RESEARCH ARTICLE

Molecular Reproduction & Development 80:977–987 (2013)

Changes in WNT Signaling-Related Gene ExpressionAssociated With Development and Cloning in BovineExtra-Embryonic and Endometrial Tissues During thePeri-Implantation Period

FERNANDO H. BIASE,1 CHANAKA RABEL,2 MICHEL GUILLOMOT,3 OLIVIER SANDRA,3 KALISTA ANDROPOLIS,2

COLLEEN OLMSTEAD,2 ROSANE OLIVEIRA,2 RICHARD WALLACE,2 DANIEL LE BOURHIS,3,4 CHRISTOPHE RICHARD,5

EVELYNE CAMPION,3 AUR�ELIE CHAULOT-TALMON,3 CORINNE GIRAUD-DELVILLE,3 G�ERALDINE TAGHOUTI,3

H�EL�ENE JAMMES,3 ISABELLE HUE,3 JEAN PAUL RENARD3, AND HARRIS A. LEWIN1,2,6*

1 Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois2 Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, Illinois3 INRA, UMR1198 Biologie du D�eveloppement et Reproduction, Jouy-en-Josas, France4 ENVA, Maisons Alfort, France5 INRA, UE1298 Unit�e Commune d’Exp�erimentation Animale de Bressonvilliers, Leudeville, France6 Department of Evolution and Ecology and The Genome Center, University of California, Davis, Davis, California

SUMMARY

We determined if somatic cell nuclear transfer (SCNT) cloning is associated withWNT-related gene expression in cattle development, and if the expression of genes intheWNT pathway changes during the peri-implantation period. Extra-embryonic andendometrial tissues were collected at gestation days 18 and 34 (d18, d34).WNT5A,FZD4, FZD5, LRP5, CTNNB1, GNAI2, KDM1A, BCL2L1, and SFRP1 transcriptswere localized in extra-embryonic tissue, whereas SFRP1 and DKK1 were localizedin the endometrium. There were no differences in the localization of these transcriptsin extra-embryonic tissue or endometrium from SCNT or artificial insemination (AI)pregnancies. Expression levels of WNT5A were 11-fold greater in the allantois ofSCNT than AI samples. In the trophoblast, expression of WNT5A, FZD5, CTNNB1,and DKK1 increased significantly from d18 to d34, whereas expression of KDM1AandSFRP1 decreased, indicating that implantation is associatedwithmajor changesin WNT signaling. SCNT was associated with altered WNT5A expression in troph-oblasts,with levels increasing 2.3-foldmore in AI thanSCNTconceptuses fromd18 tod34. In the allantois, expression ofWNT5A increased 6.3-fold more in SCNT than AIconceptuses from d18 to d34. Endometrial tissue expression levels of the genestested did not differ between AI or SCNT pregnancies, although expression ofindividual genes showed variation across developmental stages. Our results dem-onstrate that SCNT is associated with altered expression of specific WNT-relatedgenes in extra-embryonic tissue in a time- and tissue-specific manner. The pattern ofgene expression in the WNT pathway suggests that noncanonical WNT signaltransduction is important for implantation of cattle conceptuses.

Mol. Reprod. Dev. 80: 977�987, 2013. � 2013 Wiley Periodicals, Inc.

Received 4 March 2013; Accepted 20 August 2013

�Corresponding author:1850 Research Park DriveSuite 300Davis, CA 95618E-mail: lewin@ucdavis.edu

Grant sponsor: USDA-ARS;Grant number: AG58-1265-7-027;Grant sponsor: European ProgramSABRE;Grantnumber:CT-2006-0162;Grant sponsor: National Agency ofResearch; Grant numbers:ANR-06-GANI-003-01,ANR-09-GENM-012

Published online 17 October 2013 in Wiley Online Library(wileyonlinelibrary.com).DOI 10.1002/mrd.22257

� 2013 WILEY PERIODICALS, INC.

INTRODUCTION

In cattle, only 9�15% of somatic cell nuclear transfer(SCNT)-derived pregnancies reach full term (reviewed byRenard et al., 2002 and Meissner and Jaenisch, 2006). Amuch smaller fraction of these pregnancies results in thebirth of a healthy calf (Wilmut et al., 2002; Wilmut andPaterson, 2003;Heyman, 2005). Independent studies havedemonstrated that most failures occur within the first50 days of pregnancy (reviewed by Heyman, 2005; Farinet al., 2006). Of the SCNT-derived embryos that survive theinitial 21 days of pregnancy, 57% develop past the implan-tation period, and 46% of these reach day 50 (d50) ofgestation as viable embryos. By comparison, 84% and81% of embryos derived from in vitro fertilization (IVF)develop beyond the implantation period and d50 of gesta-tion, respectively (Heyman et al., 2002). Most of the SCNTembryos that survive this critical period develop abnormal-ities related to Large Offspring Syndrome, which is char-acterized by altered energy metabolism, increased fetalweight, and enlarged or malformed organs (Younget al., 1998; Farin et al., 2004, 2006). Additionally, malfor-mations in the placenta, such as placental edema, placen-tomegaly, decreased number of placentomes, andhydroallantois, contribute to fetal losses (Hill et al., 2000;Bertolini and Anderson, 2002; Constant et al., 2006).

Heightened loss of embryos during the peri-implantationperiod may be related to alterations in crosstalk betweenthe conceptus and the endometrium. By d18 of gestation,the trophoblast is in loose contact with the luminal epitheli-um of the endometrium; around d19�20, trophoblast cellsare apposed to microvilli of the luminal epithelium (Kinget al., 1981; Guillomot, 1995). This attachment furtherprogresses with embryo-maternal interdigitation of micro-villi from the apical membrane of the endometrial luminalepithelium and trophoblast cells. At the end of the firstmonth of pregnancy, development of villi and crypts inthe caruncular areas occurs, and is followed by the forma-tion of placentomes (King et al., 1979).

Previous studies have explored differences in geneexpression within embryonic and endometrial tissues forcattle pregnancies derived from artificial insemination (AI),IVF, and SCNT (Smith et al., 2005; Arnold et al., 2006;Bauersachs et al., 2009; Mansouri-Attia et al., 2009; Ro-driguez-Alvarezet al., 2010a,b). Among the genes showingtranscriptional changes due to the SCNT process, DKK1and SFRP1, which encode protein regulators of WNTsignaling, were also found to be differentially expressedin extra-embryonic tissues and endometria harboringclones (Ledgard et al., 2009; Mansouri-Attia et al., 2009).The importance of WNT signaling for embryo survival,trophoblast attachment, and the establishment of pregnan-cy has also been demonstrated in murine models (Chenet al., 2009; Sonderegger et al., 2010).

