Upload
doandiep
View
228
Download
3
Embed Size (px)
Citation preview
1
Berberine down-regulates cellular JNK and NF-κB activation and this may result in an 1
inhibition of HSV replication 2
3
4
Siwei Song a, Min Qiua, Ying Chua, Deyan Chena, Xiaohui Wanga, Airong Sua, Zhiwei 5
Wua,b# 6
7
Center for Public Health Research, School of Medicine, Nanjing University, Nanjing, P.R. 8
Chinaa; State Key Lab of Analytical Chemistry for Life Science, Nanjing University, 9
Nanjing, P.R. Chinab 10
11
Running Title: Berberine Inhibition of HSV Replication 12
13
#Address correspondence to Zhiwei Wu, [email protected]. 14
S.S. and M.Q. contributed equally to this work. 15
16
17
AAC Accepts, published online ahead of print on 9 June 2014Antimicrob. Agents Chemother. doi:10.1128/AAC.02427-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
2
Abstract 18
Berberine is a quaternary ammonium salt from the protoberberine group 19
of isoquinoline alkaloids. Some reports show that berberine exhibits anti-inflammatory, 20
anti-tumor and antiviral properties by modulating multiple cellular signaling pathways, 21
including p53, nuclear factor kappaB (NF-κB) and mitogen-activated protein kinase 22
(MAPK). In the current study, we investigated the antiviral effect of berberine against 23
herpes simplex virus (HSV) infection. Current anti-herpes medicines such as acyclovir 24
can lessen the recurring activation when used early at infection but are unable to prevent 25
or cure infections where treatment has selected for resistant mutants. In searching for new 26
antiviral agents against herpesvirus infection, we found that berberine reduced viral RNA 27
transcription, protein synthesis, and virus titers in a dose-dependent manner. To elucidate 28
the mechanism of its antiviral activity, the effect of berberine on the individual steps of 29
viral replication cycle of HSV was investigated via time-of-drug addition assay. We found 30
that berberine acted at the early stage of HSV replication cycle, between viral 31
attachment/entry and genomic DNA replication, probably at the immediate early (IE) 32
gene expression stage. We further demonstrated that berberine significantly reduced 33
HSV-induced NF-κB activation, as well as IκB-α degradation and p65 nuclear 34
translocation. Moreover, we found that berberine also depressed HSV-induced c-Jun 35
N-terminal kinases (JNK) phosphorylation, but had little effect on p38 phosphorylation. 36
Our results suggest that the berbreine inhibition of HSV infection may be mediated 37
through modulating cellular JNK and NF-κB pathways. 38
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
3
Key words: Berberine; Herpes simplex virus (HSV); Antiviral activity; Nuclear factor 39
kappaB (NF-κB); c-Jun N-terminal kinases (JNK). 40
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
4
Introduction 41
Herpes simplex virus (HSV) infection causes several distinct medical disorders. 42
Common infection of the skin or mucosa may affect the face and mouth (orofacial 43
herpes), genitalia (genital herpes), or hands (herpetic whitlow) (1, 2). More serious 44
disorders occur when the virus infects and damages the eye (herpes keratitis), or invades 45
the central nervous system, damaging the brain (herpes encephalitis). HSV infection is 46
highly prevalent worldwide and is shown to facilitate human immunodeficiency virus-1 47
(HIV-1) infection and transmission (3-6). HSV-1 and HSV-2, both large DNA viruses, are 48
the etiological agents for orofacial and genital infections, respectively, although HSV-1 49
infection of genitalia was also reported (1, 7). 50
HSV establishes lifelong infection, and the virus cannot yet be eradicated once the 51
virus establishes latency. Unfortunately, there are no cures or approved vaccines to 52
prevent HSV infection and transmission. Antiviral medication is most effective if it is 53
taken when patients have the prodromal symptoms of a recurrent genital herpes outbreak. 54
Acyclovir, famcyclovir, valacyclovir and penciclovir are the currently available 55
medications which act in similar mechanisms by inhibiting viral DNA polymerase and 56
causing premature chain termination when they compete with guanine triphosphate for 57
incorporation into newly synthesized viral DNA (8-10). Acyclovir is thus an effective 58
inhibitor of HSV and causes only mild side-effects. However, drug resistance occurs 59
especially in immunocompromised individuals (11-13). Due to the limited effectiveness 60
of the current medication and resistant viruses, it is necessary to continue the search for 61
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
5
new potential antiviral agents that act in distinct antiviral mechanisms. 62
Previous studies have shown that berberine (Fig. 1A) possesses in vitro activities in 63
suppressing the growth of colonic carcinoma (14), neuroblastoma (15) and a number of 64
other tumor cells (16). Although the mechanisms of these anti-pathogenic and anti-tumor 65
activities have not been well illustrated, its inhibitory effects on several intracellular 66
signaling pathways, including p53 nuclear factor kappa B (NF-κB) (17) and 67
mitogen-activated protein kinase (MAPK) (18), have been investigated. 68
In this paper, we demonstrated the antiviral activity of berberine against the infection 69
of both HSV-1 and HSV-2 and provided evidence showing that its inhibitory activity was 70
mediated by modulating host cell NF-κB and MAPK pathways activation. The treatment 71
of berberine could result in the inhibition of virus-induced IκB-α degradation and p65 72
nuclear translocation. We also provided evidence that treatment with berberine 73
suppressed c-Jun N-terminal kinase (JNK) activation in the HSV-infected cells. These 74
findings demonstrate that berberine may possess a unique mechanism of antiviral action 75
and may serve as a potential anti-herpes virus agent. 76
77
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
6
Materials and Methods 78
Reagents, cell lines, plasmids and viruses. Berberine and acyclovir were obtained 79
from National Institutes for Food and Drug Control in China (Beijing, China). SB203580, 80
SP600125, BAY11-7082, MG132 and phorbol-12-myristate-13-acetate (PMA) were 81
purchased from Beyotime (Haimen, Jiangsu, China). Alexa Fluor 488 goat 82
anti-mouse IgG (H+L) and DAPI were from Life Technologies (Carlsbad, CA, US). 83
IRDye 680 goat-anti-rabbit and IRDye 800 goat-anti-mouse antibodies were obtained 84
from LI-COR (Lincoln, NE, USA). Antibodies specific for gD-1/2, ICP4-1, ICP-8, 85
ICP27-1, JNK2, p38, GAPDH and β-catenin, and RIPA lysis buffer were purchased from 86
Santa Cruz (Santa Cruz, CA, USA). Antibodies specific for p65, p-p38, p-c-Jun, 87
p-JNK1/2, p-ATF-2 and IκB-α were from Cell Signaling Technology (Beverly, USA). 88
Anti-ICP5-1/2 was obtained from Abcam (Cambridge, UK). Recombinant human TNF-α 89
was obtained from PeproTech (Rocky Hill, NJ, USA). 90
HEK293T, Vero, and HEC-1-A cells were obtained from American Type Culture 91
Collection (ATCC, Manassas, VA, USA). NF-κB-luc and AP-1-luc reporter plasmids 92
were purchased from Clontech (Palo Alto, CA, USA). pGL4-TNF-α-promoter was 93
constructed by inserting TNF-α promoter (-100~+900) into pGL4.17 (Promega, Madison, 94
