal root cell elongation measurements were analyzed for

pavement cell expansion by examining the cotyledon abaxial surface (Figures 5C and 5D).

207

My results indicate that over time, epsR1 cotyledon pavement cells do not expand as

extensively as Col0 pavement cells at the same developmental stage. Additionally,

cotyledon pavement cell expansion over time displayed an identical trend compared to

primary root elongation in both epsR1 alleles (Figures 5A and 5B). Although overall

cotyledon size is similar between 8-day old epsR1 and Col0 seedlings (Figure 4A), we

observed significant rosette stunting in adult epsR1 plants 4 to 5 weeks in soil, compared

to Col0 (Fig S2A).

Stomatal Patterning and Distribution is Altered in epsR1 Alleles. To further

explore developmental defects in epsR1 alleles, I examined stomatal patterning on the

abaxial surface of epsR1 8-day old cotyledons using toluidine blue stain. Interestingly, I

discovered increased number of absolute stomata and even identified stomatal clusters in

epsR1 seedlings, compared to Col0 (Figure 6A). As a comparison, I quantified the number

and classes of stomatal clusters observed for epsR1 seedlings to bak1-4 null seedlings,

which are lacking BAK1, the co-activator of FLS2 and multiple other cell surface receptors

(258, 259). As shown in Figures 3B and 3C, the absolute number of stomata, as well as the

number of double and triple stomatal clusters in epsR1 cotyledons, is strikingly similar to

bak1-4 cotyledons. By taking a genetic approach, previous work has categorized similar

stomatal clustering phenotypes in various BR-defective and -insensitive mutants (260,

261). Additionally, as discussed for Figures 2C and 2D, decreased cellular expansion in

epsR1 alleles may produce an increased number of stomata within a defined area of tissue;

therefore, to determine if the alteration in stomatal patterning was due to a lack of cellular

expansion, we assessed the total number of cells: pavement cells, guard cell pairs, and

208

meristemoid precursor cells, in epsR1 and Col0 cotyledons at 5, 7, and 10-days post-

germination. Comparison between these cellular pools revealed that the increased number

of stomata was not due to a lack of cellular expansion (Fig S2B and S2C and Table S1);

rather, our data suggest the change in stomatal patterning may arise from mis-regulation of

precursor stem cells which differentiate into guard cell pairs.

IV.V Conclusions

I provide evidence that EpsinR1 has a role(s) in promoting tissue growth and

development and functions as a positive regulator of distinct PAMP-induced signaling

pathways. Using PAMP-induced and morphological phenotypes in epsR1 seedlings, we

gained insights into determining possible signaling pathways abrogated in the absence of

EpsinR1. Analysis of developing epsR1 seedlings revealed decreased primary epidermal

root cell elongation and cotyledon pavement cell expansion at 5, 7, and 10 days post-

germination compared to Col0. The loss of EpsinR1 may affect developmental intracellular

signaling pathways which have been shown to be important for the localization and

intracellular trafficking of activated copper, iron, and boron transporters utilized in

developmental pathways (262-264). Additionally, auxin and brassinosteroid hormonal

signaling pathways have been shown to be regulated in a similar fashion (201, 235, 265,

266). Hormonal signaling pathways in plants are rather complex and defective tissue

elongation and expansion could arise from multiple hormonal signaling imbalances;

therefore, we sought to identify additional developmental defects which may shed light on

possible hormonal imbalances in the absence of EpsinR1. New evidence has identified a

role for BR-signaling in regulation of stomata formation in newly developing tissues.

209

Brassinosteroid-deficient, and –insensitive, mutants display an increase in stomatal

clusters, which has led to the proposition that BR-signaling negatively regulates stomatal

development through BIN2-mediated inhibition of YODA. When YODA is active, it

suppresses activity of transcription factors responsible for stomatal differentiation such as

SPEECHLESS, FAMA, TMM, and MUTE (267-270). Although the complete mechanism

is unresolved, it is clear that BR-signaling influences activity of the transcription factor

SPEECHLESS and the kinase YODA (260, 261, 271). Analysis of the abaxial surface of

epsR1 cotyledons revealed increased stomata number and stomatal clustering compared to

Col0. Interestingly, we observed epsR1 stomatal numbers and patterning were strikingly

similar to bak1-4 null mutants. Recent evidence implicates an antagonistic relationship

between BR-signaling and PAMP-induced signaling pathways (272, 273). Although the

mechanism of action is currently debated, initial speculation focused on the obvious

candidate BAK1, seeing as it serves as the co-activator to BRI1 and multiple PAMP

receptors, including FLS2. In the absence of BAK1 all early and late flg22-induced

signaling responses are strongly impaired (194, 204). Treatment of 8-day old seedling

tissues using flg22 indicated early, (ROS production; 10 min post-elicitation) and late

(callose deposition; 24h post-elicitation) signaling responses associated with the RBOHD-

branch of PAMP-induced signaling showed decreased activation in epsR1 seedlings

compared to Col0. Similarly, early (MAPK-phosphorylation; 10 min post-treatment) and

intermediate (WRKY29 and FRK1 transcript accumulation; 1h and 4h post-treatment,

respectively) flg22-induced signaling responses associated with the MAPK branch of

PAMP-induced signaling also exhibited decreased activation in 8-day old epsR1 seedlings,

compared to Col0 following flg22-treatment. Because signal transduction within the

210

respective RBOHD and MAPK branches of PAMP-induced signaling is believed to occur

independently, we reasoned that decreased flg22-signaling may stem from abrogated

receptor-complex formation, dysfunction of specific receptor-complex component(s),

and/or a lack of accumulation of receptor component(s) at the plasma membrane. Analysis

of total FLS2 protein levels using 8-day old epsR1-2 and Col0 seedlings revealed that

decreased flg22-induced signaling was not due to lack of FLS2 protein accumulation;

rather, it may be due to dysfunction of a critical receptor-complex component such as

BAK1, or due to lack of accumulation of FLS2 or other receptor-complex components at

the plasma membrane. We provide support suggesting BAK1-dependent signaling

pathways, but not BAK1-independent signaling pathways, may not function correctly in

epsR1. Examination of signaling competency for independent bacterial and fungal PAMP

receptors EFR (EF-Tu Receptor) and CERK1, respectively, revealed that elf26-treatment

demonstrated decreased signaling for ROS production and callose deposition in epsR1-2;

however, elicitation using chitin displayed no significant difference in callose deposition

and MAPK-phosphorylation in epsR1-2, compared to Col0 seedlings. These preliminary

results suggest that signaling defects in epsR1 mutants are not due to a general cell-

signaling defect but rather are specific to a class of elicitors (bacterial vs. fungal), specific

to signal a transduction mechanism (BAK1-dependent vs. BAK1-independent), or specific

to an EpsinR1-dependent vesicular trafficking pathway. Collectively, our PAMP-induced

signaling results taken together with our analysis of morphological defects in epsR1

suggests BAK1-dependent signaling pathways may be compromised in the absence of

EpsinR1. As described below, further experimentation is needed to identify if BAK1

211

dysfunction, or lack of accumulation, is a potential causative agent for the collective

experimental observations.

IV.VI Future Directions

All tested flg22-induced signaling responses in epsR1 mutants displayed decreased

activation compared to WT controls. Decreased amplitude for early, intermediate, and late

stage PAMP-induced signaling responses in epsR1 are consistent with abrogated receptor-

complex formation, defective initiation of signal transduction, or mis-localization of

receptor-complex components. Because total FLS2 protein accumulation is similar

between epsR1 and WT, one explanation may be that other factor(s), possibly BAK1, as

being the causative component(s) producing the documented phenotypes. It is also

important to note that observed signaling defects may originate from abrogation of

activated receptor internalization and endocytic trafficking. In mammalian systems, the

innate immune receptor TLR4 has been shown to have compartmentalized signaling

following perception of its cognate ligand (274). Although this signaling phenomenon has

not been demonstrated for FLS2, it could be an explanation for the decreased signaling

amplitude in epsR1 mutants. Activated FLS2 protein may enter endocytic trafficking

pathways, but in the absence of EpsinR1, may be unable to reach a unique endosomal

signaling compartment wherein amplification of signaling occurs through specific adaptor

molecules, resulting in decreased activation of ROS and MAPK signaling pathways.

212

1. Because all documented flg22- and elf26-induced signaling responses display

decreased activation, it is a logical extension to propose that immunity against both

virulent and avirulent bacterial pathogens would not be as robust in epsR1 mutant

plants, compared to Col0. Inoculation using the isogenic bacterial mutant

Pseudomonas syringae DC3000 hrcC- would assess if bacteria lacking a functional

type-three secretion system could multiply to a higher titer in epsR1 plants because

of decreased PAMP-induced signaling pathways. Inoculation would need to be

carried out directly using syringe-infiltration to circumvent experimental bias from

other inoculation techniques, such as spray inoculation, due to the increase of

stomatal number and clustering in epsR1 plants. As controls, Col0 and sid2-2 would

be included to assess infection in WT plants and infection of mutant line known to

have increased susceptibility to bacterial infection, respectively. Additionally, to

further test the ability of epsR1 plants to mount a robust immune response,

inoculation using the virulent bacterial strain Pseudomonas syringae DC3000 could

be used. This bacterial strain retains its type three secretion system and is able to

inject roughly 30-50 effectors into the host tissue (275). Inoculation would be

carried out in the same manner as described above using the same plant lines.

2. As discussed above, BAK1 could be a possible target responsible for the observed

signaling phenotypes. Serving as the co-activator of FLS2, impaired function, lack

of BAK1 protein accumulation at the plasma membrane, or disrupted FLS2-BAK1

complex formation, would result in decreased signaling through all flg22-induced

signaling pathways. A direct way to test this hypothesis would be to use

213

immunoblot analysis on microsomal, or total, protein isolations from both epsR1

and Col0 seedlings, or leaf tissue, and probe using the lab’s anti-BAK1 antibody.

If BAK1 protein does not accumulate, accumulates to reduced levels, or does not

localize to the plasma membrane in epsR1 compared to Col0, this would likely

explain all observed phenotypes.

Two experimental approaches to determine if BAK1 function is abrogated would

be to cross the epsR1 plants with the bak1-4 plants to generate double-mutants and

to use antagonists of the BR-signaling pathway, such as BL and BRZ, and use

qPCR analysis to look at induction or repression of specific genetic markers in the

BR-signaling pathway. Briefly, I will go into further detail regarding both of these

approaches. The genetic approach is relatively straight forward. The epsR1-2

knock-out line would be crossed with the bak1-4 null mutant line to create a double

mutant. Using the same signaling assays shown and described in the results section

(ROS production and MAPK-phosphorylation) one could determine if the double-

mutant displayed addative signaling defects, or if no change occurred. For

comparison, both epsR1-2 and bak1-4 single mutants and Col0 would be included

in these analyses. If no additive or synergistic change in signaling amplitude

occurred, then one could suggest that the protein affecting in the absence of

EpsinR1 is either BAK1 or receptor-complex formation.

