Research ArticleBerberine Reduces Neurotoxicity Related toNonalcoholic Steatohepatitis in Rats

Doaa A Ghareeb1 Sofia Khalil1 Hani S Hafez2 Juumlrgen Bajorath3 Hany E A Ahmed45

Eman Sarhan6 Eiman Elwakeel7 and Maha A El-Demellawy8

1Biochemistry Department Faculty of Science Alexandria University Alexandria 21511 Egypt2Biotechnology Department Zoology Faculty of Science Suez University Suez Egypt3Department of Life Science Informatics B-IT LIMESProgramUnit Chemical Biology andMedicinal Chemistry Rheinische Friedrich-Wilhelms-Universitat Bonn Dahlmannstraszlige 2 53113 Bonn Germany4Pharmaceutical Organic Chemistry Department Faculty of Pharmacy Al-Azhar University Nasr City Cairo Egypt5Pharmacognosy and Pharmaceutical Chemistry Department Pharmacy College Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia6Protein Research Department Genetic Engineering amp Biotechnology Research InstituteCity for Scientific Research amp Technology Applications Alexandria Egypt7Zewail City of Science and Technology Helmy Institute for Medical Sciences Center for Aging and Associated DiseasesSheikh Zayed District 6th of October City Giza 12588 Egypt8Medical Biotechnology Department Genetic Engineering amp Biotechnology Research InstituteCity for Scientific Research amp Technology Applications Alexandria Egypt

Correspondence should be addressed to Sofia Khalil sofiakhalilymailcom and Hany E A Ahmed heahmadtaibahuedusa

Received 16 June 2015 Accepted 28 September 2015

Academic Editor Yibin Feng

Copyright copy 2015 Doaa A Ghareeb et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Berberine is a plant alkaloid that has several pharmacological effects such as antioxidant antilipidemic and anti-inflammatoryeffects Nonalcoholic steatohepatitis (NASH) triggers different aspects of disorders such as impaired endogenous lipid metabolismhypercholesterolemia oxidative stress and neurotoxicity In this study we examined the mechanism by which NASH inducesneurotoxicity and the protective effect of berberine against bothNASH and its associated neurotoxicity NASH induced rats showedsignificant impairments in lipid metabolism with increased serum triglycerides cholesterol and low-density lipoprotein (LDL)The NASH induced group also demonstrated a significant oxidative stress which is characterized by increased TBARs level anddecreased antioxidant capacity such as GSH and SOD levels Moreover the NASH induction was associated with inflammationwhich was demonstrated by increased TNF120572 and nitric oxide levels Hyperglycemia and hyperinsulinemia were observed in theNASH induced group Also our results showed a significant increase in the expression of the acetylcholine esterase (AChE) andamyloid beta precursor protein (A120573PP)These changeswere significantly correlatedwith decreased insulin degrading enzyme (IDE)and beta-amyloid

40(A12057340) and increased beta-amyloid

42(A12057342) in the hippocampal region Daily administration of berberine

(50mgkg) for three weeks ameliorated oxidative stress inflammation hyperlipidemia hyperglycemia hyperinsulinemia and theobserved neurotoxicity

1 Introduction

Nonalcoholic fatty liver disease (NAFLD) is the nonphysio-logical accumulation of fats in the liver due to impaired fattyacidsrsquo metabolism This disease is followed by hepatic injurymediated by inflammatory cytokines oxidative stress andmitochondrial dysfunction which promote inflammatory

infiltration and fibrosis resulting in steatohepatitis (NASH)[1] Cholesterol rich environment directs the amyloid pre-cursor protein (APP) to be predominantly cleaved with betasecretase 1 (BACE1) generating the neurotoxic A120573 fragmentwith manifestations of AD pathology [2] Furthermore thedecline in cholinergic system markers such as choline acetyl-transferase and acetylcholinesterase has been correlated with

Hindawi Publishing CorporationEvidence-Based Complementary and Alternative MedicineVolume 2015 Article ID 361847 13 pageshttpdxdoiorg1011552015361847

2 Evidence-Based Complementary and Alternative Medicine

both the degree of dementia and the number of neuriticplaques It was shown that hypercholesterolemia increasedthe risk of Alzheimer disease (AD) [3]

Our previous studies have revealed the role hypercholes-terolemia and lipid peroxidation associated with dyslipi-demia and the role of insulin resistance in brain tissues andbody fluids implicating their effects in triggering brain dam-age through the upregulation of acetylcholinesterase [4] Themost effective way to control cholesterol synthesis is inhibit-ing the 3-hydroxy-3-methylglutaryl coenzyme A reductase(HMGR EC 11188) HMG-CoA reductase catalyzes theconversion of HMG-CoA into mevalonate (MVA) Epidemi-ological studies showed a potential link between cholesterol-lowering compounds such as statins and decreased preva-lence or incidence of dementia through targeting lipidmetab-olizing enzymes [5] Neither the potential efficacy of statinsin treating the dementia nor the mechanisms of the reportedstatin-induced neuroprotection are well-understood Also itwas shown that acetyl cholinesterase inhibitors are associatedwith a range of side effects [6] It was suggested that insulinresistance may contribute to amyloidosis by interfering withinsulin degrading enzyme (IDE) mediated degradation ofamyloid A120573 peptides [7]

Berberine is a plant alkaloid with a long history of medic-inal use in both Ayurvedic and Chinese culture [8] Clinicalstudies showed that the administration of 500mg berberineper day for 4 weeks reduced LDL-c level by 20 [9] whichwas mediated by increasing LDLR expression at the post-transcriptional level through stabilization of LDLRmRNA inan extracellular signal-regulated kinase-dependent mannera mechanism distinct from that of statins [10] It was shownthat berberine has antilipidemic effect in mice [11] 200ndash400mgkg berberine daily for six weeks with twice weeklyinjections of CCL

4demonstrated hepatoprotective effects in

regard to serum liver enzymes and histological examina-tion [12] Furthermore berberine has been found to havean inhibitory potential activity against acetylcholinesterase(AChE) and butyrylcholinesterase (BChE) [13] In vitroberberine reduced 120573-amyloid levels (APPNL-H4 cells) anddownregulate 120573-secretase in HEK293 cells [14] In our previ-ous studies berberine extracts were found to inhibit AChE ina competitive manner with inhibition percent value of 50Thus berberine extract is considered as competitive inhibitorto AChE [4 15]

In this study we will investigate the mechanism bywhich nonalcoholic steatohepatitis (NASH) affects liver andconsequently develops neurotoxicity In addition we willintroduce extensive biochemical and computational analysesfor the effect of berberine as promising treatment NASH andits associated neurotoxicity

2 Materials and Methods

21 Chemicals and Reagents Carbon tetrachloride (CCL4)

NAD+ dimethylaminobenzaldehyde reagent thiobarbituricacid (TBA) cumene H

2O2 reduced glutathione (GSH) Ell-

manrsquos reagent (551015840-dithiobis-(2-nitrobenzoic acid) or DTNB)p-hydroxydiphenyl trichloroacetic acid Folinrsquos reagent(sodium 12-naphthoquinone-4-sulfonate) acetylthiocholine

iodide (ACTI) and berberine chloride were purchased fromSigma Chemical Company (St Louis Mo USA) All theother reagents and commercial kits were purchased fromDiamond diagnostic and Biodiagnostic companies (Egypt)

22 Animals and Experimental Design Forty adult femaleSprague-Dawley rats (weighed from 150ndash200 g) were pro-cured from the animal house of Faculty of MedicineAlexandria University Egypt Experiments were performedfollowing international ethical standards and according to theGuide for the Care and Use of Laboratory Animals of theNational Institutes of Health (Institute of Laboratory AnimalResources 1996) The rats were kept in cages in groups of tenand exposed to approximately 23ndash25∘Cwith a 12-h lightdarkcycle Food and water were available ad libitum for one week(acclimatization period) CCL

4was mixed at a concentration

of 16 (VV) in olive oil for administration according tostandard protocol [16]

The animal groups were classified as follows Group1 (control) rats of this group were injected with water(12mLKg) three times weekly for 3 weeks then orallyadministrated 05mL of 20 PEG (polyethylene glycol) foranother three weeks as vehicle with free access to tap waterGroup 2 (control berberine) was orally received 05mL of50mgkg berberine dissolved in 20 PEG for 3 weeksTwenty rats were intraperitoneally injected with CCL

4solu-

tion at a dose of (50 120583LKg) three times per weeks for threeweeks After the induction period the rats were subgroupedinto 2 groups (10 rats each) as follows one groupwas received05mLPEG20asNASH induced group and the other groupwas received 05mL of 50mgkg berberine for another threeweeks as the fourth group

Rats were sacrificed after anesthesia with diethyletherinhalation and the brains were rapidly removed and cutsagittally into left and right hemispheres on an ice-cooledboardThe hippocampuswas dissected from the left and righthemisphere and stored at minus80∘C for biochemical tests sand-wich enzyme-linked immunosorbent assay (ELISA) andRNA extraction Liver tissue was collected and stored informalin for histological studies Blood was collected andsera were separated to measure the liver function lipidsprofile 120573-amyloid

40 prooxidantsantioxidants and acetyl-

cholinesterase (AChE) measurementsBrain tissue was weighed and homogenized directly in 9

volumes of cold phosphate buffer using Potter-Elvehjem typeglass-Teflon homogenizer To separate the nuclear debristhe tissue homogenates were centrifuged at 3000 rpm for15min at 4∘C Brain supernatant was used for further anal-ysis For ELISA assays tissues were homogenized in radio-immunoprecipitation assay buffer containing protease andphosphatase inhibitors [17]

23 Biochemical Parameters Assays

231 Determination of Blood and Brain Lipid PeroxidationThe malondialdehyde content a measure of lipid peroxida-tion was assayed in the form of thiobarbituric acid-reactivesubstances (TBARS) by the method described by Wills [18]

Evidence-Based Complementary and Alternative Medicine 3

232 Determination of Blood and Brain Endogenous Antioxi-dant Activities

(1) Glutathione peroxidase (Gpx) activity was calculatedaccording to Paglia and Valentine with the followingequation GPx activity (Ug wet tissue) = 119860 times 62 times100131 times 005 times 10 [19]

(2) Reduced glutathione (GSH) activity was assayed by themethod of Jollow et al and the resulting color wasmeasured immediately at 412 nm [20] Standard curvewas constructed using standard GSH

(3) Superoxide dismutase (SOD) activity was assessedaccording tomethod of SMarklund andGMarklund[21] The inhibition percent was calculated accordingto the following equation the percentage inhibition= [100 minus (119860

119905minminus1mLminus1 sample)(119860

119903minminus1mLminus1

reference)] times 100

233 Determination of Serum Triglycerides Triglyceride wasmeasured by themethod described in the commercial triglyc-erides kit purchased from Biodiagnostic Egypt [22]

Estimation of Brain and Serum Cholesterol The assay wascarried out according to the method of Watson using acommercial cholesterol kit purchased from BiodiagnosticEgypt [23]

234 Estimation of Low and High Density Lipoproteins (LDLand HDL) LDL and HDL were assayed according to Friede-wald et al and Lopes-Virella et al respectively using thecommercial kit [24 25]While VLDLwas calculated by usingthe following equation

VLDL (mgdL) =Blood triglyceride

5

(1)

235 Determination of SerumAST andALTEnzymes Aspar-tate aminotransferase (AST) and alanine aminotransferase(ALT) were assayed by the method described in the commer-cial ALT kit purchased from Biodiagnostic Egypt [26]

236 Sandwich ELISA for Quantification of Beta Amyloid 1-40 and 1-42 Rat amyloid beta peptide 1-40 and 1-42 (A120573 1-40and A120573 1-42) were assayed by the method described in thecommercial A120573 1-40 and A120573 1-42 ELISA kit purchased fromCusabio Biotech Co China The levels A120573 1-40 and A120573 1-42were measured by the enzyme-linked immunosorbent assay(ELISA) using the anti-rat amyloid beta peptide 1-40 or A1205731-42 precoated microplates (12 times 8 microwell strips)

237 Determination of Serum TNF120572 TNF120572 was measuredas described by the commercial TNF120572 ELISA kit purchasedfrom RayBiotech USA The TNF120572 level was determinedby the enzyme-linked immunosorbent assay (ELISA) usingthe anti-rat TNF120572 precoated microplates (12 times 8 microwellstrips)

238 Determination of Acetylcholinesterase (AChE) Activitywas measured according to Ellman et al [27]

239 Nitric Oxide Assay Nitric oxide level was estimatedaccording to Hummel et al [28]

2310 Monoamine Oxide (MAO) Assay 667 120583L of 500 120583Mp-tyramine and 133 120583L potassium phosphate buffer pH 76were added to 100 120583L brain liver supernatant or serum Theabsorbance was measured at 250 nm against air after 30 s and90 s The activity of MAO (UL) was calculated according toSandler et al [29] with the following equation

MAO Activity = Δ119860 times Total volume times 1000322 times Sample volume times 05

(2)

2311 Determination of Blood Retinol Binding Protein-4(RBP4) Level RBP4 was assayed according to the descrip-tion of the commercial RBP4 ELISA kit purchased fromRayBiotech USA using biotinylated RBP4 antibody andstreptavidin-peroxidase conjugateThe absorbance wasmon-itored on a microplate reader at a wavelength of 450 nmimmediately A standard curve was generated using theRBP4 standard concentrations on the 119909-axis against themean absorbance at 450 nm on the 119910-axis Unknown sampleconcentration was determined using the standard curve