WI, USA). HSV-1 (HF), HSV-1/blue and HSV-2 (G) were propagated and titrated on 95
Vero cells as described previously (19). 96
97
In vitro antiviral assay. The in vitro antiviral activity of berberine was determined by 98
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
7
titrating the infectious virions in berberine-treated cells as described (20). HEC-1-A cells 99
were seeded into 96-well plates at a density of 2×104 per well and cultured for 24 hrs, and 100
then pre-treated with serial concentrations of berberine and infected with HSV-1 or 101
HSV-2 (moi=1). After 24 hrs p.i., cultural medium were discarded and then 200μl fresh 102
medium was dispensed into each well. HSV-1/2-infected cells were frozen and thawed 103
with three cycles to release the virions. Then the virion-containing medium was diluted 104
and dispensed on confluent Vero cell monolayers. Viral titration was performed by 105
counting the numbers of plaques. 106
107
In vitro cytotoxicity assay. The in vitro cytotoxicity of berberine was measured using 108
a commercial CCK-8 kit (Dojindo, Kumamoto, Japan) via colorimetric method according 109
to the manufacturer’s instructions. Briefly, 2×104 cells per well were seeded into 96-well 110
plates and cultured for 24 hrs before serial concentrations of berberine were added in 111
triplicate. After 24 hrs, 10μl CCK-8 reagent was dispensed into each well, and the plates 112
were incubated at 37°C for 3 hrs. Absorbance at 450nm was measured using a TECAN 113
Infinite M200 microplate reader (Männedorf, Switzerland). Cell viability was plotted as 114
the percent viable cells of the mock-treated control cells. 115
116
Western blot and In-cell Western. Cells were lysed using RIPA lysis buffer on ice 117
for 30 min and then centrifuged at 12,000×g for 10 min at 4°C. Total protein 118
concentrations in the supernatants were determined using BCA protein assay kit (Pierce, 119
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
8
Rockford, IL, USA). After separated using SDS-PAGE, the proteins were transferred to 120
polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The 121
membranes were blocked using Odyssey Blocking buffer (LI-COR) and then incubated 122
with primary antibodies for 2 hrs at room temperature (RT). After 5 washes with 123
PBS-0.1% Tween-20 (PBS-T buffer), the membranes were incubated in IRDye IgG 124
(1:10,000) for 1 hr at RT and visualized under LI-COR Odyssey Infrared Imager 125
(LI-COR). 126
In-cell Western was performed in 96-well plate. The cells cultured in a 96-well plate 127
were fixed with 4% paraformaldehyde for 20 min at RT and permeabilized by 5 washes 128
in PBS-0.1% Triton-X 100 with 5 min for each wash. Cell monolayers were blocked for 129
90 min in blocking buffer (4% non-fat dry milk) and then incubated with primary 130
antibodies diluted in blocking buffer (1:200) for 2 hrs at RT. After washing with PBS-T 131
buffer, the cell layers were stained with IRDye IgG (1:1500) for 1 hr, rinsed and scanned 132
in Odyssey Infrared Imager. Relative protein expression level was normalized against 133
β-catenin. 134
135
Synergy analysis. Anti-HSV-2 activity of berberine and acyclovir were tested 136
individually in serial concentrations in HEC-1-A cells through In-cell Western and the 137
50% maximal effective concentration (EC50) values of the single drugs were calculated. 138
The two drug combinations were tested at a fixed molar concentration ratio, which was 139
optimized to give the greatest synergism over a range of serial dilutions. The EC50 values 140
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
9
of single drugs and the combination index (CI) of the two drugs were calculated using 141
CalcuSyn software (21) according to the method of Chou-Talalay (22). The synergy was 142
estimated by CI values (22). CI <0.1: very strong synergism; 0.1–0.3: strong synergism; 143
0.3–0.7: synergism; 0.7–0.85: moderate synergism; 0.85–0.90: slight synergism; 0.9-1.1: 144
Nearly additive and >1.1: antagonism. 145
146
Immunofluorescence staining and microscopic imaging. HEC-1-A cells grown on 147
Φ10mm glass coverslips in a 24-well plate were rinsed with PBS and then fixed with 4% 148
paraformaldehyde for 15 min at RT. The cells were then permeabilized with PBS-0.2% 149
Triton X-100 for 15 min followed by washing twice with PBS. The coverslips were 150
blocked with 1% BSA in PBS for 30 min at RT. Target proteins were immunolabeled 151
using respective primary antibodies and followed by Alexa Fluor 488 goat-anti-mouse 152
488 IgG and Alexa Fluor goat-anti-rabbit 594 IgG (Life Technologies). Nuclei were 153
visualized by staining with DAPI. Images were acquired using an Olmpus FluoView 154
FV10i confocal microscope (Tokyo, Japan). 155
156
Cell transfection and luciferase assay. HEC-1-A cells cultured in a 96-well plate 157
were transiently transfected with luciferase reporter plasmid (100ng/well) using 158
Lipofectamine 2000 transfection reagent (Life Technologies). The cells were further 159
cultured for 24 hrs and treated as described. The relative luciferase activity was 160
determined using Bright-Glo luciferase assay system (Promega). 161
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
10
162
RNA extraction and real-time PCR. Cellular total RNA was extracted using TRIzol 163
reagent (Life Technologies) according to manufacturer’s protocol. cDNA was 164
reverse-transcribed using ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). 165
Real-time PCR was performed in triplicate on ABI Prism 7300 Sequence Detection 166
System using the SYBR Green PCR Master Mix (Life Technologies). The sequences of 167
primer pairs were listed in Table 1. Messenger RNA (mRNA) transcription levels were 168
standardized against housekeeping gene GAPDH. 169
170
HSV-1/blue assay. Confluent HEC-1-A cells in 96-well plate were pre-incubated with 171
drugs for 30min and then infected with HSV-1/blue (moi=1). Cells were lysed with 1% 172
NP-40 in PBS 12 hrs postinfection (p.i.). Cell lysates were then transferred into a new 173
Costar 96-well flat plate and mixed with CPRG (chlorophenol red-β-D-galactopyranoside; 174
Boehringer, Ingelheim, Germany), and β-gal activity were measured in a TECAN Infinit 175
M200 microplate reader at 570nm after 1 hr. 176
177
Statistics. Statistical analysis was performed using two-tailed student t-test. Statistical 178
significance: * p<0.05, ** p<0.01. 179
180
181
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
11
3. Results 182
Berberine inhibited HSV viral replication. To investigate the antiviral effect of 183
berberine on HSV-1 and HSV-2 replication, HEC-1-A cells were pretreated with serial 184
concentrations of berberine and then infected with HSV-1 (HF) and HSV-2 (G), 185
respectively. Berberine effectively inhibited the formation of HSV-induced 186
cytopathogenic effect (CPE) (data not shown). Furthermore, the infectious viral particles 187
were released by three cycles of freezing and thawing the infected cells, and viral 188
infectivity was titrated by measuring the plaque forming unit (PFU). As shown in Fig. 1B 189
and C, berberine inhibited replication of both HSV-1 (Fig. 1B) and HSV-2 (Fig. 1C) in a 190