For the second approach, BR-signaling would be used to determine if BAK1

function is abrogated in epsR1 because BAK1 is the co-activator of the BR-receptor

214

BRI1. Several morphological phenotypes were described in the results section (cell

expansion, elongation, and stomata formation) which cumulatively suggest BR-

signaling is decreased in epsR1 plants. Two well characterized genetic markers

used for analysis of BR-signaling are CPD and DWF4 (82, 276). We would analyze

both treated and non-treated samples of epsR1-2 and Col0 8-day old seedlings to

maintain consistency with our previous findings. For treatment, brassinolide (BL)

and/or brassinazole (BRZ) would be used on respective samples to effectively

suppress the transcript accumulation of CPD and DWF4. We would treat seedlings

for 3h (the time point most consistently used in the literature) with BL/BRZ (+), or

without (-, dH2O) and perform qPCR analysis comparing CPD and DWF4 in both

epsR1-2 and Col0 seedlings at 0h and 3h following treatment. The 0h time point

will be crucial because, based on literature and observed phenotypes in epsR1

seedlings, our data suggest that CPD and DWF4 may be elevated at 0h in epsR1

seedlings compared to Col0. We would expect that analysis of the 3h time point

would reveal suppression (decreased mRNA accumulation) of these two markers

in Col0 samples, but none, or minimal, suppression in epsR1-2 samples because

signaling through the BR pathways would not occur as strongly due to possible

BAK1 dysfunction.

Another readily utilized analysis which could be used in conjunction with the

aforementioned BR-treatment is immunoblot analysis of BES1 protein

phosphorylation. BES1 is a protein in the BR-signaling pathway which is upstream

of CPD and DWF4 and its phosphorylated and de-phosphorylated forms are readily

215

detectable using immunoblot analysis. Samples would be treated with (+) BL/BRZ,

or without (-, dH2O) for 0h and 3h and total proteins would be isolated and

subjected to immunoblot analysis. Again, the 0h time point is of importance

because there may be an equilibrium shift of the phosphorylation/de-

phosphorylation state of BES1 in epsR1-2 seedlings compared to Col0. In the

presence of BL/BRZ we would expect BES1 to shift to the de-phosphorylated state

in Col0 samples, but not as strong of a shift, or no shift, in epsR1-2 samples.

3. Another question is whether FLS2 is degraded in the absence of EpsinR1? Because

EpsinR1 has been shown to localize to the EE/TGN and PVC compartments (243),

one may hypothesize that in epsR1 plants FLS2 may not degraded following flg22-

perception. To determine if FLS2 is degraded following ligand-perception, epsR1-

2 and Col0 seedlings would be treated with 100nM flg22 and samples would be

collected at 0, 10, 20, 30, 40, and 60 minutes following treatment. These time points

were chosen specifically because FLS2 has been shown to be internalized and

degraded from 30-60 minutes following ligand perception (191, 221). Total

proteins would be isolated and subjected to immunoblot analysis and probed using

αFLS2 antibody to assess degradation over time. If EpsinR1 has a direct, or indirect,

role(s) in trafficking FLS2 to a degradative compartment, we would expect to see

less, or no, FLS2 degradation in epsR1-2 compared to Col0 during this time course

in response to flg22. We have also established that following degradation FLS2

accumulated in a signaling competent state over time (Salamango, in prep.). It

would also be interesting to determine if EpsinR1 has a role in trafficking newly

216

synthesized FLS2 protein to the plasma membrane. Following a similar

experimental approach as listed above, one would expand the time course to focus

on times greater than 1h, including an intermediate time at 3h and a late time at

16h. Initially, immunoblot analysis of total FLS2 protein could be used to assess

degradation and accumulation following flg22-treatment. However, if this

methodology does not yield conclusive results, one could test the role of EpsinR1

in FLS2 protein secretion using two-phase partitioning to determine if FLS2 protein

co-localizes with known plasma membrane markers following flg22-treatment.

217


Signaling Responses.

(A) EpsinR1 protein accumulation in allelic T-DNA insertion lines. Total proteins from

Col0, epsR1-1 (SALK_049204), and epsR1-2 (SAIL_394G02) 8-day old seedlings were

isolated and subjected to immunoblot analysis. Samples were probed using αEpsinR1 #131

to determine EpsinR1 protein accumulation, and αMPK6 to assess equal loading

(repeats=3). (B) flg22-induced ROS production is decreased in epsR1. Cut cotyledons from

8-day old seedlings were elicited with 10nM flg22 and ROS production was monitored for

40 minutes using a luminol based assay (RLU= relative light units). Filled squares

represent Col0, open squares represent epsR1-1, and grey squares represent epsR1-2

(n=32/genotype) (repeats≥10). Statistical difference between epsR1 alleles and Col0 is ***

p<0.0001 (C) flg22-induced peak MAPK-phosphorylation is decreased in epsR1 alleles.

Whole 8-day old seedlings were elicited with (+), or without (-), 10nM flg22 for 10 minutes

and total proteins were subjected to immunoblot analysis. Samples were probed with αP-

p44/42 MAPK to assess flg22-induced phosphorylation of MPK6 (P-M6) and MPK3 (P-

M3), and with αMPK6 to determine MAPK6 accumulation and equal loading. (repeats=3)

218


Signaling Responses.

219


Responses.

(A) and (B) flg22-induced transcript accumulation of WRKY29 and FRK1 mRNA is

significantly reduced in epsR1 alleles. Whole 8-day old seedlings were treated with 10nM

flg22 (1h, or 4h), or without (0h, dH2O), for the indicated time and flash frozen. Samples

were processed for qRT-PCR using At2g28390 as the reference gene. Filled bar represents

Col0, open bar represents epsR1-1, and grey bar represents epsR1-2. Results depicted as

relative expression normalized to At2g28390. Asterisks represent the degree of significant

difference (**; p<0.001, ***; p<0.0001) between epsR1-2 and Col0. (repeats= 1 biological

rep with an n=3) (C) Callose deposition following flg22-treatment is reduced in the absence

of EpsinR1. Adult 4 to 5 week old leaf tissue was syringe infiltrated with10nM flg22 and

analyzed for callose deposition 24 hours post-infiltration using analine blue stain. Scale bar

represents 50nm and ** represents p<0.001. (repeats=2) (D) flg22-indcued PR1 protein

accumulation is reduced in epsR1. 4 to 5 week old leaf tissue was syringe infiltrated using

100nM flg22 (+), or water (-) and flash frozen at the indicated time post-infiltration. Total

proteins from samples were subjected to immunoblot analysis and probed using αPR1 to

assess PR1 protein accumulation, or αMPK6 to assess equal loading. h, hour; PF, flg22;

MPK6, MAPK6. (repeats=1).

220


Responses.

221


(A) Total FLS2 protein accumulation is similar between Col0 and epsR1. Total proteins

from un-elicited 8-day old seedlings were subjected to immunoblot analysis and probed

using αFLS2 to assess FLS2 protein accumulation, or αMPK6 to show equal loading.

(repeats≥3) (B) Decreased PAMP-induced MAPK-Phosphorylation in epsR1 is PAMP-

dependent. Whole 8-day old seedlings were elicited with 10nM flg22 or 100μg/mL chitin

for 10 minutes and flash frozen. Total proteins from samples were subjected to immunoblot

analysis and probed with αP-p44/42 MAPK to assess PAMP-induced phosphorylation of

MPK6 (P-M6) and MPK3 (P-M3), and with αMPK6 to assess equal loading. (repeats=1)

(C) Decreased PAMP-induced callose deposition in epsR1 is PAMP-dependent. 8-day old

seedlings were submerged in either 10nM flg22, 10nM elf26, or 100μg/ml chitin for 24

hours. Samples were stained using aniline blue to assess callose deposition. Scale bar

represents 50nm. (repeats=1).

222


223


Germination.

(A) Comparison of 8-day old seedling aerial tissue. Representative Col0, epsR1-1, and

epsR1-2 8-day old seedlings were removed from 0.5% MS 1% sucrose plates and aerial

tissue was imaged for comparison. (repeats=3) (B) and (C) Primary root length is stunted

in epsR1 alleles. Col0, epsR1-2, and epsR1-1 8-day old seedlings were grown horizontally

on 0.5% MS 1% sucrose plates and gently extracted for primary root length measurements.

Image depicts representative seedlings from an individual growth period. White bars

represent primary root tips to highlight overall lengths. (repeats ≥5) (C) Root lengths were

statistically analyzed (n=30) and filled bars represent Col0, grey bars represent epsR1-2,

and open bars represent epsR1-1. Asterisks represent a significant difference between

mutants and wild-type primary root lengths (**; p<0.001, ***; p<0.0001). (repeats ≥5).

224


Germination.

225


Pavement Cell Expansion.

(A) and (B) Mutant epsR1 seedlings exhibit shortened primary epidermal root cells.

Primary epidermal root cell length measurements for seedlings 5, 7, and 10 days post-

germination (n=20 for each time point) Asterisks *** represent p<0.0001. Filled bars

represent Col0, Grey bars represent epsR1-2, and open bars represent epsR1-1.

(repeats=3). (C) and (D) Mutant epsR1 pavement cells exhibit inhibited cellular

expansion. Cotyledon pavement cell area measurements for seedlings 5 (n≥130), 7

(n≥100), and 10 (n≥70) days post-germination (repeats=3). Filled bars represent Col0,

grey bars represent epsR1-2, and open bars represent epsR1-1. Asterisks **,*** indicate

a highly-significant difference between mutant and wild-type measurements p<0.001 and

p<0.0001 respectively. μm; micrometers, μm2; micrometers squared (surface area).

226


Pavement Cell Expansion.

227

Figure IV.VI: Increased Stomatal Number and Clustering in epsR1 Alleles.

(A) Mutant epsR1 seedlings display increased stomatal number and clustering.

Representative images of the abaxial surface of toluidine blue stained 8-day old cotyledons.

* Asterisks highlight the presence of stomata on the surface of stained cotyledons. Scale

bar represents 50nm. (repeats=3) (B) Quantification of absolute stomata number per ocular

field of view present on the abaxial surface of 8-day old cotyledons following toluidine

blue staining (n=total from 5 independent fields of view). Filled bar represents Col0, grey

bar represents epsR1-2, open bar represents epsR1-1, diagonally striped bar represents

bak1-4. Asterisks **, *** indicate a significant difference between wild-type and mutant

stomatal counts p<0.001 and p<0.0001 respectively. (repeat=1). (C) Similarity between

epsR1 and bak1-4 stomatal clustering on the abaxial surface of 8-day old cotyledons.

Doubly and triply clustered stomata were quantified on the abaxial surface of 8-day old

seedlings following toluidine blue staining. The number depicted represents the sum across

3 independent images taken from one cotyledon. (repeat=1).

228

Figure IV.VI: Increased Stomatal Number and Clustering in epsR1 Alleles.

229


Dependency.