2312 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis Total RNA was extracted from frozen tissuesusing TRIzol reagent (Invitrogen)The amount and quality ofRNA were assessed using a BioRad spectrophotometer andan Agilent 2100 Bioanalyzer To examine the mRNA levelscells were briefly washed twice with ice-cold RNase-free PBSTwo micrograms of RNA were reverse transcribed to cDNA(Ambion Austin TX) in 25120583L of total reaction volumePrimer sequences of the analyzed genes amyloid beta precur-sor protein (A120573PP) F GCAGAATGGAAAATGGGAGTCAG R AAT CAC GAT GTG GGT GTG CGT C and acetyl-cholinesterase (AChE) F TTC TCC CAC ACC TGT CCTCAT C R TTC ATA GAT ACC AAC ACG GTT CCC Theamplification was performed on a thermal cycler (AppliedBiosystems Foster City CA) with different conditions foreach gene The resulting products were visualized on agarosegelsThe intensity of the bands was quantified by the densito-meter (Imaging Research St Catharines Ontario Canada)and resulting data were normalized by using the corre-sponding GAPDH (F TACCCCACGGCAAGTTCAATGGR AGGGGCGGAGATGATGATGACCC)

24 Histopathology Sections of liver were fixed in 10 neu-tral buffered formalin for 48 h Specimens were dehydratedand embedded in paraffin sectioned and stained with hema-toxylin and eosin (HampE) for histopathological examination

25 Molecular Docking Berberine was docked into the crys-tal structures of acetylcholinesterase (AChE) (PDB code2CMF) and HMG-CoA reductase (PDB code 1HWK) Twoknown drugs were also docked including atorvastatin (statindrug HMG-CoA reductase inhibitor) and donepezil (AChEinhibitor) and used as reference for comparison to berberineAutoDock 30 [30] and MOE [31] software were used for

4 Evidence-Based Complementary and Alternative Medicine

Table 1 Mean levels of blood liver function tests and lipid profile in control NASH and berberine treated groups

Groups AST(UL) ALT (UL) ASTALT RBP-4

(pgL) TG mgdL CholesterolmgdL LDL mgdL VLDL

mgdL LDLHDLBrain

cholesterol(mgg)

Control 12 plusmn 12a 10 plusmn 04a 12 2005 plusmn 19a 56 plusmn 75a 70 plusmn 45b 40 plusmn 23b 11 plusmn 122b 267 90 plusmn 10a

Berberinecontrol 13 plusmn 21a 85 plusmn 032a 153 190 plusmn 20a 40 plusmn 23a 50 plusmn 23a 30 plusmn 21a 8 plusmn 21a 25 98 plusmn 12a

NASH 30 plusmn 32b 45 plusmn 42b 067 600 plusmn 76c 180 plusmn 23c 200 plusmn 23c 140 plusmn 10c 36 plusmn 31d 58 2387 plusmn 349c

Berberinetreatment 15 plusmn 25a 12 plusmn 42a 125 230 plusmn 85ab 70 plusmn 11ab 80 plusmn 67b 40 plusmn 55b 14 plusmn 21c 154 130 plusmn 99b

Values are reported as means plusmn SD of rat groups (10 rats each) with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

all docking calculations The AutoDockTools package wasemployed to generate the docking input files and to analyzethe docking results [30] A grid box size of 90 times 90 times 90points with a spacing of 0375 A between the grid pointswas generated that covered almost the entire protein surfaceLegends were fully flexibly docked All nonpolar hydrogensand crystallographic water molecules were removed priorto the calculations The docking grid was centered on themass center of the bound TSA In each case 100 dockedstructures were generated using genetic algorithm searchesA default protocol was appliedwith an initial population of 50randomly placed conformations amaximumnumber of 25times105 energy evaluations and a maximum number of 27 times 104generations A mutation rate of 002 and a crossover rate of08 were used Heavy atom comparison root mean squaredeviations (RMSD values) were calculated and initial ligandbinding modes were plotted Protein-ligand interaction plotswere generated using MOE 2012 [31]

26 Statistical Analysis Data are reported as the mean plusmnSD One-way analysis of variance (ANOVA) was followedby Student Newman-Keuls test which was provided by thePrimer Biostatistics program (Version 5) The differenceswere considered statistically significant at 119875 values lt 005

3 Results

In this study we used CCL4to induce NASH and to

investigate if there is any accompanied neurotoxicity effectHere we also studied the therapeutic effects of berberineon both NASH complications and its accompanied diseasesOurmeasurements focused on some biochemical parametersrelated to oxidative stress inflammation lipid profile liverfunction and neurotoxicity

31 The Effect of Berberine Treatment on NASH Biomarkersand Accompanied Dyslipidemia Liver injury and steatosiswere diagnosed by measuring the changes in the liverenzymes aspartate aminotransferase (AST) and alanineaminotransferase (ALT) and their ratio These enzymesrsquo levelwas significantly increased in the NASH induced groupcompared to the control group and the berberine treatedgroup giving ASTALT ratio lower than 1 (067) (Table 1)

Furthermore we measured the serum retinol-binding pro-tein 4 (RBP-4) levels as an indicator marker for the severityof steatosis and NASH progress The NASH group had asignificant increase in the RBP-4 levels compared to thecontrol and the berberine treated group (Table 1) NASHinduced group showed a remarkable dyslipidemia Thiswas manifested by the significant increase in the bloodtriglycerides LDL VLDL LDLHDL ratio and cholesterollevels Upon berberine treatment a significant reduction inthe blood triglycerides LDL VLDL LDLHDL ratio andcholesterol levels was observed compared to theNASH group(Table 1) Furthermore a marked increase in the cholesterolconcentration in the brain tissue in the NASH induced groupwas compared to the control group Around a 54 decreasein the brain cholesterol level in the berberine-treated groupwas compared to the NASH induced group

32 The Effect of Berberine on Antioxidant Capacity andAssociated Inflammation In the NASH induced group theproduction rate of thiobarbituric acid-reactive substances(TBARS) in the serum and brain tissue samples was signif-icantly increased in the blood samples reflecting the increasein the lipid peroxidation Moreover a marked decrease in thelevels of the blood endogenous antioxidant markers such asGPx SOD and GSH was observed in the NASH inducedgroup (Table 2) In contrast the berberine treated groupshowed a significant increase in the antioxidant systemwhichis accompanied by a marked decrease in the TBARS Theresults of the berberine treated group are similar to that ofthe berberine vehicle group and control group The level ofthe blood xanthine oxidase also revealed 28-fold increasein the NASH induced group relative to the control groupThis increase in the xanthine oxidase was reversed in theberberine treated group giving value similar to that of thecontrol group Also the data in the brain tissues of the NASHgroup revealed a marked increase in the TBARS and 15-foldincrease in the xanthine oxidase with a significant decreasein the antioxidant markers (Table 3 Figure 1) Berberinetreatment decrease the lipid peroxidation and increase theantioxidant parameters in the brain tissues (Figure 1) Ourdata also showed a significant increase in tumor necrosisfactor (TNF120572) which markedly decreased after berberinetreatment giving results similar to that of the control group

Evidence-Based Complementary and Alternative Medicine 5

Table 2 Mean levels of serum oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARSnmolmL

XO(120583Mhour)

GPx(IU) SOD (IU) GSH

(mgdL)TNF-alpha(pgL)

NO(nmolemL)

Control 23 plusmn 02b 134 plusmn 16a 72 plusmn 05c 34 plusmn 02b 32 plusmn 03b 87 plusmn 12a 93 plusmn 31b

Berberine control 15 plusmn 01a 121 plusmn 22a 91 plusmn 05d 41 plusmn 02c 4 plusmn 01c 76 plusmn 96a 5 plusmn 09a

NASH group 10 plusmn 12d 372 plusmn 52b 42 plusmn 02a 21 plusmn 01a 14 plusmn 02a 500 plusmn 45c 30 plusmn 72c

Berberinetreatment 5 plusmn 09c 132 plusmn 42a 61 plusmn 02b 31 plusmn 05b 32 plusmn 02b 150 plusmn 30b 103 plusmn 23b

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 3 Mean levels of brain oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARS(nMmL) XO (120583Mhour) GPx

(IU)SOD(IU) GSH (mgdL) TNF-alpha

(pgL)NO

(nmolemL)Control 125 plusmn 12a 82 plusmn 09a 002 plusmn 0001b 82 plusmn 007c 21 plusmn 21b 605 plusmn 35b 56 plusmn 05a

Berberine control 101 plusmn 21a 75 plusmn 04a 002 plusmn 0001b 99 plusmn 05d 34 plusmn 23c 504 plusmn 62a 43 plusmn 06a

NASH group 305 plusmn 31c 123 plusmn 06c 001 plusmn 0007a 21 plusmn 004a 64 plusmn 07a 205 plusmn 125c 541 plusmn 2d

Berberine treatment 146 plusmn 19ab 101 plusmn 09b 0019 plusmn 00001b 73 plusmn 02b 201 plusmn 065b 89 plusmn 101c 115 plusmn 1c

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

a ac

ab

c d

ab

b

c

a

b

05

10152025303540

Valu

es

BC NASH BtC

Figure 1 Effect of berberine treatment on the changes in brainoxidative stress factors of different rat groups C control group BCberberine control group NASH the CCL

4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine The

figure shows the data of GSH (black bars) SOD (dotted white bars)and TBARS (gray bars)

Moreover the NASH induced group showed around three-fold increase in the nitric oxide level which significantlydecreases to value similar to that of the control group uponberberine treatment

33 NASH Induction and Its Related Hyperglycemia andHyperinsulinemia The blood glucose concentration was sig-nificantly increased from 78mgdL in the control group to180mgdL in the NASH induced group reflecting hyper-glycemia in the NASH induced group The berberine con-trol group showed a slight decrease in the blood glucoselevel compared to the control group (Table 4) Furthermoretwofold increase in the blood insulin level (20 pgL) inthe NASH induced group was compared to the control

group (102 pgL) suggesting hyperinsulinemia in the NASHinduced group Upon berberine treatment the blood insulinlevel was returned back to a value of 101 pgL which is similarto the control groupThe calculatedHOMA-IR wasmarkedlydecreased from 89 to 22 upon berberine treatment Inthe brain tissues of NASH group a significant reduction inthe glucose with around 3-fold increase in the insulin wasobserved Berberine treatment reduced both the glucose andinsulin levels in the brain tissues (Table 4)

34 NASH Triggers Neurotoxicity In blood and brain sam-ples the NASH induced group showed a significant increasein the AChE activity compared to the control group (Table 5)Moreover around 15- and 25-fold increase in the MAOactivity in the blood and brain tissues of the NASH inducedgroup was compared to the control group respectivelyBerberine treatment markedly decreases the AChE andMAO activity in both blood and brain tissues (Table 5) Amarked increase in the 120573-amyloid (A120573

42) and decrease in the

A12057340

were observed in the brain tissues of NASH inducedrats Upon berberine treatment the 120573-amyloid (A120573

42) level

was decreased while A12057340

increased to values similar tothat of the control group Furthermore IDE activity wasdecreased in the NASH induced group but it was returnedback to a value similar to that of the control by berber-ine treatment (Table 5 Figure 2) To investigate the long-term effects of NASH on genes and proteins that can beupregulated during neurotoxicity induction we measuredamyloid-120573-precursor protein (A120573PP) and AChE mRNA lev-els by qRT-PCR analysis Here we used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 Evidence-Based Complementary and Alternative Medicine

both the degree of dementia and the number of neuriticplaques It was shown that hypercholesterolemia increasedthe risk of Alzheimer disease (AD) [3]

Our previous studies have revealed the role hypercholes-terolemia and lipid peroxidation associated with dyslipi-demia and the role of insulin resistance in brain tissues andbody fluids implicating their effects in triggering brain dam-age through the upregulation of acetylcholinesterase [4] Themost effective way to control cholesterol synthesis is inhibit-ing the 3-hydroxy-3-methylglutaryl coenzyme A reductase(HMGR EC 11188) HMG-CoA reductase catalyzes theconversion of HMG-CoA into mevalonate (MVA) Epidemi-ological studies showed a potential link between cholesterol-lowering compounds such as statins and decreased preva-lence or incidence of dementia through targeting lipidmetab-olizing enzymes [5] Neither the potential efficacy of statinsin treating the dementia nor the mechanisms of the reportedstatin-induced neuroprotection are well-understood Also itwas shown that acetyl cholinesterase inhibitors are associatedwith a range of side effects [6] It was suggested that insulinresistance may contribute to amyloidosis by interfering withinsulin degrading enzyme (IDE) mediated degradation ofamyloid A120573 peptides [7]

Berberine is a plant alkaloid with a long history of medic-inal use in both Ayurvedic and Chinese culture [8] Clinicalstudies showed that the administration of 500mg berberineper day for 4 weeks reduced LDL-c level by 20 [9] whichwas mediated by increasing LDLR expression at the post-transcriptional level through stabilization of LDLRmRNA inan extracellular signal-regulated kinase-dependent mannera mechanism distinct from that of statins [10] It was shownthat berberine has antilipidemic effect in mice [11] 200ndash400mgkg berberine daily for six weeks with twice weeklyinjections of CCL

4demonstrated hepatoprotective effects in

regard to serum liver enzymes and histological examina-tion [12] Furthermore berberine has been found to havean inhibitory potential activity against acetylcholinesterase(AChE) and butyrylcholinesterase (BChE) [13] In vitroberberine reduced 120573-amyloid levels (APPNL-H4 cells) anddownregulate 120573-secretase in HEK293 cells [14] In our previ-ous studies berberine extracts were found to inhibit AChE ina competitive manner with inhibition percent value of 50Thus berberine extract is considered as competitive inhibitorto AChE [4 15]