In the present study, we examined the expression of asubset of WNT-related genes in maternal and embryonictissues of cattle-clone pregnancies during the pre- andearly post-implantation stages of development. The ex-pression of WNT-related genes was localized and quan-

tified in extra-embryonic and endometrial tissues.Somatic cell cloning did not affect the localization oftranscripts from WNT-related genes, but did affect levelsof gene expression in specific tissues in a time-dependentmanner.

RESULTS

Histology of Embryos and Conceptuses Used forGene Expression Studies

To study the effects of embryo cloning and implantationon WNTsignaling-related genes, eight AI and nine SCNT-generated, elongated cattle conceptuses and matchingendometria were collected from pregnancies interruptedat gestation d18. In addition, 10 AI and 11 SCNT concep-tuses and their corresponding endometrial tissues wereobtained at d34 of pregnancy. Among the d34 AI pregnan-cies, 8/10embryosdevelopednormally,with ameancrown-rump length of 12.4� 0.94mm, whereas 2/10 were devel-opmentally delayed on the basis of their crown-rump mea-surement. No signs of embryo or extra-embryonic-tissueabnormality were observed for the two developmentallydelayed embryos, so all 10 AI samples were used forquantification of mRNA. The d34 SCNT conceptuseswere smaller in size (mean crown-rump length,10.8� 1.6mm) than the AI conceptuses (P< 0.05). Amongthem, 2/11 were degenerate and 1/11 presented morpho-logical evidence of hepatomegaly. Tissues from SCNTconceptuses with no sign of abnormal organ or extra-embryonic tissue development (n¼ 8)were used for furtheranalysis. All SCNT conceptuses developed a completechorionic sac, amnion, and allantois. Histological analysisrevealed no structural difference in the extra-embryonicmembranes between SCNTand AI conceptuses. The d18conceptuses were elongated, with cuboidal, mononucleat-ed trophoblast cells and parietal endoderm sparsely dis-tributed underneath the trophoblast. The extra-embryonictissue at d34 had binucleated and mononucleated troph-oblasts in similar proportions for both SCNT and AIconceptuses (SCNT¼ 10.8%, AI¼ 8.3%). Additionally,the histology of the allantoic membranes was similar forSCNT and AI conceptuses at d34 of pregnancy.

Localization of WNT Signaling-Related GeneExpression in Extra-Embryonic Tissues andEndometrium

The mRNA of eight genes related to the WNT pathwaywere localized in the extra-embryonicmembranes of SCNTconceptuses using in situ hybridization (Fig. 1). Five ran-domly selected samples collected from AI-derived concep-tuses were used as controls for mRNA localization. At d18,WNT5A, FZD4, FZD5, LRP5, GNAI2, KDM1A, andBCL2L1 transcripts were detected in trophoblasts and

Abbreviations used: AI, artificial insemination; d, day; FDR, false discoveryrate; IVF, invitro fertilization;SCNT, somatic cell nuclear transfer;WNT,wingless-type mouse mammary tumor virus integration site family

Molecular Reproduction & Development BIASE ET AL.

978 Mol. Reprod. Dev. 80:977–987 (2013)

parietal endoderm.CTNNB1 transcriptswereonlydetectedin trophoblasts.SFRP1 transcriptswerenot detected. In thechorio-allantoic membranes of d34 conceptuses, tran-scripts of WNT5A, FZD4, FZD5, LRP5, GNAI2, KDM1A,

and BCL2L1 were detected in both mononucleated andbinucleated trophoblasts, in extra-embryonic mesoderm,and in the cells of the allantoic membrane. Transcripts ofCTNNB1 were detected only in trophoblasts. SFRP1

Figure 1. Representative images ofWNT-related gene expression in extra-embryonic tissues. Scale bars, 300mm. [Color figure can be viewed inthe online issue which is available at wileyonlinelibrary.com]

WNT GENE EXPRESSION IN CATTLE CLONING

Mol. Reprod. Dev. 80:977–987 (2013) 979

transcripts were not detected in chorio-allantoic mem-branes from any samples. None of the genes testedshowed any difference in transcript localization betweenAI and SCNT samples.

Endometrial tissues from uteri that carried cloned em-bryos and conceptuses were used to localize DKK1 andSFRP1 transcripts (Fig. 2). Samples from five randomlyselected uteri that carried AI embryos and conceptuseswere used for comparison. At d18 of pregnancy, onlySFRP1 transcripts were localized in the stroma of theuterine caruncle and intercaruncule regions. No differen-ces in endometrial transcript localization were observed inpregnancies produced by AI or SCNT. In tissues collectedfrom uteri at d34 of pregnancy, the luminal epithelium waslost in large sections of the samples. DKK1 and SFRP1transcripts did, however, co-localizewithin a thin layer of thestratum compactum underlying the luminal border of theendometrium (Fig. 2). Localization of DKK1 and SFRP1expression did not differ in endometrium from AI or SCNTpregnancies (Fig. 2).

Comparisons of Gene Expression Levels in AI andSCNT Extra-Embryonic Tissue and Endometria

Six WNT signaling-related genes (WNT5A, FZD5,CTNNB1, KDM1A, SFRP1, and DKK1) were selected forcomparative gene expression analysis between AI andSCNT samples (Fig. 3A). Separate statistical modelswere used to test for differences in gene expression inextra-embryonic tissue and the endometrium (see theMaterials and Methods Section). For extra-embryonic tis-sue, the variable ‘‘group’’ (AI or SCNT) was significant forWNT5A (P< 0.05), whereas the variable ‘‘tissue type’’ (d18extra-embryonic tissue, d34 chorion, d34 allantois) wassignificant for all six genes tested (P< 0.05). The interac-tion between the variables ‘‘group’’ and ‘‘tissue type’’ wassignificant for WNT5A (P< 0.05). ‘‘Day’’ and ‘‘tissue type’’are confounded variables because chorion and allantoisare not differentiated at d18. Therefore, specific contrasts

were used to test for differences in gene expression be-tween AI and SCNTand the different tissues, with P valuesadjusted for the number of comparisons using the falsediscovery rate (FDR) (Table 1).

At d18, no difference in transcript levels for any of the sixgenes was observed between AI and SCNT samples(Fig. 3A). At d34, allantoic membranes from cloned con-ceptuses had 11.1-fold greater expression ofWNT5A tran-scripts compared to tissues from AI conceptuses (FDRP< 0.05); no significant difference was observed for othergenes (Fig. 3A). At d34, chorion from both AI and SCNTconceptuses expressed significantly greater levels ofWNT5A, FZD5,CTNNB1, andDKK1 transcripts, and lowerlevels of KDM1A and SFRP1 transcripts, compared toallantoic membranes (Table 1). The increase in expressionof WNT5A in trophoblasts compared to the allantois was14.3-fold greater in AI relative to that observed for SCNTsamples.