dose-dependent manner. The EC50 values for HSV-1 and HSV-2 were 6.77±1.13μM and 191
5.04±1.07μM, respectively. 192
We initially investigated its anti-HSV activity by monitoring the reduction of gD 193
expression, an HSV late gene product. As shown in Fig. 2A and B, berberine was 194
effective in inhibiting the expression of both HSV-1 (Fig. 2A) and HSV-2 gD (Fig. 2B). 195
To confirm these results, we investigated the effect of berberine on HSV-1 or HSV-2 gD 196
expression level by measuring the copy numbers of gD mRNA transcript via real-time 197
PCR. Similarly, the inhibitory effect was in parallel to that of the protein expression (Fig. 198
2C and D). The expression of another late gene product, VP5, the major capsid protein, 199
was also determined, and the results were consistent with the gD expression (Fig. 2E and 200
F). Western blot analysis of gD expression in another HSV permissive cell line, 201
HEK293T cells, further substantiated the inhibitory effect of berberine and ruled out cell 202
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
12
type specific effect of the drug, as shown in Fig. 2G. Taken together, we conclude that 203
berberine inhibits the replication of HSV-1 and HSV-2 and the viral late gene expression. 204
The viral inhibitory activity was not due to the effect of cytotoxicity of the drug to the 205
host cells as we showed that berberine had low cytotoxicities to both HEK293T and 206
HEC-1-A cell lines. As shown in Fig. 2H, the 50% cytotoxicity concentration (CC50) of 207
berberine to HEC-1-A cells was greater than 400μM, significantly higher than the viral 208
inhibitory dosage. The CC50 of berberine to HEK293T cells was 165.7μM, still 209
significantly higher than that used in its antiviral assay. These results suggest that the viral 210
inhibitory activity of berberine is not due to its cytotoxicity. 211
212
Berberine inhibited HSV infection at a post-entry step. A time-of-drug-addition 213
assay was performed to determine the steps of berberine action during HSV-2 replication 214
cycle. As shown in Fig. 3, HSV-2-infected HEC-1-A cells were treated with berberine, 215
acyclovir and dextran sulfate (DXS) (a polyanion that inhibits HSV virion attachment and 216
entry) at indicated time point p.i. The results showed that HSV-2 began to escape from 217
the inhibition by berberine 4-8 hrs p.i., whereas it escaped from the inhibition by DXS 218
0-2 hrs p.i. Acyclovir inhibited HSV-2 gD expression during the entire 0-8 hrs p.i. Based 219
on the observation above, we postulate that berberine may act at an early stage of HSV 220
replication cycle, between viral entry and viral genomic DNA replication, probably 221
during IE gene expression stage. 222
223
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
13
Berberine inhibited HSV immediate early and early genes expression. We further 224
explored the mechanisms of berberine inhibition of gD expression by investigating the 225
immediate early (IE) genes that regulate the late genes. Due to the importance of HSV IE 226
expression in the viral replication, we first investigated the inhibitory effect of berberine 227
on one of the IE genes, infected cell polypeptides 4 (ICP4) 24 hrs p.i. As shown in Fig. 228
4A, using an In-cell Western assay, we showed that berberine inhibited HSV-1 ICP4 229
expression in a dose-dependent manner, consistent with the reduction of late gene 230
expression (shown in Fig. 2). We also employed HSV-1/blue recombinant virus to 231
determine the inhibitory effect of berberine on reporter gene lacZ expression. This virus 232
contains an HSV-1 ICP4 promoter-driven lacZ gene inserted into HSV-1 TK gene loci 233
(23, 24). As shown in Fig. 4B, berberine inhibited ICP4 promoter-driven lacZ gene 234
expression in a dose-dependent manner, further demonstrating that berberine might 235
inhibit HSV replication through interfering with viral IE gene expression. 236
We also investigated the time course of the inhibitory effect of berberine on ICP4 gene 237
expression at early stages of HSV infection and the result showed that berberine could 238
inhibit ICP4 expression 8 and 12 hrs p.i., and completely inhibited gD expression (Fig. 239
4C). We also investigated the time course of the inhibitory effect of berberine on ICP27 240
gene expression at early stages of HSV infection, and the result showed that berberine 241
could also have inhibitory effect on ICP27 expression 8 and 12 hrs p.i. (Fig. 4D). 242
Whether berberine inhibited HSV-1 early gene expression was also determined. As 243
shown in Fig. 4E, berberine could block ICP8 expression completely. ICP8 is a 244
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
14
single-strand DNA-binding protein, which is required for HSV genomic DNA replication 245
(25). The inhibitory effect of berberine on ICP8 was consistent with the results of the late 246
genes expression (Fig. 2). 247
248
Berberine inhibited HSV-2-induced NF-κB activation. HSV infection induces a 249
persistent NF-κB activation, which is necessary for the viral replication and host cell 250
survival at the early stage of viral infection (26-29). To better understand whether 251
berberine could inhibit HSV-2-induced NF-κB activation, we used NF-κB luciferase 252
reporter plasmid to evaluate its effect. As shown in Fig. 5A, berberine down-regulated 253
HSV-2-induced NF-κB activation in a dose-dependent manner. MG132, a specific 254
proteasome and NF-κB inhibitor and served as a positive control, completely inhibited 255
NF-κB activation. We also examined the level of IκB-α, an endogenous NF-κB inhibitor 256
and found that HSV-2 infection induced the degradation of IκB-α, whereas berberine 257
could block the IκB-α degradation 12 and 24 hrs p.i. (Fig. 5B). We also evaluated the 258
effect of berberine on TNF-α -induced NF-κB activation, and the result showed that 259
berberine at the concentration of 50μM could suppress TNF-α -induced NF-κB and 260
treatment with berberine only did not induce the NF-κB activation (Fig. 5C). p65 is a 261
subunit of NF-κB transcription complex, which plays a crucial role in inflammatory and 262
immune responses. The inhibitory effect of IκB-α upon NF-κB in the cytoplasm is 263
exerted primarily through the interaction with p65 and p65 nuclear translocation is often 264
taken as an indication of NF-κB activation. We also demonstrated that berberine could 265
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
15
inhibit virus-mediated p65 nuclear translocation and HSV-2 gD expression, 266
simultaneously (Fig. 5D). Together, the data suggests that berberine may inhibit 267
HSV-2-induced NF-κB activation which may result in an inhibition of HSV replication. . 268
269
Berberine inhibited HSV-2-induced JNK activation, but showed less effect on p38 270
MAP kinase activation. JNK and p38 MAP kinase pathways are stimulated by HSV-1 271
infection and their activations play a central role on HSV-1 replication (30, 31). We 272
investigated whether HSV-2 infection would activate both MAPK cascades in HEC-1-A 273
cells and whether berberine would inhibit HSV-2-induced AP-1 activation, which was the 274
main transcription factor downstream of JNK/p38 MAP kinase. We found that berberine 275