(A) Adult leaf tissue displays decreased ROS production following flg22-treatment. 4 to

5 week old cut leaf disks were elicited with 10nM flg22 and ROS production was

monitored over 40 minutes using a luminol based assay (RLU=relative light units). Filled

squares represent Col0, grey squares represent epsR1-2, and open squares represent

epsR1-1 (n=32/genotype) (repeats=3). (B) and (C) Seedlings display decreased ROS

production using titrations of PAMPs as low as 1nM. 8-day old cut cotyledons were

elicited with either 1, 5, or 10nM of the indicated PAMP and ROS production was

monitored over 40 minutes using a luminol based assay (RLU= relative light units). ROS

production depicted occurred at 10-12 min post-elicitation and was taken at the peak of

ROS production for each treatment. Filled bars represent Col0, grey bars represent

epsR1-2. Each set of PAMP titrations were run on the same 96-well ROS plate for direct

comparison (n=16/treatment/genotype). Asterisks represent the degree of significant

difference (*; p<0.05, **; p<0.001) between epsR1-2 and Col0 cut cotyledons (repeats

for flg22=3, for elf26=1).

230


Dependency.

231


Dependent MAPK Activation.

Flg22-indcued MAPK-phosphorylation profile is severely abrogated in the absence of

EpsinR1. Whole 8-day old seedlings were elicited with (+), or without (-), 10nM flg22 for

the indicated amount of time and flash frozen. Total proteins were subjected to immunoblot

analysis and probed with αP-p44/42 MAPK to assess flg22-induced phosphorylation of

MPK6 (P-M6) and MPK3 (P-M3), and with αMPK6 to determine MAPK6 accumulation

and to assess loading. min, minutes; PF, flg22; MPK6, MAPK6; P-MPK 6/3,

phosphorylated MAPK6/3 (repeats=1).

232


Dependent MAPK Activation.

233


Cellular Expansion.

(A) Adult rosettes display stunting in epsR1 alleles. 4 to 5 week old plants were grown in

8h light/16h dark and imaged to compare relative rosette diameters between Col0 and

epsR1 alleles. (repeat=1) (B) and (C) Decreased cellular expansion is not the causative

agent for increased stomata number in epsR1 alleles. Abaxial surfaces of 8-day old

cotyledons were imaged at 5, 7, and 10-days post-germination. Seedlings were stained

using toluidine blue and cellular pools were quantified at each individual time point. Guard

cell pairs are represented by light green bars, meristemoid precursor cells are represented

by dark green bars, and pavement cells are represented by open bars. The total number of

cells was determined from a fixed area of the cotyledon, which was used to normalize the

individual cellular pools shown as a percentage of the total cells. (repeat=3).

234


Cellular Expansion.

235

Table S1: Statistical Analysis of Cellular Pools from Abaxial Cotyledons.

Breakdown of the quantification of cellular pools ascertained for seedlings 5, 7, and 10-

day post-germination. The total for each cell type from the mutants was directly compared

to Col0 controls for the indicated time point. Asterisks represent the degree of significant

difference between mutants and Col0 controls for the indicated cellular pool at the

indicated time point (*; p<0.05, **; p<0.001, and ***; p<0.0001). Non-significant

differences are represented with “ns.” (repeats=3).

236

Table IV.S1: Statistical Analysis of Cellular Pools from Abaxial Cotyledons

237

REFERENCES

1. Provitera P, El-Maghrabi, R, and Scarlata, S. 2006. The effect of HIV-1 Gag

myristoylation on membrane binding. . Biophys Chem 119:23-32.

2. Chukkapalli V, and Ono, A. . 2011. Molecular determinants that regulate

plasma membrane association of HIV-1 Gag. J Mol Biol 410:512-524.

3. Hogue I, Llewellyn, G, and Ono, A. . 2012. Dynamic Association between HIV-

1 Gag and Membrane Domains. Mol Biol Intl.

4. Yufenyuy EaA, C. 2013. The NTD-CTD intersubunit interface plays a critical

role in assembly and stabilization of the HIV-1 capsid. Retrovirology 10:29.

5. Ako-Adjei D, Johnson, M and Vogt, V. 2005. The Retroviral Capsid Domain

Dictates Virion Size, Morphology, and Coassembly of Gag into Virus-Like

Particles. Journal of Virology 79:13463–13472.

6. Bell N, and Lever, A. 2013. HIV Gag polyprotein: processing and early viral

particle assembly. Trends Microbiol 21:136-144.

7. Tazi J, Bakkour, N, Marchand, V, Ayadi, L, Aboufirassi, A, and Branlant, C.

2010. Alternative splicing: regulation of HIV-1 multiplication as a target for

therapeutic action. FEBS J 277:867-876.

8. Corbin A, Prats, A, Darlix, J, and Sitbon, M. 1994. A nonstructural gag-

encoded glycoprotein precursor is necessary for efficient spreading and

pathogenesis of murine leukemia viruses. Journal of Virology 68:3857-3867.

9. Pillemer E, Kooistra, D, Witte, O, and Weissman, I 1986. Monoclonal

antibody to the amino-terminal L sequence of murine leukemia virus glycosylated

238

Gag polyproteins demonstrates their unusual orientation in the cell membrane.

Journal of Virology 57:413-421.

10. VM V. 1997. Retroviral Virions and Genomes. Retroviruses, eds Coffin JM,

Hughes SH, Varmus HE (Cold Spring Harbor Lab Press, Cold Spring Harbor,

NY).

11. Fass D, Harrison, S, and Kim, P. 1996. Retrovirus envelope domain at 1.7

angstrom resolution. Nat Struct Biol 3:465-469.

12. Johnston E, and Radke, K. 2000. The SU and TM envelope protein subunits of

bovine leukemia virus are linked by disulfide bonds, both in cells and in virions


13. Leamnson R, and Halpern, M. 1976. Subunit structure of the glycoprotein

complex of avian tumor virus. Journal of Virology 18:956-968.

14. Opstelten D, Wallin, M., and Garoff, H. 1998. Moloney murine leukemia virus

envelope protein subunits, gp70 and Pr15E, form a stable disulfide-linked

complex. Journal of Virology 72:6537-6545.

15. Pinter A, and Fleissner, E. 1977. The presence of disulfide-linked gp70-p15(E)

complexes in AKR murine leukemia viruses. Virology 83:417-422.

16. Henzy J, and Coffin, J. 2013. Betaretroviral envelope subunits are noncovalently

associated and restricted to the mammalian class. Journal of Virology 87:1937-

1946.

17. Kowalski M, Potz, J., Basiripour, L., Dorfman, T., Goh, W., Terwilliger, E.,

Dayton, A., Rosen, C., Haseltine, W., and Sodrosk,i J. 1987. Functional

239

regions of the envelope glycoprotein of human immunodeficiency virus type 1.

Science 237.

18. Hunter E. 1997. Viral Entry and Receptors. Retroviruses, eds Coffin JM, Hughes

SH, Varmus HE (Cold Spring Harbor Lab Press, Cold Spring Harbor, NY).

19. Celma C, Paladino, M, González, S, and Affranchino, J. 2007. Importance of

the short cytoplasmic domain of the feline immunodeficiency virus

transmembrane glycoprotein for fusion activity and envelope glycoprotein

incorporation into virions. Virology 366:405-414.

20. Côté M, Zheng, Y, Albritton, L, and Liu, S. 2008. Fusogenicity of Jaagsiekte

sheep retrovirus envelope protein is dependent on low pH and is enhanced by

cytoplasmic tail truncations. Journal of Virology 82:2543-2554.

21. Postler T, and Desrosiers, R. 2013. The tale of the long tail: the cytoplasmic

domain of HIV-1 gp41. Journal of Virology 87:2-15.

22. Deschambeault J, Lalonde, J, Cervantes-Acosta, G, Lodge, R, Cohen, E, and

Lemay, G. 1999. Polarized human immunodeficiency virus budding in

lymphocytes involves a tyrosine-based signal and favors cell-to-cell viral

transmission. Journal of Virology 73:5010-5017.

23. Lodge R, Delemarre, L, Lalonde, J, Alvarado, J, Sanders, D, Dokhélar, M,

Cohen, E, and Lemay, G. 1997. Two distinct oncornaviruses harbor an

intracytoplasmic tyrosine-based basolateral targeting signal in their viral envelope

glycoprotein. Journal of Virology 71:5696-5702.

240

24. Lodge R, Lalonde, J, Lemay, G, and Cohen, E. 1997. The membrane-proximal

intracytoplasmic tyrosine residue of HIV-1 envelope glycoprotein is critical for

basolateral targeting of viral budding in MDCK cells. EMBO J 16:695-705.

25. Hensel J, Hintz, M, Karas, M, Linder, D, Stahl, B, and Geyer, R. 1995.

Localization of the palmitoylation site in the transmembrane protein p12E of

Friend murine leukaemia virus. Eur J Biochem 232:373-380.

26. Ochsenbauer-Jambor C, Miller, D, Roberts, C, Rhee, S, and Hunter, E. 2001.

Palmitoylation of the Rous sarcoma virus transmembrane glycoprotein is required

for protein stability and virus infectivity. Journal of Virology 75:11544-11554.

27. Yang C, Spies, C, and Compans, R. 1995. The human and simian

immunodeficiency virus envelope glycoprotein transmembrane subunits are

palmitoylated. PNAS 92:9871-9875.

28. Murakami T. 2012. Retroviral env glycoprotein trafficking and incorporation

into virions. Mol Biol Intl.

29. White J. 1992. Membrane Fusion. Science 258:917-924.

30. Telesnitsky A, and Goff, S. 1997. Reverse Transcriptase and the Generation of

Retroviral DNA. Retroviruses, eds Coffin JM, Hughes SH, Varmus HE (Cold

Spring Harbor Lab Press, Cold Spring Harbor, NY).

31. Po B. 1997. Integration. Retroviruses, eds Coffin JM, Hughes SH, Varmus HE

(Cold Spring Harbor Lab Press, Cold Spring Harbor, NY).

32. Iwatani Y, Chan, D, Wang, F, Maynard, K, Sugiura, W, Gronenborn, A,

Rouzina, I, Williams, M, Musier-Forsyth, K, and Levin, J. 2007. Deaminase-

241

independent inhibition of HIV-1 reverse transcription by APOBEC3G. Nuc Acids

Res 35:7096-7108.

33. Swanstrom R. 1997. Synthesis, Assembly, and Processing of Viral Proteins.

Retroviruses, eds Coffin JM, Hughes SH, Varmus HE (Cold Spring Harbor Lab

Press, Cold Spring Harbor, NY).

34. Rhee S, and Hunter, E. 1990. A single amino acid substitution within the matrix

protein of a type D retrovirus converts its morphogenesis to that of a type C

retrovirus. Cell 63:77-86.

35. Kuff E, and Lueders, K. 1988. The intracisternal A-particle gene family:

structure and functional aspects. Adv Cancer Res 51:183-276.

36. Kutluay S, and Bieniasz, P. 2010. Analysis of the initiating events in HIV-1

particle assembly and genome packaging. PLos Pathol 6.