Comparisons between extra-embryonic tissue at d18and d34 revealed significant developmental changes in theexpression of genes related to the WNT pathway duringpre- and post-implantation periods (Table 1). WNT5A ex-pression increased from d18 extra-embryonic tissue to d34in trophoblasts of both AI (327.7-fold) and SCNT (144.3-fold) samples (FDR P< 0.05). FZD5, which encodes areceptor for theWNT5A ligand, also significantly increasedin expression from d18 extra-embryonic tissue to d34 in AItrophoblasts (3.6-fold) but not SCNT trophoblasts. Expres-sion of CTNNB1, an intracellular signal transducer in theWNTsignaling pathway, significantly increased from d18 inextra-embryonic tissue to d34 in trophoblasts of SCNTsamples (2.7-fold) but not of AI samples. The expressionof KDM1A, which encodes for a protein that suppressesSFRP1 transcription (Huang et al., 2007, 2009), was sig-nificantly decreased in d18 extra-embryonic tissue com-pared to d34 trophoblast for the SCNTsamples, but not forthe AI samples. In both AI and SCNT samples, the WNTantagonist genes SFRP1 and DKK1 were expressedat significantly different levels in trophoblasts at d34

Figure 2. Representative images of in situ hybridization forDKK1 andSFRP1 transcripts in endometrial tissues. Scale bars, 5mm. nd: staining notdetected.

Molecular Reproduction & Development BIASE ET AL.

980 Mol. Reprod. Dev. 80:977–987 (2013)

compared to d18 extra-embryonic tissue (SFRP1 down10-fold, DKK1 up 54-fold).

Although the implantation-associated changes in tran-script levels of WNT-related signaling genes were highlysimilar in terms of their direction in AI and SCNTsamples,the relative changes were dramatically different forWNT5A. This was supported by the results of the statisticalmodel, where the interaction term between the variables

group (AI, SCNT) and tissue type (d18 extra-embryonictissue, d34 chorion, d34 allantois) was significant forWNT5A (P< 0.05). The increase in WNT5A expressionin trophoblasts from d18 to d34 was 2.3-fold greater forAI than for SCNT samples.

As a means to assess possible differences in crosstalkbetween the conceptus and the endometrium in AI andSCNT pregnancies, the relative abundances of transcript

Figure 3. Quantitative reverse-transcription PCR data of WNT-related genes in cattle pregnancies at d18 and d34. A: Extra-embryonic tissues.Averages of relative mRNA expression are represented by black symbols: triangle, trophoblast (TRO); circle, chorion (CHO); and square, allantois(ALL).B: Endometrial tissues.Averagesof relativemRNAexpressionare representedbyblack symbols: square, d18caruncle (d18-CAR); circle, d8intercaruncle (d18-ICAR); triangle, d34 caruncle (d34-CAR); and diamond, d34 intercaruncle (d34-ICAR). SCNT, somatic cell nuclear transfer; AI,artificial insemination. Open symbols represent AI-derived samples, and filled symbols represent SCNT-derived samples. Vertical bars representthe standard deviation of the relative mRNA expression (target gene relative to ACTB).

WNT GENE EXPRESSION IN CATTLE CLONING

Mol. Reprod. Dev. 80:977–987 (2013) 981

for WNT5A, FZD5, CTNNB1, KDM1A, SFRP1, and DKK1were measured in endometrial tissues (Fig. 3B). Therewere no significant differences in transcript levels betweenAI and SCNT pregnancies for the genes tested. By com-parison, the variable ‘‘day’’ was significant for all six genestested (P< 0.05), demonstrating the strong effect of im-plantation on expression of genes in WNT signaling path-ways in the endometrium. The expression of WNT5A,FZD5, CTNNB1, and KDM1A was significantly lowerfrom d18 to d34 in both caruncle and intercaruncle regionsof AI and SCNTsamples (Table 2).SFRP1 had significantlylower transcript levels in the caruncle fromd34 compared tod18, but only for AI pregnancies. By contrast, the expres-sion of DKK1 was approximately two-fold higher in theintercaruncle at d34 of AI pregnancies compared to d18(FDR P< 0.05, Table 2).

DISCUSSION

We determined whether SCNTand developmental pro-cesses affect the expression of WNT signaling-relatedgenes in extra-embryonic tissue and corresponding endo-metrial tissues pre- and post-implantation (d18 and d34,respectively). The WNT signaling pathway was chosenbecause of its known importance in regulating cell�cellcommunication during embryonic development. We there-

fore sought evidence that WNT signaling is a mediator ofearly development of the cattle conceptus and a possibleculprit in themassive failure of cloned-embryo pregnanciesduring the peri-implantation period. We demonstrated thatthe expression ofWNTsignaling geneswas not affected bySCNTat d18, but thatWNT5Awas differentially expressedbetween SCNTand AI allantois samples at d34. There wasan association between the expression of WNT signalinggenes and post-implantation development, and important-ly, SCNTcorrelatedwith developmental changes inWNT5Aexpression in specific extra-embryonic tissues. Our resultsindicate that the embryo cloning process is associated withaltered expression levels ofWNT ligands (e.g., WNT5A), inembryonic structures at specific developmental stages.

The WNT signaling genes tested were not differentiallyexpressed between SCNT and AI derived conceptuses atd18. In accordance with our results, a recent investigationof cattle d18 extra-embryonic tissue did not identify differ-ential expression of the same genes tested in our study(WNT5A, CTNNB1, FZD5, KDM1A, SFRP1, and DKK1)between SCNT- and AI-derived conceptuses (Degrelleet al., 2012). Contrary to our findings, DKK1 was foundby Ledgard et al. (2009) to be differentially expressed inextra-embryonic tissue at d18 in SCNT compared to AIconceptuses. These authors used slot blot to evaluateexpression levels, which is less accurate than quantitativePCR. In addition, these investigators did not find evidenceof differential DKK1 expression in the extra-embryonictissue of SCNT and AI conceptuses at d20, d26, andd31, which corroborate with our findings at gestationd34. Thus, it is unclear whether or not the embryo cloningprocess is associated with differential expression of DKK1in extra-embryonic tissue during the peri-implantation peri-od. The same report showed an increase in DKK1 expres-sion from d18 to d31, in accordance with our findings thatDKK1 was strongly expressed in both AI and SCNTextra-embryonic tissue at d34 compared to d18. The knockout ofDKK1 inmice demonstrated that developmental changes inDKK1 expression are critical to the normal development ofthe fetus, for example, by modulating the formation of headand limbs (Mukhopadhyay et al., 2001). Our data supportanother important role for DKK1 expression in trophoblastsduring post-implantation development of the bovine fetus.

