BIO 424 Week 2a DNA Structure (3)

video slide

Nucleic acids store and transmit hereditary informationThe amino acid sequence of a polypeptide is programmed by a unit of inheritance called a geneGenes are made of DNA: a nucleic acidCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings1The Roles of Nucleic AcidsThere are two types of nucleic acids:Deoxyribonucleic acid (DNA)Ribonucleic acid (RNA)Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings2The Structure of Nucleic AcidsNucleic acids are polymers called polynucleotidesEach polynucleotide is made of monomers called nucleotidesEach nucleotide consists of:Nitrogenous basePentose sugarPhosphate groupCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings3

Fig. 5-27ab5' end5'C3'C5'C3'C3' end(a) Polynucleotide, or nucleic acid(b) NucleotideNucleosideNitrogenousbase3'C5'CPhosphategroupSugar(pentose)4Figure 5.27 Components of nucleic acidsNucleotide MonomersThe portion of a nucleotide without the phosphate group is called a nucleoside

Nucleoside = nitrogenous base + sugar

Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings5

Fig. 5-27ab5' end5'C3'C5'C3'C3' end(a) Polynucleotide, or nucleic acid(b) NucleotideNucleosideNitrogenousbase3'C5'CPhosphategroupSugar(pentose)6Figure 5.27 Components of nucleic acidsNucleotide MonomersThere are two families of nitrogenous bases: Pyrimidines have a single six-membered ringCytosineThymineUracil (only in RNA)


Fig. 5-27c-1(c) Nucleoside components: nitrogenous basesPurinesGuanine (G)Adenine (A)Cytosine (C)Thymine (T, in DNA)Uracil (U, in RNA)Nitrogenous basesPyrimidines8Figure 5.27 Components of nucleic acidsNucleotide MonomersThere are two families of nitrogenous bases: Purines have a six-membered ring fused to a five-membered ringAdenineGuanine


Fig. 5-27c-1(c) Nucleoside components: nitrogenous basesPurinesGuanine (G)Adenine (A)Cytosine (C)Thymine (T, in DNA)Uracil (U, in RNA)Nitrogenous basesPyrimidines10Figure 5.27 Components of nucleic acidsNucleotide MonomersIn DNA the sugar is deoxyribose

In RNA the sugar is ribose

Nucleotide = nucleoside + phosphate groupCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings11

Fig. 5-27c-2Ribose (in RNA)Deoxyribose (in DNA)Sugars(c) Nucleoside components: sugars12Figure 5.27 Components of nucleic acidsNucleotide PolymersNucleotide polymers are linked together to build a polynucleotideAdjacent nucleotides are joined by covalent bonds that form between the OH group on the 3 carbon of one nucleotide and the phosphate on the 5 carbon on the nextCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings13

Fig. 5-27ab5' end5'C3'C5'C3'C3' end(a) Polynucleotide, or nucleic acid(b) NucleotideNucleosideNitrogenousbase3'C5'CPhosphategroupSugar(pentose)14Figure 5.27 Components of nucleic acidsNucleotide PolymersThese phosphodiester linkages create a backbone of sugar-phosphate units with nitrogenous bases as appendagesThe sequence of nitrogenous bases along a DNA or mRNA polymer is unique for each geneCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings15The DNA Double HelixRNA molecule is a single polynuculeotideSingle strandedDNA molecule ..Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings16Building a Structural Model of DNAAfter most biologists became convinced that DNA was the genetic material the challenge was to determine how its structure accounts for its roleMaurice Wilkins and Rosalind Franklin were using a technique called X-ray crystallography to study molecular structureFranklin produced a picture of the DNA molecule using this techniqueCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings17

Fig. 16-6b(b) Franklins X-ray diffraction photograph of DNA18Figure 16.6 Rosalind Franklin and her X-ray diffraction photo of DNAFranklins X-ray crystallographic images of DNA enabled Watson to deduce that DNA was helical The X-ray images also enabled Watson to deduce the width of the helix and the spacing of the nitrogenous basesThe width suggested that the DNA molecule was made up of two strands forming a double helixCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings19Fig. 16-1

