a. a five-carbon sugarb. type of weak bond between base pairs that holds the double helix togetherc. four kinds and they form specific pairsd. subunits that make up DNAe. one of two pyrimidines used as a nitrogenous base in nucleotidesf. one of two purines used as a nitrogenous base in nucleotidesg. discovered that the amount of adenine always equaled the amount of cytosine and that guanine always equaled cytosineh. two strands of nucleotides twisted around each other

Section: The Structure of DNARead each question, and answer based upon what you learn in the section.

1. What is the central dogma of biology?

DNA mRNA Protein Trait

Match the letter of the phrase with the appropriate term

2. __h___ double helix

3. __d___ nucleotides

4. __a___ deoxyribose

5. __b___ hydrogen bond

6. __c___ nitrogenous

bases

7. __f___ adenine

8. __e___ cytosine

9. __g___ Chargaff

Describe each feature of DNA below10. Complementary: one strand matches the other, not

mirror images but fits together like hands.11. Anti-parallel: the backbones are parallel but run in

opposite directions, like a two-lane highway.12. Backbone: outside regions of the molecule. composed

of repeating molecules of phosphate groups and 5-carbon sugars

13. Nucleotides: subunits of nucleic acids. Made of a phosphate group, 5-carbon sugar, and a nitrogen base.

14. Purines: category of nucleotide with 2-ringed nitrogenous bases A & G

15. Pyrimidines: category of nucleotide with 1-ring nitrogenous bases: T, C, & U

16. Hydrogen Bonds: the weak type of bond that holds the 2 strands of DNA together between the nitrogen bases.

17. Base-pairing rules: based off of Chargaff’s rules. A double bonds with T, C triple bonds with G

Section: Replication1. labeling

Section: Gene Expression, Transcription & translationMatch the letter of the phrase with appropriate term

1. __b___ribonucleic acid (RNA)2. __f___uracil3. __e___transcription4. __c___translation5. __a___gene expression6. __d___codon

Complete each statement by identifying the correct term or phrase in the brackets.

7. Transcription begins when [RNA / RNA polymerase] binds to the gene’s promoter. The promoter region contains the sequence [AUG / TAC]. RNA polymerase adds complementary [DNA / RNA] nucleotides as it “reads” the gene. In eukaryotes, transcription takes place in the [nucleus / cytoplasm].

Read each question, and write your answer in the space provided.8. What are three differences between RNA & DNA?

Has uracil instead of thymine, single-stranded instead of double, ribose instead of deoxyribose.1. For the DNA sequence [GGCCTACTGCAATATCGAGT], where is the gene? What determines where on the DNA

molecule gene transcription begins and where it ends?The gene starts and ends with the sequences in DNA. The start sequence is TAC and the stop sequences are ATT, ATC, ACT. These are signals for transcription to begin and end.

2. How could mRNA in the brain be different than the mRNA in the heart?Even though both cell types have the same DNA, including all the same genes, only the genes needed by the tissue is used for the organ. Brain cells use the brain genes and ignore the heart genes, heart cells use the heart genes and ignore the brain genes.Describe the role of each RNA molecule.

3. mRNA: is the RNA transcript of the gene in DNA. Carries the gene recipe to the cytoplasm4. tRNA: is the link between genetic material (RNA) and amino acids. Carries amino acid corresponding to the

codon.5. rRNA: structural component (along with protein) of ribosomes.

Complete each statement by identifying the correct term or phrase in the brackets.6. Translation takes place in the [nucleus / cytoplasm]. It uses the molecules called [rRNA / tRNA] to bring [proteins

/ amino acids] to the [E.R. / ribosome] by matching their [anti-codon /codon] to the complementary [anti-codon / codon] in [DNA / mRNA].

7. See below (XXX = given)ATGACTAGCTGGGGGTATTACTTTTAG TACTGATCGACCCCCATAATGAAAATCMrna xxxxxxxxxxxxxxUACUGAUCGACCCCCAUAAUGAAAAUCMET-THR-SER-TYR-GLY-TYR-TYR-LYS-STOP

XXXGAGTGTGAT(GCC…)TACAAC(CCT…)TAAXXXCTCACACTA(CGG…)XXXTTG(GGA…)ATTAUGGAGXXXXXX(GCC…)UACAAC(CCU…)UAAUACXXXACACUA(CGG…)AUGXXX(GGA…)XXXMET-GLU-CYS-VAL-XXX-TYR-THR-XXX-STOP

Section G2:1. Dna starts to condense (finishes in prophase) and organelle are doubled.2. Label

a. DNAb. Nucleosomesc. 30nm fiberd. Centromere

a. the entire process by which genes are used to build proteins/traits.b. a molecule made of linked nucleotidesc. the process of reading instructions on an RNA molecule to put together the amino acids that make up a proteind. a 3-nucleotide sequence of mRNAe. the process of transferring a gene’s instructions for making a protein to an RNA moleculef. a nitrogenous base used in RNA instead of the base thymine found in DNA

e. chromosomef. Chromatid (one of 2 sister chromatid)g. Histone inside nucleosome

Section: Mitosis

1.2. SEE RIGHT3. Interphase, the phase of living4. Mitosis is nuclear division, cytokinesis is cytoplasm division (or

the rest of cell division)Matching:

1. D2. A3. C4. I (eye)5. Q6. K7. N8. A9. M10. E11. M12. L 13. F/G (L sortof)14. C

Section: Mutations1. See below

a. Point = 1 DNA nucleotide changed to anotherb. A point mutation that results in a new amino acidc. A point mutation that results in a stop codond. A point mutation, changing one base to anothere. A DNA mutation that results in a base being removed, results in a frameshiftf. When and insertion of deletion results in the codon sequence to change forward of the mutation.

2. Frameshift mutations (caused by insertions or deletions) and nonsense mutations (point substitution mutations that change the codon to a stop codon) cause the biggest problems. The more amino acids affected, the bigger the affect so if the change is at the beginning of the coding sequence (DNA in the gene) then it will have more of an affect than if it were at the end of the coding sequence.