An 11-fold increase in the expression of WNT5A wasdetected in the allantois from SCNT and AI conceptuses.WNT5A expression was detectable in the extra-embryonicmesoderm, mesenchyme, and epithelial cells from theblood vessels. Therefore, we cannot distinguish whetherup-regulation of WNT5A was in a particular cell type orgeneralized throughout the allantois structure becausewhole allantoic tissues were used for quantitative PCRanalysis. As expression of WNT5A is under epigeneticcontrol (Jensen et al., 2009; Li et al., 2010), our findingthat embryo cloning affects WNT5A expression is consis-tent with the hypothesis that aberrant genetic reprogram-ming in extra-embryonic tissue is oneof themajor causes ofgestational failures among cloned conceptuses (Yanget al., 2007). In humans, the importance of WNTsignalingthrough WNT5A in the allantois has been reported for

TABLE 1. Fold-Changes in EET Gene Expression AssociatedWith Gestation Day and Tissue Type

d34 trophoblast/d18 extra-embryonic tissue

d34 trophoblast/d34 allantois

AI SCNT AI SCNT

WNT5A 327.7�� 144.3�� 65.9�� 4.6�

FZD5 3.6� 2.9 5.1�� 5.1��

CTNNB1 4.9 2.7�� 1.8�� 2.0��

KDM1A 0.7 0.6� 0.5�� 0.6�

SFRP1 0.1�� 0.1�� 0.1�� 0.2��

DKK1 54.3�� 58.6�� 50.2�� 27.6��

�FDR P< 0.05.��FDR P< 0.01.

TABLE 2. Effect of Gestation Day on Gene Expression inCaruncle and Inter-Carunclea

Caruncle Inter-caruncle

AI SCNT AI SCNT

WNT5A 0.5�� 0.5�� 0.5�� 0.6��

FZD5 0.2�� 0.2� 0.3�� 0.2��

CTNNB1 0.6�� 0.7�� 0.7�� 0.8��

KDM1A 0.5�� 0.5�� 0.5�� 0.6��

SFRP1 0.6�� 0.8 0.9 1.0DKK1 1.3 0.8 2.0�� 1.2

aFold changes are expressed in d34/d18.�FDR P< 0.05.��FDR P< 0.01.

Molecular Reproduction & Development BIASE ET AL.

982 Mol. Reprod. Dev. 80:977–987 (2013)

angiogenesis (Masckauch�an et al., 2006), and the differ-entiation and proliferation of mesoderm into mesenchymecells (Fazzi et al., 2011). These results suggest that thedysregulation of WNT5A expression may have importantconsequences for the cloned fetus, such as the develop-ment of hydrallantois (Constant et al., 2006; Chavatte-Palmer et al., 2012) at later stages of placentation.

Major differences in expression of WNTsignaling geneswere observed in comparisons made between the pre- andpost-implantation periods. The most striking changes wereobserved in the differentiating trophoblast (Table 1). Fur-thermore, therewasan association of SCNTwith the rate ofincrease or decrease of WNT5A expression from pre- topost-implantation time points. WNT5A protein activatesWNT/b-catenin-dependent and -independent pathways,based on which co-receptor is activated (Mikels andNusse, 2006; Grumolato et al., 2010). The expression ofboth FZD4/5 receptors, LRP5 and WNT5A in the d18trophoblast suggests that both canonical and noncanonicalWNT pathways may be activated (Mikels and Nusse,2006). In the trophoblasts of d34 bovine conceptuses,we detected transcripts from the two FZD receptors andthe co-receptor LRP5. We also detected high levels ofDKK1 transcripts at d34. DKK1 produced by binucleatedcells of the trophoblast (Ledgard et al., 2009) and stromalcells of the endometrium (Fig. 2) may interact with LRP5/6(Bafico et al., 2001; Mao et al., 2001) in the chorion. TheDKK1 protein removes LRP5/6 from the cell membrane(Mao et al., 2002), thus making it unavailable for formationof the WNT5A/FZD/LRP5 complex (Niehrs, 2006). Giventhese data, we hypothesize that the bovine trophoblastexhibits WNT5A signaling through the noncanonical path-way (Kohn and Moon, 2005) shortly after implantation. b-catenin-independent signaling would mainly induce cellmigration and polarity (Kikuchi et al., 2009). The levels ofWNT5A reached at post-implantation in cloned conceptus-es may be associated with some of the abnormal pheno-types and post-implantation mortality commonly observedin SCNT pregnancies, such as enlarged placentomes.Further experiments are needed to determine whetherthe differences observed are due to the donor cell lineused. In this regard, it is important to point out that theexperiments we conducted utilized expensive-to-produce,non-inbred animals where it was not feasible to control forall variables or confounding effects (e.g., source of recipientoocytes); given this complication, we controlled for asmanyvariables as possible in the statistical model used to detectdifferences in gene expression. In addition, it will be impor-tant to support our gene expression findings by measuringprotein levels, although such experimentswith tissues fromindividual d18 embryos are not currently feasible.

The bovine endometrium has been shown to be exqui-sitely sensitive to the presence of a cloned or IVF-producedembryo (Mansouri-Attia et al., 2009). At the pre-implanta-tion stage, we found that endometrium collected fromSCNT pregnancies expressed similar relative transcriptlevels of theWNTsignaling-related genes tested comparedto AI pregnancies. Consistent with our results, Bauersachset al. (2009) found levels of DKK1 transcripts that were

similar for the endometrial tissues collected from pregnan-cies derived from IVF and SCNT. Mansouri-Attia et al.(2009) used microarray analysis to compare gene expres-sion in endometrial tissues collected from SCNT and AIpregnancies at d20 of gestation. In contrast to our findings,these investigators reported that SFRP1 was up-regulatedin caruncle from SCNT pregnancies (which could be due todifferences at d18 and d20), whereas consistent with ourresults, five other genes in common with our study(WNT5A, FZD5, CTNNB1, KDM1A, and DKK1) showedno difference in expression. At the early post-implantationstage, we found the expression of six WNTsignaling-relat-ed genes to be similar between endometrial tissues fromAIand SCNT pregnancies. Differences in DKK1 expressionhave been reported in caruncle collected at d50 of preg-nancy (Ledgard et al., 2009). Collectively, these resultsindicate that differential, SCNT-associated DKK1 expres-sion in caruncle may develop later than d34. Our generalconclusion, however, is that WNTsignaling in the endome-trium during the peri-implantation period is not affected bySCNT.