37. Bryant M, and Ratner, L. 1990. Myristoylation-dependent replication and

assembly of human immunodeficiency virus 1. PNAS 87:523-527.

38. Chukkapalli V, Hogue, I, Boyko, V, Hu, W, and Ono, A. 2008. Interaction

between the human immunodeficiency virus type 1 Gag matrix domain and

phosphatidylinositol-(4,5)-bisphosphate is essential for efficient gag membrane

binding. Journal of Virology 82:2405-2417.

39. Dalton A, Ako-Adjei, D, Murray, P, Murray, D, and Vogt, V. 2007.

Electrostatic interactions drive membrane association of the human

immunodeficiency virus type 1 Gag MA domain. Journal of Virology 81:6434-

6445.

242

40. Dalton A, Murray, P, Murray, D, and Vogt, V. 2005. Biochemical

characterization of rous sarcoma virus MA protein interaction with membranes.


41. Luttge B, and Freed, E. 2010. FIV Gag: virus assembly and host-cell

interactions. Vet Immunol Immunopathol 134:3-13.

42. Ono A. 2009. HIV-1 Assembly at the Plasma Membrane: Gag Trafficking and

Localization. Future Virol 4:241-257.

43. Ono A. 2010. Relationships between plasma membrane microdomains and HIV-1

assembly. Biol Cell 102:335-350.

44. Jouvenet N, Bieniasz, P, and Simon, S. 2008. Imaging the biogenesis of

individual HIV-1 virions in live cells. Nature 454:236-240.

45. Pelchen-Matthews A, and Marsh, M. 2007. Electron microscopy analysis of

viral morphogenesis. Methods Cell Biol 79:515-542.

46. Deneka M, Pelchen-Mathews, A, Byland, R, Ruiz-Mateos, E, and Marsh, M.

2007. In macrophages, HIV-1 assembles into an intracellular plasma membrane

domain containing the tetraspanins CD81, CD9, and CD53. Journal of Cell

Biology 177:329-341.

47. Bennett A, Narayan, K, Shi, D, Hartnell, L, Gousset, K, He, H, Lowekamp,

B, Yoo, T, Bliss, D, Freed, E, and Subramaniam, S. 2009. Ion-abrasion

scanning electron microscopy reveals surface-connected tubular conduits in HIV-

infected macrophages. PLos Pathol 5.

243

48. Welsch S, Keppler, O, Habermann, A, Allespach, I, Krijnse-Locker, J, and

Kräusslich, H. 2007. HIV-1 buds predominantly at the plasma membrane of

primary human macrophages. PLos Pathol 3.

49. Pessin J, and Glaser, M. 1980. Budding of Rous sarcoma virus and vesicular

stomatitis virus from localized lipid regions in the plasma membrane of chicken

embryo fibroblasts. Journal of Biological Chemistry 255:9044-9050.

50. Quigley J, Rifkin, D, and Reich, E. 1972. Lipid studies of Rous sarcoma virus

and host cell membranes. Virology 50:550-557.

51. Quigley J, Rifkin, D, and Reich, E. 1971. Phospholipid composition of Rous

sarcoma virus, host cell membranes and other enveloped RNA viruses. Virology

46:106-116.

52. Aloia R, Tian, H, and Jensen, F. 1993. Lipid composition and fluidity of the

human immunodeficiency virus envelope and host cell plasma membranes. PNAS

90:5181-5185.

53. Brügger B, Glass, B, Haberkant, P, Leibrecht, I, Wieland, F, and Kräusslich,

H. 2006. The HIV lipidome: a raft with an unusual composition. PNAS

103:2641-2646.

54. Campbell S, Gaus, K, Bittman, R, Jessup, W, Crowe, S, and Mak, J. 2004.

The raft-promoting property of virion-associated cholesterol, but not the presence

of virion-associated Brij 98 rafts, is a determinant of human immunodeficiency

virus type 1 infectivity. Journal of Virology 78:10556-10565.

244

55. Campbell S, Crowe, S, and Mak, J. 2002. Virion-associated cholesterol is

critical for the maintenance of HIV-1 structure and infectivity. AIDS 16:2253-

2261.

56. Nguyen D, and Hildreth, J. 2002. Evidence for budding of human

immunodeficiency virus type 1 selectively from glycolipid-enriched membrane

lipid rafts. Journal of Virology 74:3264-3272.

57. Blot V, Perugi, F, Gay, B, Prévost, M, Briant, L, Tangy, F, Abriel, H, Staub,

O, Dokhélar, M, and Pique, C. 2004. Nedd4.1-mediated ubiquitination and

subsequent recruitment of Tsg101 ensure HTLV-1 Gag trafficking towards the

multivesicular body pathway prior to virus budding. Journal of Cell Sci 117:2357-

2367.

58. Bouamr F, Melilo, J, Wang, M, Nagashima, K, de Los Santos, M, Rein, A,

and Goff, S. 2003. PPPYVEPTAP motif is the late domain of human T-cell

leukemia virus type 1 Gag and mediates its functional interaction with cellular

proteins Nedd4 and Tsg101. Journal of Virology 77:11882-11895.

59. Chung H, Morita, E, von Schwedler, U, Müller, B, Kräusslich, H, and

Sundquist, W. 2008. NEDD4L overexpression rescues the release and infectivity

of human immunodeficiency virus type 1 constructs lacking PTAP and YPXL late

domains. Journal of Virology 82:4884-4897.

60. Gottwein E, Bodem, J, Müller, B, Schmechel, A, Zentgraf, H, and

Kräusslich, H. 2003. The Mason-Pfizer monkey virus PPPY and PSAP motifs

both contribute to virus release. Journal of Virology 77:9474-9485.

245

61. Heidecker G, Lloyd, P, Fox, K, Nagashima, K, and Derse, D. 2004. Late

assembly motifs of human T-cell leukemia virus type 1 and their relative roles in

particle release. Journal of Virology 78:6636-6648.

62. Jolly C. 2010. T cell polarization at the virological synapse. Viruses 2:1261-

1278.

63. Jolly C, and Sattentau, Q. 2004. Retroviral spread by induction of virological

synapses. Traffic 5:643-650.

64. Jolly C, Welsch, S, Michor, S, and Sattentau, Q. 2007. The regulated secretory

pathway in CD4(+) T cells contributes to human immunodeficiency virus type-1

cell-to-cell spread at the virological synapse. PLos Pathol 7.

65. Sattentau Q. 2010. Cell-to-Cell Spread of Retroviruses. Viruses 2:1306-1321.

66. Cronin J, Zhang, X, and Reiser, J. 2005. Altering the tropism of lentiviral

vectors through pseudotyping. Curr Gene Ther 5:387-398.

67. M. J. 2011. Mechanisms for Env glycoprotein acquisition by retroviruses. AIDS

Res Hum Retrovir 27:239-247.

68. Mazari PaR, M. 2013. Library screening and receptor-directed targeting of

gammaretroviral vectors. Future Microbiol:107-121.

69. Akari H, Fukumori, T, and Adachi, A. 2000. Cell-dependent requirement of

human immunodeficiency virus type 1 gp41 cytoplasmic tail for Env

incorporation into virions. Journal of Virology 74:4891-4893.

70. Dubay J, Roberts, S, Hahn, B, and Hunter, E. 2002. Truncation of the human

immunodeficiency virus type 1 transmembrane glycoprotein cytoplasmic domain

blocks virus infectivity. Journal of Virology 66:6616-6625.

246

71. Gabuzda D, Lever, A, Terwilliger, E, and Sodroski, J. 1992. Effects of

deletions in the cytoplasmic domain on biological functions of human

immunodeficiency virus type 1 envelope glycoproteins. Journal of Virology

66:3306-3315.

72. Murakami T, and Freed, E. 2000. The long cytoplasmic tail of gp41 is required

in a cell type-dependent manner for HIV-1 envelope glycoprotein incorporation

into virions. PNAS 97:343-348.

73. Lucas TM, Lyddon TD, Grosse SA, Johnson MC. 2010. Two distinct

mechanisms regulate recruitment of murine leukemia virus envelope protein to

retroviral assembly sites. Virology 405:548-555.

74. Gregory D. LT, and Johnson MC. 2013. Multiple gag domains contriobute to

selective recruitment of meurine leukemia virus (MLV) Env to MLV virions.


75. Weclewicz K, Ekström, M, Kristensson, K, and Garoff, H. 1998. Specific

interactions between retrovirus Env and Gag proteins in rat neurons. Journal of

Virology 72:2832-2845.

76. Zhong P, Agosto, L, Munro, J, and Mothes, W. 2013. Cell-to-cell transmission

of viruses. Curr Opin Virol 3:44-50.

77. Jorgenson R. VV, and Johnson M. 2009. Foreign Glycoproteins Can Be

Actively Recruited to Virus Assembly Sites during Pseudotyping. Journal of

Virology 83:4060-4067.

78. Jin J. LF, Mothes W. 2011. Viral determinants of polarized assembly for the

murine leukemia virus. Journal of Virology 85.

247

79. Bauby H, Lopez-Verges, S, Hoeffel, G, Delcroix-Genête, D, Janvier, K,

Mammano, F, Hosmalin, A, and Berlioz-Torrent, C. 2010. TIP47 is required

for the production of infectious HIV-1 particles from primary macrophages.

Traffic 11:455-467.

80. Blot G, Janvier, K, Le Panse, S, Benarous, R, and Berlioz-Torrent, C. 2003.

Targeting of the human immunodeficiency virus type 1 envelope to the trans-

Golgi network through binding to TIP47 is required for env incorporation into

virions and infectivity. Journal of Virology 77:6931-6945.

81. Checkley M, Luttge, B, Mercredi, P, Kyere, S, Donlan, J, Murakami, T,

Summers, M, Cocklin, S, and Freed, E. 2013. Reevaluation of the requirement

for TIP47 in human immunodeficiency virus type 1 envelope glycoprotein

incorporation. Journal of Virology 87:3561-3570.

82. Miklós Szekeres KN, Zsuzsanna Koncz-Kálmán, Jaideep Mathur, Annette

Kauschmann, Thomas Altmann, George P Rédei, Ferenc Nagy, Jeff Schell,

and Csaba Koncz. 1996. Cytochrome P450, Controlling Cell Elongation and De-

etiolation in Arabidopsis. Cell 85:171-182.

83. Grove J, and Marsh, M. 2011. The cell biology of receptor-mediated virus

entry. Journal of Cell Biology 195:1071-1082.

84. Loving R, Li, K., Wallin, M., Sjoberg, M., and Garoff, H. 2008. R-peptide

cleavage potentiates fusion-controlling isomerization of the intersubunit disulfide

in Moloney murine leukemia virus Env. Journal of Virology 82:2594-2597.

248

85. Ragheb J, and Anderson, W. 1994. pH-independent murine leukemia virus

ecotproic envelpe-mediated cell fusion: implications for the role of the R peptide

and p12E TM in viral entry. Journal of Virology 68:3220-3231.