In this study we will investigate the mechanism bywhich nonalcoholic steatohepatitis (NASH) affects liver andconsequently develops neurotoxicity In addition we willintroduce extensive biochemical and computational analysesfor the effect of berberine as promising treatment NASH andits associated neurotoxicity

2 Materials and Methods

21 Chemicals and Reagents Carbon tetrachloride (CCL4)

NAD+ dimethylaminobenzaldehyde reagent thiobarbituricacid (TBA) cumene H

2O2 reduced glutathione (GSH) Ell-

manrsquos reagent (551015840-dithiobis-(2-nitrobenzoic acid) or DTNB)p-hydroxydiphenyl trichloroacetic acid Folinrsquos reagent(sodium 12-naphthoquinone-4-sulfonate) acetylthiocholine

iodide (ACTI) and berberine chloride were purchased fromSigma Chemical Company (St Louis Mo USA) All theother reagents and commercial kits were purchased fromDiamond diagnostic and Biodiagnostic companies (Egypt)

22 Animals and Experimental Design Forty adult femaleSprague-Dawley rats (weighed from 150ndash200 g) were pro-cured from the animal house of Faculty of MedicineAlexandria University Egypt Experiments were performedfollowing international ethical standards and according to theGuide for the Care and Use of Laboratory Animals of theNational Institutes of Health (Institute of Laboratory AnimalResources 1996) The rats were kept in cages in groups of tenand exposed to approximately 23ndash25∘Cwith a 12-h lightdarkcycle Food and water were available ad libitum for one week(acclimatization period) CCL

4was mixed at a concentration

of 16 (VV) in olive oil for administration according tostandard protocol [16]

The animal groups were classified as follows Group1 (control) rats of this group were injected with water(12mLKg) three times weekly for 3 weeks then orallyadministrated 05mL of 20 PEG (polyethylene glycol) foranother three weeks as vehicle with free access to tap waterGroup 2 (control berberine) was orally received 05mL of50mgkg berberine dissolved in 20 PEG for 3 weeksTwenty rats were intraperitoneally injected with CCL

4solu-

tion at a dose of (50 120583LKg) three times per weeks for threeweeks After the induction period the rats were subgroupedinto 2 groups (10 rats each) as follows one groupwas received05mLPEG20asNASH induced group and the other groupwas received 05mL of 50mgkg berberine for another threeweeks as the fourth group

Rats were sacrificed after anesthesia with diethyletherinhalation and the brains were rapidly removed and cutsagittally into left and right hemispheres on an ice-cooledboardThe hippocampuswas dissected from the left and righthemisphere and stored at minus80∘C for biochemical tests sand-wich enzyme-linked immunosorbent assay (ELISA) andRNA extraction Liver tissue was collected and stored informalin for histological studies Blood was collected andsera were separated to measure the liver function lipidsprofile 120573-amyloid

40 prooxidantsantioxidants and acetyl-

cholinesterase (AChE) measurementsBrain tissue was weighed and homogenized directly in 9

volumes of cold phosphate buffer using Potter-Elvehjem typeglass-Teflon homogenizer To separate the nuclear debristhe tissue homogenates were centrifuged at 3000 rpm for15min at 4∘C Brain supernatant was used for further anal-ysis For ELISA assays tissues were homogenized in radio-immunoprecipitation assay buffer containing protease andphosphatase inhibitors [17]

23 Biochemical Parameters Assays

231 Determination of Blood and Brain Lipid PeroxidationThe malondialdehyde content a measure of lipid peroxida-tion was assayed in the form of thiobarbituric acid-reactivesubstances (TBARS) by the method described by Wills [18]

Evidence-Based Complementary and Alternative Medicine 3

232 Determination of Blood and Brain Endogenous Antioxi-dant Activities

(1) Glutathione peroxidase (Gpx) activity was calculatedaccording to Paglia and Valentine with the followingequation GPx activity (Ug wet tissue) = 119860 times 62 times100131 times 005 times 10 [19]

(2) Reduced glutathione (GSH) activity was assayed by themethod of Jollow et al and the resulting color wasmeasured immediately at 412 nm [20] Standard curvewas constructed using standard GSH

(3) Superoxide dismutase (SOD) activity was assessedaccording tomethod of SMarklund andGMarklund[21] The inhibition percent was calculated accordingto the following equation the percentage inhibition= [100 minus (119860

119905minminus1mLminus1 sample)(119860

119903minminus1mLminus1

reference)] times 100

233 Determination of Serum Triglycerides Triglyceride wasmeasured by themethod described in the commercial triglyc-erides kit purchased from Biodiagnostic Egypt [22]

Estimation of Brain and Serum Cholesterol The assay wascarried out according to the method of Watson using acommercial cholesterol kit purchased from BiodiagnosticEgypt [23]

234 Estimation of Low and High Density Lipoproteins (LDLand HDL) LDL and HDL were assayed according to Friede-wald et al and Lopes-Virella et al respectively using thecommercial kit [24 25]While VLDLwas calculated by usingthe following equation

VLDL (mgdL) =Blood triglyceride

5

(1)

235 Determination of SerumAST andALTEnzymes Aspar-tate aminotransferase (AST) and alanine aminotransferase(ALT) were assayed by the method described in the commer-cial ALT kit purchased from Biodiagnostic Egypt [26]

236 Sandwich ELISA for Quantification of Beta Amyloid 1-40 and 1-42 Rat amyloid beta peptide 1-40 and 1-42 (A120573 1-40and A120573 1-42) were assayed by the method described in thecommercial A120573 1-40 and A120573 1-42 ELISA kit purchased fromCusabio Biotech Co China The levels A120573 1-40 and A120573 1-42were measured by the enzyme-linked immunosorbent assay(ELISA) using the anti-rat amyloid beta peptide 1-40 or A1205731-42 precoated microplates (12 times 8 microwell strips)

237 Determination of Serum TNF120572 TNF120572 was measuredas described by the commercial TNF120572 ELISA kit purchasedfrom RayBiotech USA The TNF120572 level was determinedby the enzyme-linked immunosorbent assay (ELISA) usingthe anti-rat TNF120572 precoated microplates (12 times 8 microwellstrips)

238 Determination of Acetylcholinesterase (AChE) Activitywas measured according to Ellman et al [27]

239 Nitric Oxide Assay Nitric oxide level was estimatedaccording to Hummel et al [28]

2310 Monoamine Oxide (MAO) Assay 667 120583L of 500 120583Mp-tyramine and 133 120583L potassium phosphate buffer pH 76were added to 100 120583L brain liver supernatant or serum Theabsorbance was measured at 250 nm against air after 30 s and90 s The activity of MAO (UL) was calculated according toSandler et al [29] with the following equation

MAO Activity = Δ119860 times Total volume times 1000322 times Sample volume times 05

(2)

2311 Determination of Blood Retinol Binding Protein-4(RBP4) Level RBP4 was assayed according to the descrip-tion of the commercial RBP4 ELISA kit purchased fromRayBiotech USA using biotinylated RBP4 antibody andstreptavidin-peroxidase conjugateThe absorbance wasmon-itored on a microplate reader at a wavelength of 450 nmimmediately A standard curve was generated using theRBP4 standard concentrations on the 119909-axis against themean absorbance at 450 nm on the 119910-axis Unknown sampleconcentration was determined using the standard curve

2312 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis Total RNA was extracted from frozen tissuesusing TRIzol reagent (Invitrogen)The amount and quality ofRNA were assessed using a BioRad spectrophotometer andan Agilent 2100 Bioanalyzer To examine the mRNA levelscells were briefly washed twice with ice-cold RNase-free PBSTwo micrograms of RNA were reverse transcribed to cDNA(Ambion Austin TX) in 25120583L of total reaction volumePrimer sequences of the analyzed genes amyloid beta precur-sor protein (A120573PP) F GCAGAATGGAAAATGGGAGTCAG R AAT CAC GAT GTG GGT GTG CGT C and acetyl-cholinesterase (AChE) F TTC TCC CAC ACC TGT CCTCAT C R TTC ATA GAT ACC AAC ACG GTT CCC Theamplification was performed on a thermal cycler (AppliedBiosystems Foster City CA) with different conditions foreach gene The resulting products were visualized on agarosegelsThe intensity of the bands was quantified by the densito-meter (Imaging Research St Catharines Ontario Canada)and resulting data were normalized by using the corre-sponding GAPDH (F TACCCCACGGCAAGTTCAATGGR AGGGGCGGAGATGATGATGACCC)

24 Histopathology Sections of liver were fixed in 10 neu-tral buffered formalin for 48 h Specimens were dehydratedand embedded in paraffin sectioned and stained with hema-toxylin and eosin (HampE) for histopathological examination

25 Molecular Docking Berberine was docked into the crys-tal structures of acetylcholinesterase (AChE) (PDB code2CMF) and HMG-CoA reductase (PDB code 1HWK) Twoknown drugs were also docked including atorvastatin (statindrug HMG-CoA reductase inhibitor) and donepezil (AChEinhibitor) and used as reference for comparison to berberineAutoDock 30 [30] and MOE [31] software were used for

4 Evidence-Based Complementary and Alternative Medicine

Table 1 Mean levels of blood liver function tests and lipid profile in control NASH and berberine treated groups

Groups AST(UL) ALT (UL) ASTALT RBP-4

(pgL) TG mgdL CholesterolmgdL LDL mgdL VLDL

mgdL LDLHDLBrain

cholesterol(mgg)

Control 12 plusmn 12a 10 plusmn 04a 12 2005 plusmn 19a 56 plusmn 75a 70 plusmn 45b 40 plusmn 23b 11 plusmn 122b 267 90 plusmn 10a

Berberinecontrol 13 plusmn 21a 85 plusmn 032a 153 190 plusmn 20a 40 plusmn 23a 50 plusmn 23a 30 plusmn 21a 8 plusmn 21a 25 98 plusmn 12a

NASH 30 plusmn 32b 45 plusmn 42b 067 600 plusmn 76c 180 plusmn 23c 200 plusmn 23c 140 plusmn 10c 36 plusmn 31d 58 2387 plusmn 349c

Berberinetreatment 15 plusmn 25a 12 plusmn 42a 125 230 plusmn 85ab 70 plusmn 11ab 80 plusmn 67b 40 plusmn 55b 14 plusmn 21c 154 130 plusmn 99b

Values are reported as means plusmn SD of rat groups (10 rats each) with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

all docking calculations The AutoDockTools package wasemployed to generate the docking input files and to analyzethe docking results [30] A grid box size of 90 times 90 times 90points with a spacing of 0375 A between the grid pointswas generated that covered almost the entire protein surfaceLegends were fully flexibly docked All nonpolar hydrogensand crystallographic water molecules were removed priorto the calculations The docking grid was centered on themass center of the bound TSA In each case 100 dockedstructures were generated using genetic algorithm searchesA default protocol was appliedwith an initial population of 50randomly placed conformations amaximumnumber of 25times105 energy evaluations and a maximum number of 27 times 104generations A mutation rate of 002 and a crossover rate of08 were used Heavy atom comparison root mean squaredeviations (RMSD values) were calculated and initial ligandbinding modes were plotted Protein-ligand interaction plotswere generated using MOE 2012 [31]

26 Statistical Analysis Data are reported as the mean plusmnSD One-way analysis of variance (ANOVA) was followedby Student Newman-Keuls test which was provided by thePrimer Biostatistics program (Version 5) The differenceswere considered statistically significant at 119875 values lt 005

3 Results

In this study we used CCL4to induce NASH and to

investigate if there is any accompanied neurotoxicity effectHere we also studied the therapeutic effects of berberineon both NASH complications and its accompanied diseasesOurmeasurements focused on some biochemical parametersrelated to oxidative stress inflammation lipid profile liverfunction and neurotoxicity

31 The Effect of Berberine Treatment on NASH Biomarkersand Accompanied Dyslipidemia Liver injury and steatosiswere diagnosed by measuring the changes in the liverenzymes aspartate aminotransferase (AST) and alanineaminotransferase (ALT) and their ratio These enzymesrsquo levelwas significantly increased in the NASH induced groupcompared to the control group and the berberine treatedgroup giving ASTALT ratio lower than 1 (067) (Table 1)

Furthermore we measured the serum retinol-binding pro-tein 4 (RBP-4) levels as an indicator marker for the severityof steatosis and NASH progress The NASH group had asignificant increase in the RBP-4 levels compared to thecontrol and the berberine treated group (Table 1) NASHinduced group showed a remarkable dyslipidemia Thiswas manifested by the significant increase in the bloodtriglycerides LDL VLDL LDLHDL ratio and cholesterollevels Upon berberine treatment a significant reduction inthe blood triglycerides LDL VLDL LDLHDL ratio andcholesterol levels was observed compared to theNASH group(Table 1) Furthermore a marked increase in the cholesterolconcentration in the brain tissue in the NASH induced groupwas compared to the control group Around a 54 decreasein the brain cholesterol level in the berberine-treated groupwas compared to the NASH induced group