In contrast, implantation appears to be associated withdifferences in WNT signaling in the endometrium. Thetranscript levels of most WNT-related genes were signifi-cantly reduced following implantation. The exception wasDKK1, which showed an increase in transcript levels afterimplantation in the intercaruncle from AI pregnancies. Theexpression of DKK1 in the bovine endometrium is initiatedaround d15�16 of pregnancy (Ledgard et al., 2009; Fordeet al., 2011). The increase of DKK1 expression inthe endometria of cattle (Ishitani et al., 2003; Fordeet al., 2011), humans (Tapia et al., 2011), and mice(Peng et al., 2008) during the peri-implantation periodindicates that the regulation of DKK1 is highly conserved.In cattle, the localization of DKK1 transcripts in a thin layerof stromal cells adjacent to the lumenof the uterus (Fig. 2) isa strong indication that DKK1 protein may influence therearrangement of the endometrial stromal cells and extra-embryonic tissue. As we and others have observed, theendometrial luminal epithelial cellsmaynot forma cohesivelayer of cells at d34 of gestation. Therefore, a portion of thetrophoblast layer may directly contact the basal lamina ofthe luminal endometrium. The expression of DKK1 by bothendometrium and binucleated cells of the extra-embryonictissue at d34 (Ledgard et al., 2009, data not shown) in-dicates that the noncanonical WNTsignaling pathway mayplay an important role in the differentiation and remodelingof extra-embryonic tissue and endometrium followingimplantation.

In summary, we examined the effects of SCNT andembryo implantation on the expression of WNT signalinggenes in extra-embryonic and endometrial tissues. Extra-embryonic tissues expressedWNT pathway-related genesduring the peri-implantation period, and embryo cloningwas associated with altered expression of WNT5A in theallantois at d34. In addition, the magnitude of the change inexpression of WNT signaling-related genes was shownto differ in extra-embryonic tissue derived from SCNTand AI conceptuses. After implantation is established,

WNT GENE EXPRESSION IN CATTLE CLONING

Mol. Reprod. Dev. 80:977–987 (2013) 983

the noncanonical WNT signaling pathway appears to be-come more active than the canonical pathway. In cattle,DKK1 expressed by binucleated cells and the endometrialstromal cells may drive this shift.

MATERIALS AND METHODS

Sample CollectionSamples consisted of bovine extra-embryonic tissue

obtained from both AI- and SCNT-derived conceptusesat d18 and d34, and corresponding endometrial tissues.Conceptuses from d18 AI pregnancies and all SCNT con-ceptuses were produced at the experimental farm of theInstitut National de la Recherche Agronomique, France(INRA). All experimental procedures were performed inaccordance with the rules and regulations of the EuropeanConvention on Animal Experimentation; the research in-volving cloned animals was approved by the INRA ethicalcommittee. Gestations producing d34 AI-derived concep-tuses were established and processed at the University ofIllinois atUrbana-Champaign,USA,with the approval of theInstitutional Animal Care and Use Committee. All methodsfor producing AI pregnancies and collection of tissues andRNA were standardized between the two laboratories.

AI PregnanciesHolstein heifers were artificially inseminated with frozen

semencollected fromHolstein bulls.All d34AI conceptuseswere produced using semen from one bull. Eight heifers atd18 and 10 heifers at d34 post-insemination were slaugh-tered. To collect d18 conceptuses, the uteruswas removed,and the ipsi-lateral horn was cannulated and flushed with1� phosphate-buffered saline (PBS). The collected con-ceptuses were observed under a stereomicroscope, andthe embryonic disc and the trophoblast were sampledseparately. d34 conceptuses were collected by incisionthrough the wall of the ipsi-lateral uterine horn, and theconceptuses were detached from the endometria. Theembryos were dissected from the extra-embryonic mem-branesandmeasured to evaluate their development status.The chorionic membranes were dissected away from theallantois, andboth tissuesweresampled separately.At bothd18 and d34 of pregnancies, the gravid horn was openedand rinsed with 1� PBS, then the endometrial carunclesand intercaruncular endometrium were dissected awayfrom the myometrium and sampled separately. All tissuesamples were either fixed in 4% paraformaldehyde or snapfrozen in liquid nitrogen for further processing.

SCNT PregnanciesCloned embryos were produced following a previously

published protocol (Vignon et al., 1998). Briefly, oocyteswere enucleated bymicromanipulation and fused with cellsfrom Holstein bovine skin fibroblast cell line 5538 (Heymanet al., 2002) by electro-stimulation. Reconstituted embryoswere cultured onto a feeder layer of monkey liver Vero cells

in B2 medium (CCD, Paris, France) supplemented with2.5% fetal bovine serum until the blastocyst stage. Twocloned blastocysts per recipient were transferred to estrus-synchronized Holstein heifers, and pregnancies were in-terrupted at d18 (n¼ 9) or d34 (n¼ 8) of gestation. Samplecollection was conducted as described previously for theAI-derived pregnancies.

Sample PreservationParaformaldehyde-fixed tissues were either dehydrated

in ethanol and embedded in paraffin wax or embedded inTissue-Tek1 O.C.T. compound (Sakura Finetek USA, Inc.,Torrance, CA) and frozen in contact with liquid-nitrogenvapor.

In Situ Hybridization and HistologyWNTsignaling-related geneswere selected for localized

expression analysis in extra-embryonic tissue (WNT5A,FZD4, FZD5, LRP5, GNAI2, CTNNB1, KDM1A, BCL2L1,and SFRP1), and two genes were selected for localizationanalysis in the endometrium (SFRP1 and DKK1). Thesegenes were selected on the basis of their role in the WNTsignaling pathway based on theMetaCore database (Ekinset al., 2007) and previous microarray data generated fromextra-embryonic tissue (Everts, RE; Sommers, CA; Oli-veira, R; Rodriguez-Zas, SR; Sung, LY; Du, F; Evans, ACO;Boland, M; Fair, T; Lonergan, P; Renard, JP; Yang, X;Lewin, HA; Tian, XC, unpublished results) and endometri-um (Mansouri-Attia et al., 2009). We selectedWNT5A andFZD5because theywere the paralogs observed to have thehighest expression in extra-embryonic tissue at d25.

Probes were prepared from cDNA cloned in previouslydescribed libraries (Everts et al., 2008). The insert frag-ment and one adjacent promoter were amplified by PCRusing the following primers (Degrelle et al., 2011):T3_pT3T7Pac_F: GTAAAACGAGGCCAGTGA; T3_pT3T7Pac_R: GCCCTCGAGGCCAAGAAT; T7_pT3T7Pac_F:CACAGGAAACAGCTATGACC; T7_pT3T7Pac_R: TGC-TTGCGGCCGCATTTGTTT; SP6_PGEMZf11_F: CACA-GGAAACAGCTATGACC;SP6_PGEMZf11_R:ATTGGCC-AAGTCGGCCGA; T7_PGEMZf11_F: GTAAAACGACGG-CCAGTGA;T7_PGEMZf11_R:CTCAAGCTTAGCATGCGG.The PCR products were purified with the Qiaquick1 PCRpurification kit (Qiagen, Boston, MA). One hundred nano-grams of DNA were used as the template to synthesizedigoxigenin-UTP (DIG)-labeled RNA using the DIG RNALabeling Mix (Roche Diagnostics, Indianapolis, IN) with thecorresponding RNA polymerase (Promega, Madison, WI).The probes were purified with mini Quick-Spin RNA Col-umns (Roche Diagnostics), quantified, subjected to aga-rose gel electrophoresis for purity evaluation, and frozen at�808C until used.

