Upload
garry-caldwell
View
230
Download
2
Tags:
Embed Size (px)
Citation preview
Organic compounds – ALL organic compounds contain the elements carbon and hydrogen always!
– Carbon & Hydrogen together = Organic
Inorganic compounds – Any of Earth’s elements combined but will rarely contain carbon and hydrogen together.
– Carbon & Hydrogen not together = Not Organic
Types of Compounds
1. Water (H2O)
2. Methane (CH4)
3. Carbon Dioxide (CO2)
4. Salts (NaCl)
5. Carbonic Acid (CH2O3)
6. Sugar (C6H12O6)
7. Ozone (O3)
Organic or Inorganic Compound?
Which compound has the most stored energy in its bonds? Why?
Do Now 4
1. Which compound has the most stored energy? Why?a) CH3(CH2)20COOH
b) C12H24O12
c) C3H7O2N
2. Where is chemical energy stored?
3. How is an organic compound different from an inorganic compound?
4. What are 4 common elements in living things?
WATER! H2O Living things consist of 60-98% water. Important for transport and chemical reactions
Polar molecule (like a magnet!)
More positive (+) on one sideMore negative (-) on opposite side
Why is this important (turn the page)
Important INORGANIC compound
http://www.zo.utexas.edu/faculty/sjasper/images/WaterStructure.swf
Why is it important that water has a positive and negative side? Gives water special properties:
1. Cohesion - water sticks together 2. Adhesion – water sticks to other surfaces3. Water is the universal solvent!
Importance of Water being Polar
http://www.zo.utexas.edu/faculty/sjasper/images/WaterTransport.swf
Many substances in the body dissolve in waterSolvent:
Substance that is present in a greater amount and dissolves another substance (solute)
Solute: Substance that is dissolved
Put salt in water… what is the solute and solvent?
Hint to remember difference*
Solvent?
Water is good at dissolving substances with a charge. Here is sodium chloride (table salt).
Sodium has a positive charge because chlorine took one of sodium's electrons. Chlorine is now negative because it has an extra electron.
The negative end of water pulls on the sodium atom and the positive end of other water molecules pull on the negatively charged chlorine.
CheckpointWe now know:
Elements, atoms, protons, neutrons, electrons, ionsHow atoms work
Molecules, macromolecules, compounds, organic, inorganicHow atoms interact
Water, polar, adhesion, cohesion, solvent, solute Why water is a special and important inorganic molecule
Now we know some chemistry, lets look at organic molecules and their structure and function in organisms
Organic MacromoleculesThe molecules found in living things are composed of hundreds of atoms, sometimes more (macromolecules).
Cells create macromolecules by joining monomers (smaller molecules) in to long chains of monomers called polymers.
Monomers and Polymers
Polymers are made up of many monomers
Dimer = Two unitsMonomer = One unit.
Polymer = Several units bonded together.
CarbohydratesCarbohydrates contain the elements:
1. Carbon C2. Hydrogen H3. Oxygen O
Carbon, Hydrogen, Oxygen atoms are in the ratio 1:2:1 (C:H:O)
What does this mean?•There are always 2 Oxygen for 1 Hydrogen•O:H ratio = 2:1
Carbohydrates
How are carbohydrates created?– Made by plants (autotrophs)
How do carbohydrates look? Single ring-like compound (monomer)Many single rings bonded together (polymer)
Major functions:Energy and energy storage in organisms Structural support in plant cell wall
Do Now1. Describe these prefixes or suffixes:
a) Mono c) Polyb) Di d) Saccharide
2. What is the ratio of C:H:O atoms in a sugar?
3. What does the structure of sugar look like?
4. What foods contain carbohydrates?
Carbohydrates
Basic forms of Carbohydrates:1. Monosaccharides (“one” – “sugar”)2. Disaccharides (“two” – “sugar”)3. Polysaccharides (“many” – “sugar”)
Carbohydrates are made of monomers called monosaccharides
A
B
Types of CarbohydratesMonosaccharides: simple sugars (monomers)
– Glucose C6H12O6
Disaccharides: 2 sugars bonded together– Sucrose (table sugar)– Lactose (milk sugar)
CarbohydratesPolysaccharide: more than 2 sugars bonded together
– Starch – energy storage in plants – Example: potatoes
– Cellulose – provides structural support in cell walls
– Glycogen – used for energy storage in animals (liver/muscles)
What kind of “saccharide”1. Glucose + Glucose =
2. Glucose + Glucose + Glucose =
3. Starch + Glucose =
4. Cellulose =
5. Glucose =
What do you notice about the names for most sugars?