inhibited HSV-2-induced AP-1-binding site-driven luciferase expression in a 276
dose-dependent manner, implying that it could attenuate virus-mediated MAPK 277
activation through modulating certain cascade(s) (Fig. 6A). Also, we found that HSV-2 278
infection resulted in persistent activation of JNK and p38 MAP kinase pathways in 279
HEC-1-A cells (Fig. 6B), and their specific inhibitors (SB203580 and SP600125, 280
respectively) were able to reduce HSV-2 replication (Fig. 6C). Further evidence showed 281
that berberine could disrupt the phosphorylation of upstream activator JNK, but not p38 282
MAP kinase. As shown in Fig. 6D, HSV-2 infection caused JNK phosphorylation, which 283
could be suppressed by berberine. The phosphorylation of its substrate, c-Jun was also 284
attenuated by the berberine treatment. In contrast, berberine would increase the 285
phosphorylation level of p38 MAP kinase in mock-infected cells. Although the low 286
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
16
concentrations of berberine (12.5μM) partially inhibited HSV-2-induced p38 activation, 287
high concentrations activated p38 MAP kinase cascade instead. ATF-2, both the substrate 288
of JNK and p38 MAP kinase, was also activated in berberine-treated uninfected cells, but 289
suppressed in infected ones which might be due to the JNK pathway. These results 290
indicate that berberine inhibits HSV-2-induced JNK activation, but only has marginal 291
inhibitory effect on p38 MAP kinase activation. And the effect of berberine on 292
PMA-induced MAPK activation was also investigated. As shown in Fig. 6E, berberine 293
could inhibit PMA-induced phosphorylation of JNK and its specific substrate c-Jun, but 294
showed less effect on p38 MAP kinase and ATF-2. Together, the data suggests that 295
berberine may inhibit HSV-2-induced JNK activation which may result in an inhibition of 296
HSV replication, but not p38 MAP kinase cascade. 297
298
Berberine down-regulated HSV-2-induced IL-8 and TNF-α expression. Previous 299
studies report that HSV infection could up-regulate the expression of certain 300
cytokines/chemokines, which is associated with cellular NF-κB and MAPK activation (32, 301
33). Therefore, whether berberine would inhibit the virus-induced up-regulation of 302
cytokines/chemokines was investigated via real-time PCR. As shown in Fig. 7A and B, 303
berberine effectively inhibited the expression of virus-induced IL-8 and TNF-α, two 304
hallmarks of chemotactic and proinflammatory factors, respectively. Using a TNF-α 305
reporter plasmid, we also confirmed the inhibitory effect of berberine on TNF-α promoter 306
activity (Fig. 7C). 307
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
17
The synergistic effect of berberine and acyclovir against HSV-2 infection. Since 308
berberine and acyclovir, an inhibitor of herpesviruse TK, likely acted with distinct 309
mechanisms against HSV (as demonstrated in section 3.2), the viral inhibitory activity of 310
combining berberine and acyclovir was investigated. As shown in Fig. 8, the combination 311
index (CI) of berberine and acyclovir was 0.814, which represented a moderate synergism 312
against HSV-2 infection when two drugs were used in combination, suggesting potential 313
beneficial effects of using two drugs in combination. 314
315
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
18
Discussion 316
Berberine is a natural product found in many traditional Chinese herbs. It is found in 317
such plants as Berberis, Hydrastis canadensis (goldenseal), Xanthorhiza 318
simplicissima (yellow root) and Phellodendron amurense (Amur cork tree), has been used 319
traditionally to treat fungal infections, Candida albicans, parasites and bacterial/viral 320
infections (17, 34-36). Some reports suggest it as a potential anti-tumor and 321
anti-inflammatory agent (37, 38). 322
Berberine exhibits inhibitory activity against some viruses, including influenza A virus 323
(39) and human cytomegalovirus (40). Chin et al. firstly report that berberine from 324
Coptidis rhizoma showed anti-HSV effect (41). Due to low cytotoxicity and minimal 325
side-effects, berberine is considered to be a promising antiviral drug candidate for 326
alternative treatment. In the current study, we demonstrated that berberine could 327
effectively inhibit HSV-1 and HSV-2 replication at the concentrations below the 50% 328
cytotoxicity dosage (Fig. 1 and 2). We also studied the synergistic effect of berberine and 329
acyclovir against HSV-2 infection in vitro, and showed that these two drugs exhibited 330
moderate synergism against viral replication (Fig. 8). Combination treatment of acyclovir 331
with drug that has the ability to inhibit HSV replication could increase the anti-HSV 332
activity in vitro and in vivo (42-45). In our study, we found that berberine not only 333
attenuated HSV replication, but also depressed the inflammatory response and associated 334
pathways activation. Thus, berberine and acyclovir may be potentially used in 335
combination for treatment of HSV infection. 336
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
19
The time-of-drug-addition analysis indicated that berberine exerted its inhibitory effect 337
after viral attachment and entry, but before HSV genomic DNA replication (Fig. 3). 338
Further mechanistic analysis showed that berberine inhibited the viral IE genes, ICP4 and 339
ICP27 expression. We postulate that berberine might act at the stage of HSV IE gene 340
expression and thus inhibit the expression of the early (ICP8) and the late genes (ICP5 341
and gD) expression, leading to the reduced HSV infectivity and inhibition of viral 342
replication. HSV IE gene expression plays significant roles in the viral replication and 343
regulates the early and late gene expression. ICP4 and ICP27 are two major 344
transcriptional activators for the viral early and late genes and essential for viral growth 345
(46, 47). Our evidence suggests that the inhibitory effect of berberine is mediated by 346
acting on ICP4 and ICP27 expression, leading to the down-modulation of downstream 347
early and late genes expression. 348
HSV can utilize certain cellular signaling pathways to facilitate its replication. In this 349
paper, we found that berberine depressed the degradation of endogenous NF-κB inhibitor 350
IκB-α and p65 nuclear translocation induced by HSV-2 infection, leading to the inhibition 351
of NF-κB activation. It has been reported that HSV infection undergoes a sustained host 352
cell NF-κB activation, which is necessary to prevent host cell from apoptosis at 3 to 6 hrs 353
p.i. and lasts until viral lytic phase (48). NF-κB belongs to the foremost transcription 354
factors that mediate immune, inflammatory, or anti-apoptotic responses. NF-κB can be 355
activated by exposure of cells to lipopolysaccharide (LPS), inflammatory cytokines 356
(TNF-α, IL-1β, etc.), phorbol ester, UV irradiation, viral infection or expression of certain 357
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
20
viral gene products (49). Since it plays a key role in promoting HSV infection, inhibition 358
of NF-κB signaling might be a promising therapeutic approach in HSV-induced 359