Paraffin- and OCT-preserved samples were sectioned(7mm) and mounted on Super Frost slides (Menzel-Gl€azer1, Germany), dried, and deparaffinized when nec-essary. Tissue sections were permeabilized with protein-ase K solution (10mg/ml) for 30min and hybridized withantisense or sense probes for 16 hr at 558C. After two

Molecular Reproduction & Development BIASE ET AL.

984 Mol. Reprod. Dev. 80:977–987 (2013)

washes in 2� saline-sodium citrate (SSC) for 10min at458C, sections were treated with RNase for 30min andwashed with 2� SSC five times for 5min at 458C. Thesections were incubated with sheep anti-DIG-alkalinephosphatase-conjugated antibody diluted 1:2,500 for 2 hr(RocheDiagnostics). Stainingwas developed using aNBT/BCIP solution (Promega, Madison, WI). The staining timewas consistent for both sense and antisense probes of anygiven gene. Each slide was mounted with a coverslip, andimages of the tissues were digitized with a Nanozoomer2.0-HT scanner (Hamamatsu, Hamamatsu City, Japan).

Paraffin sections of samples collected from d34 concep-tuses were stained with eosin and hematoxylin for cellidentification and counting in the trophoblast. At least100 cells were counted in three different regions of thesection image for the estimation of the percentage ofbinucleated cells.

RNA Extraction and cDNA SynthesisTotal RNAwas extracted from snap-frozen tissues using

the guanidinium thiocyanate-phenol-chloroform method(Chomczynski and Sacchi, 2006) (TRIzol1 Reagent, Invi-trogen, Carlsbad, CA), following the manufacturer’s in-structions with slight modifications. A purification withacid phenol:chloroform (pH 4.5, Ambion, Austin, TX) wasadded prior to RNA precipitation with isopropanol. RNAsamples were purified with the RNeasy1Mini Kit (Qiagen),quantified, and assayed for quality on a 2100 Bioanalyzer(Agilent, Santa Clara, CA).

Following extraction, cDNA was synthesized from100 ng of total RNA using SuperScript III Reverse Tran-scriptase (Invitrogen) with oligo(dT)12 and pentadecamersas primers (Invitrogen).

Quantitative Reverse-Transcriptase PCR andStatistical Analysis

Quantitative polymerase chain reactions were con-ducted to quantify the expression of genes related to the

WNT pathway. These reactions consisted of 1� PowerSYBR1 Green PCR Master Mix (Applied Biosystems,Foster City, CA), 100mM of specific primers for each targetgene, and cDNA (1/20th of the RT reaction), totaling 10ml.Oligonucleotide sequences used to amplify segments ofeach gene tested are listed in Table 3.

Reactions were performed in an ABI Prism 7900 HTSDS instrument (Applied Biosystems) following the man-ufacturer’s reaction parameters. Relative quantificationwas calculated using the standard curve method (UserBulletin #2, Applied Biosystems). Only cycle thresholdssmaller than 35 were used for analysis. An arbitrary abun-dance of target genes in extra-embryonic and endometrialtissues was estimated relative to the ACTB gene as aninternal control.

Arbitrary relative mRNA abundances were log2-trans-formed, and the differences were statistically comparedusing analysis of variance. Themodel used to analyze datafrom extra-embryonic tissue included ‘‘group’’ (AI, SCNT)and ‘‘tissue type’’ (d18extra-embryonic tissue, d34 chorion,d34 allantois) as fixed variables, and a ‘‘group’’� ‘‘tissuetype’’ interaction. The model used to analyze data fromendometrial tissue included gestation ‘‘day’’ (d18, d34),‘‘tissue type’’ (caruncle, intercaruncle), ‘‘group’’ (AI,SCNT), and the following pairwise interactions: ‘‘day’’� ‘‘group’’, ‘‘day’’� ‘‘tissue type’’, and ‘‘tissue type’’� ‘‘group’’.For both the extra-embryonic tissue and endometrial sam-ples, contrast statements were written to compare specific‘‘day’’, ‘‘tissue’’, and ‘‘group’’ combinations. The differencesbetween the adjusted mean expression values of thetwo compared ‘‘groups’’ were then converted to ratiosof expression levels by calculating anti-logarithms of theestimated differences. The analysis was conducted usingSAS/STAT1 software (Version 9.2 of the SAS System,Cary, NC) using the general linear model procedure.Rawprobability (P) values from the contrastswereadjustedfor multiple hypothesis testing using the FDR procedure(Benjamini and Hochberg, 1995). Contrasts with FDR-adjusted P values < 0.05 were considered statisticallysignificant.

TABLE 3. Primers Used to Determine Relative Levels of Gene Expression by Quantitative RT-PCR

Gene Sequence (5’-3’) Amplicon (bp) Accessiona

ACTB CCTGGCACCCAGCACAA 90 AY141970AGCGAGGCCAGGATGGA

CTNNB1 TTGAGCTGACCAGTTCTCTCTTCA 79 NM_00107614.1GCACCAATATCAAGTCCAAGATCA

DKK1 GGATGGGTACTCCAGAAGAACTACA 93 XM_580572.4GCACAGTCTGATGAGCGAAGAC

FZD5 CCATCTGGTGGGTCATCCTATC 64 ENSBTAT00000027911CTCGTTGCCCCACTTCATG

KDM1A GCAAAGGAAACTATGTAGCTGACCTT 76 BC151756CTGACCACAGCCATGGGATT

SFRP1 ATCTCTGTGCCAGCGAGTTT 75 NM_174460CAATCTTCTTGTCGCCGTTT

WNT5A AGGACGCTCCGCTTGGAT 150 XM_608467.5TTAGGAAGAACTTGGAAGACATTGC

aGenBank or Ensembl accession number of cattle mRNA sequence.

WNT GENE EXPRESSION IN CATTLE CLONING

Mol. Reprod. Dev. 80:977–987 (2013) 985

ACKNOWLEDGMENTS

The authors would like to thank Travis Michels for hisassistance with the sample collection at the University ofIllinois at Urbana-Champaign, and the staff of INRA exper-imental units (Saint-Gen�es-Champanelle, France andNou-zilly, France) for animal management and tissue collection.This study was supported by the USDA-ARS (no. AG58-1265-7-027), European Program SABRE (no. CT-2006-0162), National Agency of Research (nos. ANR-08-GENM-037, ANR-06-GANI-003-01, and ANR-09-GENM-012).