86. Kubo Y, Tominaga, C., Yoshii, H., Kamiyama, H., Mitani C., Amanuma H.,

and Yamamoto, N. 2007. Characterization of R-peptide of murine leukemia

virus envelope glycoprotein in syncytium formation and entry Arch Virology

152:2169-2182.

87. Li M, Li, Z., Yao, Q., Yang, C., Steinhauer, D., and Compans, R. 2006.

Murine leukemia virus R peptide inhibits influenza virus hemagglutinin-induced

membrane fusion. Journal of Virology 80:6106-6114.

88. Rein A, Mirro, J., Haynes, J., Ernst, S., and Nagashima, K. 1994. Function of

the cytoplasmic domain of a retroviral transmembrane protein: p15E-p2E

cleavage activates the membrane fusion capability of the murine leukemia virus

Env protein. Journal of Virology 68:1773-1781.

89. Henderson L, Sowder, R., Copeland, T., Smythers, G., and Oroszlan, S. 1984.

Quantitative separation of murine leukemia virus proteins by reverse-phase high-

pressure liquid chromatography reveals newly described gag and env cleavage

products. Journal of Virology 52:492-500.

90. Loving R, Wu, S., Sjoberg, M., Lindqvist, B., and Garoff, H. 2012. Maturation

cleavage of the meurine leukemia virus Env precursor separates the

transmembrane subunits to prime it for receptor triggering. PNAS 109:7735-

7740.

249

91. Owens R, Burke, C., and Rose, J. 1994. Mutations in the Membrane-Spanning

Domain of the Human Immunodeficiency Virus Envelope Glycoprotein That

Affect Fusion Activity. Journal of Virology 68:570-574.

92. Apellániz B, Rujas, E., Serrano, S., Morante, K., Tsumoto, K., Caaveiro, J.,

Jiménez, M., and Nieva, J. 2015. The Atomic Structure of the HIV-1 gp41

Transmembrane Domain and Its Connection to the Immunogenic Membrane-

proximal External Region. Journal of Biological Chemistry 290:12999-13015.

93. Sun Z, Cheng, Y., Kim, M., Song, L., Choi, J., Kudahl, U, Brusic, V,

Chowdhury, B, Yu, L, Seaman, M, Bellot, G, Shih, W, Wagner, G, and

Reinherz, E. 2014. Disruption of Helix-Capping Residues 671 and 674 Reveals a

Role in HIV-1 Entry for a Specialized Hinge Segment of the Membrane Proximal

External Region of gp41. J Mol Biol 426:1095-1108.

94. Yi H, Diaz-Rohrer, B., Saminathan, P., and Jacobs, A. 2015. The Membrane

Proximal External Regions of gp41 from HIV‑1 Strains HXB2 and JRFL Have

Different Sensitivities to Alanine Mutation. Biochemistry 54:1681-1693.

95. Salzwedel K, West, J. and Hunter, E. 1999. A Conserved Tryptophan-Rich

Motif in the Membrane-Proximal Region of the Human Immunodeficiency Virus

Type 1 gp41 Ectodomain is Important for Env-Mediated Fusion and Virus

Infectivity. Journal of Virology 73:2469-2480.

96. Apellaniz B, Rujas, E., Carravilla, P., Requejo-Isidro, J., Huarte, N.,

Domene, C., and Nieva, J. 2014. Cholesterol-Dependent Membrane Fusion

Induced by the gp41 Membrane-Proximal External Region-Transmembrane

250

Domain Connection Suggests a Mechanism for Broad HIV-1 Neutralization.


97. Cordes F, Bright, J, and Samson, M. 2002. Proline-induced distortions of

transmembrane helices. J Mol Biol 323:951-960.

98. Jardetzky O. 1996. Simple allosteric model for membrane pumps. Nature

211:696-670.

99. Sansom M, and Weinstein, H. 2000. Hinges, swivels & switches: the role of

prolines in signalling via transmembrane a-helices. Trends Pharmacol Sci 21:445-

451.

100. Govaerts C, Blanpain, C., Deupi, X., Ballet, S., Ballesteros, J. A., Wodak, S.

J. et al. 2001. The TXP motif in the second transmembrane helix of CCR5—a

structural determinant of chemokine-induced activation. Journal of Biological

Chemistry 276:13217-13225.

101. Ri Y, Ballesteros, J., Abrams, C., Oh, S., Verselis, V., Weinstein, H., and

Bargiello, T. 1999. The role of a conserved proline residue in mediating

conformational changes associated with voltage gating of Cx32 gap junctions.

Biophysical J 76:2887-2898.

102. Janaka S, Gregory, D., and Johnson, M. 2013. Retrovirus Glycoprotein

Functionality Requires Proper Alignment of the Ectodomain and the Membrane-

Proximal Cytoplasmic Tail. Journal of Virology 87:12805-12813.

103. Kim J, Lee, S., Li, L., Park, H., Park, J., Lee, K., Kim, M., Shin, B., and

Choi, S 2011. HIgh Cleavage Efficiency of a 2A Peptide Derived from Porcine

Teschovirus-1 in Human Cell Lines, Zebrfish and Mice. Plos One 6:e18556.

251

104. Trichas G, Begbie, J., and Srinivas, S. 2008. Use of the viral 2A peptide for

bicistronic expression in transgenic mice. BMC Biol 6.

105. Boussif O, Lezoualc'h, F., Zanta, M., Scherman, D., Demeneix, B., and Behr,

J. 1995. A versitle vector for gene and oligonucleotide transfer into cells in

culture and in vivo: polyethylenimine. PNAS 92:7297-7301.

106. Wu B, Lu, J., Gallaher, T., Anderson, W., and Cannon, P. 2000. Identification

of regions in the Moloney murine leukemia virus SU protein that tolerate the

insertion of an integrin-binding peptide Virology 269:7-17.

107. Erlwien O, Buchholz, C., and Schnierle, B. 2003. The proline rich region of

ecotropic Moloney murine leukemia virus envelope protein tolerates the insertion

of the green fluorescent protein and allows the generation of replication-

competent virus. J Gen Virol 84:369-373.

108. Rothenberg S, Olsen, M., Laurent, L., Crowly, R., and Brown, P. 2001.

Comprehensive mutational analysis of the Moloney murine leukemia virus

envelope glycoprotein. Journal of Virology 75:11851-11862.

109. Dawson J, Weinger, J., and Engleman, D. 2002. Motifs of Serine and

Threonine can Drive Association of Transmembrane Helices J Mol Biol 316:799-

805.

110. Deupi X, Olivella, M., Govaerts, C., Ballesteros, J., Campillo, M., and Pardo,

L. 2004. Ser and Thr residues modulate the comformation of Pro-kinked

transmembrane aplha-helices. Biophysical J 86:105-115.

252

111. del Val C, White, S., and Bondar, A. 2012. Ser/Thr Motifs in Transmembrane

Proteins: Conservation Patterns and Effects on Local Protein Structure and

Dynamics. J Membrane Biol 245:717-730.

112. Kurochkina N. 2007. Amino acid composition of parallel helix-helix interfaces.

Journal of Theoretical Biology 247:110-121.

113. Bowie J. 2011. Membrane Protein Folding: How Important are Hydrogen Bonds?

Curr Opin Struc Biol 21:42-49.

114. Gray T, and Matthews, B. 1984. Intrahelical hydrogen bonding of serine,

threonine and cysteine residues within alpha-helices and its relevance to

membrane-bound proteins. J Mol Biol 175:75-81.

115. Sansom M, and Weinstein, H. 2000. Hinges, swivels and switches: the role of

prolines in signalling via transmembrane alpha-helices. Trends Pharmacol Sci

21:445-451.

116. Tieleman P, Shrivastava, I., Ulmschneider, M., and Sansom, M. 2001.

Proline-induced hinges in transmembrane helices: possible roles in ion channel

gating. PROTEINS 44:63-72.

117. Adamian L, and Liang, J. 2001. Helix-Helix Packing and Interfacial Pairwise

Interactions of Residues in membrane Proteins. J Mol Biol 311:891-907.

118. Taylor G, and Sanders, A. 2003. Structural criteria for regulation of membrane

fusion and virion incorporation by the murine leukemia virus TM cytoplasmic

domain. Virology 312:295-305.

253

119. Taylor G, and Sanders, A. 1999. The Role of the Membrane-spanning Domain

Sequence in Glycoprotein-mediated Membrane Fusion. Mol Biol of the Cell

10:2803-2815.

120. Boyko V. LM, Gorelick R., Fu W., Nikolaitchik O., Pathak V. 2006.

Coassembly and complementation of Gag proteins from HIV-1 and HIV-2, two

distinct human pathogens. Mol Cell 23:281-287.

121. Browning M. SR, Lew K., Rizvi T. . 2001. Primate and feline lentivirus vector

RNA packaging and propagation by heterologous lentivirus virions. Journal of

Virology 75:5129-5140.

122. Embretson J. TH. 1987. Lack of competition results in efficient packaging of

heterologous murine retroviral RNAs and reticuloendotheliosis virus

encapsidation-minus RNAs by the reticuloendotheliosis virus helper cell line.


123. Lee S. BV, Hu W. 2007. Capsid is an important determinant for functional

complementation of murine leukemia virus and spleen necrosis virus Gag

proteins. Virology 360:388-397.

124. Rizvi T. PA. 1993. Simian immunodeficiency virus RNA is efficiently

encapsidated by human immunodeficiency virus type 1 particles. . Journal of

Virology 67:26981-26988.

125. Briggs J, Wilk T., and Fuller S. . 2003. Do lipid rafts mediate virus assembly

and pseudotyping? . J Gen Virol 84:757-768.

254

126. Granoff A. aHG. 1954. Experimental production of combination forms of virus.

IV. Mixed influenza A-Newcastle disease virus infections. PNAS Proc. Soc. Exp.

Biol. Med.:84-88.

127. J. Z. 1982. The pseudotypic paradox. J Gen Virol 63:15-24.

128. Scheiffele P. RA, Wilk T., and Simons K. 1999. Influenza viruses select ordered

lipid domains during budding from the plasma membrane. Journal of Biological

Chemistry 274:2038-2044.

129. Bhattacharya J. RA, Clapham P. 2006. Gag regulates association of human

immunodeficiency virus type 1 envelope with detergent-resistant membranes.


130. Bugelski P. MB, Klinkner A., Ventre J., and Hart T. . 1995. Ultrastructural

evidence of an interaction between Env and Gag proteins during assembly of HIV

type 1. AIDS Res Hum Retrovir 11:55-64.

131. P. C. 1996. Direct interaction between the envelope and matrix proteins of HIV-1.

EMBO J 15:5783-5788.

132. Dorfman T. MF, Haseltine W., Gottlinger H. 1994. Role of the matrix protein

in the virion association of the human immunodeficiency virus type 1 envelope

glycoprotein. . Journal of Virology 68:1689-1696.

133. Freed E. MM. 1996. Domains of the human immunodeficiency virus type 1

matrix and gp41 cytoplasmic tail required for envelope incorporation into virions.