inflammatory responses (50). The effect of berberine on the NF-κB activation during 360
HSV replication indicates that it might be a potential inhibitor in HSV multiplication. It 361
was worth mentioning that berberine showed significant antiviral activity at low 362
concentration, however, it could not inhibit HSV-2-induced NF-κB activation at the same 363
concentration. Only high concentrations of berberine could inhibit virus-induced NF-κB 364
activation. It suggested to us that berberine is a multifunctional molecule and may have 365
other mechanisms of action for anti-herpes virus effect. 366
Reports have shown that HSV infection resulted in an activation of JNK/MAP kinase 367
pathway. Both JNK and p38 mitogen-activated protein kinases are stimulated after HSV 368
infection. A subset of cellular genes transactivated by AP-1 may ensure efficient viral 369
gene expression and DNA replication and facilitate viral replication (31, 51). JNK and 370
p38 MAP kinases are two main members of mitogen-avtivated protein kinase family, and 371
these two stress-activated protein kinases are activators for sensing various stimuli, such 372
as proinflammatory cytokines, genotoxic agents, osmotic shock and bacterial LPS (52). 373
Activated JNK/p38 MAP kinases can transmit upstream signals to downstream factors, 374
thus to mediate apoptosis, differentiation, growth or immune responses. JNK/p38 MAP 375
kinases are also reported to be stimulated by many viruses or virus-associated proteins, 376
including vaccinia virus (53), rotavirus (54), varicella-zoster virus (VZV) (55), HIV-1 377
(56), HSV-1 (30), coxsackievirus B3 (CVB3) (57), influenza virus (58) and hepatitis B/C 378
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
21
virus (HBV/HCV) (59). Our data showed that berberine had inhibitory effect on the 379
activation of transcription factor AP-1, the main downstream factor of JNK/p38 MAP 380
kinase, and that HSV infection led to a robust JNK phosphorylation, which was mitigated 381
by berberine treatment. The virus-induced c-Jun and ATF-2 phosphorylations were also 382
suppressed by the drug in a dose-dependent manner. Although berberine at 12.5μM 383
exhibited slight inhibitory effect on HSV-induced p38 phosphorylation, the higher 384
concentration (50μM) increased the level of phosphorylated p38 in both mock-infected 385
and HSV-infected cells (Fig. 6B). Besides, berberine could attenuate PMA-induced JNK 386
activation, but showed marginal effect on p38 MAP kinase (Fig. 6E). Based on the 387
observations that berberine inhibited HSV-induced JNK phosphorylation, we postulate 388
that berberine may act at upstream of JNK cascade, which requires further investigation. 389
IL-8 and TNF-α are important hallmarks of chemotactic and proinflammatory responses, 390
respectively, and these two inflammatory cytokines are up-regulated during HSV-1 391
infection, which is associated with MAPK and NF-κB pathways (32, 33). IL-8 392
promoter region has binding sites for NF-κB and AP-1, and this proinflammatory factor 393
can be regulated by NF-κB and MAPK activation (60, 61). TNF-α promoter has four 394
NF-κB binding sites and one AP-1 binding site (62). We showed that berberine inhibited 395
HSV-2-induced up-regulation of IL-8 and TNF-α expression (Fig. 7), consistent with our 396
evidence that berberine down-regulated these downstream factors via modulating MAPK 397
and NF-κB pathways. 398
In conclusion, we investigated the inhibitory mechanism of berberine on HSV-1 and 399
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
22
HSV-2 infection and found that berberine exhibited a significant inhibition on 400
HSV-induced JNK and NF-κB activation. As a result, we conclude that the inhibitory 401
effect of berberine on host cell JNK and NF-κB activation may result in an inhibition of 402
HSV replication. However, further study is needed to delineate the mechanisms in detail 403
on the roles of IE genes and NF-κB and JNK pathways. In view of its low cytotoxicity 404
and significant anti-herpetic activity, berberine might be a valuable candidate for further 405
study as a promising anti-HSV drug. 406
407
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
23
Acknowledgement 408
We thank Dr. Tao Peng from Guangzhou Institutes of Biomedicine and Health, 409
Chinese Academy of Sciences for the generous gift of HSV-1/blue strain. This study was 410
supported by the Major Research and Development Project from the Ministry of Health 411
of China (Grant No. 2012ZX10001-007-009-001 and 2013ZX10001005-003) and the 412
Innovative Project for Graduate Students of Jiangsu Province (Grant No. CXLX13_039). 413
414
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
24
415
References 416
1. Lafferty WE, Downey L, Celum C, Wald A. 2000. Herpes simplex virus type 1 417
as a cause of genital herpes: impact on surveillance and prevention. Journal of 418
Infectious Diseases 181:1454-1457. 419
2. Whitley RJ, Roizman B. 2001. Herpes simplex virus infections. The Lancet 420
357:1513-1518. 421
3. Corey L, Wald A, Celum CL, Quinn TC. 2004. The effects of herpes simplex 422
virus-2 on HIV-1 acquisition and transmission: A review of two overlapping 423
epidemics. Jaids-Journal of Acquired Immune Deficiency Syndromes 35:435-445. 424
4. Freeman EE, Weiss HA, Glynn JR, Cross PL, Whitworth JA, Hayes RJ. 2006. 425
Herpes simplex virus 2 infection increases HIV acquisition in men and women: 426
systematic review and meta-analysis of longitudinal studies. Aids 20:73-83. 427
5. Mbopi-Kéou F-X, Grésenguet G, Mayaud P, Weiss HA, Gopal R, Matta M, 428
Paul J-L, Brown DW, Hayes RJ, Mabey DC. 2000. Interactions between herpes 429
simplex virus type 2 and human immunodeficiency virus type 1 infection in 430
African women: opportunities for intervention. Journal of Infectious Diseases 431
182:1090-1096. 432
6. Wald A, Link K. 2002. Risk of human immunodeficiency virus infection in 433
herpes simplex virus type 2–seropositive persons: a meta-analysis. Journal of 434
Infectious Diseases 185:45-52. 435
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
25
7. Roberts CM, Pfister JR, Spear SJ. 2003. Increasing proportion of herpes 436
simplex virus type 1 as a cause of genital herpes infection in college students. 437
Sexually transmitted diseases 30:797-800. 438
8. De Clercq E, Field HJ. 2006. Antiviral prodrugs–the development of successful 439
prodrug strategies for antiviral chemotherapy. British journal of pharmacology 440
147:1-11. 441
9. Earnshaw D, Bacon T, Darlison S, Edmonds K, Perkins R, Hodge RV. 1992. 442
Mode of antiviral action of penciclovir in MRC-5 cells infected with herpes 443
simplex virus type 1 (HSV-1), HSV-2, and varicella-zoster virus. Antimicrobial 444
agents and chemotherapy 36:2747-2757. 445
10. Wald A, Zeh J, Barnum G, Davis L, Corey L. 1996. Suppression of subclinical 446
shedding of herpes simplex virus type 2 with acyclovir. Annals of Internal 447
medicine 124:8-15. 448
11. Reyes M, Shaik NS, Graber JM, Nisenbaum R, Wetherall NT, Fukuda K, 449
Reeves WC. 2003. Acyclovir-resistant genital herpes among persons attending 450
sexually transmitted disease and human immunodeficiency virus clinics. Archives 451
of internal medicine 163:76-80. 452