REFERENCES

Arnold DR, Bordignon V, Lefebvre R, Murphy BD, Smith LC. 2006.Somatic cell nuclear transfer alters peri-implantation trophoblastdifferentiation in bovine embryos. Reproduction 132:279�290.

Bafico A, Liu G, Yaniv A, Gazit A, Aaronson SA. 2001. Novelmechanism of Wnt signalling inhibition mediated by Dickkopf-1interaction with LRP6/Arrow. Nat Cell Biol 3:683�686.

Bauersachs S, Ulbrich SE, Zakhartchenko V, Minten M, Reich-enbach M, Reichenbach HD, Blum H, Spencer TE, Wolf E.2009. The endometrium responds differently to clonedversus fertilized embryos. Proc Natl Acad Sci USA 106:5681�5686.

Benjamini Y, Hochberg Y. 1995. Controlling the false discoveryrate: A practical and powerful approach to multiple testing. J RStat Soc B 57:289�300.

Bertolini M, Anderson GB. 2002. The placenta as a contributor toproduction of large calves. Theriogenology 57:181�187.

Chavatte-Palmer P, Camous S, Jammes H, Cleac’h NL, GuillomotM, Lee RSF. 2012. Placental perturbations induce the develop-mental abnormalities often observed in bovine somatic cellnuclear transfer. Placenta 33:S99�S104.

ChenQ, Zhang Y, Lu J,WangQ,Wang S, Cao Y,Wang H, Duan E.2009. Embryo-uterine cross-talk during implantation: The role ofWnt signaling. Mol Hum Rep 15:215�221.

Chomczynski P, Sacchi N. 2006. The single-step methodof RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: Twenty-something years on. Nat Protoc1:581�585.

Constant F, Guillomot M, Heyman Y, Vignon X, Laigre P,Servely JL, Renard JP, Chavatte-Palmer P. 2006. Largeoffspring or large placenta syndrome? Morphometric analysisof late gestation bovine placentomes from somatic nucleartransfer pregnancies complicated by hydrallantois. Biol Re-prod 75:122�130.

Degrelle SA, Le Cao KA, Heyman Y, Everts RE, Campion E,Richard C, Ducroix-Crepy C, Tian XC, Lewin HA, Renard JP,Robert-Granie C, Hue I. 2011. A small set of extra-embryonicgenes defines a new landmark for bovine embryo staging.Reproduction 141:79�89.

Degrelle SA, Jaffrezic F, Campion E, Cao KAL, Bourhis DL,Richard C, Rodde N, Fleurot R, Everts RE, Lecardonnel J,

Heiman Y, Vignon X, Yang X, Tian XC, Lewin H, Renard JP,Hue I. 2012. Uncoupled embryonic and extra-embryonic tissuescompromise blastocyst development after somatic cell nucleartransfer. PLoS ONE 7:e38309.

Ekins S, Nikolsky Y, Bugrim A, Kirillov E, Nikolskaya T. 2007.Pathway mapping tools for analysis of high content data. Meth-ods Mol Biol 356:319�350.

Everts RE, Chavatte-Palmer P, Razzak A, Hue I, Green CA,Oliveira R, Vignon X, Rodriguez-Zas SL, Tian XC, Yang X,Renard JP, Lewin HA. 2008. Aberrant gene expression patternsin placentomes are associated with phenotypically normal andabnormal cattle cloned by somatic cell nuclear transfer. PhysiolGenomics 33:65�77.

Farin CE, Farin PW, Piedrahita JA. 2004. Development of fetusesfrom in vitro-produced and cloned bovine embryos. J Anim Sci82:E53�E62.

Farin PW, Piedrahita JA, Farin CE. 2006. Errors in development offetuses and placentas from in vitro-produced bovine embryos.Theriogenology 65:178�191.

Fazzi R, Pacini S, Carnicelli V, Trombi L, Montali M, Lazzarini E,Petrini M. 2011. Mesodermal progenitor cells (MPCs) differen-tiate into mesenchymal stromal cells (MSCs) by activation ofWnt5/calmodulin signalling pathway. PLoS ONE 6:e26600.

Forde N, Carter F, Spencer TE, Bazer FW, Sandra O, Mansouri-Attia N, Okumu LA, McGettigan PA, Mehta JP, McBride R,O’Gaora P, Roche JF, Lonergan P. 2011. Conceptus-inducedchanges in the endometrial transcriptome: How soon does thecow know she is pregnant? Biol Reprod 85:144�156.

Grumolato L, Liu G, Mong P, Mudbhary R, Biswas R, Arroyave R,VijayakumarS,EconomidesAN,AaronsonSA. 2010.Canonicaland noncanonical Wnts use a common mechanism to activatecompletely unrelated coreceptors. Genes Dev 24:2517�2530.

Guillomot M. 1995. Cellular interactions during implantation indomestic ruminants. J Reprod Fertil Suppl 49:39�51.

Heyman Y. 2005. Nuclear transfer: A new tool for reproductivebiotechnology in cattle. Reprod Nutr Dev 45:353�361.

Heyman Y, Chavatte-Palmer P, LeBourhis D, Camous S, Vignon X,Renard JP. 2002. Frequency and occurrence of late-gestationlosses from cattle cloned embryos. Biol Reprod 66:6�13.

Hill JR, Burghardt RC, Jones K, Long CR, Looney CR, Shin T,Spencer TE, Thompson JA, Winger QA, Westhusin ME. 2000.Evidence for placental abnormality as the major cause of mor-tality in first-trimester somatic cell cloned bovine fetuses. BiolReprod 63:1787�1794.

Huang Y, Greene E, Stewart TM, Goodwin AC, Baylin SB, WosterPM, Caero RA, Jr. 2007. Inhibition of lysine-specific demehy-lase1 by polyamine analogues results in reexpression of aber-rantly silenced genes. ProcNatl AcadSci USA104:8023�8028.

Huang Y, Stewart TM, Wu Y, Baylin SB, Marton LJ, Perkins B,Jones RJ, Woster PM, Casero RA, Jr. 2009. Novel oligoamineanalogues inhibit lysine-specific demethylase 1 (LSD1) andinduce re-expression of epigenetic silenced genes. Clin CancerRes 15:7217�7228.

Molecular Reproduction & Development BIASE ET AL.