Glucose
Fructose
Maltose
Sucrose
Galactose
Cellulose
What kind of “saccharide”1. Glucose + Glucose =
2. Glucose + Glucose + Glucose =
3. Starch + Glucose =
4. Cellulose =
5. Glucose =
6. Maltose =
What’s going on in the picture?How is the left side different from the right side?What is missing on the right side that is on the left side?
Monomers are brought together to make Polymers
Building Polymers– Dehydration synthesis: process of synthesizing large,
complex molecules (polymers) from smaller molecules (monomers) by removing water!
Summary
1.Does water influence (have an effect) on chemical reactions?
2.How are macromolecules synthesized?
1. Is the molecule organic or inorganic?
a) Water (H2O)
b) Methane (CH4)
c) Carbon Dioxide (CO2)
d) Sugar (C6H12O6)
e) Ozone (O3)
2. Explain what is happening and fill-in the blank:
a) Glucose + Glucose = ________________
a) Process = ______________________
b) Starch + Glucose = ____________________
a) Process = _______________________
Is the molecule organic or inorganic?
a) Water (H2O)
b) Methane (CH4)
c) Carbon Dioxide (CO2)
d) Sugar (C6H12O6)
e) C10H18O2
What’s going on in the picture?How is the left side different from the right side?What is missing on the left side that is on the right side?
How do you break larger molecules apart?Simply add water!Hydrolysis – Polymers are broken down into monomers when water is introduced (added)
LipidsContain the elements:
Carbon, Hydrogen, Oxygen NOT a 1:2:1 ratio! H:O ratio = greater than 2:1 H:O ratio
Function:1. Energy Storage
Stores more energy than other types of molecules2. Large part of cell membrane structure
Are lipids organic? Why?
Lipids
Examples of Lipids:1. Fats2. Oils3. Waxes4. Steroids (Cholesterol)
Lipids are non-polar Do lipids and water mix? NO! Lipids are considered hydrophobic Hydro phobic -
Lipid StructureNo “ring” structure
Only in steroids (you don’t have to know)
Building Blocks (Also known as monomers)1. Glycerol backbone
Holds the fatty acids together 2. Fatty Acids
Long chains of H-C bonds
Common lipid Triglyceride
Glycerol backbone and 3 fatty acids
Complete your Lipid Chart
Lipid Words and Examples
Elements found in Lipids
Monomers Polymer
Examples:
Brought together by:
Broken down by:
Functions of Lipids Found in what foods
Proteins Elements in Proteins:
CarbonHydrogenOxygenNitrogen (N) Some contain (P, S)
Are proteins organic? Why?
ProteinsProteins have several very important functions:
Hormones (insulin)Enzymes (speed up chemical reactions)ReceptorsMembrane transportAntibodiesCell structureMuscle contraction
And more…
They help cells communicate and get things done!
Building Blocks are amino acidsPolymer = Protein (Polypeptide)Monomers = Amino AcidsProteins are long chains of amino acids
Proteins
Amino Acid Amino Acid Amino Acid
Amino AcidHow can I make these amino acids a protein?
Proteins: made of amino acidsAmino Acids
There are 20 different Amino Acids
Amino acids combine to form unlimited types of proteins – Just like the 26 letters in the alphabet
AMINO ACID SEQUENCE (order) DETERMINES : Protein SHAPE (how it folds) and protein FUNCTION
Proteins: made of amino acids
Peptide bonds – join amino acids together
Polypeptide = Another name for a protein
a.a.
a.a.
a.a.
a.a.
Peptide Bond
Nucleic AcidsFound: In the nucleus Is the macromolecule that makes-up your genetic code!Blueprints for every trait, protein in your body!
Elements:All contain: C,H,O, N and Phosphorus (P)
2 kinds of Nucleic Acids:1. Deoxy-ribo-nucleic-acid (DNA)2. Ribo-nucleic-acid (RNA)
Nucleic Acids
Building Blocks (monomers):Nucleotides
Nucleic Acids: Made of nucleotides
Put many small nucleotides (small pieces) together, you get a big nucleic acid (polymer).
Nucleic Acids: Made of nucleotides5 types of nucleotides (bases):
1. Adenine 2. Guanine 3. Cytosine 4. Thymine (only DNA)5. Uracil (only RNA)
The sequence of your nucleotides CGATTCGATCGCCTAGCAACTCGATCIs your genetic code. It makes you, YOU!
Nucleotides (where the elements come from)
Made up of:1. Sugar (Deoxyribose or Ribose)2. Phosphate 3. Base (5 types)
The Molecules of LifeKnow the Building Blocks of Macromolecules
• Carbohydrates (monosaccharides)
• Lipids (fatty acids)
• Proteins (amino acids)
• Nucleic Acids (nucleotides)