Aras Zinc Preconditioning

  • View
    216

  • Download
    1

Embed Size (px)

Text of Aras Zinc Preconditioning

  • PKC regulation of neuronal zinc signaling mediates survivalduring preconditioning

    Mandar A. Aras*, Hirokazu Hara, Karen A. Hartnett*, Karl Kandler*,, and Elias Aizenman**Department of Neurobiology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261Department of Otolaryngology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261Laboratory of Clinical Pharmaceutics, Gifu Pharmaceutical University, Gifu, Japan

    AbstractSub-lethal activation of cell death processes initiate pro-survival signaling cascades. As intracellularZn2+ liberation mediates neuronal death pathways, we tested whether a sub-lethal increase in freeZn2+ could also trigger neuroprotection. Neuronal free Zn2+ transiently increased followingpreconditioning, and was both necessary and sufficient for conferring excitotoxic tolerance. Lethalexposure to NMDA led to a delayed increase in Zn2+ that contributed significantly to excitotoxicityin non-preconditioned neurons, but not in tolerant neurons, unless preconditioning-induced freeZn2+ was chelated. Thus, preconditioning may trigger the expression of Zn2+-regulating processes,which, in turn, prevent subsequent Zn2+-mediated toxicity. Indeed, preconditioning increased Zn2+-regulated gene expression in neurons. Examination of the molecular signaling mechanism leadingto this early Zn2+ signal revealed a critical role for protein kinase C (PKC) activity, suggesting thatPKC may act directly on the intracellular source of Zn2+. We identified a conserved PKCphosphorylation site at serine-32 (S32) of metallothionein (MT) that was important in modulatingZn2+-regulated gene expression and conferring excitotoxic tolerance. Importantly, we observedincreased PKC-induced serine phosphorylation in immunopurified MT1, but not in mutant MT1(S32A). These results indicate that neuronal Zn2+ serves as an important, highly regulated signalingcomponent responsible for the initiation of a neuroprotective pathway.

    Keywordszinc; preconditioning; PKC; excitotoxicity; metallothionein; tolerance

    IntroductionThe mammalian brain contains relatively high concentrations of Zn2+ (150M; Weiss etal. 2000), reflecting its critical role not only as a structural component of numerous proteinsand transcription factors but also as a neuromodulator and intracellular signaling messenger(Frederickson & Bush 2001, Yamasaki et al. 2007). Most cellular Zn2+ is tightly bound tometal-binding proteins, limiting the normal amount of chelatable, free Zn2+ in the cytoplasm(Krezel & Maret 2006). Nonetheless, the liberation of neuronal Zn2+ from intracellular storesduring oxidative and nitrative stress can readily trigger cell death signaling (Aizenman et al.2000b, Bossy-Wetzel et al. 2004). Neurotoxicity initiated by endogenous Zn2+ liberation ismediated by the generation of reactive oxygen species (ROS; McLaughlin et al. 2001, Bossy-

    Address correspondence and reprint requests to (laboratory of origin): Elias Aizenman, Department of Neurobiology, University ofPittsburgh School of Medicine, E1405 Biomedical Science Tower, 3500 Terrace Street, Pittsburgh, PA 15261, USA, Phone:412-648-9434, Fax: 412-648-1441, Email: E-mail: redox@pitt.edu.

    NIH Public AccessAuthor ManuscriptJ Neurochem. Author manuscript; available in PMC 2009 August 3.

    Published in final edited form as:J Neurochem. 2009 July ; 110(1): 106117. doi:10.1111/j.1471-4159.2009.06106.x.

    NIH

    -PA Author Manuscript

    NIH

    -PA Author Manuscript

    NIH

    -PA Author Manuscript

  • Wetzel et al. 2004, Dineley et al. 2008), the release of cytochrome c and apoptosis-inducingfactor (Sensi et al. 2003), and phosphorylation of mitogen-activated protein kinases(McLaughlin et al. 2001, Bossy-Wetzel et al. 2004).

    A sub-lethal, preconditioning stimulus can activate endogenous pathways that limit or resistsubsequent lethal injury in the brain (Kitagawa et al. 1990; for recent review, see Gidday2006). While the mechanisms conferring neuronal tolerance have yet to be fully defined,increasing evidence suggests that preconditioning stimuli induce the sub-lethal activation ofcell death factors that trigger survival pathways, which, in turn, prevent subsequent lethalsignaling (Gidday, 2006). For example, ischemic preconditioning leads to sub-lethal activationof caspase-3 both in vivo and in vitro (Garnier et al. 2003, McLaughlin et al. 2003, Tanaka etal. 2004, Lee et al. 2008), required for the establishment of tolerance to lethal stimuli(McLaughlin et al. 2003). Analogous roles in the establishment of neuronal tolerance have alsobeen described for other signaling molecules linked to cell death including poly (ADP-ribose)polymerase-1, p38, and protein kinase C (PKC; Garnier et al. 2003, Nishimura et al. 2003,Raval et al. 2003, Lee et al. 2008).