32 The Effect of Berberine on Antioxidant Capacity andAssociated Inflammation In the NASH induced group theproduction rate of thiobarbituric acid-reactive substances(TBARS) in the serum and brain tissue samples was signif-icantly increased in the blood samples reflecting the increasein the lipid peroxidation Moreover a marked decrease in thelevels of the blood endogenous antioxidant markers such asGPx SOD and GSH was observed in the NASH inducedgroup (Table 2) In contrast the berberine treated groupshowed a significant increase in the antioxidant systemwhichis accompanied by a marked decrease in the TBARS Theresults of the berberine treated group are similar to that ofthe berberine vehicle group and control group The level ofthe blood xanthine oxidase also revealed 28-fold increasein the NASH induced group relative to the control groupThis increase in the xanthine oxidase was reversed in theberberine treated group giving value similar to that of thecontrol group Also the data in the brain tissues of the NASHgroup revealed a marked increase in the TBARS and 15-foldincrease in the xanthine oxidase with a significant decreasein the antioxidant markers (Table 3 Figure 1) Berberinetreatment decrease the lipid peroxidation and increase theantioxidant parameters in the brain tissues (Figure 1) Ourdata also showed a significant increase in tumor necrosisfactor (TNF120572) which markedly decreased after berberinetreatment giving results similar to that of the control group

Evidence-Based Complementary and Alternative Medicine 5

Table 2 Mean levels of serum oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARSnmolmL

XO(120583Mhour)

GPx(IU) SOD (IU) GSH

(mgdL)TNF-alpha(pgL)

NO(nmolemL)

Control 23 plusmn 02b 134 plusmn 16a 72 plusmn 05c 34 plusmn 02b 32 plusmn 03b 87 plusmn 12a 93 plusmn 31b

Berberine control 15 plusmn 01a 121 plusmn 22a 91 plusmn 05d 41 plusmn 02c 4 plusmn 01c 76 plusmn 96a 5 plusmn 09a

NASH group 10 plusmn 12d 372 plusmn 52b 42 plusmn 02a 21 plusmn 01a 14 plusmn 02a 500 plusmn 45c 30 plusmn 72c

Berberinetreatment 5 plusmn 09c 132 plusmn 42a 61 plusmn 02b 31 plusmn 05b 32 plusmn 02b 150 plusmn 30b 103 plusmn 23b

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 3 Mean levels of brain oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARS(nMmL) XO (120583Mhour) GPx

(IU)SOD(IU) GSH (mgdL) TNF-alpha

(pgL)NO

(nmolemL)Control 125 plusmn 12a 82 plusmn 09a 002 plusmn 0001b 82 plusmn 007c 21 plusmn 21b 605 plusmn 35b 56 plusmn 05a

Berberine control 101 plusmn 21a 75 plusmn 04a 002 plusmn 0001b 99 plusmn 05d 34 plusmn 23c 504 plusmn 62a 43 plusmn 06a

NASH group 305 plusmn 31c 123 plusmn 06c 001 plusmn 0007a 21 plusmn 004a 64 plusmn 07a 205 plusmn 125c 541 plusmn 2d

Berberine treatment 146 plusmn 19ab 101 plusmn 09b 0019 plusmn 00001b 73 plusmn 02b 201 plusmn 065b 89 plusmn 101c 115 plusmn 1c

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

a ac

ab

c d

ab

b

c

a

b

05

10152025303540

Valu

es

BC NASH BtC

Figure 1 Effect of berberine treatment on the changes in brainoxidative stress factors of different rat groups C control group BCberberine control group NASH the CCL

4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine The

figure shows the data of GSH (black bars) SOD (dotted white bars)and TBARS (gray bars)

Moreover the NASH induced group showed around three-fold increase in the nitric oxide level which significantlydecreases to value similar to that of the control group uponberberine treatment

33 NASH Induction and Its Related Hyperglycemia andHyperinsulinemia The blood glucose concentration was sig-nificantly increased from 78mgdL in the control group to180mgdL in the NASH induced group reflecting hyper-glycemia in the NASH induced group The berberine con-trol group showed a slight decrease in the blood glucoselevel compared to the control group (Table 4) Furthermoretwofold increase in the blood insulin level (20 pgL) inthe NASH induced group was compared to the control

group (102 pgL) suggesting hyperinsulinemia in the NASHinduced group Upon berberine treatment the blood insulinlevel was returned back to a value of 101 pgL which is similarto the control groupThe calculatedHOMA-IR wasmarkedlydecreased from 89 to 22 upon berberine treatment Inthe brain tissues of NASH group a significant reduction inthe glucose with around 3-fold increase in the insulin wasobserved Berberine treatment reduced both the glucose andinsulin levels in the brain tissues (Table 4)

34 NASH Triggers Neurotoxicity In blood and brain sam-ples the NASH induced group showed a significant increasein the AChE activity compared to the control group (Table 5)Moreover around 15- and 25-fold increase in the MAOactivity in the blood and brain tissues of the NASH inducedgroup was compared to the control group respectivelyBerberine treatment markedly decreases the AChE andMAO activity in both blood and brain tissues (Table 5) Amarked increase in the 120573-amyloid (A120573

42) and decrease in the

A12057340

were observed in the brain tissues of NASH inducedrats Upon berberine treatment the 120573-amyloid (A120573

42) level

was decreased while A12057340

increased to values similar tothat of the control group Furthermore IDE activity wasdecreased in the NASH induced group but it was returnedback to a value similar to that of the control by berber-ine treatment (Table 5 Figure 2) To investigate the long-term effects of NASH on genes and proteins that can beupregulated during neurotoxicity induction we measuredamyloid-120573-precursor protein (A120573PP) and AChE mRNA lev-els by qRT-PCR analysis Here we used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 3

232 Determination of Blood and Brain Endogenous Antioxi-dant Activities

(1) Glutathione peroxidase (Gpx) activity was calculatedaccording to Paglia and Valentine with the followingequation GPx activity (Ug wet tissue) = 119860 times 62 times100131 times 005 times 10 [19]

(2) Reduced glutathione (GSH) activity was assayed by themethod of Jollow et al and the resulting color wasmeasured immediately at 412 nm [20] Standard curvewas constructed using standard GSH

(3) Superoxide dismutase (SOD) activity was assessedaccording tomethod of SMarklund andGMarklund[21] The inhibition percent was calculated accordingto the following equation the percentage inhibition= [100 minus (119860

119905minminus1mLminus1 sample)(119860

119903minminus1mLminus1

reference)] times 100

233 Determination of Serum Triglycerides Triglyceride wasmeasured by themethod described in the commercial triglyc-erides kit purchased from Biodiagnostic Egypt [22]

Estimation of Brain and Serum Cholesterol The assay wascarried out according to the method of Watson using acommercial cholesterol kit purchased from BiodiagnosticEgypt [23]

234 Estimation of Low and High Density Lipoproteins (LDLand HDL) LDL and HDL were assayed according to Friede-wald et al and Lopes-Virella et al respectively using thecommercial kit [24 25]While VLDLwas calculated by usingthe following equation

VLDL (mgdL) =Blood triglyceride

5

(1)

235 Determination of SerumAST andALTEnzymes Aspar-tate aminotransferase (AST) and alanine aminotransferase(ALT) were assayed by the method described in the commer-cial ALT kit purchased from Biodiagnostic Egypt [26]

236 Sandwich ELISA for Quantification of Beta Amyloid 1-40 and 1-42 Rat amyloid beta peptide 1-40 and 1-42 (A120573 1-40and A120573 1-42) were assayed by the method described in thecommercial A120573 1-40 and A120573 1-42 ELISA kit purchased fromCusabio Biotech Co China The levels A120573 1-40 and A120573 1-42were measured by the enzyme-linked immunosorbent assay(ELISA) using the anti-rat amyloid beta peptide 1-40 or A1205731-42 precoated microplates (12 times 8 microwell strips)

237 Determination of Serum TNF120572 TNF120572 was measuredas described by the commercial TNF120572 ELISA kit purchasedfrom RayBiotech USA The TNF120572 level was determinedby the enzyme-linked immunosorbent assay (ELISA) usingthe anti-rat TNF120572 precoated microplates (12 times 8 microwellstrips)

238 Determination of Acetylcholinesterase (AChE) Activitywas measured according to Ellman et al [27]

239 Nitric Oxide Assay Nitric oxide level was estimatedaccording to Hummel et al [28]

2310 Monoamine Oxide (MAO) Assay 667 120583L of 500 120583Mp-tyramine and 133 120583L potassium phosphate buffer pH 76were added to 100 120583L brain liver supernatant or serum Theabsorbance was measured at 250 nm against air after 30 s and90 s The activity of MAO (UL) was calculated according toSandler et al [29] with the following equation

MAO Activity = Δ119860 times Total volume times 1000322 times Sample volume times 05

(2)

2311 Determination of Blood Retinol Binding Protein-4(RBP4) Level RBP4 was assayed according to the descrip-tion of the commercial RBP4 ELISA kit purchased fromRayBiotech USA using biotinylated RBP4 antibody andstreptavidin-peroxidase conjugateThe absorbance wasmon-itored on a microplate reader at a wavelength of 450 nmimmediately A standard curve was generated using theRBP4 standard concentrations on the 119909-axis against themean absorbance at 450 nm on the 119910-axis Unknown sampleconcentration was determined using the standard curve

2312 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis Total RNA was extracted from frozen tissuesusing TRIzol reagent (Invitrogen)The amount and quality ofRNA were assessed using a BioRad spectrophotometer andan Agilent 2100 Bioanalyzer To examine the mRNA levelscells were briefly washed twice with ice-cold RNase-free PBSTwo micrograms of RNA were reverse transcribed to cDNA(Ambion Austin TX) in 25120583L of total reaction volumePrimer sequences of the analyzed genes amyloid beta precur-sor protein (A120573PP) F GCAGAATGGAAAATGGGAGTCAG R AAT CAC GAT GTG GGT GTG CGT C and acetyl-cholinesterase (AChE) F TTC TCC CAC ACC TGT CCTCAT C R TTC ATA GAT ACC AAC ACG GTT CCC Theamplification was performed on a thermal cycler (AppliedBiosystems Foster City CA) with different conditions foreach gene The resulting products were visualized on agarosegelsThe intensity of the bands was quantified by the densito-meter (Imaging Research St Catharines Ontario Canada)and resulting data were normalized by using the corre-sponding GAPDH (F TACCCCACGGCAAGTTCAATGGR AGGGGCGGAGATGATGATGACCC)

24 Histopathology Sections of liver were fixed in 10 neu-tral buffered formalin for 48 h Specimens were dehydratedand embedded in paraffin sectioned and stained with hema-toxylin and eosin (HampE) for histopathological examination

25 Molecular Docking Berberine was docked into the crys-tal structures of acetylcholinesterase (AChE) (PDB code2CMF) and HMG-CoA reductase (PDB code 1HWK) Twoknown drugs were also docked including atorvastatin (statindrug HMG-CoA reductase inhibitor) and donepezil (AChEinhibitor) and used as reference for comparison to berberineAutoDock 30 [30] and MOE [31] software were used for

4 Evidence-Based Complementary and Alternative Medicine

Table 1 Mean levels of blood liver function tests and lipid profile in control NASH and berberine treated groups

Groups AST(UL) ALT (UL) ASTALT RBP-4

(pgL) TG mgdL CholesterolmgdL LDL mgdL VLDL

mgdL LDLHDLBrain

cholesterol(mgg)

Control 12 plusmn 12a 10 plusmn 04a 12 2005 plusmn 19a 56 plusmn 75a 70 plusmn 45b 40 plusmn 23b 11 plusmn 122b 267 90 plusmn 10a

Berberinecontrol 13 plusmn 21a 85 plusmn 032a 153 190 plusmn 20a 40 plusmn 23a 50 plusmn 23a 30 plusmn 21a 8 plusmn 21a 25 98 plusmn 12a

NASH 30 plusmn 32b 45 plusmn 42b 067 600 plusmn 76c 180 plusmn 23c 200 plusmn 23c 140 plusmn 10c 36 plusmn 31d 58 2387 plusmn 349c

Berberinetreatment 15 plusmn 25a 12 plusmn 42a 125 230 plusmn 85ab 70 plusmn 11ab 80 plusmn 67b 40 plusmn 55b 14 plusmn 21c 154 130 plusmn 99b

Values are reported as means plusmn SD of rat groups (10 rats each) with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

all docking calculations The AutoDockTools package wasemployed to generate the docking input files and to analyzethe docking results [30] A grid box size of 90 times 90 times 90points with a spacing of 0375 A between the grid pointswas generated that covered almost the entire protein surfaceLegends were fully flexibly docked All nonpolar hydrogensand crystallographic water molecules were removed priorto the calculations The docking grid was centered on themass center of the bound TSA In each case 100 dockedstructures were generated using genetic algorithm searchesA default protocol was appliedwith an initial population of 50randomly placed conformations amaximumnumber of 25times105 energy evaluations and a maximum number of 27 times 104generations A mutation rate of 002 and a crossover rate of08 were used Heavy atom comparison root mean squaredeviations (RMSD values) were calculated and initial ligandbinding modes were plotted Protein-ligand interaction plotswere generated using MOE 2012 [31]

26 Statistical Analysis Data are reported as the mean plusmnSD One-way analysis of variance (ANOVA) was followedby Student Newman-Keuls test which was provided by thePrimer Biostatistics program (Version 5) The differenceswere considered statistically significant at 119875 values lt 005

3 Results

In this study we used CCL4to induce NASH and to

investigate if there is any accompanied neurotoxicity effectHere we also studied the therapeutic effects of berberineon both NASH complications and its accompanied diseasesOurmeasurements focused on some biochemical parametersrelated to oxidative stress inflammation lipid profile liverfunction and neurotoxicity