986 Mol. Reprod. Dev. 80:977–987 (2013)

Ishitani T, Kishida S, Hyodo-Miura J, UenoN, Yasuda J,WatermanM, Shibuya H, Moon RT, Ninomiya-Tsuji J, Matsumoto K. 2003.The TAK1-NLKmitogen-activated protein kinase cascade func-tions in the Wnt-5a/Ca(2þ) pathway to antagonize Wnt/beta-catenin signaling. Mol Cell Biol 23:131�139.

Jensen TJ, Wozniak RJ, Eblin KE, Wnek SM, Gandolfi AJ,Futscher BW. 2009. Epigenetic mediated transcriptional activa-tion of WNT5A participates in arsenical-associated malignanttransformation. Toxicol Appl Pharmacol 235:39�46.

Kikuchi A, Yamamoto H, Sato A. 2009. Selective activationmechanisms of Wnt signaling pathways. Trends Cell Biol 19:119�129.

King GJ, Atkinson BA, Robertson HA. 1979. Development ofthe bovine placentome during the second month of gestation.J Reprod Fertil 55:173�180.

King GJ, Atkinson BA, Robertson HA. 1981. Development of theintercaruncular areas during early gestation and establishmentof the bovine placenta. J Reprod Fertil 61:469�474.

Kohn AD, Moon RT. 2005. Wnt and calcium signaling: Beta-catenin-independent pathways. Cell Calcium 38:439�446.

Ledgard A, Lee RS, Couldrey C, Peterson J. 2009. Dickkopf-1expression during early bovine placentation and its down-regu-lation in somatic cell nuclear transfer (SCNT) pregnancies. JReprod Dev 55:467�474.

Li J, Ying J, Fan Y, Wu L, Ying Y, Chan AT, Srivastava G, Tao Q.2010. WNT5A antagonizes WNT/b-catenin signaling and isfrequently silenced by promoter CpGmethylation in esophagealsquamous cell carcinoma. Cancer Biol Ther 10:617�624.

Mansouri-Attia N, Sandra O, Aubert J, Degrelle S, Everts RE,Giraud-Delville C, Heyman Y, Galio L, Hue I, Yang X, Tian XC,Lewin HA, Renard JP. 2009. Endometrium as an early sensor ofin vitro embryo manipulation technologies. Proc Natl Acad SciUSA 106:5687�5692.

Mao B, WuW, Li Y, Hoppe D, Stannek P, Glinka A, Niehrs C. 2001.LDL-receptor-related protein 6 is a receptor for Dickkopf pro-teins. Nature 411:321�325.

Mao B,WuW, DavidsonG,Marhold J, Li M,Mechler BM, Delius H,HoppeD,StannekP,WalterC,GlinkaA,NiehrsC. 2002.Kremenproteins are Dickkopf receptors that regulate Wnt/beta-cateninsignalling. Nature 417:664�667.

Masckauch�an TN, Agalliu D, Vorontchikhina M, Ahn A, ParmaleeNL, Li CM, Khoo A, Tycko B, Brown AM, Kitajewski J. 2006.Wnt5a signaling induces proliferation and survival of endothelialcells in vitro and expression of MMP-1 and Tie-2. Mol Biol Cell17:5163�5172.

Meissner A, Jaenisch R. 2006. Mammalian nuclear transfer. DevDyn 235:2460�2469.

Mikels AJ, Nusse R. 2006. Purified Wnt5a protein activates orinhibits beta-catenin-TCF signaling depending on receptor con-text. PLoS Biol 4:e115.

Mukhopadhyay M, Shtrom S, Rodriguez-Esteban C, Chen L,Tsukui T, Gomer L, Dorward DW, Glinka A, Grinberg A, HuangSP, Niehrs C, Izpisua Belmonte JC, Westphal H. 2001. Dick-kopf1 is required for embryonic head induction and limb mor-phogenesis in the mouse. Dev Cell 1:423�434.

NiehrsC. 2006. Functionand biological roles of theDickkopf familyof Wnt modulators. Oncogene 25:7469�7481.

Peng S, Li J, Miao C, Jia L, Hu Z, Zhao P, Li J, Zhang Y, Chen Q,Duan E. 2008. Dickkopf-1 secreted by decidual cells promotestrophoblast cell invasion during murine placentation. Reproduc-tion 135:367�375.

Renard JP, Zhou Q, LeBourhis D, Chavatte-Palmer P, Hue I, Hey-man Y, Vignon X. 2002. Nuclear transfer technologies: Betweensuccesses and doubts. Theriogenology 57:203�222.

Rodriguez-Alvarez L, Cox J, Tovar H, Einspanier R, Castro FO.2010a. Changes in the expression of pluripotency-associatedgenes during preimplantation and peri-implantation stagesin bovine cloned and in vitro produced embryos. Zygote18:269�279.

Rodriguez-Alvarez L, Sharbati J, Sharbati S, Cox JF, Einspanier R,Castro FO. 2010b. Differential gene expression in bovineelongated (day 17) embryos produced by somatic cellnucleus transfer and in vitro fertilization. Theriogenology 74:45�59.

Smith SL, Everts RE, Tian XC, Du F, Sung LY, Rodriguez-Zas SL,Jeong BS, Renard JP, Lewin HA, Yang X. 2005. Global geneexpression profiles reveal significant nuclear reprogramming bythe blastocyst stage after cloning. Proc Natl Acad Sci USA102:17582�17587.

Sonderegger S, Pollheimer J, Kn€ofler M. 2010. Wnt signalling inimplantation, decidualisation and placental differentiation��Review. Plancenta 31:839�847.

Tapia A, Vilos C, Marin JC, Croxatto HB, Devoto L. 2011. Bioinfor-matic detection of E47, E2F1 and SREBP1 transcription factorsas potential regulators of genes associated to acquisition ofendometrial receptivity. Reprod Biol Endocrinol 9:14.

Vignon X, Chesn�e P, Le Bourhis D, Heyman Y, Renard JP. 1998.Developmental potential of bovine embryos reconstructed fromenucleatedmaturedoocytes fusedwith cultured somatic cells.CR Acad Sci III 321:735�745.

Wilmut I, Paterson L. 2003. Somatic cell nuclear transfer. OncolRes 13:303�307.

Wilmut I, Beaujean N, de Sousa PA, Dinnyes A, King TJ, PatersonLA, Wells DN, Young LE. 2002. Somatic cell nuclear transfer.Nature 419:583�586.

Yang X, Smith SL, Tian XC, Lewin HA, Renard JP, Wakayama T.2007. Nuclear reprogramming of cloned embryos and its im-plications for therapeutic cloning. Nat Genet 39:295�302.

YoungLE,Sinclair KD,Wilmut I. 1998. Largeoffspring syndrome incattle and sheep. Rev Reprod 3:155�163.

WNT GENE EXPRESSION IN CATTLE CLONING

Mol. Reprod. Dev. 80:977–987 (2013) 987