    Here, we establish endogenous intracellular Zn2+ as an early signal in an in vitro model ofexcitotoxic tolerance (see also Lee et al. 2008). Preconditioning-induced increases in neuronalZn2+ were critical in rendering neurons resistant to lethal excitotoxic insults that wouldotherwise induce Zn2+-mediated toxicity. Examination of a potential Zn2+-mediatedneuroprotective pathway revealed that the major source of preconditioning-induced Zn2+ ismetallothionein (MT) and that the Zn2+ signal emanating from the metal binding protein canbe directly modulated by PKC phosphorylation. The results presented here strongly suggestthat free Zn2+ serves as an upstream signaling component responsible for the initiation of pro-survival pathways in neurons.

    Experimental ProceduresMaterials

    The MRE-luciferase construct (pLuc-MCS/4MREa) was kindly provided by Dr. DavidGiedroc (Indiana University, Bloomington, IN; Chen et al. 2004). Isoform-specificconstitutively active PKC plasmids were kindly provided by Dr. Jae-Won Soh (Inha University,Incheon, South Korea; Soh et al. 1999).

    Rat primary cortical culture and transfectionAll experiments were performed in cortical cultures prepared from E16 rats (Hartnett et al.1997). Cultures were utilized at 1822 days in vitro. For transfection, neurons were treated for5 hours with 2L Lipofectamine 2000 (Invitrogen, Carlsbad, CA), 100L OptiMEM (GIBCO,Grand Island, NY), and 1.5g DNA per well in 500L 2% serum-containing media.

    Preconditioning and assessment of neuronal viabilityAn in vitro model of ischemic preconditioning was previously described (Aizenman et al.2000a, McLaughlin et al. 2003). Briefly, cortical cultures were treated with 3mM potassiumcyanide (KCN) in a glucose-free solution (150mM NaCl, 2.8mM KCl, 1mM CaCl2, 10mMHEPES, pH 7.2) for 90min at 37C. Twenty-four hours later, neurons were exposed to 100MN-methyl-D-aspartate (NMDA) and 10M glycine for 60 min prepared in phenol red-freeMEM, supplemented with 25mM HEPES and 0.01% BSA. Neuronal viability was determined1824 hours following NMDA treatment with a lactate dehydrogenase (LDH) release assay(TOX-7 in vitro toxicology assay kit; Sigma) and/or by cell counting, with essentially similarresults (Koh & Choi 1987, Aras et al. 2008). Neuronal viability in transfected neurons wasassessed using a luciferase reporter assay (Aras et al. 2008). Twenty-four to forty-eight hours

    Aras et al. Page 2

    J Neurochem. Author manuscript; available in PMC 2009 August 3.

    NIH

    -PA Author Manuscript

    NIH

    -PA Author Manuscript

    NIH

    -PA Author Manuscript

  • following transfection of a luciferase reporter plasmid (pUHC13-3) and any other plasmids ofinterest, neurons were treated with control and experimental conditions and assayed forluciferase-mediated luminescence using a SteadyLite luciferase assay system (PerkinElmer,Waltham, MA). Cell viability is proportional to luciferase activity.

    Intraneuronal Zn2+ imagingTo assess the relative magnitude of intracellular free Zn2+ in neurons, we utilized the Zn2+-sensitive fluorescent probe, FluoZin-3 AM (Molecular Probes, Eugene, OR; Devinney et al.2005). Following treatment with chemical ischemia or an excitotoxic stimulus, neurons wereloaded with FluoZin-3 (30min; 5M prepared in buffered solution containing 144mM NaCl,3mM KCl, 10mM HEPES, 5.5mM glucose, 5mg/mL bovine serum albumin; pH 7.3). Cultureswere then immediately transferred to a recording chamber (Warner, Hamden, CT) mounted onan inverted epifluorescence microscope superfused with phenol red-free MEM, supplementedwith 25mM HEPES and 0.01% BSA. Images were acquired by exciting the fluorescent dyewith 490 nm light every 10 seconds for 5 minutes using a computer controlled monochromator(Polychrome II, TILL photonics, Martinsried, Germany) and CCD camera (IMAGO, TILLphotonics). Following acquisition of baseline metal levels (for approximately 100s), anyneuronal free Zn2+ was chelated by superfusing cells with the membrane-permeant Zn2+chelator N,N,N,N-tetrakis (2-pyridalmethyl) ethylenediamine (TPEN, 20M). Themagnitude of the Zn2+ fluorescence for all neuronal cell bodies in a single field (n = 520neurons) was determined by subtracting the fluorescence signal after TPEN perfusion from theinitial baseline signal (FTPEN). With this method, larger FTPEN values correspond to higheramounts of pre-existing free intracellular Zn2+ in cells (Knoch et al. 2008).

    MRE-Luciferase reporter assayCortical neurons were co-transfected with the metal response element (MRE)-firefly luciferasereporter (pLuc-MCS/4MREa) and Renilla luciferase reporter (pRL-TK) using Lipofectamine2000 (Invitrogen, Carlsbad, CA; Hara and Aizenman, 2004). The MRE-luciferase constructcontains four tandem repeats of the endogenous MREa sequence(GGCTTTTGCACTCGTCCCGGCT) from the human metallothionein-IIA (hMT-IIA) geneupstream of a basal promoter that drives transcription of firefly luciferase (Chen et al. 2004).Renilla luciferase was used to standardize transfection efficiency. Neurons were treated 24 -48 hours following transfection. Foll

Recommended

View more >