12. Shin YK, Weinberg A, Spruance S, Bernard M, Bacon TH, Boon RJ, Levin 453
MJ. 2003. Susceptibility of herpes simplex virus isolates to nucleoside analogues 454
and the proportion of nucleoside-resistant variants after repeated topical 455
application of penciclovir to recurrent herpes labialis. Journal of Infectious 456
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
26
Diseases 187:1241-1245. 457
13. Stránská R, Schuurman R, Nienhuis E, Goedegebuure IW, Polman M, Weel 458
JF, Wertheim-Van Dillen PM, Berkhout RJ, van Loon AM. 2005. Survey of 459
acyclovir-resistant herpes simplex virus in the Netherlands: prevalence and 460
characterization. Journal of Clinical Virology 32:7-18. 461
14. Hsu W-H, Hsieh Y-S, Kuo H-C, Teng C-Y, Huang H-I, Wang C-J, Yang S-F, 462
Liou Y-S, Kuo W-H. 2007. Berberine induces apoptosis in SW620 human 463
colonic carcinoma cells through generation of reactive oxygen species and 464
activation of JNK/p38 MAPK and FasL. Archives of toxicology 81:719-728. 465
15. Choi MS, Yuk DY, Oh JH, Jung HY, Han SB, Moon DC, Hong JT. 2008. 466
Berberine inhibits human neuroblastoma cell growth through induction of 467
p53-dependent apoptosis. Anticancer research 28:3777-3784. 468
16. Tang J, Feng YB, Tsao S, Wang N, Curtain R, Wang YW. 2009. Berberine and 469
Coptidis Rhizoma as novel antineoplastic agents: A review of traditional use and 470
biomedical investigations. Journal of ethnopharmacology 126:5-17. 471
17. Pandey MK, Sung B, Kunnumakkara AB, Sethi G, Chaturvedi MM, 472
Aggarwal BB. 2008. Berberine Modifies Cysteine 179 of IκBα Kinase, 473
Suppresses Nuclear Factor-κB–Regulated Antiapoptotic Gene Products, and 474
Potentiates Apoptosis. Cancer research 68:5370-5379. 475
18. Cui G, Qin X, Zhang Y, Gong Z, Ge B, Zang YQ. 2009. Berberine differentially 476
modulates the activities of ERK, p38 MAPK, and JNK to suppress Th17 and Th1 477
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
27
T cell differentiation in type 1 diabetic mice. Journal of biological chemistry 478
284:28420-28429. 479
19. McLean C, Erturk M, Jennings R, Challanain DN, Minson A, Duncan I, 480
Boursnell M, Inglis S. 1994. Protective vaccination against primary and recurrent 481
disease caused by herpes simplex virus (HSV) type 2 using a genetically disabled 482
HSV-1. Journal of Infectious Diseases 170:1100-1109. 483
20. Qiu M, Chen Y, Chu Y, Song S, Yang N, Gao J, Wu Z. 2013. Zinc ionophores 484
pyrithione inhibits herpes simplex virus replication through interfering with 485
proteasome function and NF-κB activation. Antiviral research 100:44-53. 486
21. Chou T, Hayball M. CalcuSyn: Windows Software for Dose Effect Analysis. 487
1991. Ferguson, Mo 63135. 488
22. Chou T-C, Talalay P. 1984. Quantitative analysis of dose-effect relationships: the 489
combined effects of multiple drugs or enzyme inhibitors. Advances in enzyme 490
regulation 22:27-55. 491
23. Dicker IB, Seetharam S. 1995. Herpes simplex type 1: lacZ recombinant viruses. 492
I. Characterization and application to defining the mechanisms of action of known 493
antiherpes agents. Antiviral research 28:191-212. 494
24. Zhu Q-C, Wang Y, Peng T. 2010. Herpes simplex virus (HSV) immediate-early 495
(IE) promoter-directed reporter system for the screening of antiherpetics targeting 496
the early stage of HSV infection. Journal of biomolecular screening 497
15:1016-1020. 498
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
28
25. Boehmer PE, Lehman I. 1993. Herpes simplex virus type 1 ICP8: 499
helix-destabilizing properties. Journal of virology 67:711-715. 500
26. Goodkin ML, Ting AT, Blaho JA. 2003. NF-κB is required for apoptosis 501
prevention during herpes simplex virus type 1 infection. Journal of virology 502
77:7261-7280. 503
27. Gregory D, Hargett D, Holmes D, Money E, Bachenheimer S. 2004. Efficient 504
replication by herpes simplex virus type 1 involves activation of the IκB 505
kinase-IκB-p65 pathway. Journal of virology 78:13582-13590. 506
28. Li H, Li X, Wei Y, Tan Y, Liu X, Wu X. 2009. HSV-2 induces TLRs and 507
NF-κB-dependent cytokines in cervical epithelial cells. Biochemical and 508
biophysical research communications 379:686-690. 509
29. Yedowitz JC, Blaho JA. 2005. Herpes simplex virus 2 modulates apoptosis and 510
stimulates NF-κB nuclear translocation during infection in human epithelial 511
HEp-2 cells. Virology 342:297-310. 512
30. Gillis PA, Okagaki LH, Rice SA. 2009. Herpes Simplex Virus Type 1 ICP27 513
Induces p38 Mitogen-Activated Protein Kinase Signaling and Apoptosis in HeLa 514
Cells. Journal of Virology 83:1767-1777. 515
31. McLean T, Bachenheimer S. 1999. Activation of cJUN N-terminal kinase by 516
herpes simplex virus type 1 enhances viral replication. Journal of virology 517
73:8415-8426. 518
32. Li H, Zhang J, Kumar A, Zheng M, Atherton SS, Yu FSX. 2006. Herpes 519
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
29
simplex virus 1 infection induces the expression of proinflammatory cytokines, 520
interferons and TLR7 in human corneal epithelial cells. Immunology 521
117:167-176. 522
33. Melchjorsen J, Sirén J, Julkunen I, Paludan SR, Matikainen S. 2006. 523
Induction of cytokine expression by herpes simplex virus in human 524
monocyte-derived macrophages and dendritic cells is dependent on virus 525
replication and is counteracted by ICP27 targeting NF-κB and IRF-3. Journal of 526
general virology 87:1099-1108. 527
34. Birdsall TC, Kelly GS. 1997. Berberine therapeutic potential of an alkaloid 528
found in several medicinal plants. Alternative Medicine Review 2. 529
35. Mahata S, Bharti AC, Shukla S, Tyagi A, Husain SA, Das BC. 2011. Berberine 530
modulates AP-1 activity to suppress HPV transcription and downstream signaling 531
to induce growth arrest and apoptosis in cervical cancer cells. Molecular cancer 532
10:39. 533
36. Remppis A, Bea F, Greten HJ, Buttler A, Wang H, Zhou Q, Preusch MR, Enk 534
R, Ehehalt R, Katus H. 2010. Rhizoma coptidis Inhibits LPS-Induced 535
MCP-1/CCL2 Production in Murine Macrophages via an AP-1 and NF Mediators 536
of inflammation 2010. 537
37. Kuo CL, Chi CW, Liu TY. 2004. The anti-inflammatory potential of berberine in 538
vitro and in vivo. Cancer Letters 203:127-137. 539
38. Lee C-H, Chen J-C, Hsiang C-Y, Wu S-L, Wu H-C, Ho T-Y. 2007. Berberine 540
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
30
suppresses inflammatory agents-induced interleukin-1β and tumor necrosis 541
factor-α productions via the inhibition of IκB degradation in human lung cells. 542
Pharmacological Research 56:193-201. 543
39. Cecil CE, Davis JM, Cech NB, Laster SM. 2011. Inhibition of H1N1 influenza 544
A virus growth and induction of inflammatory mediators by the isoquinoline 545
alkaloid berberine and extracts of goldenseal (Hydrastis canadensis). International 546
immunopharmacology 11:1706-1714. 547
40. Hayashi K, Minoda K, Nagaoka Y, Hayashi T, Uesato S. 2007. Antiviral 548
activity of berberine and related compounds against human cytomegalovirus. 549
Bioorganic & medicinal chemistry letters 17:1562-1564. 550
41. Chin LW, Cheng Y-W, Lin S-S, Lai Y-Y, Lin L-Y, Chou M-Y, Chou M-C, 551
Yang C-C. 2010. Anti-herpes simplex virus effects of berberine from Coptidis 552
rhizoma, a major component of a Chinese herbal medicine, Ching-Wei-San. 553