134. Lee Y. TX, Cimakasky L., Hildreth J., and Yu X. 1997. Mutations in the

matrix protein of human immunodeficiency virus type 1 inhibit surface expression

255

and virion incorporation of viral envelope glycoproteins in CD4+ T lymphocytes.


135. Mammano F. KE, Sodroski J., Bukovsky A., Gottlinger H. . 1995. Rescue of

human immunodeficiency virus type 1 matrix protein mutants by envelope

glycoproteins with short cytoplasmic domains. Journal of Virology 69:3824-3830.

136. Andersen K. DH, Zedeler A. 2006. Murine leukemia virus transmembrane

protein R-peptide is found in small virus core-like complexes in cells. J Gen Virol

87:1583-1588.

137. Vincent N, Genin, C., and Malvoisin, E. 2002. Identification of a conserved

domain of the HIV-1 transmembrane protein gp41 which interacts with

cholesteryl groups. Biochimica et Biophysica Acta 1567:157-164.

138. Mahfoud R. MM, Lingwood C., and Fantini J. 2002. A novel soluble analog of

the HIV-1 fusion cofactor globotriaosylceramide (Gb3) eliminates the cholesterol

requirement for high affinity gp120/Gb3 interaction. Journal of Lipid Rresearch

43:1670-1679.

139. Greenwood A. PJ, Mills T., Nagle F., Epand R., and Nagle-Tristram S. 2008.

CRAC motif peptide of the HIV-1 gp41 protein thins SOPC membranes and

interacts with cholesterol Biochimica et Biophysica Acta 1778:1120-1130.

140. Epand R. SB, and Epand R. 2005. The Tryptopphan Rich Region of HIV gp41

and the Promotion of Cholesterol-Rich Domains. Biochemistry 44:5525-5531.

141. Epand R. SB, and Epand R. 2002. Peptide-Induced Formation of Cholesterol-

Rich Domains. Biochemistry 42:14677-14689.

256

142. Schibli D. MR, and Vogel H. 2001. The Membrane-Proximal Tryptophan-Rich

Region of the HIV Glycoprotein gp41 Forms a Well-Defined Helix in

Dodecylphosphocholine Micelles. Biochemistry 40:9570-9578.

143. Schwarzer R. LI, Gramatica A., Scolari S., Buschmann V., Veit M., and

Herrmann A. 2014. The cholesterol-binding motif of the HIV-1 glycoprotein

gp41 regulates lateral sorting and oligomerization. Cellular Microbiology

16:1565-1581.

144. Alam KK, Chang JL, Burke DH. 2015. FASTAptamer: A Bioinformatic

Toolkit for High-throughput Sequence Analysis of Combinatorial Selections. Mol

Ther Nucleic Acids 4:e230.

145. Loving R. KM, Sjober M., and Garoff H. 2011. Cooperative clevage of the R

peptide in the Env trimer of Moloney murine leukemia virus facilitates its

maturation for fusion competence. Journal of Virology 85:3262-3269.

146. Green N, Shinnick, T., Witte, O., Ponticelli, A., Sutcliffe, J., and Lerner, R.

1981. Sequence-specific antibodies show that maturation of Moloney leukemia

virus envelope polyprotein involves removal of a COOH-terminal peptide. PNAS

78:6023-6027.

147. Gregory D. OGLT, and Johnson M. 2014. Diverse viral glycoproteins as well

as CD4 co-package into the same human immunodeficiency virus (HIV-1)

particles. Retrovirology 11.

148. Ng V. WT, and Arlinghaus R. 1982. Processing of the env gene products of

Moloney murine leukemia virus J Gen Virol 59:329-343.

257

149. Senes A. ED, DeGrado W. 2004. Folding of helical membrane proteins: the role

of polar, GxxxG-like, and proline motifs. Curr Opin Struc Biol 14:465-479.

150. J. ALaL. 2002. Interhelical Hydrogen Bonds and Spatial Motifs in Membrane

Proteins: Polar Clamps and Serine Zippers. PROTEINS 47:209-218.

151. Tatko C. NV, Lear J., and DeGrado W. 2006. Polar Networks Control

Oligomeric Assembly in Membranes. JACS 128:4170-4171.

152. Nordholm J. dSD, Damjanovic J., Dou D., and Daniels R. 2013. Polar

Residues and Their Positional Context Dictate the Transmembrane Domain

Interactions of Influenza A Neuraminidases. Journal of Biological Chemistry

288:10652-10660.

153. Wan W. aM-WJ. 1999. A recurring two-hydrogen-bond motif incorporating a

serine or threonine residues is found at both at alpha-helical N termini and other

situations. J Mol Biol 286:1651-1662.

154. Song L, Sun, Z, Coleman, K, Zwick, M, Gach, J, Wang, J, Reinherz, E,

Wagner, G, and Kim, M. 2009. Broadly neutralizing anti-HIV-1 antibodies

disrupt a hinge-related function of gp41 at the membrane interface. PNAS

106:9057-9062.

155. Sun Z, Oh, K, Kim, M, Yu, J, Brusic, V, Song, L, Qiao, Z, Wang, J, Wagner,

G, and Reinherz, E. 2008. HIV-1 broadly neutralizing antibody extracts its

epitope from a kinked gp41 ectodomain region on the viral membrane. Immunity

28:52-63.

156. Viard M, Parolini, I, Sargiacomo, M, Fecchi, K, Ramoni, C, Ablan, S,

Ruscetti, F, Wang, J, and Blumenthal, R. 2002. Role of cholesterol in human

258

immunodeficiency virus type 1 envelope protein-mediated fusion with host cells.


157. Epand R. 2004. Do proteins facilitate the formation of cholesterol-rich domains?

Biochimica et Biophysica Acta 1666:227-238.

158. Shang LaH, E. 2010. Residues in membrane-spanning domain core modulate

conformation and fusogenicity of the HIV-1 envelope glycoprotein. Journal of

Virology 404:158-167.

159. Persons DA AJ, Allay ER, Smeyne RJ, Ashmun RA, Sorrentino BP, Nienhuis

AW. 1997. Retroviral-mediated transfer of the green fluorescent protein gene into

murine hematopoietic cells facilitates scoring and selection of transduced

progenitors in vitro and identification of genetically modified cells in vivo. Blood

1:1777-1786.

160. Klein D IS, von Rombs K, Amadori A, Salmons B, Günzburg WH. 1997.

Rapid identification of viable retrovirus-transduced cells using the green

fluorescent protein as a marker. Gene Ther 4:1256-1260.

161. Welsh S KS. 1997. Reporter gene expression for monitoring gene transfer. Curr

Opin Biotechnol 8:617-622.

162. Cheng L FJ, Tsukamoto A, Hawley RG. 1996. Use of green fluorescent protein

variants to monitor gene transfer and expression in mammalian cells. Nat

Biotechnol 14:606-609.

163. RY. T. 1998. The green fluorescent protein. Annu Rev Biochem 67:509-544.

259

164. Matz MV FA, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML,

Lukyanov SA. 1999. Fluorescent proteins from nonbioluminescent Anthozoa

species. Nat Biotechnol 17:969-973.

165. Shaner NC CR, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. 2004.

Improved monomeric red, orange and yellow fluorescent proteins derived from

Discosoma sp. red fluorescent protein. Nature Biotechnology 22:1567-1572.

166. Robert E. Campbell OT, Amy E. Palmer, Paul A. Steinbach, Geoffrey S.

Baird, David A. Zacharias,, Tsien aRY. 2002. A monomeric red fluorescent

protein. PNAS 99:7877-7882.

167. Onafuwa-Nuga A TA. 2009. The remarkable frequency of human

immunodeficiency virus type 1 genetic recombination. Microbiol Mol Biol Rev

73:451-480.

168. Galetto R NM. 2005. Mechanistic features of recombination in HIV. AIDS

Review 7:92-102.

169. Krista Delviks-Frankenberry AG, Olga Nikolaitchik, Helene Mens,, Hu

VKPaW-S. 2011. Mechanisms and Factors that Influence High Frequency

Retroviral Recombination. Viruses 3:1650-1680.

170. Li T, Zhang, J. 2000. Determination of the frequency of retroviral recombination

between two identical sequences within a provirus. Journal of Virology 74:7646-

7650.

171. Hu WS BE, Delviks KA, Pathak VK. 1997. Homologous recombination occurs

in a distinct retroviral subpopulation and exhibits high negative interference. J

Virol 71:6028-6036.

260

172. Li TaZ, J. 2001. Retroviral recombination is temperature dependent. Journal of

General Virology 82:1359-1364.

173. Wu X LY, Crise B, Burgess SM. 2003. Transcription start regions in the human

genome are favored targets for MLV integration. Science 300:1749-1751.

174. Lewinski MK, Yamashita, M., Emerman, M., et al. 2006. Retroviral DNA

integration: viral and cellular determinants of target-site selection. PLoS

Pathogens 2:e60.

175. Felice B, Cattoglio, C., Cittaro, D., et al. 2009. Transcription factor binding

sites are genetic determinants of retroviral integration in the human genome. .

PLos One 4:e4571.

176. Bushman FD. 2003. Targeting Survival: Integration Site Selection by

Retroviruses and LTR-Retrotransposons. Cell 115:135-138.

177. Astrid R.W. Schröder PS, Huaming Chen, Charles Berry, Joseph R. Ecker,

Frederic Bushman. 2002. HIV-1 Integration in the Human Genome Favors

Active Genes and Local Hotspots. Cell 110:521-529.

178. An W, Telesnitsky, A. 2002. Effects of varying sequence similarity on the

frequency of repeat deletion during reverse transcription of a human

immunodeficiency virus type 1 vector. J Virol 76:7897-7902.

179. Dahabieh MS OM, Simon V, Sadowski I. 2013. A doubly fluorescent HIV-1

reporter shows that the majority of integrated HIV-1 is latent shortly after

infection. J Virol 87:4716-4727.

261

180. McNamara LA GJ, Collins KL. 2012. Latent HIV-1 infection occurs in multiple

subsets of hematopoietic progenitor cells and is reversed by NF-κB activation. J

Virol 86:9337-9350.

181. Boller T, Felix G. 2009. A renaissance of elicitors: perception of microbe-

associated molecular patterns and danger signals by pattern-recognition receptors.

Annu Rev Plant Biol 60:379-406.

182. Kumar H KT, & Akira S 2011. Pathogen Recognition by the Innate Immune

System. Internat Rev Immunol 30:16-34.

183. Nicaise V, Roux M, Zipfel C. 2009. Recent advances in PAMP-triggered

immunity against bacteria: pattern recognition receptors watch over and raise the

alarm. Plant Physiol 150:1638-1647.

184. Tena G BM, & Sheen J. 2011. Protein kinase signaling networks in plant innate

immunity Curr Opin Plant Biol 14:519-529.

185. Chinchilla D, Bauer Z, Regenass M, Boller T, Felix G. 2006. The Arabidopsis

receptor kinase FLS2 binds flg22 and determines the specificity of flagellin

perception. Plant Cell 18:465-476.