31 The Effect of Berberine Treatment on NASH Biomarkersand Accompanied Dyslipidemia Liver injury and steatosiswere diagnosed by measuring the changes in the liverenzymes aspartate aminotransferase (AST) and alanineaminotransferase (ALT) and their ratio These enzymesrsquo levelwas significantly increased in the NASH induced groupcompared to the control group and the berberine treatedgroup giving ASTALT ratio lower than 1 (067) (Table 1)

Furthermore we measured the serum retinol-binding pro-tein 4 (RBP-4) levels as an indicator marker for the severityof steatosis and NASH progress The NASH group had asignificant increase in the RBP-4 levels compared to thecontrol and the berberine treated group (Table 1) NASHinduced group showed a remarkable dyslipidemia Thiswas manifested by the significant increase in the bloodtriglycerides LDL VLDL LDLHDL ratio and cholesterollevels Upon berberine treatment a significant reduction inthe blood triglycerides LDL VLDL LDLHDL ratio andcholesterol levels was observed compared to theNASH group(Table 1) Furthermore a marked increase in the cholesterolconcentration in the brain tissue in the NASH induced groupwas compared to the control group Around a 54 decreasein the brain cholesterol level in the berberine-treated groupwas compared to the NASH induced group

32 The Effect of Berberine on Antioxidant Capacity andAssociated Inflammation In the NASH induced group theproduction rate of thiobarbituric acid-reactive substances(TBARS) in the serum and brain tissue samples was signif-icantly increased in the blood samples reflecting the increasein the lipid peroxidation Moreover a marked decrease in thelevels of the blood endogenous antioxidant markers such asGPx SOD and GSH was observed in the NASH inducedgroup (Table 2) In contrast the berberine treated groupshowed a significant increase in the antioxidant systemwhichis accompanied by a marked decrease in the TBARS Theresults of the berberine treated group are similar to that ofthe berberine vehicle group and control group The level ofthe blood xanthine oxidase also revealed 28-fold increasein the NASH induced group relative to the control groupThis increase in the xanthine oxidase was reversed in theberberine treated group giving value similar to that of thecontrol group Also the data in the brain tissues of the NASHgroup revealed a marked increase in the TBARS and 15-foldincrease in the xanthine oxidase with a significant decreasein the antioxidant markers (Table 3 Figure 1) Berberinetreatment decrease the lipid peroxidation and increase theantioxidant parameters in the brain tissues (Figure 1) Ourdata also showed a significant increase in tumor necrosisfactor (TNF120572) which markedly decreased after berberinetreatment giving results similar to that of the control group

Evidence-Based Complementary and Alternative Medicine 5

Table 2 Mean levels of serum oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARSnmolmL

XO(120583Mhour)

GPx(IU) SOD (IU) GSH

(mgdL)TNF-alpha(pgL)

NO(nmolemL)

Control 23 plusmn 02b 134 plusmn 16a 72 plusmn 05c 34 plusmn 02b 32 plusmn 03b 87 plusmn 12a 93 plusmn 31b

Berberine control 15 plusmn 01a 121 plusmn 22a 91 plusmn 05d 41 plusmn 02c 4 plusmn 01c 76 plusmn 96a 5 plusmn 09a

NASH group 10 plusmn 12d 372 plusmn 52b 42 plusmn 02a 21 plusmn 01a 14 plusmn 02a 500 plusmn 45c 30 plusmn 72c

Berberinetreatment 5 plusmn 09c 132 plusmn 42a 61 plusmn 02b 31 plusmn 05b 32 plusmn 02b 150 plusmn 30b 103 plusmn 23b

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 3 Mean levels of brain oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARS(nMmL) XO (120583Mhour) GPx

(IU)SOD(IU) GSH (mgdL) TNF-alpha

(pgL)NO

(nmolemL)Control 125 plusmn 12a 82 plusmn 09a 002 plusmn 0001b 82 plusmn 007c 21 plusmn 21b 605 plusmn 35b 56 plusmn 05a

Berberine control 101 plusmn 21a 75 plusmn 04a 002 plusmn 0001b 99 plusmn 05d 34 plusmn 23c 504 plusmn 62a 43 plusmn 06a

NASH group 305 plusmn 31c 123 plusmn 06c 001 plusmn 0007a 21 plusmn 004a 64 plusmn 07a 205 plusmn 125c 541 plusmn 2d

Berberine treatment 146 plusmn 19ab 101 plusmn 09b 0019 plusmn 00001b 73 plusmn 02b 201 plusmn 065b 89 plusmn 101c 115 plusmn 1c

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

a ac

ab

c d

ab

b

c

a

b

05

10152025303540

Valu

es

BC NASH BtC

Figure 1 Effect of berberine treatment on the changes in brainoxidative stress factors of different rat groups C control group BCberberine control group NASH the CCL

4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine The

figure shows the data of GSH (black bars) SOD (dotted white bars)and TBARS (gray bars)

Moreover the NASH induced group showed around three-fold increase in the nitric oxide level which significantlydecreases to value similar to that of the control group uponberberine treatment

33 NASH Induction and Its Related Hyperglycemia andHyperinsulinemia The blood glucose concentration was sig-nificantly increased from 78mgdL in the control group to180mgdL in the NASH induced group reflecting hyper-glycemia in the NASH induced group The berberine con-trol group showed a slight decrease in the blood glucoselevel compared to the control group (Table 4) Furthermoretwofold increase in the blood insulin level (20 pgL) inthe NASH induced group was compared to the control

group (102 pgL) suggesting hyperinsulinemia in the NASHinduced group Upon berberine treatment the blood insulinlevel was returned back to a value of 101 pgL which is similarto the control groupThe calculatedHOMA-IR wasmarkedlydecreased from 89 to 22 upon berberine treatment Inthe brain tissues of NASH group a significant reduction inthe glucose with around 3-fold increase in the insulin wasobserved Berberine treatment reduced both the glucose andinsulin levels in the brain tissues (Table 4)

34 NASH Triggers Neurotoxicity In blood and brain sam-ples the NASH induced group showed a significant increasein the AChE activity compared to the control group (Table 5)Moreover around 15- and 25-fold increase in the MAOactivity in the blood and brain tissues of the NASH inducedgroup was compared to the control group respectivelyBerberine treatment markedly decreases the AChE andMAO activity in both blood and brain tissues (Table 5) Amarked increase in the 120573-amyloid (A120573

42) and decrease in the

A12057340

were observed in the brain tissues of NASH inducedrats Upon berberine treatment the 120573-amyloid (A120573

42) level

was decreased while A12057340

increased to values similar tothat of the control group Furthermore IDE activity wasdecreased in the NASH induced group but it was returnedback to a value similar to that of the control by berber-ine treatment (Table 5 Figure 2) To investigate the long-term effects of NASH on genes and proteins that can beupregulated during neurotoxicity induction we measuredamyloid-120573-precursor protein (A120573PP) and AChE mRNA lev-els by qRT-PCR analysis Here we used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 Evidence-Based Complementary and Alternative Medicine

Table 1 Mean levels of blood liver function tests and lipid profile in control NASH and berberine treated groups

Groups AST(UL) ALT (UL) ASTALT RBP-4

(pgL) TG mgdL CholesterolmgdL LDL mgdL VLDL

mgdL LDLHDLBrain

cholesterol(mgg)

Control 12 plusmn 12a 10 plusmn 04a 12 2005 plusmn 19a 56 plusmn 75a 70 plusmn 45b 40 plusmn 23b 11 plusmn 122b 267 90 plusmn 10a

Berberinecontrol 13 plusmn 21a 85 plusmn 032a 153 190 plusmn 20a 40 plusmn 23a 50 plusmn 23a 30 plusmn 21a 8 plusmn 21a 25 98 plusmn 12a

NASH 30 plusmn 32b 45 plusmn 42b 067 600 plusmn 76c 180 plusmn 23c 200 plusmn 23c 140 plusmn 10c 36 plusmn 31d 58 2387 plusmn 349c

Berberinetreatment 15 plusmn 25a 12 plusmn 42a 125 230 plusmn 85ab 70 plusmn 11ab 80 plusmn 67b 40 plusmn 55b 14 plusmn 21c 154 130 plusmn 99b

Values are reported as means plusmn SD of rat groups (10 rats each) with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

all docking calculations The AutoDockTools package wasemployed to generate the docking input files and to analyzethe docking results [30] A grid box size of 90 times 90 times 90points with a spacing of 0375 A between the grid pointswas generated that covered almost the entire protein surfaceLegends were fully flexibly docked All nonpolar hydrogensand crystallographic water molecules were removed priorto the calculations The docking grid was centered on themass center of the bound TSA In each case 100 dockedstructures were generated using genetic algorithm searchesA default protocol was appliedwith an initial population of 50randomly placed conformations amaximumnumber of 25times105 energy evaluations and a maximum number of 27 times 104generations A mutation rate of 002 and a crossover rate of08 were used Heavy atom comparison root mean squaredeviations (RMSD values) were calculated and initial ligandbinding modes were plotted Protein-ligand interaction plotswere generated using MOE 2012 [31]

26 Statistical Analysis Data are reported as the mean plusmnSD One-way analysis of variance (ANOVA) was followedby Student Newman-Keuls test which was provided by thePrimer Biostatistics program (Version 5) The differenceswere considered statistically significant at 119875 values lt 005

3 Results

In this study we used CCL4to induce NASH and to

investigate if there is any accompanied neurotoxicity effectHere we also studied the therapeutic effects of berberineon both NASH complications and its accompanied diseasesOurmeasurements focused on some biochemical parametersrelated to oxidative stress inflammation lipid profile liverfunction and neurotoxicity

31 The Effect of Berberine Treatment on NASH Biomarkersand Accompanied Dyslipidemia Liver injury and steatosiswere diagnosed by measuring the changes in the liverenzymes aspartate aminotransferase (AST) and alanineaminotransferase (ALT) and their ratio These enzymesrsquo levelwas significantly increased in the NASH induced groupcompared to the control group and the berberine treatedgroup giving ASTALT ratio lower than 1 (067) (Table 1)

Furthermore we measured the serum retinol-binding pro-tein 4 (RBP-4) levels as an indicator marker for the severityof steatosis and NASH progress The NASH group had asignificant increase in the RBP-4 levels compared to thecontrol and the berberine treated group (Table 1) NASHinduced group showed a remarkable dyslipidemia Thiswas manifested by the significant increase in the bloodtriglycerides LDL VLDL LDLHDL ratio and cholesterollevels Upon berberine treatment a significant reduction inthe blood triglycerides LDL VLDL LDLHDL ratio andcholesterol levels was observed compared to theNASH group(Table 1) Furthermore a marked increase in the cholesterolconcentration in the brain tissue in the NASH induced groupwas compared to the control group Around a 54 decreasein the brain cholesterol level in the berberine-treated groupwas compared to the NASH induced group

32 The Effect of Berberine on Antioxidant Capacity andAssociated Inflammation In the NASH induced group theproduction rate of thiobarbituric acid-reactive substances(TBARS) in the serum and brain tissue samples was signif-icantly increased in the blood samples reflecting the increasein the lipid peroxidation Moreover a marked decrease in thelevels of the blood endogenous antioxidant markers such asGPx SOD and GSH was observed in the NASH inducedgroup (Table 2) In contrast the berberine treated groupshowed a significant increase in the antioxidant systemwhichis accompanied by a marked decrease in the TBARS Theresults of the berberine treated group are similar to that ofthe berberine vehicle group and control group The level ofthe blood xanthine oxidase also revealed 28-fold increasein the NASH induced group relative to the control groupThis increase in the xanthine oxidase was reversed in theberberine treated group giving value similar to that of thecontrol group Also the data in the brain tissues of the NASHgroup revealed a marked increase in the TBARS and 15-foldincrease in the xanthine oxidase with a significant decreasein the antioxidant markers (Table 3 Figure 1) Berberinetreatment decrease the lipid peroxidation and increase theantioxidant parameters in the brain tissues (Figure 1) Ourdata also showed a significant increase in tumor necrosisfactor (TNF120572) which markedly decreased after berberinetreatment giving results similar to that of the control group

Evidence-Based Complementary and Alternative Medicine 5

Table 2 Mean levels of serum oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARSnmolmL

XO(120583Mhour)

GPx(IU) SOD (IU) GSH

(mgdL)TNF-alpha(pgL)

NO(nmolemL)

Control 23 plusmn 02b 134 plusmn 16a 72 plusmn 05c 34 plusmn 02b 32 plusmn 03b 87 plusmn 12a 93 plusmn 31b

Berberine control 15 plusmn 01a 121 plusmn 22a 91 plusmn 05d 41 plusmn 02c 4 plusmn 01c 76 plusmn 96a 5 plusmn 09a

NASH group 10 plusmn 12d 372 plusmn 52b 42 plusmn 02a 21 plusmn 01a 14 plusmn 02a 500 plusmn 45c 30 plusmn 72c

Berberinetreatment 5 plusmn 09c 132 plusmn 42a 61 plusmn 02b 31 plusmn 05b 32 plusmn 02b 150 plusmn 30b 103 plusmn 23b

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 3 Mean levels of brain oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARS(nMmL) XO (120583Mhour) GPx

(IU)SOD(IU) GSH (mgdL) TNF-alpha

(pgL)NO

(nmolemL)Control 125 plusmn 12a 82 plusmn 09a 002 plusmn 0001b 82 plusmn 007c 21 plusmn 21b 605 plusmn 35b 56 plusmn 05a