Archives of virology 155:1933-1941. 554
42. Andersen JH, Jenssen H, Gutteberg TJ. 2003. Lactoferrin and lactoferricin 555
inhibit Herpes simplex 1 and 2 infection and exhibit synergy when combined with 556
acyclovir. Antiviral research 58:209-215. 557
43. Schinazi R, Peters J, Williams C, Chance D, Nahmias A. 1982. Effect of 558
combinations of acyclovir with vidarabine or its 5'-monophosphate on herpes 559
simplex viruses in cell culture and in mice. Antimicrobial agents and 560
chemotherapy 22:499-507. 561
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
31
44. Stanwick TL, Schinazi RF, Campbell DE, Nahmias AJ. 1981. Combined 562
antiviral effect of interferon and acyclovir on herpes simplex virus types 1 and 2. 563
Antimicrobial agents and chemotherapy 19:672-674. 564
45. Yoosook C, Bunyapraphatsara N, Boonyakiat Y, Kantasuk C. 2000. 565
Anti-herpes simplex virus activities of crude water extracts of Thai medicinal 566
plants. Phytomedicine 6:411-419. 567
46. DeLuca NA, Schaffer PA. 1985. Activation of immediate-early, early, and late 568
promoters by temperature-sensitive and wild-type forms of herpes simplex virus 569
type 1 protein ICP4. Molecular and cellular biology 5:1997-2008. 570
47. McGregor F, Phelan A, Dunlop J, Clements J. 1996. Regulation of herpes 571
simplex virus poly (A) site usage and the action of immediate-early protein IE63 572
in the early-late switch. Journal of virology 70:1931-1940. 573
48. Patel A, Hanson J, McLean TI, Olgiate J, Hilton M, Miller WE, 574
Bachenheimer SL. 1998. Herpes simplex virus type 1 induction of persistent 575
NF-κB nuclear translocation increases the efficiency of virus replication. Virology 576
247:212-222. 577
49. Baldwin Jr AS. 1996. The NF-κB and IκB proteins: new discoveries and insights. 578
Annual review of immunology 14:649-681. 579
50. Amici C, Belardo G, Rossi A, Santoro MG. 2001. Activation of IκB Kinase by 580
Herpes Simplex Virus Type 1 A NOVEL TARGET FOR ANTI-HERPETIC 581
THERAPY. Journal of Biological Chemistry 276:28759-28766. 582
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
32
51. Zachos G, Clements B, Conner J. 1999. Herpes simplex virus type 1 infection 583
stimulates p38/c-Jun N-terminal mitogen-activated protein kinase pathways and 584
activates transcription factor AP-1. Journal of Biological Chemistry 585
274:5097-5103. 586
52. Kyriakis JM, Avruch J. 2001. Mammalian mitogen-activated protein kinase 587
signal transduction pathways activated by stress and inflammation. Physiological 588
reviews 81:807-869. 589
53. Andrade A, Silva P, Pereira A, De Sousa L, Ferreira P, Gazzinelli R, Kroon E, 590
Ropert C, Bonjardim C. 2004. The vaccinia virus-stimulated mitogen-activated 591
protein kinase (MAPK) pathway is required for virus multiplication. Biochem. J 592
381:437-446. 593
54. Holloway G, Coulson BS. 2006. Rotavirus activates JNK and p38 signaling 594
pathways in intestinal cells, leading to AP-1-driven transcriptional responses and 595
enhanced virus replication. Journal of virology 80:10624-10633. 596
55. Rahaus M, Desloges N, Wolff MH. 2004. Replication of varicella-zoster virus is 597
influenced by the levels of JNK/SAPK and p38/MAPK activation. Journal of 598
General Virology 85:3529-3540. 599
56. Jacqué JM, Mann A, Enslen H, Sharova N, Brichacek B, Davis RJ, Stevenson 600
M. 1998. Modulation of HIV‐1 infectivity by MAPK, a virion–associated kinase. 601
The EMBO journal 17:2607-2618. 602
57. Si X, Luo H, Morgan A, Zhang J, Wong J, Yuan J, Esfandiarei M, Gao G, 603
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
33
Cheung C, McManus BM. 2005. Stress-activated protein kinases are involved in 604
coxsackievirus B3 viral progeny release. Journal of virology 79:13875-13881. 605
58. Pleschka S, Wolff T, Ehrhardt C, Hobom G, Planz O, Rapp UR, Ludwig S. 606
2001. Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK 607
signalling cascade. Nature cell biology 3:301-305. 608
59. Panteva M, Korkaya H, Jameel S. 2003. Hepatitis viruses and the MAPK 609
pathway: is this a survival strategy? Virus research 92:131-140. 610
60. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. 2002. Multiple 611
control of interleukin-8 gene expression. Journal of leukocyte biology 612
72:847-855. 613
61. Kunsch C, Rosen CA. 1993. NF-kappa B subunit-specific regulation of the 614
interleukin-8 promoter. Molecular and Cellular Biology 13:6137-6146. 615
62. Bazzoni F, Kruys V, Shakhov A, Jongeneel C, Beutler B. 1994. Analysis of 616
tumor necrosis factor promoter responses to ultraviolet light. Journal of Clinical 617
Investigation 93:56. 618
619
620
621
622
623
624
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
34
Figures Legends 625
Fig. 1. Berberine inhibited HSV viral replication. (A) The molecular structure of 626
berberine. (B-C) Berberine inhibited the formation of intracellular HSV infectious 627
particles. Confluent HEC-1-A cells were mixed with serial concentrations of berberine 628
prior to infection with HSV- 1(HF) or HSV-2(G) (moi=1) for 24 hrs. The infectious viral 629
particles were released by three cycles of freezing and thawing the infected cells, and 630
viral infectivity was titrated by measuring the plaque forming unit (PFU) as described. 631
Titrations of HSV- 1(HF) or HSV-2 (G) are the means±the standard deviations of results 632
of three separate experiments. 633
634
Fig. 2. Berberine inhibited HSV late gene expression. (A-D) Berberine inhibited gD 635
expression. HEC-1-A cells were treated with various concentrations of berberine and then 636
infected with HSV-1 or HSV-2 (moi=1). gD-1/2 protein expression level was determined 637
via In-cell Western and normalized by β-catenin 24 hrs p.i. (A-B). The mRNA transcripts 638
level of gD was quantified via real-time PCR analysis (C-D). (E-F) Berberine interfered 639
with viral ICP5 expression. HEC-1-A cells treated with serial concentrations of berberine 640
were infected with HSV-1 or HSV-2, and ICP5 expression was determined via In-cell 641
Western 24 hrs p.i. (G) Berberine inhibited HSV-1 and HSV-2 gD expression in 642
HEK293T cells. HEK293T cells were treated with various concentrations of berberine 643
(Berb) prior to infection with HSV-1 or HSV-2 (moi=1). gD expression level was 644
determined via Western blot 24 hrs p.i. (H) The cytotoxic effect of berberine on HEC-1-A 645
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
35
and HEK293T cells. Cells were treated with serial concentrations of berberine. The cell 646
viability was determined by CCK-8 colorimetric assay after 24 hrs. All experiments were 647
performed three times. The representative results were shown. Data are mean values 648
(±SD) of triplicate determinations. 649
650
Fig. 3. Berberine inhibited HSV infection at a post-entry step. HEC-1-A cells were 651
infected with HSV-2 (moi=1) and exposed to berberine (50μM), acyclovir (50μg/ml) or 652
DXS (100μg/ml) at indicated time points. Viral infection level was represented by gD-2 653
expression as determined by In-cell Western 24 hrs p.i. Data represent mean values (±SD) 654
of triplicate determinations from three dependent experiments. 655
656
Fig. 4. Berberine inhibited HSV immediate early gene expression. (A) Berberine 657