20Figure 16.1 How was the structure of DNA determined?Watson and Crick built models of a double helix to conform to the X-rays and chemistry of DNAThey placed the sugar-phosphate chains on the outside and the nitrogenous bases on the inside of the double helixThis arrangement put the relatively hydrophobic nitrogenous bases in the molecules interiorCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings21The sugar-phosphate chains of each strand are like the side ropes of a rope ladderPairs of nitrogenous bases form rungsOne base from each strandThe ladder forms a twist every ten basesThe nitrogenous bases are paired in specific combinations

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings22

Fig. 5-27ab5' end5'C3'C5'C3'C3' end(a) Polynucleotide, or nucleic acid(b) NucleotideNucleosideNitrogenousbase3'C5'CPhosphategroupSugar(pentose)23Figure 5.27 Components of nucleic acids

Each strand runs in a different direction than its complementary strandThis is known as an antiparallel arrangement


Fig. 16-7aHydrogen bond3 end5 end3.4 nm0.34 nm3 end5 end(b) Partial chemical structure(a) Key features of DNA structure1 nm26Figure 16.7 The double helix

Fig. 16-7b(c) Space-filling model27Figure 16.7 The double helix

At first Watson and Crick thought the bases paired like with like (A with A, and so on) but such pairings did not result in a uniform width Instead pairing a purine with a pyrimidine resulted in a uniform width consistent with the X-rayCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings28

Fig. 16-UN1Purine + purine: too widePyrimidine + pyrimidine: too narrowPurine + pyrimidine: width consistent with X-ray data29Watson and Crick reasoned that the pairing was more specific dictated by the base structuresThey determined that Adenine (A) paired only with thymine (T)Guanine (G) paired only with cytosine (C)Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings30

Fig. 16-8Cytosine (C)Adenine (A)Thymine (T)Guanine (G)31Figure 16.8 Base pairing in DNA

The Watson-Crick model explains Chargaffs rules: In any organism the amount of A = T and the amount of G = CCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings32Many proteins work together in DNA replication and repairThe relationship between structure and function is manifest in the double helixWatson and Crick noted that the specific base pairing suggested a possible copying mechanism for genetic material

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings33The Basic Principle: Base Pairing to a Template StrandSince the two strands of DNA are complementary each strand acts as a template for building a new strand in replicationIn DNA replication the parent molecule unwinds and two new daughter strands are built based on base-pairing rulesCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings34

Fig. 16-9-1ATGCTATAGC(a) Parent molecule35Figure 16.9 A model for DNA replication: the basic concept

Fig. 16-9-2ATGCTATAGCATGCTATAGC(a) Parent molecule(b) Separation of strands36Figure 16.9 A model for DNA replication: the basic concept

Fig. 16-9-3ATGCTATAGC(a) Parent moleculeATGCTATAGC(c) Daughter DNA molecules, each consisting of one parental strand and one new strand(b) Separation of strandsATGCTATAGCATGCTATAGC37Figure 16.9 A model for DNA replication: the basic conceptWatson and Cricks model of replication was semiconservative It predicted that when a double helix replicates each daughter molecule will have one old strand (derived from the parent molecule) and one newly made strandCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings38

Competing models include the conservative model and the dispersive modelIn the conservative model the two parent strands rejoin


In the dispersive model each strand is a mix of old and newCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings42

Fig. 16-10Parent cellFirst replicationSecond replication(a) Conservative model(b) Semiconserva- tive model(c) Dispersive model44Figure 16.10 Three alternative models of DNA replicationExperiments by Matthew Meselson and Franklin Stahl supported the semiconservative model In their experiments they labeled the nucleotides of the old strands with a heavy isotope of nitrogen (15N) while any new nucleotides were indicated by a lighter isotope (14N)Replicated strands could be separated by density in a centrifuge Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin CummingsMeselson and Stahl Experiment45

Fig. 16-11aEXPERIMENTRESULTS1324Bacteria cultured in medium containing 15NBacteria transferred to medium containing 14NDNA sample centrifuged after 20 min (after first application)DNA sample centrifuged after 20 min (after second replication)Less denseMore dense46Figure 16.11 Does DNA replication follow the conservative, semiconservative, or dispersive model?The first replication in the 14N medium produced a band of hybrid (15N-14N) DNA eliminating the conservative modelCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