Berberine control 101 plusmn 21a 75 plusmn 04a 002 plusmn 0001b 99 plusmn 05d 34 plusmn 23c 504 plusmn 62a 43 plusmn 06a

NASH group 305 plusmn 31c 123 plusmn 06c 001 plusmn 0007a 21 plusmn 004a 64 plusmn 07a 205 plusmn 125c 541 plusmn 2d

Berberine treatment 146 plusmn 19ab 101 plusmn 09b 0019 plusmn 00001b 73 plusmn 02b 201 plusmn 065b 89 plusmn 101c 115 plusmn 1c

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

a ac

ab

c d

ab

b

c

a

b

05

10152025303540

Valu

es

BC NASH BtC

Figure 1 Effect of berberine treatment on the changes in brainoxidative stress factors of different rat groups C control group BCberberine control group NASH the CCL

4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine The

figure shows the data of GSH (black bars) SOD (dotted white bars)and TBARS (gray bars)

Moreover the NASH induced group showed around three-fold increase in the nitric oxide level which significantlydecreases to value similar to that of the control group uponberberine treatment

33 NASH Induction and Its Related Hyperglycemia andHyperinsulinemia The blood glucose concentration was sig-nificantly increased from 78mgdL in the control group to180mgdL in the NASH induced group reflecting hyper-glycemia in the NASH induced group The berberine con-trol group showed a slight decrease in the blood glucoselevel compared to the control group (Table 4) Furthermoretwofold increase in the blood insulin level (20 pgL) inthe NASH induced group was compared to the control

group (102 pgL) suggesting hyperinsulinemia in the NASHinduced group Upon berberine treatment the blood insulinlevel was returned back to a value of 101 pgL which is similarto the control groupThe calculatedHOMA-IR wasmarkedlydecreased from 89 to 22 upon berberine treatment Inthe brain tissues of NASH group a significant reduction inthe glucose with around 3-fold increase in the insulin wasobserved Berberine treatment reduced both the glucose andinsulin levels in the brain tissues (Table 4)

34 NASH Triggers Neurotoxicity In blood and brain sam-ples the NASH induced group showed a significant increasein the AChE activity compared to the control group (Table 5)Moreover around 15- and 25-fold increase in the MAOactivity in the blood and brain tissues of the NASH inducedgroup was compared to the control group respectivelyBerberine treatment markedly decreases the AChE andMAO activity in both blood and brain tissues (Table 5) Amarked increase in the 120573-amyloid (A120573

42) and decrease in the

A12057340

were observed in the brain tissues of NASH inducedrats Upon berberine treatment the 120573-amyloid (A120573

42) level

was decreased while A12057340

increased to values similar tothat of the control group Furthermore IDE activity wasdecreased in the NASH induced group but it was returnedback to a value similar to that of the control by berber-ine treatment (Table 5 Figure 2) To investigate the long-term effects of NASH on genes and proteins that can beupregulated during neurotoxicity induction we measuredamyloid-120573-precursor protein (A120573PP) and AChE mRNA lev-els by qRT-PCR analysis Here we used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 5

Table 2 Mean levels of serum oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARSnmolmL

XO(120583Mhour)

GPx(IU) SOD (IU) GSH

(mgdL)TNF-alpha(pgL)

NO(nmolemL)

Control 23 plusmn 02b 134 plusmn 16a 72 plusmn 05c 34 plusmn 02b 32 plusmn 03b 87 plusmn 12a 93 plusmn 31b

Berberine control 15 plusmn 01a 121 plusmn 22a 91 plusmn 05d 41 plusmn 02c 4 plusmn 01c 76 plusmn 96a 5 plusmn 09a

NASH group 10 plusmn 12d 372 plusmn 52b 42 plusmn 02a 21 plusmn 01a 14 plusmn 02a 500 plusmn 45c 30 plusmn 72c

Berberinetreatment 5 plusmn 09c 132 plusmn 42a 61 plusmn 02b 31 plusmn 05b 32 plusmn 02b 150 plusmn 30b 103 plusmn 23b

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 3 Mean levels of brain oxidative stress and proinflammatory parameters in control NASH and berberine treated groups

Groups TBARS(nMmL) XO (120583Mhour) GPx

(IU)SOD(IU) GSH (mgdL) TNF-alpha

(pgL)NO

(nmolemL)Control 125 plusmn 12a 82 plusmn 09a 002 plusmn 0001b 82 plusmn 007c 21 plusmn 21b 605 plusmn 35b 56 plusmn 05a

Berberine control 101 plusmn 21a 75 plusmn 04a 002 plusmn 0001b 99 plusmn 05d 34 plusmn 23c 504 plusmn 62a 43 plusmn 06a

NASH group 305 plusmn 31c 123 plusmn 06c 001 plusmn 0007a 21 plusmn 004a 64 plusmn 07a 205 plusmn 125c 541 plusmn 2d

Berberine treatment 146 plusmn 19ab 101 plusmn 09b 0019 plusmn 00001b 73 plusmn 02b 201 plusmn 065b 89 plusmn 101c 115 plusmn 1c

Values are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

a ac

ab

c d

ab

b

c

a

b

05

10152025303540

Valu

es

BC NASH BtC

Figure 1 Effect of berberine treatment on the changes in brainoxidative stress factors of different rat groups C control group BCberberine control group NASH the CCL

4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine The

figure shows the data of GSH (black bars) SOD (dotted white bars)and TBARS (gray bars)

Moreover the NASH induced group showed around three-fold increase in the nitric oxide level which significantlydecreases to value similar to that of the control group uponberberine treatment

33 NASH Induction and Its Related Hyperglycemia andHyperinsulinemia The blood glucose concentration was sig-nificantly increased from 78mgdL in the control group to180mgdL in the NASH induced group reflecting hyper-glycemia in the NASH induced group The berberine con-trol group showed a slight decrease in the blood glucoselevel compared to the control group (Table 4) Furthermoretwofold increase in the blood insulin level (20 pgL) inthe NASH induced group was compared to the control

group (102 pgL) suggesting hyperinsulinemia in the NASHinduced group Upon berberine treatment the blood insulinlevel was returned back to a value of 101 pgL which is similarto the control groupThe calculatedHOMA-IR wasmarkedlydecreased from 89 to 22 upon berberine treatment Inthe brain tissues of NASH group a significant reduction inthe glucose with around 3-fold increase in the insulin wasobserved Berberine treatment reduced both the glucose andinsulin levels in the brain tissues (Table 4)

34 NASH Triggers Neurotoxicity In blood and brain sam-ples the NASH induced group showed a significant increasein the AChE activity compared to the control group (Table 5)Moreover around 15- and 25-fold increase in the MAOactivity in the blood and brain tissues of the NASH inducedgroup was compared to the control group respectivelyBerberine treatment markedly decreases the AChE andMAO activity in both blood and brain tissues (Table 5) Amarked increase in the 120573-amyloid (A120573

42) and decrease in the

A12057340

were observed in the brain tissues of NASH inducedrats Upon berberine treatment the 120573-amyloid (A120573

42) level

was decreased while A12057340

increased to values similar tothat of the control group Furthermore IDE activity wasdecreased in the NASH induced group but it was returnedback to a value similar to that of the control by berber-ine treatment (Table 5 Figure 2) To investigate the long-term effects of NASH on genes and proteins that can beupregulated during neurotoxicity induction we measuredamyloid-120573-precursor protein (A120573PP) and AChE mRNA lev-els by qRT-PCR analysis Here we used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a housekeeping gene

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 Evidence-Based Complementary and Alternative Medicine

Table 4 Mean levels of insulin and glucose levels in the blood and brain tissues in control NASH and berberine treated groups

Groups InsulinA (pgL) GlucoseA (mgdL) HOMA-IRA InsulinB (pgl0 g) GlucoseB (mg10 g)Control 102 plusmn 11a 78 plusmn 29b 19 plusmn 0007b 35 plusmn 02a 53 plusmn 04b

Berberine control 99 plusmn 02a 60 plusmn 32a 15 plusmn 0009a 32 plusmn 02a 51 plusmn 01b

NASH group 20 plusmn 19b 180 plusmn 12d 89 plusmn 01d 102 plusmn 09c 12 plusmn 02a

Berberine treatment 101 plusmn 07a 90 plusmn 84c 22 plusmn 0004c 49 plusmn 01b 53 plusmn 05b

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

Table 5 Mean levels of brain parameters in control NASH and berberine treated groups

Groups AChEA (liter molesminminus1mLminus1) MAOA (IU) 120573-amyloidB

A12057340

(pmolL)

AChEB

(liter molesminminus1 gminus1)

MAOB

(IUmg)120573-amyloidB

A12057340(pmolL) IDEB

Control 43 plusmn 21b 82 plusmn 11b 56 plusmn 08b 355 plusmn 311a 31 plusmn 03a 50 plusmn 65b 306 plusmn 253b

Berberine control 36 plusmn 21a 43 plusmn 09a 6 plusmn 01b 306 plusmn 21a 32 plusmn 04a 23 plusmn 34a 32 plusmn 394b

NASH group 98 plusmn 12d 12 plusmn 3c 21 plusmn 01a 898 plusmn 12c 81 plusmn 09c 120 plusmn 22d 22 plusmn 09a

Berberine treatment 55 plusmn 75c 9 plusmn 11b 63 plusmn 09b 550 plusmn 75b 43 plusmn 05b 70 plusmn 19c 293 plusmn 27a

The superscript letter A the parameters that were measured in the bloodThe superscript letter B the parameters that were measured in the brain tissuesValues are reported as means plusmn SD of rat groups with different degrees of significance at 119875 lt 005aLowest value of significancedHighest value of significanceIf two groups have the same letters it means no significant difference is detected

b b

a

b b ba a

a

c a bc c

c

ad

ab b

b

b c a

IDE

(pg

g)

120573-A

myl

oid

A12057340

(pg

g)

120573-A

myl

oid

A12057342

(pg

g)

AChE

(L m

oles

m

inminus1

gminus1)

LDL

(mg

dL)

(mg

dL)

Chol

este

rol0

100200300400500600700800900

1000

Valu

es

Figure 2 Effect of berberine treatment on serum cholesterol LDLand brain tissue AChE A120573

40 A12057342 and IDE C control group BC

berberine control group NASH the CCL4-NASH induced group

and Bt the CCl4-NASH induced group treated with berberine

Control group (gray bars) berberine control group (white bars)NASH induced group (black bars) and NASH induced grouptreated with berberine (dotted gray bars)

The RT-PCR studies demonstrated that NASH inductionincreased the expression of A120573PP gene and AChE gene Incontrast berberine treatment showed a significant decreasein the expression of both genes (Figure 3)

35Histopathology of Liver Tissues Histopathological studiesshowed that the liver of treated rats with CCL

4revealed

a NASH pathology with ballooning lobular inflammation

typically localized in acinar zone which contained obviousfat droplets with obvious necrosis and inflammation Therewere mixed patterns of macrovesicular hepatic steatosiswith the conspicuous disorganization of the hepatic cordarchitecture with scattered foci of hepatocellular necrosis(Figure 4(b)) Berberine administration for NASH groupshowed disappearance of necrosis and inflammation sites andthe statuses decreased from moderate to mild grade withreduced necrotic and macrovesicular structure (Figure 4(d))

36 Molecular Docking Analysis Here we used moleculardocking to compare the binding of berberine andHMG-CoAreductase inhibitor (atorvastatin) to HMG-CoA reductaseMoreover we also conducted the molecular docking analysisto compare the binding of berberine and an AChE inhibitor(donepezil) to AChE 2D ligands molecular properties werecalculated that accounted for several characteristics includ-ing flexibility (number of rotatable bonds) polarity (totalpolar surface area) and hydrophobicity (VDW surface area)The comparison is reported in (Figure 5) and showed a fulloverview about the binding chemistry of these compoundsThis analysis revealed that berberine is less flexible and morerigid in structure than the known drugs donepezil andatorvastatinHowever it has comparable propertieswhich areconsistent with its observed activity

361 Berberine Binding Mode to AChE in Comparisonwith Donepezil as a Reference Drug The structure of theAChE enzyme shows dual binding sites for inhibitors

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 7

a a

b

a

ba

c

a

BC NASH BtCGroups

0102030405060708090

Valu

es

(a)

123

199

495

(bp) 1 2 3 4 5 6 7 8

Control Berberine Steatosis Berberine treated

AChE

APP

GAPDH

(b)

Figure 3 RT-PCR analysis of AChE and APP expression The expression level of APP (a)The relative expression of mRNA to housekeepinggene C control group BC berberine control group NASH the CCL

4-NASH induced group and Bt the CCL

4-NASH induced group treated

with berberine APP (gray bars) and AChE (back bars) (b) gel electrophoresis of cDNA of the two genes

(a) (b)

(c) (d)

Figure 4 Light microscope examination of liver tissues photomicrograph of liver sections of the different groups using (HampE 40xmagnification) (a) section of the liver tissue of control group showed normal hepatic cells radiating around the central vein (Cv) and separatedby sinusoids (S) (b) In theCCL

4-NASH induced group the liver had hepatic cells radiating around the central vein (Cv) separated by sinusoids