186. Dunning FM SW, Jansen KL, Helft L, & Bent AF 2007. Identification and

Mutational Analysis of Arabidopsis FLS2 Leucine-Rich Repeat Domain Residues

That Contribute to Flagellin Perception. Plant Cell 19:3297-3313.

187. Korasick DA ea. 2010. Novel Functions of Stomatal Cytokinesis-Defective 1

(SCD1) in Innate Immune Responses against Bacteria. J Biol Chem 285:23342-

23350.

262

188. Lu X ea. 2009. Uncoupling of sustained MAMP receptor signaling from early

outputs in an Arabidopsis endoplasmic reticulum glucosidase II allele. . Proc Natl

Acad Sci U S A 106:22522-22527.

189. Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JD, Felix G, Boller T.

2004. Bacterial disease resistance in Arabidopsis through flagellin perception.

Nature 428:764-767.

190. Göhre V ea. 2008 Plant Pattern-Recognition Receptor FLS2 Is Directed for

Degradation by the Bacterial Ubiquitin Ligase AvrPtoB. Curr Biol 18:1824-1832.

191. Robatzek S C, D, and Boller T. 2006. Ligand-induced endocytosis of the pattern

recognition receptor FLS2 in Arabidopsis. Genes and Dev 20:537-542.

192. Lu D, Lin W, Gao X, Wu S, Cheng C, Avila J, Heese A, Devarenne TP, He P,

Shan L. 2011. Direct ubiquitination of pattern recognition receptor FLS2

attenuates plant innate immunity. Science 332:1439-1442.

193. Zipfel C KG, Chinchilla D, Caniard A, Jones JD, Boller T, Felix G. 2006.

Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts

Agrobacterium-mediated transformation. Cell 125:749-760.

194. Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nurnberger T, Jones JD,

Felix G, Boller T. 2007. A flagellin-induced complex of the receptor FLS2 and

BAK1 initiates plant defence. Nature 448:497-500.

195. Serrano M ea. 2007. Chemical Interference of Pathogen-associated Molecular

Pattern-triggered Immune Responses in Arabidopsis Reveals a Potential Role for

Fattyacid Synthase Type II Complex-derived Lipid Signals. J Biol Chem

282:6803-6811.

263

196. Trujillo M IK, Casais C, and Shirasu K 2008. Negative Regulation of PAMP

Triggered Immunity by an E3 Ubiquitin Ligase Triplet in Arabidopsis. . Curr Biol

18:1396-1401.

197. Lee H, Bowen, C, Popescu, G, Kang, H, Kato, N, Ma, S, Dinesh-Kumar, S,

Snyder, M, and Popescu, S. (2011) Arabidopsis RTNLB1 and RTNLB2

Reticulon-Like Proteins Regulate Intracellular Trafficking and Activity of the

FLS2 Immune Receptor. . Plant Cell 23:3374-3391.

198. Saijo Y. 2010. ER quality control of immune receptors and regulators in plants. .

Cellular Microbiol Res 12:716-724.

199. Robatzek S. 2007. Vesicle trafficking in plant immune responses. Cell Microbiol

9:1-8.

200. S GNR. 2008. Plant Receptors Go Endosomal: A Moving View on Signal

Transduction. . Plant Physiol 147:1565-1574.

201. Geldner N HD, Wang X, Schumacher K, Chory J. 2007. Endosomal signaling

of plant steroid receptor kinase BRI1. Genes and Dev 21:1598-1602.

202. Irani NG ea. 2012 Fluorescent castasterone reveals BRI1 signaling from the

plasma membrane. . Nat Chem Biol 8:583-589.

203. Gómez-Gómez L FG, Boller T. 1999. A single locus determines sensitivity to

bacterial flagellin in Arabidopsis thaliana. Plant J 18:277-284.

204. Heese A, Hann DR, Gimenez-Ibanez S, Jones AM, He K, Li J, Schroeder JI,

Peck SC, Rathjen JP. 2007. The receptor-like kinase SERK3/BAK1 is a central

regulator of innate immunity in plants. Proc Natl Acad Sci U S A 104:12217-

12222.

264

205. Torres MA, Dangl J, Jones J. 2002. Arabidopsis gp91 phox homologues

Atrbohd and Atrbohf are required for accumulation of reactive oxygen

intermediates in the plant defense response. Proc Natl Acad Sci U S A 99:517-

522.

206. Anderson JC ea. 2011. Arabidopsis MAP Kinase Phosphatase 1 (AtMKP1)

negatively regulates MPK6-mediated PAMP responses and resistance against

bacteria. Plant Journal 67:258-268.

207. Kneen M FJ, Li Y, & Verkman AS 1998. Green Fluorescent Protein as a

Noninvasive Intracellular pH Indicator. Biophysical J 74:1591-1599.

208. Ntoukakis V SB, Segonzac C, and Zipfel C. 2011 Cautionary Notes on the Use

of C-Terminal BAK1 Fusion Proteins for Functional Studies. Plant Cell 23:3871-

3878.

209. Bauer Z G-GL, Boller T, & Felix G 2001. Sensitivity of Different Ecotypes and

Mutants ofArabidopsis thaliana toward the Bacterial Elicitor Flagellin Correlates

with the Presence of Receptor-binding Sites J Biol Chem 276:45669-45676.

210. Denoux C ea. 2008 Activation of Defense Response Pathways by OGs and Flg22

Elicitors in Arabidopsis Seedlings. Mol Plant 1:423-445.

211. Nühse TS B, A.R., Jones, A.M.E., Peck, S.C. . 2007 Quantitative

phosphoproteomic analysis of plasma membrane proteins reveals regulatory

mechanisms of plant innate immune responses. Plant J 51:931-940.

212. Schweighofer A ea. (2007) The PP2C-Type Phosphatase AP2C1, Which

Negatively Regulates MPK4 and MPK6, Modulates Innate Immunity, Jasmonic

Acid, and Ethylene Levels in Arabidopsis. Plant Cell 19:2213-2224.

265

213. Roux M, Schwessinger B, Albrecht C, Chinchilla D, Jones A, Holton N,

Malinovsky FG, Tor M, de Vries S, Zipfel C. 2011. The Arabidopsis leucine-

rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required

for innate immunity to hemibiotrophic and biotrophic pathogens. Plant Cell

23:2440-2455.

214. Sun W, Cao Y, Jansen Labby K, Bittel P, Boller T, Bent AF. 2012. Probing

the Arabidopsis flagellin receptor: FLS2-FLS2 association and the contributions

of specific domains to signaling function. Plant Cell 24:1096-1113.

215. Shan L, He P, Li J, Heese A, Peck SC, Nurnberger T, Martin GB, Sheen J.

2008. Bacterial effectors target the common signaling partner BAK1 to disrupt

multiple MAMP receptor-signaling complexes and impede plant immunity. Cell

Host Microbe 4:17-27.

216. Zhang J, Li W, Xiang T, Liu Z, Laluk K, Ding X, Zou Y, Gao M, Zhang X,

Chen S, Mengiste T, Zhang Y, Zhou JM. 2010. Receptor-like cytoplasmic

kinases integrate signaling from multiple plant immune receptors and are targeted

by a Pseudomonas syringae effector. Cell Host Microbe 7:290-301.

217. Block A, Alfano JR. 2011. Plant targets for Pseudomonas syringae type III

effectors: virulence targets or guarded decoys? Curr Opin Microbiol 14:39-46.

218. Iwasaki A aMR. 2012. Regulation of Adaptive Immunity by the Innate Immune

System. Science 327:291-295.

219. Monaghan J ZC. 2012. Plant pattern recognition receptor complexes at the

plasma membrane. Curr Opin Plant Biol 15:349-357.

266

220. Gomez-Gomez L BT. 2000. FLS2: An LRR Receptor–like Kinase Involved in

the Perception of the Bacterial Elicitor Flagellin in Arabidopsis. Molecular Cell

5:1003-1011.

221. Beck M ZJ, Faulkner C, MacLean D, Robatzek S. 2012. Spatio-temporal

cellular dynamics of the Arabidopsis flagellin receptor reveal activation status-

dependent endosomal sorting. Plant Cell 24:4205-4219.

222. Andersson ER. 2012. The role of endocytosis in activating and regulating signal

transduction. Cell Mol Life Sci 69:1755-1771.

223. Ichimura KC, C. Peck, S. C. Shinozaki, K. Shirasu, K. 2006. MEKK1 is

required for MPK4 activation and regulates tissue-specific and temperature-

dependent cell death in Arabidopsis. J Biol Chem 281:36969-36976.

224. Petersen M, Brodersen, Peter, Naested, Henrik, Andreasson, Erik, Lindhart,

Ursula, Johansen, Bo, Nielsen, Henrik B., Lacy, Michelle, Austin, Mark J.,

Parker, Jane E., Sharma, Sashi B., Klessig, Daniel F., Martienssen, Rob,

Mattsson, Ole, Jensen, Anders B., Mundy, John. 2000. Arabidopsis MAP

Kinase 4 Negatively Regulates Systemic Acquired Resistance. Cell 103:1111-

1120.

225. He P, Shan L, Sheen J. 2007. Elicitation and suppression of microbe-associated

molecular pattern-triggered immunity in plant-microbe interactions. Cell

Microbiol 9:1385-1396.

226. Jens Boch VJ, Lisa Gao, Tara L. Robertson, Melisa Lim, Barbara N. Kunke.

2002. Identification of Pseudomonas syringae pv. tomato genes induced during

infection of Arabidopsis thaliana. Molecular Microbiology 44:73-88.

267

227. Shapiro UJaL. 1996. Cell cycle-controlled proteolysis of a flagellar motor

protein that is asymmetrically distributed in the Caulobacter predivisional cell.

EMBO J 15:2393-2406.

228. Nicaise V, Joe A, Jeong BR, Korneli C, Boutrot F, Westedt I, Staiger D,

Alfano JR, Zipfel C. 2013. Pseudomonas HopU1 modulates plant immune

receptor levels by blocking the interaction of their mRNA with GRP7. EMBO J

32:701-712.

229. Baulcombe NBaDC. 2005. Arabidopsis ARGONAUTE1 is an RNA Slicer that

selectively recruits microRNAs and short interfering RNAs. PNAS 102:11928-

11933.

230. Xiaoming Zhang HZ, Shang Gao, Wei-Chi Wang, Surekha Katiyar-Agarwal,

Hsien-Da Huang, Natasha Raikhel, and Hailing Jin. 2011. Arabidopsis

Argonaute 2 regulates innate immunity via miRNA393*-mediated silencing of a

Golgi-localized SNARE gene MEMB12. Mol Cell 42:356-366.

231. Iwasaki A, Medzhitov R. 2010. Regulation of adaptive immunity by the innate

immune system. Science 327:291-295.

232. Asai T TG, Plotnikova J, Willman M, Chiu W et al. 2002. MAP Kinase

Signaling Cascade in Arabidopsis Innate Immunity. Nature 415:977-983.