inhibited ICP4-1 expression in a dose-dependent manner. Confluent HEC-1-A cells were 658
treated with indicated concentrations of berberine prior to infection with HSV-1 (moi=1). 659
ICP4-1 expression was determined via In-cell Western and normalized by β-catenin level 660
24 hrs p.i. (B) Berberine inhibited HSV-1/blue ICP4 promoter-driven lacZ gene 661
expression in a dose-dependent manner. HEC-1-A cells were treated with serial 662
concentrations of berberine or MG132 (5μg/ml) prior to infection with HSV-1/blue 663
(moi=1). The β-Gal activity was measured as described 12 hrs p.i. (C) HEC-1-A cells 664
were either mock-treated or treated with berberine (50 μM) and then infected with HSV-1 665
(moi=1). Cells were lysed at each time point. ICP4 was visualized by Western blot. (D) 666
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
36
HEC-1-A cells were either mock-treated or treated with berberine (50 μM) and then 667
infected with HSV-1 (moi=1). Cells were lysed at each time point. ICP27 was visualized 668
by Western blot. (E) HEC-1-A cells were either mock-treated or treated with berberine 669
(50 μM) and then infected with HSV-1 (moi=1). Cells were lysed at each time point. 670
ICP8 was visualized by Western blot. Data represent mean values (±SD) of triplicate 671
determinations from three dependent experiments. 672
673
Fig. 5. Berberine inhibited HSV-2-induced NF-κB activation. (A) HEC-1-A cells were 674
transfected with NF-κB-luc reporter plasmid. The cells were mock-treated, treated with 675
indicated concentrations of berberine or MG132 (5μg/ml) prior to mock-infected or 676
infected with HSV-2 (moi=1). The relative luciferase activity was determined after 24 hrs 677
and expressed as a fold change of that of the mock-treated cells. (B) Berberine inhibited 678
HSV-2-induced IκB-α degradation. HEC-1-A cells were mock-infected or infected with 679
HSV-2 (moi=1) in the absence or presence of berberine (12.5 and 50μM) or MG132 680
(5μg/ml). IκB-α, gD and GAPDH levels were determined 12 or 24 hrs p.i. by Western 681
blot. The band intensity was determined by Odyssey V3.0 software. (C) Berberine 682
suppressed TNF-α -induced NF-κB activation. HEC-1-A cells transfected with NF-κB-luc 683
reporter plasmid were mock-treated, treated with berberine (50μM) or MG132 (5μg/ml) 684
prior to exposure to TNF-α (100ng/ml). The relative luciferase activity was determined 685
after 12 hrs and expressed as a fold change of that of the mock-treated cells. (D) 686
Berberine interfered with HSV-2-induced p65 nuclear translocation. HEC-1-A cells were 687
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
37
mock-infected or infected with HSV-2 (moi=1) in the presence or absence of berberine 688
(50μM). p65 translocation was determined via immunofluorescence assay 24 hrs p.i. Data 689
represent mean values (±SD) of triplicate determinations from three dependent 690
experiments. 691
692
Fig. 6. Berberine inhibited HSV-2-induced JNK activation, but showed less effect on 693
p38 MAP kinase activation. (A) Berberine inhibited HSV-2-induced AP-1 activation. 694
HEC-1-A cells were transfected with AP-1-luc reporter plasmid. The cells were 695
mock-treated, treated with serial concentrations of berberine, SB203580 (20μM) or 696
SP600125 (20μM) prior to mock-infected or infected with HSV-2 (moi=1). SB203580 697
and SP600125, p38/MAP kinase and JNK inhibitors, respectively, were used as controls. 698
The relative luciferase activity was determined after 24 hrs and expressed as a fold 699
change of that of the mock-treated cells. (B) HSV-2 infection induced the activation of 700
JNK and p38 MAP kinase pathways in HEC-1-A cells. HEC-1-A cells were infected with 701
HSV-2 (moi=1). Cells were lysed at each time point. The phosphorylation level of p38 702
MAP kinase, JNK and their substrates were determined via Western blot. (C) SB203580 703
and SP600125 showed inhibitory effect of HSV-2 replication in HEC-1-A cells. 704
HEC-1-A cells seeded in 96-well plate were treated with serial concentration of 705
SB203580 and SP600125 prior to infected with HSV-2 (moi=1). gD protein expression 706
level was determined via In-cell Western and normalized by β-catenin 24 hrs p.i. (D) 707
Berberine inhibited the virus-induced JNK phosphorylation, but shown less effect on p38 708
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
38
MAP kinases phosphorylation. HEC-1-A cells were mock-infected or infected with 709
HSV-2 (moi=1) in the presence or absence of berberine. JNK, p38 MAP kinase, and their 710
phosphorylated forms and the downstream p-c-Jun, p-ATF-2 were determined 12 hrs p.i. 711
(E) Berberine inhibited PMA-induced JNK activation. HEC-1-A cells were mock-treated 712
or treated with PMA (4μg/ml) in the presence or absence of berberine. JNK, p38 MAP 713
kinase, and their phosphorylated forms and their substrates were determined after 2 hrs. 714
All experiments were performed three times and the representative results were shown. 715
Data represent mean values (±SD) of triplicate determinations. 716
717
Fig. 7. Berberine down-regulated HSV-2-induced IL-8 and TNF-α expression. 718
HEC-1-A cells were mock-infected or infected with HSV-2 (moi=1) in the presence or 719
absence of berberine (50μM). The IL-8 (A) and TNF-α (B) expression levels were 720
quantified by real-time PCR after 24 hrs p.i. (C) Berberine inhibited HSV-2-induced 721
TNF-α promoter activation. HEC-1-A cells were transfected with TNF-α promoter 722
luciferase reporter plasmid, and after 24 hrs, cell were infected with HSV-2 (moi=1) in 723
the presence of serial concentrations of berberine or MG132 (5μg/ml). The relative 724
luciferase activity was measured 24 hrs p.i. Data represent mean values (±SD) of 725
triplicate determinations from three dependent experiments. 726
727
Fig. 8. Berberine showed moderate synergistic effect with acyclovir against HSV-2 728
infection. The effective concentrations for inhibition of HSV-2 infection by a compound 729
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
39
alone and in combination were plotted in two curves. The CI values were calculated using 730
CalcuSyn. CI <0.1: very strong synergism; 0.1–0.3: strong synergism; 0.3–0.7: synergism; 731
0.7–0.85: moderate synergism; 0.85–0.90: slight synergism; 0.9-1.1: Nearly additive 732
and >1.1: antagonism. Data represent mean values (±SD) of triplicate determinations 733
from three dependent experiments. 734
735
Table 1. Primer pairs used in this study 736
Gene Name Sequence
Forward Reverse
HSV-1 gD AGCAGGGGTTAGGGAGTTG CCATCTTGAGAGAGGCATC
HSV-2 gD CCAAATACGCCTTAGCAGACC CACAGTGATCGGGATGCTGG
IL-8 ATTGAGAGTGGACCACACTG ACTACTGTAATCCTAACACCTG
TNF-α CCTGCCCCAATCCCTTTATT CCCTAAGCCCCCAATTCTCT
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
737
738
739
740
741
742
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from
Table 1. Primer pairs used in this study
Gene Name Sequence
Forward Reverse
HSV-1 gD AGCAGGGGTTAGGGAGTTG CCATCTTGAGAGAGGCATC
HSV-2 gD CCAAATACGCCTTAGCAGACC CACAGTGATCGGGATGCTGG
IL-8 ATTGAGAGTGGACCACACTG ACTACTGTAATCCTAACACCTG
TNF-α CCTGCCCCAATCCCTTTATT CCCTAAGCCCCCAATTCTCT
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
on May 24, 2018 by guest
http://aac.asm.org/
Dow
nloaded from