(S) and the black arrows refer to inflammatory reaction with polymorphonuclear leukocytes surrounding hepatocytes (c) Section of livertissue of berberine control group showed a normal histological structure of the hepatic cords sinusoids (S) and central vein (Cv) (d) TheCCL4-NASH induced group treated with berberine had liver with little vacuolation of hepatocytes and central veins with RBCs (black arrow)

the peripheral binding site and the catalytic binding site PBSand CBS respectively Usually all AChE inhibitors consistof two moieties representing different pharmacophores thatare linked by an appropriate chain to simultaneously bindto both the peripheral and catalytic sites (PBS and CBS) ofAChE The PBS and CBS are separated by about 14 A andlocated at the mouth and the bottom of the gorge of AChErespectively Berberine and the known drug donepezil weredocked and compared (Figure 6) The isoquinoline moiety

of berberine adopted an appropriate orientation to forma 120587-120587 stacking (hydrophobic aromatic) with the benzenering of Tyr334 in PBS pocket In addition hydrophobicinteractions were formed between the benzodioxole part ofberberine and the backbone Phe330 The remaining part ofberberine also interacted with Tyr121 and Phe330 resemblingthe reference ligand donepezil (Figures 6(a) 6(b) and 6(c))Thus berberine might have a binding mode similar to that ofdonepezil

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

8 Evidence-Based Complementary and Alternative Medicine

6

334 40

412

2561

40

41

13

4168

11467

Valu

es

DonepezilBerberineAtorvastatin

VSA_hyd TPSAb_rotNDescriptors

Log P

Figure 5 Calculated 2D compound properties of berberine com-pared to reference drugs here is the reports of 2D molecularanalysis of the three compounds donepezil berberine and atorvas-tatin showing different parameters controlling their activity TPSA(topological polar surface area) Log119875 values (reflect the overalllipophilicity) b rotN (number of rotatable bonds) and VSA hyd(approximation to the sum of VDW surface of the hydrophobicatoms)

362 Berberine Binding Mode to HMG-CoA Reductase Com-pared to Atorvastatin as Reference Drug Here we havestudied the putative binding mode of berberine in theactive site of HMG-CoA enzyme via molecular docking incomparison to atorvastatin (Figure 7) In the X-ray structureof the HMG-CoA reductaseatorvastatin complex the ligandforms two strong hydrogen bonding interactions through analiphatic hydroxyl group with residues Asn755 and Glu559respectively and additional hydrogen bonding interactionsthrough the terminal carboxyl group and amide carbonylwith Lys735 and Ser565 Docking of berberine showedthat similar mode of binding could be exhibited throughthe dioxole ring moiety with Ser684 Lys735 and Lys692residues by stable hydrogen-bonding interactions Additionalaromatic hydrophobic interaction might be formed via thebenzodioxole fragment with Arg590 amino acid (Figures7(a) 7(b) and 7(c)) Thus berberine might adopt a bindingmode similar to atorvastatin that enhances working by thesame mechanism

4 Discussion

Steatohepatitis is recognized as one of the major causes ofchronic liver diseases which is characterized by elevated liverenzymes It was reported that NASH is associated with somemetabolic disorders including dyslipidemia and Alzheimer-like disease pathogenesis [16] In our study we tried to inves-tigate two main aims first to speculate the mechanism bywhich NASH progression can trigger neurotoxicity secondto investigate the therapeutic effects of berberine againstNASH complications and the developed neurotoxicity

Our study demonstrated that berberine treatment seemedto improve liver function through rebalanced lipid metab-olism attenuated inflammation and oxidative stress Ourresults are consistent with a recent study that revealed thatberberine has a potent hepatoprotective effect as well as anti-inflammatory effect against NASH [11] Furthermore ourdata is consistent with what has been reported that berberinehas a protective effect against CCL

4-induced liver injury and

hepatotoxicity [32] In our study The protective effect ofberberine against liver injury in NASH was manifested bylowering the blood levels of ALT and AST These enzymesare considered as screening tools of liver damage and inflam-mation Generally the ratio ASTALT exceeds 1 with thecirrhosis development [33] In our study berberine treatmentlowered the ASTALT ratio to be less than 1 suggestingits protective effect Berberine treatment also lowered thelevel of the retinol binding protein-4 (RBP4) compared withthe untreated group RBP4 is the specific carrier protein ofretinol in the blood and it is mainly synthesized in liverIt was shown that RBP4 is significantly elevated in severand moderate NASH compared to mild NASH [34] Thusit was used as a good biomarker in many liver diseases Inagreement with the previous results berberine improved theliver histopathology and demonstrated a reduction in theinflammation and necrosis in the tissues

In this study berberine exerted antilipemic effect Thiseffect was manifested by lowering the total cholesterol LDLtriglycerides and LDLHDL ratio Our docking analysisshowed that berberine might have a similar HMG-CoAreductase binding characteristic to atorvastatin (HMG-CoAreductase inhibitor) Hence the antilipemic effect of berber-ine is probably due to its inhibitory activity on HMG-CoA reductase It was reported that HMG-CoA reductaseinhibitors were effective in managing hyperlipidemia and itsassociated diseases such as coronary artery diseases [35] Theantilipemic effect of these inhibitors was manifested throughlowering the level of total cholesterol and LDL-cholesterol[35] However all statins have risk to cause rhabdomyolysisat high doses [36] Hence a natural HMG-CoA reductaseinhibitor or a combination between low dose of statins and anatural HMG-CoA reductase inhibitor will be a helpful alter-native therapy Recently it has been supported that berberinehas antioxidant activity [37] Our results also demonstratedthe antioxidant capacity of berberine through the reductionin the TBARS level and the increase in the antioxidantsystemparameters such asGSH and SOD Taken together thetherapeutic effect of berberine against the NASH-associatedhyperlipidemia which observed in our study is probably dueto a combined effect of its inhibitory activity of HMG-CoAreductase and its antioxidant capacity

Furthermore oxidative stress is frequently stated to be acentral mechanism of hepatocellular injury in NASH Herethe oxidative stress in the brain tissue plays a significant rolein neurotoxicity Here we observed that the increase in theoxidative stress was associated with an increase in the level ofTNF120572 It was shown that lipid accumulation is a potent causeof increased generation of oxidative stress and subsequentexpression of proinflammatory cytokines such as TNF120572 andIL-6 [38] In the literature TNF120572 is considered as a key

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 9

O

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

(a)

O

O

O

Tyr70

Asp72

Trp84

Gly117

Gly118

Tyr121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334 His

440

+NH

(b)

O

O

OO

OO

O

Tyr70

Asp72

Trp84Tyr

121

Glu199

Trp279

Leu282

Ser286Ile

287

Phe288

Arg289

Phe290

Phe330

Phe331

Tyr334

His440

N+

+NH

(c)

Figure 6 Structural models of berberine as AChEI three plots are represented (a) proposed binding mode of berberine in the active siteof AChE (b) docking model of reference drug donepezil (c) comparison of putative binding modes of both berberine (red) and donepezil(green)

cytokine that has the ability to start the inflammatory cascadeThus in our study we focused to measure this cytokine andto investigate its role in the development of neurotoxicity Itwas reported that the increase in TNF120572 is associated withthe pathogenesis of Alzheimer disease (AD) [39] Here theincreased level of TNF120572 was associated with increase in theexpression of A120573PP gene in the NASH induced group Thebeta amyloid peptides can play various physiological andpathological roles depending on the path of its formationNormally A120573 is produced from amyloid precursor protein

(APP) under the action of 120573 and 120574-secretases via the mecha-nism of intramembrane proteolysis It was reported that theoxidative stress induced by different agents increasedA120573 pro-duction in cell culture [40] The increase in the A120573

42and the

decrease in the A12057340were indicated in the AD pathogenesis

Taken together the observed increase in the A120573PP and itsproteolysis product A120573

42in our study is probably due to the

effect of both of the increased oxidative stress and TNF120572Hence the anti-inflammatory and the antioxidant activitiesof berberine resulted in a significant decrease in the TNF120572

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

10 Evidence-Based Complementary and Alternative Medicine

O

OO

O

Arg

Ser

Asn

Asp

Lys

Glu

Lys

Ala

Leu

Ala

Leu

N+

B559

B735

B751

B853

B856

B857

A692

A690

A686

A684

A590

(a)

F

O

ON

N

OOHH

HArg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

Ser

Arg

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

H2O

Ominus

B559

B560

B561

B562

B565

B56

B735

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(b)

F

O

ON N

OOHH

H

O

O

O

O

Arg

Ser

Val

Ser

Asn

Asp Lys

LysGlu

Gly

Cys

Leu

SerB565

ArgB568

Lys

Ala

His

Asn

Ser

Leu

Ala Leu

N+

H2O

Ominus

B559

B560

B561

B735

B562

B751

B752

B755

B852

B853

B856 B857

A692

A691A690

A686

A684

A683

A661

A590

(c)Figure 7 Structural models of berberine as HMG-CoA reductase inhibitor three plots are represented (a) proposed binding mode ofberberine in the active site of HMG-CoA (b) atorvastatin bound to crystal structure of HMG-CoA reductase (c) comparison of putativebinding modes of both berberine (red) and atorvastatin (green)

and the consequent decrease in the A120573PP and A12057342

whichwas associated with an increase in the A120573

40level Our results

supported the synergistic interaction between dyslipidemiadisorders and oxidative stress in increasing the risk factorsfor the neurotoxicity and the onset of Alzheimer-like diseasepathogenesis

Also our results showed that the defect in the lipidand cholesterol metabolism was associated with upregula-tion of the AChE and APP genes expression which mayspeculate their role in neuronal and synaptic impairmentBerberine treatment showed a potential inhibitory activityagainst AChE activity Thus it can act as acetylcholinesteraseinhibitor (AChEI) providing a novel therapeutic agentagainst the diseases in which a higher acetylcholinesterase

activity is indicated such as Alzheimerrsquos disease pathogenesisOur docking analysis supports our biochemical analysisbecause it showed that berberine can bind to AChE in asimilar manner to that of donepezil It was shown thatacetylcholine decreased the release of the proinflammatorycytokine [41] Thus the AChE inhibitory activity of berberinewill share in part in its anti-inflammatory activity It wasdemonstrated that statins limit the amyloidogenic pathwayvia inhibiting the dimerization of 120573-secretase [42] Furtherstatins improved dyslipidemia and inhibited the productionof A120573 by disrupting secretase enzyme function and reducingneuroinflammation [43] Thus the inhibitory activity ofberberine againstHMG-CoA reductasemight also have a rolein the improvement of Alzheimer-like pathology

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 11

It was reported that obesity develops insulin resistance[44] Thus the observed hyperlipidemia in our study is oneof the causes of the observed hyperglycemia and hyperin-sulinemia Furthermore many studies suggested that TNF120572is one of the major causes of insulin resistance It wasalso shown that anti-TNF120572 treatment decreases the insulinresistance in type II diabetes mellitus [45] Having said thatthe observed hyperglycemia and hyperinsulinemia in ourstudy resulted from both effects of hyperlipidemia and thehigh TNF120572 in the NASH induced group thus the antilipemicand anti-inflammatory effects of berberine attenuated thehyperglycemia and hyperinsulinemia which are observed inthe NASH induced group Also it was reported that hyper-insulinemia significantly increased the risk for Alzheimerdisease [46] Our study revealed a significant decrease forinsulin-degrading enzyme (IDE) activity in the hippocampusof NASH induced rats accompanied with decreased solublenontoxic antiamyloidgenic agent A120573

40 IDE cleaves small

proteins such as amyloid 120573-protein (A120573) and insulin Thusthe amyloid accumulation in the NASH induced group isenhanced by limiting A120573 degradation via decreasing theinsulin sensitivity which in turn competes for the IDE sitesand impairs aggregated amyloids clearance

Furthermore the significant increase in NO in our studyis considered as one of the risk factors for Alzheimer-likedisease development Our suggestion is supported by Fer-nandez et al who showed that NO is one of the factors thatis involved in the AD progression [47] They suggested thatNOS inhibitors will be beneficial in the AD treatment Itwas reported that cytokines such as TNF120572 and interleukin-1 enhance the production of some inflammatory media-tors including NO [48] Another study by Cordes et aldemonstrated that NO donor acts as IDE inhibitor via S-nitrosylation of the protein This protein modification affectsboth the insulin and A120573 degradation by IDE [49] HenceNO plays a significant role in the insulin resistance and ADprogression

In our study the observed increase in MAO activityin the NASH induced rats plays a crucial role in the ADpathogenesis Our suggestion is supported byYanez andVinawho showed that dual inhibitors of MAO and AChE areeffective in the AD treatment [50] In this studyThe observedreduction in the MAO-B activity mostly resulted from theinhibitory effect of berberine against MAO-B These resultsare supported by Ji and Shen who showed that berberinebinds MAO-A and MAO-B with theoretical 119870

1198891052 and

66 120583M respectively [51]

5 Conclusion

In conclusion nonalcoholic steatohepatitis with its healthcomplications including dyslipidemia cholesterol impair-ments oxidative stress and upregulation of AChE with amy-loid precursor protein (APP) are considered potential dan-gerous risk factors for neurotoxicity Our study showed thatthe marked hyperlipidemia associated with NASH inductionplays a crucial role in the development of the inflammationand the oxidative stress Furthermore our study showed thatthe dyslipidemia contributes to the development of other

complications such as insulin resistance All these compli-cations in particular the decrease in the insulin sensitivityand the elevated TNF120572 play a major role in the developmentof Alzheimer-like pathology which was manifested in ourstudy by high AChE activity and expression increased A120573

42

decreased A12057340 increased NO decreased IDE and high

MAO activity Our promising results of alkaloid berberinetreatment showed its potential therapeutic activity againstthe NASH and its associated diseases such as insulin resis-tance and Alzheimer-like pathology via its effect as antioxi-dant anti-inflammatory an AChE inhibitor and HMG-CoAreductase inhibitor Finally our study enhances the recom-mendation of berberine as potential natural therapeutic agentfor treatment of hepatic diseases insulin resistance andAlzheimer-like disease pathogenesis