233. Vetter MM, Kronholm I, He F, Haweker H, Reymond M, Bergelson J,

Robatzek S, de Meaux J. 2012. Flagellin perception varies quantitatively in

Arabidopsis thaliana and its relatives. Mol Biol Evol 29:1655-1667.

234. Schulze B MT, Jehle A, Mueller K, Beeler S, Boller T, Felix G, Chinchilla D.

2010. Rapid Heteromerization and Phosphorylation of Ligand-activated Plant

268

Transmembrane Receptors and Their Associated Kinase BAK1. JBC 285:9444-

9451.

235. Eugenia Russinova J-WB, Mark Kwaaitaal, Ana Can Delgado, Yanhai Yin,

Joanne Chory,and Sacco C. de Vries. 2004. Heterodimerization and

Endocytosis of Arabidopsis Brassinosteroid Receptors BRI1 and AtSERK3

(BAK1). Plant Cell 16:3216-3229.

236. Wang X KU, He K, Blackburn K, Li J, Goshe MB, Huber SC, Clouse SD.

2008. Sequential transphosphorylation of the BRI1/BAK1 receptor kinase

complex impacts early events in brassinosteroid signaling. Dev Cell 15:220-235.

237. Horvath CA, Vanden Broeck D, Boulet GA, Bogers J, De Wolf MJ. 2007.

Epsin: inducing membrane curvature. Int J Biochem Cell Biol 39:1765-1770.

238. Rosenthal J CH, Slepnev V, Pellegrini L, Salcini A, Di Fiore P, and Camilli P.

1999. The epsins define a family of proteins that interact with components of the

clathrin coat and contain a new protein module. JBC 274:33959-33965.

239. D W. 2002. Epsins: adaptors in endocytosis? Nature Reviews 3:971-977.

240. Ford M MI, Peter B, Vallis Y, Praefcke G, Evans P, McMahon H. 2002.

Curvature of clathrin-coated pits driven by epsin. Nature 419:361-366.

241. Sen A MK, Mukherjee D, Aguilar C. 2012. The epsin protein family:

coordinators of endocytosis and signaling. Biomolecular Concepts 3:117-126.

242. Holstein SE OP. 2005. Sequence analysis of Arabidopsis thaliana E/ANTH-

domain-containing proteins: membrane tethers of the clathrin-dependent vesicle

budding machinery. Protoplasma 226:13-21.

269

243. Song J, Lee MH, Lee GJ, Yoo CM, Hwang I. 2006. Arabidopsis EPSIN1 plays

an important role in vacuolar trafficking of soluble cargo proteins in plant cells

via interactions with clathrin, AP-1, VTI11, and VSR1. Plant Cell 18:2258-2274.

244. S Z, D.F. K. 2001. MAPK cascades in plant defense signaling. Trends Plant Sci

6:520-527.

245. Andrea Pitzschke ASaHH. 2009. MAPK cascade signalling networks in plant

defence. 12:1-6.

246. Luna E PV, Robert J, Flors V, Mauch-Mani B, Ton J. 2011. Callose

deposition: a multifaceted plant defense response. Mol Plant Microbe Interact

24:183-193.

247. Jacobs AK LV, Burton RA, Panstruga R, Strizhov N, Schulze-Lefert P,

Fincher GB. 2003. An Arabidopsis callose synthase, GSL5, is required for

wound and papillary callose formation. Plant Cell 15:2503-2513.

248. Kim MG dCL, McFall AJ, Belkhadir Y, DebRoy S, Dangl JL, Mackey D.

2005. Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal

defense in Arabidopsis. Cell 121:749-759.

249. Nishimura MT SM, Hou BH, Vogel JP, Edwards H, Somerville SC. 2003.

Loss of a callose synthase results in salicylic acid-dependent disease resistance.

Science 301:969-972.

250. Zhang J SF, Li Y, Cui H, Chen L, Li H, Zou Y, Long C, Lan L, Chai J, et al.

2007. A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-

induced immunity in plants. Cell Host Microbe 1:175-185.

270

251. Mary C. Wildermuth JD, Gang Wu, Frederick M. Ausubel. 2001.

Isochorismate synthase is required to synthesize salicylic acid for plant defence.

Nature 414:562-565.

252. Nawrath C MJ. 1999. Salicylic acid induction-deficient mutants of Arabidopsis

express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen

inoculation. Plant Cell 11:1393-1404.

253. N Zhou TLT, F Tsui, D F Klessig, and J Glazebrook. 1998. PAD4 functions

upstream from salicylic acid to control defense responses in Arabidopsis. Plant

Cell 10:1021-1030.

254. Jiyoung Lee JN, Hyeong Cheol Park, Gunnam Na, Kenji Miura, Jing Bo Jin,

Chan Yul Yoo, Dongwon Baek, Doh Hoon Kim, Jae Cheol Jeong, Donggiun

Kim, Sang Yeol Lee, David E. Salt, Tesfaye Mengiste, Qingqiu Gong, Shisong

Ma, Hans J. Bohnert, Sang-Soo Kwak, Ray A. Bressan, Paul M. Hasegawa

and Dae-Jin Yun. 2006. Salicylic acid-mediated innate immunity in Arabidopsis

is regulated by SIZ1 SUMO E3 ligase. The Plant Journal 49:79-90.

255. Arup K. Mukherjeea M-JC, Rina Zuchmanc, Tamar Zivc, Benjamin A.

Horwitza, Shimon Gepsteina. 2010. Proteomics of the response of Arabidopsis

thaliana to infection with Alternaria brassicicola. J Proteomics 73:709-720.

256. Gimenez-Ibanez S HD, Ntoukakis V, Petutschnig E, Lipka V, and Rathjen P.

2009. AvrPtoB Targets the LysM Receptor Kinase CERK1 to Promote Bacterial

Virulence on Plants. Current Biology 19:423-429.

271

257. Miya A AP, Shinya T, Desaki Y, Ichimura K, Shirasu K, Narusaka Y,

Kawakami N, Kaku H, and Shibuya N. 2007. CERK1, a LysM receptor kinase,

is essential for chitin elicitor signaling in Arabidopsis. PNAS 104:19613-19618.

258. Li J, Wen, J., Lease, K.A., Doke, J.T., Tax, F.E., and Walker, J.C. 2002.

BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and

modulates brassinosteroid signaling. Cell 110:213-222.

259. Nam KH, and Li, J. 2002. BRI1/BAK1, a receptor kinase pair mediating

brassinosteroid signaling. Cell 110:203-212.

260. S. Casson AH. 2012. GSK3-Like Kinases Integrate Brassinosteroid Signaling and

Stomatal Development. Perspec in Plant Biol 5:e30.

261. Tae-Wuk Kim MM, Dominique C. Bergmann & Zhi-YongWang. 2012.

Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of

a MAPK pathway. Nature 482:419-423.

262. Nuria Andrés-Colás AP-G, Sergi Puig and Lola Peñarrubia. 2010.

Deregulated Copper Transport Affects Arabidopsis Development Especially in

the Absence of Environmental Cycles. Plant Physiology 153:170-184.

263. Marie Barberona EZ, Stéphanie Robertb, Geneviève Conéjéroa, Cathy

Curiea, Jìří Friml and Grégory Verta. 2011. Monoubiquitin-dependent

endocytosis of the IRON-REGULATED TRANSPORTER 1 (IRT1) transporter

controls iron uptake in plants. PNAS 108:E450-E458.

264. Enric Zelazny MB, Catherine Curie, and Grégory Vert. 2011. Ubiquitination

of transporters at the forefront of plant nutrition. Plant Signal Behav 6:1597-1599.

272

265. Marhavý P BA, Abas L, Abuzeineh A, Duclercq J, Tanaka H, Pařezová M,

Petrášek J, Friml J, Kleine-Vehn J, Benková E. 2011. Cytokinin modulates

endocytic trafficking of PIN1 auxin efflux carrier to control plant organogenesis.

Dev Cell 21:796-804.

266. Jürgen Kleine-Vehna PD, Ranjan Swarupb, Malcolm Bennett and Jiří Friml.

2006. Subcellular Trafficking of the Arabidopsis Auxin Influx Carrier AUX1

Uses a Novel Pathway Distinct from PIN1. Plant Cell 18:3171-3181.

267. Gregory R Lampard DCB. 2007. A Shout-Out to Stomatal Development: How

the bHLH Proteins SPEECHLESS, MUTE and FAMA Regulate Cell Division

and Cell Fate. Plant Signal Behav 2:290-292.

268. Hetherington JEGaAM. 2004. Plant Development: YODA the Stomatal Switch.

Curr Biol 14:488-490.

269. Neela S. Bhave KMV, Jeanette A. Nadeau, Jessica R. Lucas, Sanjay L.

Bhave, and Fred D. Sack. 2009. TOO MANY MOUTHS promotes cell fate

progression in stomatal development of Arabidopsis stems. Planta 229:357-367.

270. Serna L. 2009. Cell fate transitions during stomatal development. BioEssays

31:865-873.

271. Gudesblat GE. 2012. SPEECHLESS integrates brassinosteroid and stomata

signalling pathways. Nature cell biology 14.

272. Albrecht C, Boutrot F, Segonzac C, Schwessinger B, Gimenez-Ibanez S,

Chinchilla D, Rathjen JP, de Vries SC, Zipfel C. 2012. Brassinosteroids inhibit

pathogen-associated molecular pattern-triggered immune signaling independent of

the receptor kinase BAK1. Proc Natl Acad Sci U S A 109:303-308.

273

273. Belkhadir Y JY, Epple P, Balsemao-Pires E, Dangl J.L., Chory J. 2012.

Brassinosteroids modulate the efficiency of plant immune responses to microbe-

associated molecular patterns PNAS 109:297-302.

274. Lu Y-C YW-C, Ohashi P. 2008. LPS/TLR4 signal transduction pathway.

Cytokine 42:145-151.

275. Petnicki-Ocwieja T, Schneider DJ, Tam VC, Chancey ST, Shan L, Jamir Y,

Schechter LM, Janes MD, Buell CR, Tang X, Collmer A, Alfano JR. 2002.

Genomewide identification of proteins secreted by the Hrp type III protein

secretion system of Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad

Sci U S A 99:7652-7657.

276. Sunghwa Choe BPD, Shozo Fujioka, Suguru Takatsuto, Akira Sakurai, and

Kenneth A. Feldmann. 1998. The DWF4 Gene of Arabidopsis Encodes a

Cytochrome P450 That Mediates Multiple 22 a-Hydroxylation Steps in

Brassinosteroid Biosynthesis. The Plant Cell 10:231-243.

274

VITA

Daniel Salamango was born March 9, 1987 and has always been fascinated by

science. In the beginning, Dan knew he wanted to pursue a career in science and set out

to earn a bachelor’s degree in chemistry from Hope College. Along the way he was

exposed to the field of biochemistry and immediately fell in love with it. Soon after, he

was exposed to research and the rest was history. Dan has research experience in both

plant innate immunity and retroviral assembly.

Documents

CHARACTERIZING THE RETROVIRAL ENVELOPE GLYCOPROTEIN