47

Fig. 16-11bCONCLUSIONFirst replicationSecond replicationConservative modelSemiconservative modelDispersive model48Figure 16.11 Does DNA replication follow the conservative, semiconservative, or dispersive model?A second replication produced both light and hybrid DNA eliminating the dispersive model and supporting the semiconservative modelCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

49

Fig. 16-11bCONCLUSIONFirst replicationSecond replicationConservative modelSemiconservative modelDispersive model50Figure 16.11 Does DNA replication follow the conservative, semiconservative, or dispersive model?A chromosome consists of a DNA molecule packed together with proteinsThe bacterial chromosome is a double-stranded circular DNA molecule associated with a small amount of proteinIn a bacterium the DNA is supercoiled and found in a region of the cell called the nucleoidCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings51Eukaryotic chromosomes have linear DNA molecules associated with a large amount of proteinAlmost equal amount of DNA and proteinChromatin is a complex of DNA and protein and is found in the nucleus of eukaryotic cellsHistones are proteins that are responsible for the first level of DNA packing in chromatinCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings52For the Cell Biology Video Cartoon and Stick Model of a Nucleosomal Particle, go to Animation and Video Files.Most common histones are H2A, H2B, H3, H4Histones have relatively high percentage of positively charged amino acidsLysine and arginineAllows histones to bind to negatively charged DNACopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings53For the Cell Biology Video Cartoon and Stick Model of a Nucleosomal Particle, go to Animation and Video Files.Histones are highly conservedH4 in cow and pea differ by 2 AAsLack of change over time indicates how vital they areCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings54For the Cell Biology Video Cartoon and Stick Model of a Nucleosomal Particle, go to Animation and Video Files.Chromatin is organized into fibers10-nm fiberDNA winds around histones to form nucleosome beadsNucleosomes are strung together like beads on a string by linker DNA H2A, H2B, H3 and H4 involved


Fig. 16-21aDNA double helix (2 nm in diameter)Nucleosome(10 nm in diameter)HistonesHistone tailH1DNA, the double helixHistonesNucleosomes, or beads on a string (10-nm fiber)56Figure 16.21a Chromatin packing in a eukaryotic chromosome30-nm fiberInteractions between histone tails of nucleosomes and linker DNA cause the thin fiber to coil or fold into this thicker fiberAnother histone (H1) also involvedCommon during interphaseCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings57

Fig. 16-21b30-nm fiberChromatid (700 nm)LoopsScaffold300-nm fiberReplicated chromosome (1,400 nm)30-nm fiberLooped domains (300-nm fiber)Metaphase chromosome59Figure 16.21b Chromatin packing in a eukaryotic chromosome300-nm fiberThe 30-nm fiber forms looped domains that attach to proteinsMetaphase chromosomeThe looped domains coil furtherThe width of a chromatid is 700 nmGenes always end up in same positionCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings60

Fig. 16-21b30-nm fiberChromatid (700 nm)LoopsScaffold300-nm fiberReplicated chromosome (1,400 nm)30-nm fiberLooped domains (300-nm fiber)Metaphase chromosome61Figure 16.21b Chromatin packing in a eukaryotic chromosomeMost chromatin is loosely packed in the nucleus during interphase and condenses prior to mitosisLoosely packed chromatin is called euchromatinCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings62During interphase a few regions of chromatin (centromeres and telomeres) are highly condensed into heterochromatinDense packing of the heterochromatin makes it difficult for the cell to express genetic information coded in these regionsCopyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings63DNA and Proteins as Tape Measures of EvolutionOne DNA molecule includes many genesThe linear sequences of nucleotides in DNA molecules are passed from parents to offspringTwo closely related species are more similar in DNA than are more distantly related speciesMolecular biology can be used to assess evolutionary kinshipCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings64The DNA Double HelixAn RNA molecule is a single polynuculeotideSingle strandedA DNA molecule has two polynucleotides spiraling around an imaginary axis forming a double helixDouble strandedIn the DNA double helix, the two backbones run in opposite 5 3 directions from each otherThis arrangement referred to as antiparallelCopyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings65The DNA Double HelixThe two chains are held together by hydrogen bonds forming between the nitrogenous basesThe nitrogenous bases in a DNA strand pair up and form hydrogen bonds with complement: adenine (A) always pairs with thymine (T)guanine (G) always pairs with cytosine (C)Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings66

Documents

BIO 424 Week 2a DNA Structure (3)