Conflict of Interests

There is no any type of conflict of interests among authorsThe coauthor Eiman El-Wakeel was added by the first authorDoaa A Ghareeb as she performed only the PCR experimentduring her training in Ghareeb laboratory

Acknowledgments

This work was supported financially by the Science andTechnology Development Fund (STDF) Egypt Grant no4779The author Hany E A Ahmed extends his appreciationto the Deanship of Scientific Research at Taibah UniversityAl-Madinah Al-Munawarah Saudi Arabia

References

[1] G Marchesini E Bugianesi G Forlani et al ldquoNonalcoholicfatty liver steatohepatitis and the metabolic syndromerdquo Hep-atology vol 37 no 4 pp 917ndash923 2003

[2] H Xiong D Callaghan A Jones et al ldquoCholesterol retentionin Alzheimerrsquos brain is responsible for high beta- and gamma-secretase activities and Abeta productionrdquo Neurobiology ofDisease vol 29 no 3 pp 422ndash437 2008

[3] G Di Paolo and T-W Kim ldquoLinking lipids to Alzheimerrsquosdisease cholesterol and beyondrdquo Nature Reviews Neurosciencevol 12 no 5 pp 284ndash296 2011

[4] D Ghareeb A N Al Sayed F H Rashidy H M Hussein andN A Asmaa ldquoEfficacy of natural extracts of Ginkgo biloba andberberry and a synthetic derivative of genistein (ipriflavone) asacetylcholinesterase inhibitors comparative study with Aricepteffectrdquo Journal of Biochemistry and Biotechnology vol 1 no 1pp 5ndash11 2010

[5] J D Buxbaum E I Cullen and L T Friedhoff ldquoPharmacologi-cal concentrations of the HMG-CoA reductase inhibitor lovas-tatin decrease the formation of the Alzheimer beta-amyloidpeptide in vitro and in patientsrdquo Frontiers in Bioscience vol 7pp a50ndasha59 2002

[6] F Inglis ldquoThe tolerability and safety of cholinesterase inhibitorsin the treatment of dementiardquo International Journal of ClinicalPractice Supplement no 127 pp 45ndash63 2002

[7] W Farris S Mansourian Y Chang et al ldquoInsulin-degradingenzyme regulates the levels of insulin amyloid 120573-protein andthe 120573-amyloid precursor protein intracellular domain in vivordquo

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

12 Evidence-Based Complementary and Alternative Medicine

Proceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 7 pp 4162ndash4167 2003

[8] T C Birdsall ldquoBerberine therapeutic potential of an alkaloidfound in several medicinal plantsrdquoAlternativeMedicine Reviewvol 2 no 2 pp 94ndash103 1997

[9] W-J Kong J Wei Z-Y Zuo et al ldquoCombination of sim-vastatin with berberine improves the lipid-lowering efficacyrdquoMetabolism Clinical and Experimental vol 57 no 8 pp 1029ndash1037 2008

[10] W J Kong J Wei P Abidi et al ldquoBerberine is a novel cho-lesterol-lowering drug working through a unique mechanismdistinct from statinsrdquoNature Medicine vol 10 no 12 pp 1344ndash1351 2004

[11] H-B Xiao Z-L SunH-B Zhang andD-S Zhang ldquoBerberineinhibits dyslipidemia in C57BL6 mice with lipopolysaccharideinduced inflammationrdquo Pharmacological Reports vol 64 no 4pp 889ndash895 2012

[12] N Wang Y Feng F Cheung et al ldquoA comparative study onthe hepatoprotective action of bear bile and coptidis rhizomaaqueous extract on experimental liver fibrosis in ratsrdquo BMCComplementary and Alternative Medicine vol 12 article 2392012

[13] L Huang Z Luo F He A Shi F Qin and X Li ldquoBerberinederivatives with substituted amino groups linked at the 9-position as inhibitors of acetylcholinesterasebutyrylcholines-teraserdquo Bioorganic and Medicinal Chemistry Letters vol 20 no22 pp 6649ndash6652 2010

[14] F Zhu F Wu Y Ma et al ldquoDecrease in the production of 120573-amyloid by berberine inhibition of the expression of120573-secretasein HEK293 cellsrdquo BMC Neuroscience vol 12 article 125 2011

[15] A E AbdEl-WahabDAGhareeb E EM SarhanMMAbu-Serie and M A El Demellawy ldquoIn vitro biological assessmentof berberis vulgaris and its active constituent berberine antiox-idants anti-acetylcholinesterase anti-diabetic and anticancereffectsrdquo BMC Complementary and Alternative Medicine vol 13article 218 2013

[16] D A Ghareeb H S Hafez H M Hussien and N F KabapyldquoNon-alcoholic fatty liver induces insulin resistance and meta-bolic disorders with development of brain damage and dysfunc-tionrdquoMetabolic Brain Disease vol 26 no 4 pp 253ndash267 2011

[17] L L Moroz J R Edwards S V Puthanveettil et al ldquoNeu-ronal transcriptome of Aplysia neuronal compartments andcircuitryrdquo Cell vol 127 no 7 pp 1453ndash1467 2006

[18] E D Wills ldquoMechanisms of lipid peroxide formation in tissuesRole of metals and haematin proteins in the catalysis of theoxidation of unsaturated fatty acidsrdquo Biochimica et BiophysicaActamdashLipids and Lipid Metabolism vol 98 no 2 pp 238ndash2511965

[19] D E Paglia and W N Valentine ldquoStudies on the quantitativeand qualitative characterization of erythrocyte glutathione per-oxidaserdquo The Journal of Laboratory and Clinical Medicine vol70 no 1 pp 158ndash169 1967

[20] D J Jollow J R Mitchell N Zampaglione and J R GilletteldquoBromobenzene induced liver necrosis Protective role of glu-tathione and evidence for 34 bromobenzene oxide as thehepatotoxic metaboliterdquo Pharmacology vol 11 no 3 pp 151ndash169 1974

[21] S Marklund and G Marklund ldquoInvolvement of the superoxideanion radical in the autoxidation of pyrogallol and a convenientassay for superoxide dismutaserdquo European Journal of Biochem-istry vol 47 no 3 pp 469ndash474 1974

[22] P Fossati and L Prencipe ldquoSerum triglycerides determinedcolorimetrically with an enzyme that produces hydrogen per-oxiderdquo Clinical Chemistry vol 28 no 10 pp 2077ndash2080 1982

[23] D Watson ldquoA simple method for the determination of serumcholesterolrdquo Clinica Chimica Acta vol 5 no 5 pp 637ndash6431960

[24] W T Friedewald R I Levy and D S Fredrickson ldquoEstimationof the concentration of low-density lipoprotein cholesterol inplasma without use of the preparative ultracentrifugerdquo ClinicalChemistry vol 18 no 6 pp 499ndash502 1972

[25] M F Lopes-Virella P Stone S Ellis and J A ColwellldquoCholesterol determination inHDL separated by three differentmethodsrdquo Clinical Chemistry vol 23 no 5 pp 882ndash884 1977

[26] S Reitman and S Frankel ldquoGlutamic-pyruvate transaminaseassay by colorimetric methodrdquo American Journal of ClinicalPathology vol 28 p 56 1957

[27] G L Ellman K D Courtney V Andres Jr and R M Feather-stone ldquoA new and rapid colorimetric determination of acetyl-cholinesterase activityrdquo Biochemical Pharmacology vol 7 no 2pp 88ndash95 1961

[28] S G Hummel A J Fischer S M Martin F Q Schafer and GR Buettner ldquoNitric oxide as a cellular antioxidant a little goes along wayrdquo Free Radical Biology and Medicine vol 40 no 3 pp501ndash506 2006

[29] M Sandler M A Reveley and V Glover ldquoHuman plateletmonoamine oxidase activity in health and disease a reviewrdquoJournal of Clinical Pathology vol 34 no 3 pp 292ndash302 1981

[30] G M Morris D S Goodsell R S Halliday et al ldquoAutomateddocking using a Lamarckian genetic algorithm and an empiricalbinding free energy functionrdquo Journal of Computational Chem-istry vol 19 no 14 pp 1639ndash1662 1998

[31] Molecular Operating Environment (MOE) Chemical Comput-ing Group 2012 httpwwwchemcompcom

[32] K H Janbaz and A H Gilani ldquoStudies on preventive and cura-tive effects of berberine on chemical-induced hepatotoxicity inrodentsrdquo Fitoterapia vol 71 no 1 pp 25ndash33 2000

[33] P Angulo J C Keach K P Batts and K D Lindor ldquoIndepen-dent predictors of liver fibrosis in patients with nonalcoholicsteatohepatitisrdquo Hepatology vol 30 no 6 pp 1356ndash1362 1999

[34] X Terra T Auguet M Broch et al ldquoRetinol binding protein-4circulating levels were higher in nonalcoholic fatty liver diseasevs Histologically normal liver from morbidly obese womenrdquoObesity vol 21 no 1 pp 170ndash177 2013

[35] L M Lopez ldquoManaging hyperlipidemia current and futureroles of HMG-CoA reductase inhibitorsrdquo American Journal ofHealth-System Pharmacy vol 59 no 12 pp 1173ndash1179 2002

[36] PDThompson P Clarkson andRHKaras ldquoStatin-associatedmyopathyrdquoThe Journal of theAmericanMedical Association vol289 no 13 pp 1681ndash1690 2003

[37] Z Li Y-N Geng J-D Jiang andW-J Kong ldquoAntioxidant andanti-inflammatory activities of Berberine in the treatment ofdiabetesmellitusrdquo Evidence-Based Complementary andAlterna-tive Medicine vol 2014 Article ID 289264 12 pages 2014

[38] J K Reddy and M S Rao ldquoLipid metabolism and liver inflam-mation II Fatty liver disease and fatty acid oxidationrdquo TheAmerican Journal of PhysiologymdashGastrointestinal and LiverPhysiology vol 290 no 5 pp G852ndashG858 2006

[39] V Sharma and R Deshmukh ldquoTumor necrosis factor and Alz-heimerrsquos disease a cause and consequence relationshiprdquoBulletinof Clinical Psychopharmacology vol 22 no 1 pp 86ndash97 2012

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Evidence-Based Complementary and Alternative Medicine 13

[40] M S Wolfe and R Kopan ldquoIntramembrane proteolysis themeand variationsrdquo Science vol 305 no 5687 pp 1119ndash1123 2004

[41] K T Uysal S MWiesbrock MWMarino and G S Hotamis-ligil ldquoProtection from obesity-induced insulin resistance inmice lacking TNF-120572 functionrdquo Nature vol 389 no 6651 pp610ndash614 1997

[42] R B Parsons G C Price J K Farrant D Subramaniam JAdeagbo-Sheikh and B M Austen ldquoStatins inhibit the dimer-ization of 120573-secretase via both isoprenoid- and cholesterol-mediated mechanismsrdquo Biochemical Journal vol 399 no 2 pp205ndash214 2006

[43] T Silva J Teixeira F Remiao and F Borges ldquoAlzheimerrsquosdisease cholesterol and statins the junctions of importantmetabolic pathwaysrdquo Angewandte Chemie International Edi-tion vol 52 no 4 pp 1110ndash1121 2013

[44] M Qatanani and M A Lazar ldquoMechanisms of obesity-associated insulin resistance many choices on themenurdquoGenesamp Development vol 21 no 12 pp 1443ndash1455 2007

[45] A T Cheung D Ree J K Kolls J Fuselier D H Coy and MBryer-Ash ldquoAn in vivo model for elucidation of the mechanismof tumor necrosis factor-120572 (TNF-120572)-induced insulin resistanceevidence for differential regulation of insulin signaling by TNF-120572rdquo Endocrinology vol 139 no 12 pp 4928ndash4935 1998

[46] EM C Schrijvers J CMWitteman E J G Sijbrands A Hof-man P J Koudstaal andMM B Breteler ldquoInsulinmetabolismand the risk of Alzheimer disease the Rotterdam StudyrdquoNeurology vol 75 no 22 pp 1982ndash1987 2010

[47] A P Fernandez A Pozo-Rodrigalvarez J Serrano and RMartinez-Murillo ldquoNitric oxide target for therapeutic strate-gies inAlzheimerrsquos diseaserdquoCurrent Pharmaceutical Design vol16 no 25 pp 2837ndash2850 2010

[48] M B Goldring and F Berenbaum ldquoThe regulation of chondro-cyte function by proinflammatory mediators prostaglandinsand nitric oxiderdquo Clinical Orthopaedics and Related Researchno 427 supplement pp S37ndashS46 2004

[49] C M Cordes R G Bennett G L Siford and F G HamelldquoNitric oxide inhibits insulin-degrading enzyme activity andfunction through S-nitrosylationrdquo Biochemical Pharmacologyvol 77 no 6 pp 1064ndash1073 2009

[50] M Yanez and D Vina ldquoDual inhibitors of monoamine oxidaseand cholinesterase for the treatment of Alzheimer diseaserdquoCurrent Topics in Medicinal Chemistry vol 13 no 14 pp 1692ndash1706 2013

[51] H-F Ji and L Shen ldquoMolecular basis of inhibitory activities ofberberine against pathogenic enzymes in Alzheimerrsquos diseaserdquoThe Scientific World Journal vol 2012 Article ID 823201 4pages 2012

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom