Upload
truonghanh
View
216
Download
0
Embed Size (px)
Citation preview
Estudos moleculares e estruturais de enzimas de
Leishmania visando o desenho racional de inibidores
antiparasitáriosri.
APRT
Texto que sistematiza o trabalho científico do candidato para aobtenção do titulo de Livre Docência
Prof. Dr. Otavio Henrique Thiemann
Departamento de Física e InformáticaInstituto de Física de São Carlos
Universidade de São Paulo
Agosto de 2004
I F S (. U S P SERViÇO DE BIB~IOTECAINFORMAÇAO
,Indice
AgradecimentosIntroduçãoCapítulo I
1.1- Leishmanioses1.2- Desenho e desenvolvimento de fármacos
Capítulo II2.1- Síntese de purino-nucleotídeos2.2- Trabalhos apresentados em seguida
6
7
1114
16
20
Silva M, Silva C.H, Iulek J, Oliva G, and Thiemann OH. Crysta/structure
of adenine phosphoribosy/transferase from Leishmania tarento/ae:
potentia/ implications for APRT cata/ytic mechanism. Biochim Biophys
Acta. 2004;1696(1):31-9. 23
Silva M, Silva C.H, Iulek J, and Thiemann O.H. Three-dimensiona/
structure of human adenine phosphoribosy/transferase and its re/ation to
DHA-uro/ithiasis. Biochemistry. 2004;43(24): 7663-71. 32
Monzani P.S, Alfonzo J.D, Simpson L, Oliva G, and Thiemann O.H.C/oning, characterization and preliminary crystallographic ana/ysis of
Leishmania hypoxanthine-guanine phosphoribosy/transferase. Biochim
Biophys Acta. 2002;1598(1-2):3-9. 41
Castilho M. S., Araújo A.S., Oliva G. and Thiemann O.H. Biochemica/and
structura/ characterization of Leishmania major Fried/ing xanthine
phosphoribosy/transferase. Mo!. Biochem. Parasito!. Submetido. 48
Capitulo III3.1- Via glicolítica3.2- Glicose-6-fosfato isomerase
3.3- Trabalhos apresentados em seguida
596365
2
I F S (. U S P SERViÇO DE SiBLlOTECAINFORMAÇÃO
Cordeiro A.T, Godoi P.H.C, Delboni L.F, ouve G, Thiemann O.H. Human
phosphog/ucose isomerase: expression, purification, crystal/ization and
pre/iminary crystallographic ana/ysis. Acta Crystallogr D Biol Crystallogr.
2001; 57(Pt 4):592-5. 68
Cordeiro A.T., Godoi P.H.C., Silva C.H.T.P., Garratt R.C., Oliva G.,
Thiemann O.H. Crysta/ structure of human phosphog/ucose isomerase
and ana/ysis of the initia/ cata/ytic steps. Biochim Biophys Acta. 2003,
1645 (2): 117-22. 72
Cordeiro A.T., Hardre R., Michels P.A., Salmon L., Delboni L.F.,
Thiemann O.H. Leishmania mexicana mexicana g/ucose-6-phosphate
isomerase: crystal/ization, mo/ecu/ar-rep/acement so/ution and inhibition.
Acta Crystallogr D Biol Crystallogr. 2004; 60(Pt 5):915-9. 78
Cordeiro A.T., Michels P.A., Delboni L.F., Thiemann O.H. The crysta/
structure of g/ucose-6-phosphate isomerase from Leishmania mexicana
revea/s nove/ active site features. Eur J Biochem. 2004; 271(13):2765-
72. 83
Hannaert V., Albert M.A., Rigden D.J., da Silva Giotto M.T., Thiemann O.H., Garratt R.C., Van Roy J., Opperdoes F.R., Michels P.A. Kinetic
characterization, structure model/ing studies and crystallization of
Trypanosoma brucei eno/ase. Eur J Biochem. 2003;f70(15):3205-13. 91
Capitulo IV"4.1- Rastreamento de inibidores a partir de extratos
de plantas e animais marinhos
4.2- Trabalhos apresentados em seguida
100102
Napolitano H.B., Silva M., Ellena J., Rocha W.C., Vieira P.C., ThiemannO.H., Oliva G. Redetermination of skimmianine: a new inhibitor against
the Leishmania APRT enzyme. Acta Crystallogr E Struc. Rep. 59: 01503-
01505 Part 10, 2003. 105
3
Napolitano H.B., Silva M., Ellena J., Rocha W.c., Vieira P.c., ThiemannO.H., Oliva G. Redetermination and comparative structura/ study of
isopimpinellin: a new inhibitor against the Leishmania APRT enzyme. Acta
Crystallogr E Struc. Rep. 59: 01506-01508 Part 10, 2003. 108
Silva M., Napolitano H.B., Ellena J., Rocha W.c., Vieira P.c., Oliva G.,
Thiemann O.H. 3-(S,7-Dimethoxy-2,2-dimethy/-2H-benzo[b ]-pyran-6-
y/)propionic acid: a potentia/ inhibitor against Leishmania. Acta
Crystallogr E Struc. Rep. 59: 01575-01577 Part 10, 2003. 111
Napolitano H.B., Silva M., Ellena J., Rodrigues B.D.G., Almeida A.L.C.,
Vieira P.c., Oliva G. and Thiemann O.H. Aurapten, a nove/ coumarin
with growth inhibition against Leishmania major promastigotes. Braz. J.
Med. Biol. Res., No Prelo. 114
Silva M., Silva C. H. T. P., Rocha W. C., Castilho M. S., Vieira P. c., Oliva
G. and Thiemann O. H. In-vivo and ln-vitro effect of four alkaloids of
Adiscanthus fusciflorus: Inhibition of phosphoribosyl transferases activity
and antileishmanial effect. Submetido. 125
o
Berlinck R.G.S., Hajdu E., da Rocha R.M., de Oliveira J.H.H.L., Hernandez
I.L.C., Seleghim M.H.R., Granato A.C., de Almeida E.V.R., Nunez C.V.,
Muricy G., Peixinho S., Pessoa C., Moraes M.O., Cavalcanti B.C.,
Nascimento G.G.F., Thiemann O.H., Silva M., Souza A.O., Silva C.L.,
Minarini P.R.R. Challenges and rewards of resesrch in marine natural
products chemistry in Brazil. J. Nat. Prod. 67 (3): 510-5222004. 142
Capitulo VConclusões
Referências:
155158
4
Agradecimentos
Aproveito este espaço para reconhecer as pessoas que contribuíram de diversas
maneiras para a realização deste trabalho. Meus agradecimentos:
• Aos Profs. Glaucius Ollva e Richard Charles Garratt, pela amizade e acolhida no
Grupo de Cristalografia de Proteínas e Biologia Estrutural do IFSC incentivando
constantemente com competência e dedicação os trabalhos nas mais diversas
formas.
• As Profa. Ana Paula U. de Araújo pela acolhida nos primeiros anos nolaboratório e longas discussões de trabalho e a Profa. Leila M. Beltramini, pelo
apoio e acolhida junto às disciplinas do curso de Licenciatura em Ciências.
• Aos colegas de trabalho; técnicos, pos-docs, alunos e estagiarios do Grupo deCristalografia de Proteínas e Biologia Estrutural do IFSC, que ensinaram tanto
e com tanta dedicação permitiram a realização dos trabalhos de pesquisa
apresentados.
• A Luciana, Jaciara e Fernando, que com muita paciência e dedicação nos
ajudam no nosso cotidiano.
C) • Aos diversos colaboradores, sem os quáls varios projetos não existiriam.
• Aos Drs. Wim M. Degrave, Larry e Agda Simpson, que tanto me ensinaram nosanos que me acolheram em seus labotatórios.
• A minha esposa Flavia, e meu filho Daniel, pelo carinho e tantas alegrias que
fazem tudo valer a pena. Sem seu companheirismo nada seria possível.
5
Introdução
Esta tese trata de aspectos de biologia molecular e estrutural apresentados
através de uma coletânea de artigos publicados ou submetidos para publicação,
refletino nossa modesta contribuição na área da parasitologia molecular e
estrutural. Nestes artigos as técnicas empregadas abrangem a bioquímica,
biologia molecular, parasitologia molecular e cristalografia de proteínas.
A motivação que levou a escolha do tema desta tese focalizado nas vias de
recuperação de purino nucleotídeos e na via glicolítica foram duas: Em primeiro
lugar representa um conjunto de trabalhos realizados após meu doutoramento e
assim caracteriza uma nova linha de pesquisa, tanto para mim quanto para o
Grupo de Cristalografia de Proteínas e Biologia Estrutural do Instituto de Física de
São Carlos; em segundo lugar permite a formulação de uma tese sobre uma
tema coerente. Em contrapartida, os artigos aqui apresentados não representam
a totalidade da minha produção científica ao longo destes anos.
) Com a exceção do primeiro capítulo, cada. capítulo traz uma breve introdução ao
assunto a ser abordado e os artigos a ele. relacionados.
O primeiro capitulo traz uma breve introducao aos temas desta tese, decrevendo
a leishmaniose e ao desenho racional de inibidores viando futuro desenvolvimento
de fármacos.
O segundo capitulo aborda a via de sintese de purinas. Apos uma breve
introducao seguem-se quatro artigos que descrevem aspectos da bioquímica e
estrutura das fosforibosiJ transferases (PRTases) de Leishmania e humana.
6
o terceiro capitulo aborda a via glicolítica. Apos uma breve introducao seguem-se
cinco artigos. Os dois primeiros abordam a descrição da glucose-6-fosfato
isomerase (PGI) humana e as observações decorrentes do estudo estrutural
sobre esta enzima. Os dois artigos seguintes tratam da PGI de Leishmania
mexicana mexicana, sua clonagem, caracterização, atividade de inibidores
analogos ao substrato e sua estrutura cristalográfica. Finalmente o quinto artigo
desreve os trabalhos realizados com a enolase de Trypanosoma brucei.
O quarto capitulo descreve trata da busca por inibidores de PRTases e Leishmania
em extratos naturais, de plantas e animais marinhos. Compõe este capitulo sete
artigos, os tres primeiros descrevem a estrutura cristalográfica de tres inibidores
de uma Rutaceae Adiscanthus fusciflorus que possuem atividade inibitória sobre a
APRT de Leishmania. O quarto artigo, aceito para publicação, descreve o
isolamento e caracterização da atividade inibitória sobre o crescimento da cultura
de Leishmania major do 7-geranyloxycoumarin, Aurapteno, uma cumarina isolada
de Esenbeckia febrifuga (Rutaceae). O quinto artigo descreve os estudos
bioquímicos e celulares de quatro inlbldores isolados de Adiscanthus fusciflorus.
Os dois artigos finais descrevem os avanços na identificação de compostos com
atividade biológica de interesse a partir de extratos de animais marinhos.
7
Capítulo I
As décadas de 1950 e 1960 foram levadas por grande otimismo em
assuntos referentes à saúde pública e agentes infecciosos. Em 1951, a
Organização Mundial da Saúde (OMS) declarou que " ... malaria is no longer of
major importance ..." e lançou-se uma ambiciosa campanha de erradicação da
enfermidade [1]. Tal otimismo não se limitou a infecções por parasitos como a
malária. Estendeu-se a todas as doenças infecciosas, bacterianas, virais,
parasitarias, etc..., julgando-se que em poucos anos a humanidade estaria livre
dos micróbios.
Apesar dos avanços da ciência nas ultimas décadas, muitos agentes
etiológicos permanecem como uma ameaça à saúde publica e outros,
considerados erradicados, de fácil tratamento ou mesmo sob controle, estão
ressurgindo [2]. Isto se deve a fatores socioeconômicos e ambientais, fatores
.0comportamentais de risco, especialmente em populações de refugiados, em
emergências complexas, pela invasão de áreas silvestres ou pelo aparecimento de
formas resistentes aos tratamentos disponíveis."
Dentre as patogenias para as quais nunca foi desenvolvido um tratamento
adequado, seja por quimioterapia ou uma vacina eficaz, se destacam as doenças
causadas por protozoários parasitas. Das etiologias causadas por espécies da
ordem Kinetoplastida, destacamos as leishmanioses que estão colocadas na
categoria I (doenças emergentes e não controladas) pela Organização Mundial da
Saúde [3], junto com a doença do sono ou trypanosomíase africana e dengue,
8
apesar dos promissores resultados com o composto Miltefosina, em fase IV de
testes clínicos.
o interesse médico e de saúde pública despertado pelos Kinetoplastida se
soma o interesse no sentido da pesquisa fundamental que os membros dessa
ordem despertam. Esta ordem representa um ramo antigo dos eucariotos como
descrito por Carl Woese e colaboradores em 1987 [4]. Em espécies de
Kinetoplastida foram identificados fenômenos de grande interesse como a
editoração do RNA mitocondrial por adição e deleção de uridinas. Este um
fenômeno intrigante e ainda pouco resolvido. A falta de tRNAs codificados pelo
genoma mitocondrial, apesar dessa organela possuir capacidade de tradução e
síntese protéica, implica na importação de tRNAs do citoplasma para a matriz
" I EUKARYAI
I I dmo- slimeBACTERlA ram- animais flagellates molds
. . g" green "Iiatpurple ~e non-sultur pIants CI es euglenoids
""-ct " bacteria bactenaUG ena fungi
cyanobacteria
flavobacteria
mitocondrial. ocomplexo genoma
Thermotoga __ "
mitocondrial e sua
incomum organização
são alvos de intensos
o estudos desde sua
W~se (1987)MicrobiolR~51:221-227
descoberta. Transcrição
policistrônica, uma
característica de bactérias foi identificada em Kinetoplastida também, assim como
a existência de um sistema de trans-splicing, ao invés do cis-splicing identificado
em outros eucariotos [5].
9
Recentemente foi inclusive identifica da a presença de genes de cloroplasto
no genoma nuclear de Trypanosoma [6]. Esta descoberta implica em uma perda
secundaria dessa organela e pode vir a ter interessantes desdobramentos.
As características peculiares citadas alem da importância a saúde publica
humana, com as conseqüentes implicações sócio-econômicas resultantes de
tornam os estudos desta ordem de grande interesse.
1.1- Leishmanioses
As leishmanioses são zoonoses classificadas
em oito diferentes grupos segundo a sintomatologia
e espécie de parasito envolvido (Tabela I). São
causadas por protozoários de diversas espécies pertencentes ao gênero
Leishmania, ordem Kinetoplastida. Estima-se que 400.000 novos casos ocorram
anualmente nas regiões tropicais e subtropicais do globo, estando mais de 10
o milhões de indivíduos contaminados e 400,milhões sob risco de infecção [7, 8].
Esses alarmantes números retratam um alto índice de mortalidade e morbidade
"das leishmanioses. Em humanos a doença tem manifestação crônica de
apresentação cutânea ou vlsceral. As formas cutâneas do Novo Mundo se
caracterizam por desenvolverem lesões metastáticas mutilantes nas várias
mucosas. As formas viscerais, distribuídas em ambos os hemisférios, se
caracterizam por infecções do sistema retículo-endotelial.
10
Tabela I. Classificação do gênero Leishmania.
Species de Leishmania • Condição clínica b Epidemiologia c
A. Seção d HypopylariaLagartos - Novo Mundo
Leishmania agamaeLeishmania ceramodactyli
B. Seção PeripylariaLagartos - Velho Mundo
Leishmania adleriLeishmania tarentolae
Mamíferos - Novo MundoComplexo Leishmania braziliensis I (subgênero VianniaJ)
L. b. braziliensis C,ML. b. guyanensis CL. b. panamensis C, ML. b. peruviana CL. b. laisoni r CL. b. colombiensis CL. b. naiffi rL. b. shawi'L. b. equatorensis
C. Seção SuprapylariaMamíferos - Novo Mundo
Complexo Leishmania mexicana i (subgênero Leishmania)L. m. mexicana C (D)L. m. amazonensis C, D, V li, P, ML. m. pifanoi D (C)L. m. aristidesiL. m. venezuelensis CL. m. garnhami CL. m. enriettiL. m.forattinii
Complexo Leishmania hertigi (subgênero Leishmania)L. h. hertigiL. h. deanei
Mamíferos - Velho MundoComplexo Leishmania donovani (subgênero Leishmania]
L. d. donovani V, PL. d. infantum V, C ••, AL. d. chagasi • N, C ",.AL. d. archibaldi V, C, O
Complexo Leishmania tropica (subgênero Leishmania)L. t. tropica C, R, Vb, P, OL. t. killicki CL. aethiopica C, D, M
Complexo Leishmania major (subgênero Leishmania)L. m. major C, D, [V]
Leishmania gerbilli g
Leishmania turanica n. sp. g
Lagartos - Velho MundoLeishmania gymnodactyliLeishmania hemidactyliLeishmania hoogstraaliLeishmania zmeevi
ZVLZVLZVLZVL
ZVLZVL
AVLZVLZVL
AVL
ZVL
ZVL
11
• Adaptado de [10- I6). Esta tabela exclue a descrição "Leishmania sp." Para conter apenas aquelas espécies identificadas seguindo a proposta de Lainson,R. and Shaw. J. J.[IO). • Resumo das condições clínicas humanas [15,16): A, leishmaniose asintomática; C, leishmaniose cutãnea (CL); D, Ieishrnaniosedifusa cutànea (DCL, disseminada); M, leishmaniose mucocutânea (MCL); O, leishrnaniose oronasal; P, Ieishmaniose post-kala-azar dennica (PKDL); R,leishmaniose recidiva (LR, forma de relapso); V, leishrnaniose visceral (VL); ( ) existência incerta; [ ), baseada em um único caso [16]. c Caracteristicasepidemiológicas de acordo com Desjeux, P. [15): AVL, leishmaniose antroponótica visceral; ZVL, leisbmaniose zoonótica visceral. d Seção é um termotaxonômico aceito e introduzido por Lainson R. e Shaw, J. J. in 1979 [12]. c L. chagasi foi incluído no complexo Leishmania donovani por Momen, H. eta!. [17]. f Leishmania naiffi, L. laisoni e L. shawi foram classificadas por Desjeux, P. [15] como patogênicas a humanos apesar de apenas infecções emanimais terem sido descritas [16].' L. gerbilli e L. turanica foram isoladas de Rhombomys opimus e são endêmicas da Ãsia Central [18] e Russia [19]respectivamente. Estas espécies são caracterizadas por desenvolvimento suprapylaria. Até o momento estas espécies não foram classificadas em umcomplexo especifico. h Manifestação rara [15]. ;A classificação de "complexo" foi introduzida por Lainson, R e Shaw, J. J. [l I, 13].10 subgênero Vianniafoi proposto em 1989 por Lainson, R. et. a!. 1989.
Célula de LelshmanJa major (amarelo) sendofagocitada por um macrófago FIgura derrucroscopra eletromca de varredura colondaartificialmente
As formas de tratamento têm se
baseado no uso de antimônicos pentavelentes
como o antimonato de N-methyl glucamina
(Glucantine) e o estibogluconato de sódio
(Pentostam) [20-22]. A duração da terapia e a
resposta clínica variam de região a região e da
interação patógeno-hospedeiro. Na prática, a aplicação de altas doses por
prolongados períodos é comum. Isto se deve em parte a rápida eliminação destes
A B c
II
Exemplos das manifestações cllnicas dasLeishmanioses A- Lelshmanlose visceral Nota-se o abdomen dístendído mdicandosplenomegalia e a severa atrofia muscular B- aLetsbmanioss mucocutânea Nota-se ocomprometimento da reglêo da oral e nasal C-t.eishmanose cutênea Nota-se o aspectopustular desta manrfestação em particular (deWtMN .who íntltdr)
compostos da corrente sangüínea. Em
casos de recidiva e nas infecções por L.
aethiopica leishmanioses viscerais,ou
indica-se o emprego da anfotericina B
(Funqlzon) [22, 23]. A anfotericina B
apresenta efeitos colaterais indesejados e
até graves, portanto necessitando ser
ministrada em hospitais, uma dificuldade
adicional tratamento,no em se
considerando saúdecondições deas
pública prevalentes nas regiões endêmicas. Esta terapia tem se mostrado pouco
12
eficiente em diversos casos. Em pacientes resistentes ao Glucantine e ao
Fungizon não se identificam alternativas eficazes. Tende-se a repetir o
tratamento, com doses nos limites da tolerância ou a utilizar o isotionato de
pentamidina como uma última alternativa [20, 21]. Aliado a baixa eficácia de
tratamento, se observam também diversas reações de toxicidade que vão desde
náusea, vômitos e mialgia até, nos casos mais graves o choque, alterações
eletrocardiográficas, hipersensibilidade e trombose venosa. Estas características
indesejáveis, associadas ao aparecimento de formas resistentes de Leishmania
[23], têm exacerbado a necessidade do desenvolvimento de drogas
antileishmanióticas mais eficazes e menos tóxicas ao paciente. A toxicidade é
particularmente severa no tratamento de crianças e idosos ou indivíduos
portadores de infecções oportunistas secundárias.
1.2- Desenho e desenvolvimento de fármacos
A abordagem moderna para o desenvolvimento de drogas [24, 25] explora
enzimas únicas ao metabolismo do parasito ou que possuam diferenças de
"especificidade catalítica entre a enzima do parasito e a do hospedeiro. Estas
enzimas podem ser empregadas como alvo no desenvolvimento de inibidores da
cadeia metabólica, sem com isso afetar o hospedeiro. Para tanto, torna se
indispensável à determinação da estrutura tridimensional da enzima, a
caracterização do mecanismo de catálise e identificação do sítio catalítico, bem
como de domínios reguladores presentes na mesma [24]. Analises filogenéticas
13
mostram que os protozoários parasitos formam clades relativamente profundas
tendo divergido do restante da linhagem eucariota em um ancestral primitivo [26,
27]. Esta observação é uma evidência adicional que mesmo enzimas homólogas
entre o hospedeiro e os parasitos podem ter divergido suficientemente permitindo
o seu uso como alvos em abordagens de quimioterapia. Um estudo dessa
magnitude requer o desenvolvimento de proteínas mutantes, resistentes a
inibidores ou com características cinéticas alteradas a fim de permitirem elucidar
o mecanismo catalítico e os aminoácidos envolvidos no sítio catalítico. O primeiro
composto desenvolvido desta forma foi o anti-hipertensivo Captopril, um inibidor
da angiotensina convertase. O acúmulo de dados referentes a estruturas
cristalográficas e cinética de diversas enzimas levou ao desenho de vários
compostos adicionais para o emprego clínico (para uma revisão veja Kubinyi,
H.[24]).
14
Capítulo 11
2.1- Síntese de purino-nucleotídeos
o metabolismo de purino-nucleotídeos em protozoários parasitos é
significativamente diferente daquele de mamíferos. Em humanos os purino-
nucleotídeos são sintetizados de novo, a partir de precursores não-nucleotídeo
tais como aminoácidos, amônia e dióxido de carbono. Os purino-nucleotídeos
podem também ser reciclados pela via de recuperação [28-31]. Os passos
enzimáticos da via de síntese de novo são bem conservados ao longo de diversos
taxa.
Os nucleotídeos podem também ser formados a partir de purinas e purino-
nucleosídeos livres. Na via de recuperação, as purinas reagem com 5'-fosforibosil-
1-pirofosfato (PRPP) formando os nucleosídeos-5'-monofosfatos correspondentes.
Estas reações reversíveis são catalisadas por distintas fosforibosil-transferases
J (PRTases) substrato-específicas. AsPRTases formam uma classe de
aproximadamente 10 enzimas que cataílsarn reações semelhantes envolvendo
PRPPe uma base nitrogenada [32]. Em mamíferos, essas reações são catalisadas
por duas enzimas distintas: adenina-fosforibosil-transferase (APRT;
AMP:pirofosfato fosforibosiltransferase; EC 2.4.2.7) e hipoxantina-guanina-
fosforibosil-transferase (HGPRT; IMP: pirofosfato-fosforibosil-transferase; EC
2.4.2.8) nas reações reversíveis esquematizadas na figura 1. A HGPRT catalisa a
remoção do grupo pirofosfato (PP1) de PRPP e a adição de uma base purínica
15
Guanina
(hipoxantina ou1" o o- O' APRT(XJ + -'oy-.,~"-to-j-O-~-o-~
O2 Hrpoxantma
O O2 <=(~HN~l'"'""(+. ~(~)-~+
guanina) em uma
reação do tipo SN2+ PP
1
(ataque nucleofilico
de segunda ordem)
aparentemente. O
mecanismo de
FigullI 1: As dIVersas reações de transferência catalisadas pelas PRTases estão mostradas PRPP 5'-fosforibosi~l-plrofosfato, APRT ademna-fosforibosll-transferase; HGPRT hlpoxanlln&-guanina fosforibosl~transferase; XPRT xantina fosforibosil-transferase; PPi pirofosfato
reação da maioria
das PRTases
começa a ser elucidado. Mecanismo do tipo duplo-deslocamento (mecanismo
"pingue-pongue") foi sugerido para a OPRT(orotato-fosforibosil-transferase, EC
2.4.2.10) [33] e UPRT(uridina-fosforibosil-transferase, EC 2.4.2.9) de levedura
[34]. Giaconello A. e Salerno, C. [35] sugeriram que HGPRTde humanos segue o
mecanismo seqüencial em um modelo aleatório e de rápido equilíbrio, onde os
produtos se dissociam em seqüência ordenada, primeiro a base purínica seguida
do complexo Mg-P-Rib-PP (magnésio-fosforibosil-pirofosfato). Entretanto, a
(J análise de HGPRT de Schistosoma msnsoni favorece o modelo de reação
seqüencial ordenada, onde PRPPse liga a enzima primeiro e os produtos IMP ou
GMPsão liberados por último [36]. Este modelo difere do proposto para a HGPRT
de humanos [35], e sugere a possibilidade de desenho de inibidores específicos
para o complexo binário enzima-purina. O pirofosfato formado (PPi) na reação de
transferência é rapidamente hidrolisado favorecendo o deslocamento do equilíbrio
de reação para a formação dos mononucleosídeos.
16
Esta cadeia de recuperação permite ao organismo a reutilização de purinas
obtidas da degradação de ácidos nucleicos ou nucleotídeos (Figura 2). A via de
recuperação está presente em todos os organismos estudados, incluindo
protozoários parasitos [28, 31]. Em Kinetoplastida e diversos outros protozoários,
a via de recuperação consiste na única forma de obtenção de purino-nucleotídeos
[31, 37]. Como conseqüência cada gênero de parasito, auxotrófico para purlno-
nucleotídeos, desenvolveu um conjunto específico de enzimas da via de
recuperação que Ihes permite utilizar purinas pré-formadas (Figura 3). As
implicações terapêuticas do metabolismo de purino-nucleotídeos em
kinetoplastidas são substanciais [30, 31].
o
Ribose-6-phosphate _ PRPP--,PRS-I i
Synthests-ae NO""! I
~~Adenylosuccinate I \L
MRjMP
ADSL \ /AMD 1\ IGMS
~ADP-- AMPPPi I GMP-GDP:--+IGTrl
PPi~ PR'PP-YPPí
,
APRTf--PRPP HGPRTI
Adenine Guanine
AAir.. Hypoxantine
Os Kinetoplastida se
destacam pela suscetibilidade a
análogos de purino-
nucleotídeos [31, 37, 38, 39].
A HGPRT de Leishmania é
relativamente inespecífica e
pode utilizar pirazolopirimidinas
como substrato. O mais
Figura 2: Via de recuperação e interconverção, em células demamíferos. APRT- adenina-fosforibosil-transferase; HGPRT-hipoxantina-guanina-fosforibosil-transferase; PRPP- 5'-fosforibosil-I-pirofosfato.
estudado desses compostos é o
análogo da hipoxantina,
alopurinol (4-
hidroxipirazol[3,4]pirimidina) (Figura 4). O alopurinol é metabolizado por HGPRT
17
aos vários análogos de IMP (Figura 4), um eficaz inibidor de succinil-AMP-sintase
e GMP-redutase [40]. Conseqüentemente, alopurinol acarreta a inibição da
biossíntese de purinas nesses organismos. Além do efeito inibitório descrito, o
análogo de IMP é convertido a análogos de AMPque uma vez fosforilados a ATP
Ribose-6-phosphate-_ PRPPPRS-Í
liMPl .unJo PPi" PRPPAD~~ \.) Xhantine
~; 4/ " XMP.." "-- HypoxantineAdenylosuccinate . MR / XPRT Guanine
ADSL \ AMD IGMS
~ADP- AMP pPi",l .. G.M.P-GDP~
~ l tivPPi
7~RTt"--PRPP I ::;;rrAdenine Guanine
AA'iI-.. Hypo~antine
Figura 3: Via de recuperação e interconverção, em células deKinetoplastida. APRT- adenina-fosforibosil-transferase; HGPRT-hipoxantina-guanina- fosforibosil-transferase; PRPP- 5' -fosforibosil-l-pirofosfato. XPRT - xantina-guanina -fosfonbosil-transferase;AAH- adenina deaminase.
são eficientemente
incorporados na transcrição de
RNA e levam a uma rápida
degradação dos mesmos,
acompanhado da inibição de
síntese protéica [28].
Alopurinol é utilizado
extensivamente no tratamento
de hiperuricemia (ácido úrico
sangüíneo elevado) e artrite
aguda (gota) [41]. Também tem sido explorado clinicamente no tratamento de
leishmaniose cutânea [42] e Doença de Chagas crônica [43]. Isto se deve, em
parte, pela incapacidade das PRTaseshumanas de metabolizarem este composto
[31, 44]. Entretanto, reações adversas e a falha terapêutica foram observadas no
uso de alopurinol [43, 42] alertando para a necessidade de aprimorar este
composto. A via de recuperação de Leishmania e Trypanosoma se encontra
esquematizada na figura 3. Esta via varia substancialmente entre os diversos
protozoários parasitas e foi revisada em detalhe por Berens, R. L. et. aI. (1995)
[31]. A heterogeneidade nos componentes enzimáticos da via de recuperação dos
18
I F S ( U S P SERViÇO DE 8IB~IOTE\J• INFORMACAO
purino-nucleotídeos dentre os protozoários pode ser uma conseqüência da
pressão seletiva sofrida em seus nichos
ecológicos específiCOS. A maioria dos
,e<X' ~ N_Ã--çi I ) -rJV .. p~_l>;Formicina Alopunnol \ I..
f-l-DeaZ8inOSlra
parasitos, incluindo Plasmodium,
Leishmania, Trypanosoma e Toxoplasma,
_1Qc0. -rfÓ '1fÓlnosina Tubercknn
depende da atividade de fosforibosil-
transferases para a recuperação de purino-
6~Thjoguanosina nucleotídeos [31]."o
Figura 4: Bases nitrogenadas: Hipoxantina eGuanina, substratos das HGPRTases. Abaixo, algunsanálogos de purino-nucleotídeos testados comoinibidores em diversos parasitos protozoários.
Estasdiferenças entre as espéciesde
Leishmania e os hospedeiros mamíferos
tornam a resolução da estrutura tridimensional e o estudo de mutantes das
PRTasesmuito atraentes como alvos para o desenho racional de drogas [29, 39,
40].
2.2- Trabalhos apresentados em seguida
() Apresento em seguida quatro artigos relacionados com a família das fosforibosil-
transferases (PRTases). O primeiro descreve a estrutura cristalográfica da
Adenina fosforibosil-transferase (APRT) de tetstimente tarentolae em complexo
com o produto de reação AMP. Esta estrutura foi resolvida a 2.2Â e permitiu,
baseado na sobreposição estrutural com outras PRTasese calculos de potenciais
de interação molecular sugerir que o PRPPé o primeiro substrato a se ligar ao
sítio ativo, enquanto o AMPé o ultimo substrato a deixar o sitio ativo.
19
o
o segundo artigo descreve a estrutura cristalográfica da APRT humana a uma
resolucao de 2.1Â e contendo AMP ligado ao sítio ativo da enzima. A resolução
dessa estrutura permitiu a identificação de importantes residuos envolvidos na
especificidade ao substrato e discriminação de bases. A analise da estrutura da
APRT humana com os dados clínicos de pacientes acometidos de urolitíase
forneceu informações estruturais para os mecanismos pelos quais essas mutações
levam a urolitiase.
O terceiro artigo descreve a clonagem, caracterização molecular e a cristalização
da hipoxantina-guanina fosforibosil-transferase (HGPRT) de Leishmania
tarento/ae. Esta representa a primeira HGPRT de Leishmania cristalizada. Uma
publicação descrevendo as analises decorrentes deste trabalho esta em fase de
redação.
O quarto artigo descreve a clonagem e caracterização molecular da xantina
fosforibosil-transferase (XPRT) de Leishmania major. A cristalização desta enima
ainda não foi obtida, porem um modelo estrutural foi obtido baseado na estrutura
de outras PRTases descritas anteriormente. Este artigo foi recentemente
submetido para publicação.
1. Silva M, Silva C.H, Iulek J, Oliva G, and Thiemann OH. Crysta/structure of
adenine phosphoribosy/transferase from Leishmania tarento/ae: potentia/
implications for APRT cata/ytic mechanism. Biochim Biophys Acta.
2004; 1696(1): 31-9.
20
2. Silva M, Silva C.H, Iulek J, and Thiemann O.H. Three-dimensiona/
structure of human adenine phosphoribosy/transferase and its re/ation to
DHA-urolithiasis. Biochemistry. 2004; 43( 24): 7663-71.
3. Monzani P.S, Alfonzo J.O, Simpson L, Oliva G, and Thiemann O.H. C/oning,
characterization and preliminary crystallographic ana/ysis of Leishmania
hypoxanthine-guanine phosphoribosy/transferase. Biochim Biophys Acta.
2002; 1598(1-2) :3-9.
4. Castilho M. S., Araújo A.S., Ollva G. and Thiemann O.H. Biochemica/ and
structura/ characterization of Leishmania major Friedling xanthine
phosphoribosy/transferase. Moi. Biochem. Parasitol. Submetido.
21
Avaltabte onllne at www.sdencedirect.com
aetI!NCI!@DtRI!CTO
ELSEVlER
Crystal structure of adenine phosphoribosyltransferase from Leishmaniatarentolae: potential implications for APRT catalytic mechanism
M. Silvaa.l. C.H.T.P. SilvaR.I, J. Iulek", G. Oliva", O.H. Thiemann":"'l~f(JY» qf 1'ro1d1l (.'ry>ltltlógraphy ••1IJ SlrucmJ'i11 lIIúló1!>' 1'ity,kJ<l",tiM" '1S';••, ('",,},....Uoit"",Ir/" SJ& l'on,fn.(ISp,
á>. 1h'lbalhadw SJ.x~ .«()(J. p.o. B~' Ji$9. 13566-J9tJ. Sliô Cerlo», SI>.brazil• Dq"""KMI 1>/Clttml$fr): BtOlult"ology eMt"", SIQ/{! lf'd'''f'Kit? ~fP""1a (iro esr, PR, lJra:til
Rec-civcd I May 2003; """'1"00. Úl revised funu 31 My 2003; •••.""pkd 5 &v_ti>« 2003
-----,------
TIl" ülrc(-tlimcnsionaJ wlrncturc of ÚJishmania ialfl'ltlQ1ae adcmno: phOlll'horilxll>yltr.tlI5f~'UlS<: (APRT, iu C<JIul'lcx with adcIl05ine-S.monophosphate (A.\fP) and a pbo;;pbatcÍUllllll$ been sclved, RdiucU!cllt agaiusl X-ray dillIa<;tioll dala cxtcllding to2.2-Á I'C$QlutiOllled to afinal ctystallog.raphic R (acIm of 18.3% StnldUllll C.(IIllparisoll$ ammgs1 this APRT enzyme and otber 'type I' PRTases wbose snuemreshave been dctemuncd revesl 5e\'cntl illll'ortallt lbalmes uf th.: I'RTa~'S catalytíc mechanism, Based U11muctural i~itioos andmoleeulllr lnl.mtctionpotential calculotíoll$, íl was possibl~ to SIlggcst tlm! the I'RPP ís tlte fsst substrate 10 bínd, wbile lhe AMl' is th.: la.<;tprod\lct 10 íeave lhe active Sue, ín accerdance to recent kinctic studies pertormed with the Leishmania JQlu>Wl11i APRT,t,p 200.1 El$!vier II V. Ali rigbtwf.eserved
1. Introductioll
The biosynthesis of purine, I>yridíne and Pi'rimidínenucleotidcs, as well as t)f tIrotuatic amíno acid" is Catt1lyzedby enzymes of the phosphoribosyltransfernse (pRIase)furoUy. Moo organísms llYUthCSjZ~adenine Iluoleotidcs bybotb the de novo and lhe salW1ge pathways. I'n eontmst;prctozean parasites are striot })Urine nucleotI~ fUlXotrophsbecause of the absence ar 11 purine de. novo bíosyntheticpatllWa)' [I l- ll1crefol'c. 111<>1'areabsolutély dependent ouseavcnging proformedp\lt'Íll<} nueleotides fcom the 1\00 01'lhe media, Kinetoplastid profu:roa from the genus Lels"-numia possess tllt'ée PRTtlSes iuvoWed lu tlle rceyelillg ofpuríne nucleotídes bythe solvageputhway: adenille PRTtISe(APRT) (fie 2.4.2.7), hypcxamhíne-guanine )'R'rlí$o(lIGl'RT) (EC 2.4.2.8)ml<l xanthine PR1àse (xpRl) (EC
Ablllwiilli(W' I'RI'P, ,SI ,p~lI~-I).ríbosyl-l'.p)'JVplloflllhalt; Pl'í,PJIl"l!'hospbllt; Al'RT, adq:h:epho&jlhori!iosyllrallsfctasl:; Ol'll:l'. orolatc~llOrilmyJ 1raIlsfenm:;1Kif'1t1',.ll}poxmllhine-~phalpbQrílmyl..--r..r-;Xl'Itt. ~ p~y1Ira1lsiC:tasl:
• ('~s: ~ 1\01.; +)$.1647l-9'156; f;!x;+S5'J6473.98&1.
e.•••"aadtI_" tl,ic~f;Se., •••.bt(PlL ~).I nw ••• ú!I:Qr~COll~ éCjlWI)' ro Ihú~.
lS7(j.9õ3íli$ • sceíiw1t _ () l(l()3l!~lI:.rB.V.AIl righIÜ~.dl>i:IO.l(Jllí1.~p~3.09.oo3
2.4.2.22) [21. 111CdiJlere»ces in purÍlle llucleotide metaM-lism betwcen the llllllnmalilUl hoo and tllc prorowan para-sites have stimulated considereble interesr in lhe 5ldvagcplllhway as a potentíal !arge! for ehcmotherapy (forreview,see Ref. [2]).
Leishmanta tareutolae, n.j)fl1uíte or th~ gecko IiZlll'ds,hes been exploited by OUf as well as other Iaborarories as amodel trypanosomarid for a variety oI 1U01eculat, bioclwm-li:al and evoluuonary swdies. Several l'RTases have beencl~ from dItIeront organisms. Howcver. ooly IhrecAPRT enzymes have been crystallized IUId had tllCtt $Il'Uê-ture determined: (i)tbo Leishmama dOllovani Al'ln' inCCII!lf'!CX wlth three dillerouí ligtmd~,. ooenllíc, AMP au)dcírrate-suífare í011S [3}; (ti) lhe SocchnlTmlJ1Ces cerel'isiaeAl'RT, in two forms, one wíthou; au)' IigiUld tuld analtenlative (onu wílh li su!fate ion ínthe tlCÚve sUe (41and (iií) the Giardta lamblia Al'RT in complex. with either9..<Jeazaadenillc píus sulfuteor wilh MgZt_phosphóribOsyi-pyrophospblrtc (5).
Thek:tIOWll PRTnse.stl1.u::tuIés fall infO two groups .. TI1C'ty!>c I' PRTnscs are idelltitied by li CCltlSM'CÓ PRPP bíndingmotif whích features fwo adjllCCllt acidic residues sur-l'Owlded by one or more hydropbobic rcsídue [li}. ThesePRlàseS reveal 11 CQ~ «!~foldanhePRl1> motifandafíexible loop, besides a core regiollOflrt le{j$ttive. pa.rallel.~
22
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Articles
Biochemistry 2004, 4.5. 7663"" 7671 7663
Thrce-Dimcnsional Structure 01' Human Adenine Phosphoribosyltransfcrase and ItsRelation to Dl-l/v-Urolithiasisl-'
Mareio Silva}.!; Ca rios Hennque Tormch de Paula Sílv<I,§/'·l Jorge lulek." and Otavro Hennque Thlem3nn"'~
Laboratory ofProtem Crysta{/qg,'al'hy and SII'Ué·llll'á/lJi()log)'. Ph}"iCS Instttute óf Sào Carlos. U,,"~~·.'llyOfS",) Pau/o.AI!. Trabalhador Sõocarlense 400. P/> 80x 369, 13566·590 Siio Certos; SI'. 81''';11, and Departmem ofChcJ/1í.<try,
l:Ilol".'h,w/{'gy Center. Suue U"it·ersit., of Ponta 0,.0$;"" PR .. Bruzt!
n""'''ÍI'"d NN"nnbe,. /9, 1003; n,,'fts.,J .Ham,seríp! nec"h·.,J AJwd 14, 200./
A8~'TRAcr. ln mammals, adenine phosphoribosyhransferase (APRI. r~ 2,42,7) is present in ali tissuesand provides lhe only known rnechsnism for lhe metabclic salvage of adenine resulting Irom lhe polyarninebiosyrnhesis pathway or from dietary sources. In humans, APR,T dcficiency results in serious kidneyillness such as nephrolitluasis. interstiunl nephritis, and chronlc renal failure as a result of 2.8-dihydroxyadenine (DHA) precipitation in lhe renal interstitium. To address lhe molecular besis ofDHA-urolirhiasis, the recombinant human APRTwas crystallized in complex wíth adenosinc 5'-mollophospoote(A.\.fP). Refinement 01' Xsray diffraction data extended to 2.1 Á resolution led to a final crystallcgraphic&><1'" of 13.3% aOOan Rr,,,, of 17.6%. '11IÍs structure L'!composed of nine J}-strands and six n-helices, andthe acuve sue pocket opens slíghtly w accommodate lhe Alv1P product, The core 01' APN.T 18 similar tothat 01'othcr phosphoribosyhransferases (l'RTases), although lhe adenine-binding domam is quite diffcrentStructural cornparisons between the human APRT and other "type I" Pk'Iases of known siructure revealedseveral important Ieatures oí'the biochemistry ofPk'Iases. We propose íhat lhe residues located 111 posiuonscorresponding to Leu 159 and Ala 131 in hAPRT are rcsponsible for the base specificitics ar typc I PRTllSCS.111e compararive analysis shown here also provides structural information for lhe mechanism by whichmutations in lhe hurnan APRT lead to Dl+Avuroluhiasis.
Usuallv, adenine is deteeted at low levels ín blood andurine duê to APRT activity (1, 2). lu mammals, adeninephosphoribosyltrnnsferase (APRT)I is prcsent in all tissuesand provides lhe only known mechanism for lhe metabolicsalvage of adcninc resulting fram lhe polyam me biosynthesispalhway or from dietary sources (3 - 5)" Two tyres af
t 11W: work Wll$ iIlJ'p..>Ii,-"l ia J>8I1 by ("JlaIlI 99102814-9 (FAPIlSP')liIod "",'t'ived fi'''lIldi.d '''.1'1_ f")II! lhe UNOPíWOtId llwtk.'WHOSpecial Prov-.lmme ror R_ar~h and Tt1Ú1IÍJl8in TropiCál Dí~Il'.ut.{TDR) (10 Q,KT.). MS. and CH.T.d.P.s. aro FAPESP fuU""Wúptl,,-ard~. This wQd: has bcen plll1illlJy IUpported by lhe NationalS}"ehrott •.••' t.íghILMbood"')· (LNLS). BmjJ, ~I 123.710'2, forilw data ccll«lioo aI lhe Protda C.ryót3Uograpby Beamline,
1Coordinat"" f()l lhe hllln"" APIIT X-tllY $ll'uctlllc 118\''' bccnMI"""led ú. jhe PI'<>I~1ftDa~, Baul: <"lIby 1ORg),
• To wlwm I;m,,~~ld",W .bould be addremd l'IUJlI(!;(55-16)273·8089, Fax: (55-16) m·9SSLE-r1JIIiI: lhíCUHlllll@if-'C.!l$p.lv.
t U"jv\'!t'I'Íty ,'>I' São Paull,)."11,_ lmUIOl'Jconltibuted equ<llI)'to \lu, work.10Urel1l adm-: $cl\ooI ofl'harm_liool SOÍ(1_ of Ribeirà o
Preto, Unlwuíll. ofSiíl Paulo, Av. de>C..afé,VII, 14tt40-903 RibcirílóP"''1ô, SP. Brazil.
• S late Uní\'!mÍiY of Ponta Or,,"$4.'Abbre\-laIiOlIil: AI'RT, odoI,ulj' 1~lO$Jlborih<Myll.r_ferl!i<e;Pltr""",
plwphtYilx'$j1Imnsf«aBe; hAPRT. human adeJlioo phO$pholihofyt·1ran$f~ lPTG, j$l.'lJllX'P}1 P·I.l-Hbi~ctopycanOOde; 3D, tlm.'e-dim."sia\l\l; AMP, .'OIIt"cm, ••q>t,,',;phate; Tm, 1l:is(l~)'JIIt'lhy1)-atnlnomethane; SOS -PAGE, mum dod«yl rulfate-pol)'lI(f)'bmidegcl clcctrophocciis; PRPP. pllooIphoribQ$ylpyrophospluttc; PP, 1'>,,1,"1-p!límphah •.
deficiencies are curreruly recogmzed in humans, both dueto mutations in the APRT gene. T~l)C I deficiency is lheresult of a complete loss of APRT activity (5)., whereas intype D dcficiency, APRI has fi rcdueed affinity for PPRP,Jeading to li ll)-fo/d increasc in lhe K", for Ihi$ substrntil (6).Both types 01' dcficicncy resuh in lhe accumulatíon ofadenine, which is then oxidized by xanthine dehydrogenase(XDH. EC L2.3.2) to 2.8-dihydro~')'adenine (ORA), via an8.hydro.,yadenlne intennediate (7). DHA either is eliminatedthrough lhe urine or, in largc amounts, cen precipitate in lhelddn..}' tubulcs due to its 10\1/ solubility, resultillg in 2,8-. díhydro.xyadenine stones aOO urolithíasis (8). The majorclinical manifestntions associated wíth APRI deficiency-rclated kidney diseases are thc appearance ar kidney 510nO$,crystalluria, bematuria, dysuria, and infections in lhe unnarytraet (8). Such 11 clínica I profile can resuh in severe kidneyfaílure.
PbosPtoribosyhl'llllSferascs (PRTases) caralyze lhe dis-placéltlent of a PRPP (l·1 '-pyrophosphate lhrouz,h linítrogell-containing nucleophile. The reaction produets are a /l-1-substituted ribose 5'.phoophate and a free pyrophosphate (PP)(9). Thc nuclcophile \Qr mos! PRTa~ is 11 nucleetide base,while lhe product is II nucleoside 5'-mon~,phol.-phate. lheproposed oocleopbilic llttack by thcpunne \.'l( pyrimidíne baseai lhe PRPP ribose Cl' atom involves a sequential proccss
10, 102Vbí0360758 CCC; $21.50 (> 1004 Ameríean Chenúcal SocietyPobliahed on Web 0512512004
31
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
EL'5EVIER fI.oehimio .1 BiophyoÍ<:O ActA J 59&(1002) l 9
Short seqoonce-paper
Cloning, characterization and preliminary crystallographic analysis ofLeishmania hypoxanthine -guanine phosphoribosyltransferase
Paulo S. Monzani ", Juan D. AJfoIlZO b, Larry Sirnpson b. Glaucius Oliva li, Otavio H. Thiemann 11.*
'Lilboral1»Y of PmMIt CY)$tãlk>gr""J,y ami SmMUTiJ! 81ol4gy. Ph)$ítS lll$tlhil., ef Siió Carios, If"r.·trsity of S.i" P",,/(} Usp'A", 1lub<,lhador SJ"""rkt ••" 41)(). 1'>566.,90. São C•• ríos "'Si'. TlnniJ
~lI(J••.anJ il1Igh", J>kJü:aí111$11''''/0$.}.b~1J JluiúlÚlg. 9i)()9J·J66::. VCU. L"$ Angel.:!>. (Ji. t:~Received li NoV<'lllbct 2001; at«pl<d 4 FcbruaJy 2002
Abstnct
H)'flOxanthioe gllaninc plmspboribosyltt:lI",fem"" (lIGPRT) (EC 2.4.2.8) is an ímpot1llnt enzyme ín\'olved ín the r.,cycliog 01' puno"aucleotídes in ali cells, PafllSitic protozoa of lhe order IGtleWpbslida are IUlable lU synth<:$iu purínes de 1IOVOlUld U5e lhe salvsge pathwayfor lhe SYlltl",,,,1sof nucleOOdes; dlCrcíO«'. this pathway is an IIttr.tCIlve tar!l.\-'1 for lIutiparasitic drug <ksIgJl. 111\:hgpr/ gaJc was clollcd liom aU,;slunani"larenldlaegenomic bm-ary 30.1 lhe ""'l""nce de1e"lI'Iiucd. Tbe L: ,_«,Ia ••hgpi'l se ••e UM'!.";"" a 633 ,,,,,deolíde openreadingfiante lhat eecodes a 23,4-kDu proteín. A pairnise aliguruent oftbe diftCt\mt HGPRT's $CQUMCeSrevealed a 26% 53%:sequence ldentity\\'ilh thc úish",,,,lia sC'luenca lUld 87% idcntity to lhe HGPKr of Leishmaília donavanl. A rCAXlltlhinant protein '-"'aS expresscd in&cJterichia colí, puriticd to hOlDogellcity and iound to retain enzymlltÍc acti\'ít)'. Tbe rtcltd}'·state kineuc paratnel(.'t$ were do;,tcnllÍllcd for U",reccmbinant enzyme and lhe enzyme is aetive as a bomodin~ in soluUoll. Sing1e cl)'$tals were obtllined for thc J~ tare1l1al{tlt HOPRTrepresentiog lhe fim LelshmanJa HGPRT Cl)'$taUizeJ and initial crystlll~phic data ~'Ue collecsed, lpe et)'$t:als obtained belong to theorlhomombic$p3ce groul'(P212121)\\'Íth unit«lJ p~a"58.104 A,b ••S5.443 A and <:=87.398 A and díllractto a n:solution 00.3Á. lhe nvailability (li thc HGJ>RT enzyrne 110m [-e/s/Ul/anJo and ilS Cl)'$taUkatinn suitable for X-ray díffraction data collection sbouldprovide lhe basis for a fUlIClíolllll and sl:tUCluraJ analysls ar dÚ$ et12)'uIC, ""bieh has b..'CI1 proposed as a potcutiaJ brgct for rational drugdesign, in a Leishmani« Inod<:l,;ys! em, Q 2002 Elscviec Sci<._ a.v. AlI rigbts reserved,
Most organisrus ~)'nthesize purine nucleoudes by bothlhe de novo and lhe sal vage pathways, 111coutrast, proto-zoan parasites are strict puríne nucleotide auxotrcphsbecause of lhe absence of a purine de novo hiosynlhcticpathway [I]. Enzymes of lhe phosphoribosyltransferase(PRTíUiC)Canul)' eatalyze the biosymhesis of'purine nucleo-lides. Three PRTase enzymcs ar-e known 10 be involved inlbe recyclíng of puríne nucleolides lIy lhe s..1lvage pathwayín lhe Idnetoplastld protozoa fi'om lhe geaus Leishmanía,hypoxanlhinc-guaniue PRTasc (HOPRT) (EC 2.4.2.8),ooclllnePRTII&e (APR1) (EC 2.4.t. 7) and xanthine PR:1àse(xpRT) (EC 2.4.222) (2). HOPRT is responsible for cata.tyzing the conversicn of guaníne and hypoxallthine and «-J)-S-pho$phoribosyl í-pyrophosphate (PRPP) imo guaninl>-5-monopbosphate (GMP), ínosinc-â-rmmophosphere and
• ('~1"'ndilli'l''''tMt, TeI.:.•55.1(>-213-9751>; llIx: 455·1f,..173-98i1.e4J;(l11 ~"~M@~f"",.1lOp.br (O.1I. Thiemo.m),
GI67-4S)$I()2!S· _ JiOIlImall~t e lOOl m-ier S~ D.V. AlI ri$bls ••••••••••«l.l'll: Só 167-4S3~(Ol)U0334·S
p)'J'ophQsphate (pPi) [~J, The only hgprt gene that has bcencloned aad cliaraeterized from the Leishmania genus is thatfrOOl 'Leishmania donovani [4J and no strucmral data are.Imown for tI\C Cltl.yme of this l)lU1ISitcgenus. Tbe avail-abUity oime 1JypaItQse»na CYIlEI UOPRT saucture [5] is ofgreat comparatíve ímportance and wiU be used for themolecular suhstitutí<m approach.
Leishmania taremolae bas been exploüed as li modelLeishmania for a varíety oC moJecular, bíochemlcal andcvolutiollary studies. TI\C cvolutionary data support theínclusíon of L. taremolae as 11 monophyletic cíade branchingbetween lhe Vitlll1lia aud Leishmallia SIIbgenem {6- 8], Asin fhe case. or otber ttypanosomatids, L. tarentolae ís lipuríne nuc)cotidc auxctropb {9]. The case of cell culture andgenetic annlysis of L. taralliQkJe shoeld facilitatc its \1..'«: forsite-directed mutagenests of' lhe hgpri gene as well as forfunctiol\a! complementation and testlng af inhibilory sub-stratcs for lhe tationa! drug ~ign fur futuro lcisbmaníasischemotherapy; We deseribe Jn this plljlCt lhe cloning,
40
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Bíochemícal and structural cha racterizatíon of Leishmanla major Friedling
xanthíne phosphoríbosyltransferasc
Marcelo S. Castilho. Alexandre S. Araújo, Glaucius Oliva and Otavio H. Thíemann ,.
Laboratory of Protein Crystallography and Structural Bíology. Physícs Institute of São canos,
Uníversity of São Paulo - USP, Av. Trabalhador Sãocarlense 400, PO Box: 369, 13566-590,
São Cartos - SP, Brazil.
• Corresponding author: Tel.: (55-16) 3373-9756; FAX: (55-16) 3373-9881; E-maU:
thiemann@íf.sc.usp.br
Keywords: LeishmaniB major, XPRT. xanthine phosphoribosyltransferase, homology
modeling.
1
47
Protozoan parasites of the order Kinetoplastida, as well as severa I known protozoa, are stríct
purine nucleotide auxotrophs (1], lacking the entire de novo purine synthesis pathway and relying on
the host and the recycling by the salvage pathway for lhe required purine nucleolides. In contrasto
most organisms synthesize purine nucleotídes by both the de novo and the salvage pathways. In the
kínetoplastíds three PRTase are known to be involved ín lhe recycling of puríne nucleotídes;
hypoxanthine-guanine PRTase (HGPRT) (EC 2.4.2.8), adenine PRTase (APRT) (EC 2.4.2.7) and
xanthíne PRTase (XPRT) (EC 2.4.2.22) (2]. XPRT is responsible for catalyzing the conversion of
xanthine and o.-D-S-phosphoribosyl 1-pyrophosphate (PRPP) into xanthine-S-monophosphate (XMP)
and pyrophosphate (PPí) by the anomeric inversion of the ribofuranose ring [3]. Kinetic analysis of
Leishmania donovani XPRT revealed that this enzyme preferentíally phosphoribosylated xanthine but
could also recognize hypoxanthine and guanine [4] as substrates. The structural explanation for such
selectivity remams unclear, since the only structural ínformation available comes trom E. coli XGPRT
crystallographic structure. In that structure. the substrate specific interaction with Glulle and ASpl40
resídues through a water molecuíe, could bê responsible for guanine > xanthine » hlpoxantine
selectivity (5; 6].
In a broad project to design Leishmania specífic inhibítOrs. we have cloned the xprt gene trem L major
Friedling based on the sequence identifted in lhe Leishmania genome effort. We overexpressed the
recombinant enzyme to homogeneity in a heterologous expression system of Escherichia coIi. The
access to the recombinant protein aRows the kinetic characterization of the recombinant enzyme and
opens the possibility of às use ín the seareh for novel PRTases inhibitors, as well as the molecular
understanding of base selectívity of each PRTase. To advance our understanding on these essential
enzymes a structural model based on homology principies was built. According to molecular dynamics
protocols thís model is stable and ean correctly account for the XPRT topology.
The L major xptt gane was amplifled by PCR (Polymerase Chaln Reaction) trom genomic DNA with
olígodeoxyribonucleotides primers specitic for the 5' and 3' ends of the known L. major xprt $Iene. The
primers for PCR amplification introduce a Nde I and a Xho I restriction site at the highlighted positions
(5' TAGCTACATATGCTACCAACCCACATG - Nde I; 5'TCTCGAGTCAGAGCTIGGCAGGATAAC
GGG 3' - Xho I). The xprt DNA fragment was ck>ned into the expressíon vector pET-29a (Novagen) at
the Nde IIXho I sites and transformed into E. co/i Bl21 (DE3) competent ceUs by standard protocols
[7]The amplified xptt DNA contained an cpen reading frame C/f726 base pairs that encodes for a protein
of 241 amino acids wlth sequênce ldentity to other XPRTases. Alignment of L. major XPRT with other
sequences highlights the conserved purine and PRPP binding domains (fig1) [8]. The predicted amino
acíd sequence of L. major XPRT shares 87% ldentity with the L. donovan; XPRT [4] and sequence
divergence is mostly concentrated at the N- and C- términus regiC/ns.
2
48
The purification of recombinant XPRT was carried out at 4°C unless otherwise specified and using the
following steps: E..w/i cells were induced at an 0.0.600 of 0.8 with 0.5mM IPTG for 15h at 20°C in LB
media, and harvested by centrifugation (25000g for 15 min.). The cel! pellel was dissolved in 100 mM
Tris-HCI, 10 mM MgCI2. 1mM PMSF and 1mM \eupeptin. pH 7.5 (buffer A) and ceU Iysis was
achieved by ten 1-min cycles of sonication ln an ice bath. The crude extract was clariüed by
centrifugation (25OOOgfor 15 min.) and brought to 50% (wlv) ammonium sulfate for 25 min with slow
stirring. The suspension was separated by centrifugation (25000g for 15 min.) and the pellel was
dissolved in 5mL of buffer A and loaded in a 16-ml Phenyl-sepharose column. equilibrated in buffer A
+ 1M (NH.}~04 at 0.8 mllmin f1ux. XPRT eluted at O.7M (NH.hSO .•.The proteln fractlons were pulled,
desalted ín a 15mL Hytrap desalting column and loaded lnto a 1SmL Fast flow Q-sepharose. XPRT
eluted in the column void with only trace contaminants as revealed by commansie stained SDS-PAGE
(fig.2).
3
49
"""I., .•••. ,'\U'
1..d_ •.._1·"",<"011
---Nl,Í"Utuc Y-<';t'v':t:··-··Ml,f-~J1:';:C r.<J:P'1/!.<
.$i6f
L •••••}~c
".~"-E.có.U
1f.Z: _":""':"":_I ,l~~ •.• ",:"l~Ç., ~_~:~~t::_,_",.,l~"..l ..~r_"'"'.,~~tl
"·S., .• . • - - • . T_ ~---- ~ •. - . - '--: _.. •• •
":'$ • , . - .. --_._-- --. '.: ,:l1 ~~--_#_...~._- ';:;; t'l" '·I1JI···-H~U_"""'-~~#~ ~ (- - --:--~;tJt----~ ";1;.' - l:"~l .•
PRPI>~.'3_'" ,;';" ... :~".'.""':%.'''.l,,-..j0' H' '." -, _~_ "L.~".,..t H' ,', -, ...• E.C!i>lJ. lt4 _ ,W· r - -~'V :s: (l A~_-A ~A
....•r. .•• JorL.doaov •• l·C.~J.
Figuté 1· MuJlipli: alignments of I\,pt<""tlt~ti\'. XPRT sequences, 1M _mo aàd """UCtl<CS of _«ai XJ>Rl' prolcitl$ aré sho,vn alillhed ",tb lhe I•.
mqjor FricdlinJ: seqUé",,", 11.: ••••;"" acid pO$itro... 41'\: indiClIl"d ai the .id<-'$ .". lhe alignment 111<:shaded boxes Indi."... conscr""d mutaú"" (g""}) and
conllt:t'\·"d rcsid_ (bI~ck) and lhe pr«Iícl«l I'RI'!' bindi"l: .il< i. hígblighled in 11.: pktur." The wqw:n.:" '''<1 rc",~,,,"I. lhe sprt I""" cl<m.:d i•• 011I'
labor.llory. The """""n""" W~,.ClIIiS""d by Ih.: CU;STAl.X progfll1ll/9]
4
50
1 2 3 4 5
Purification Total Protein Specific Purification
step (m gIm I) Activity (U) fold
Lysis 217.8 8.01.10.4 O
(NH4hS04 138.5 1.2.10"3 1.4
Phenyl 51.0 1.9.10-3 1.5sepharose
Qsepharose 15.5 3.6.10.3 4.5
Figure 2- (upper penal) Expression of L. major Friedling XPRT in E. roli ano purification of 1he
recombinant protein .. The proteins were separated in a 15% SDS-PAGE gel. Lanes: 1-molecular
weigh marker. 2-darified extracts (S20000 supematant). 3-ammonium $\Jlfate precipitate fraclion.
4-pooled fraclions from Pheoyl sepharose HP. õ- pooled fraclions frem Q sapherose FF. (Iower
panel) Table of XPRT purification.
The kinetie parameters of L. majorXPRT were determined spectrophotometricaly at2Q4 nm as
described by Jardim et ai [4] at 25°C over a 30 seconds reaction. The Km Valué for xanthine and
guanine are símilarto those reported for L. donovani XPRT 7:1: 2IJM forxanthine and above 100 IJM
for guanine. The Km for hypoxanthine of 61 ± 26 11Mfor L. major XPRT differs by sEWen-fold to the Ldonovani XPRT 450 ± 97 11Mfor the same substrate. Such contrast in Km values ean be due to small
5
51
structure differences between the two enzymes. Unfortunately. the structure of nelther enzyme has
been determined at atomic resolution. This fact prompted us to model L major XPRT 3D structure
using T. cruzi HGPRT. another Type I PRTase (Poe code 1TC2) {10]. as a model (figure 3a). This
task was performed with the Modeller program [11].
Despite low sequence identíty among XPRTases, ali type I enzymes show a conserved folding
comprising 4-5 parallel (} sheets flanked by 3-4 (1 helix (12] which should be conserved belween the
tamplate (1TC2) and our homology based model. Ramachandran plots [13] and Verify-30 seores {14]
were used to evaluate the quality of the best 3 modele. Ali residues of our model are Iocated in
allowed regians. Verify-3D seeres for individual residues. with a stiding window of 21 residues. were
aboveO.2.
6
52
A B
Figure 3- The
panel shows
1TC2
aystallograp
hic structure
and the
XPRT
homology
cgenerated
mode! in
three
dífferent
confonnation
s. (a) 1TC2
secondary
structure is
presented as well as PRPP and alopurinol binding sites. (b) XPRT homology mode! generated by
MODELLER 6.0 program shows high topological similaríty to 1TC2. except for the first helix which has
not been modeted. (c) XPRT energy minimized structure show that hood domain loses most
secondary structure in the absence of ligands (during mínímízation and molecular dynamiCSstudies
only protein atoms were considered). although the PRPP binding domain is overall conserved. (d)
XPRT model after 200 pico seconds shows that the overall topology is stable.
Molecular dynamic simulations. using the GROMACS [15] package, were used to evaluate the
molecular stability of our rnodel. The model was relaxed through energy minimization using the
conjugate gradientalgoríthm, followed bya 100 pico seconds molecular dynamics at300K (27QC) in
vacuum.$ubsequently, 5260 water mo/ecules were added to the system resulting ina rectangular box
of 6.4 x 6.4 x4.5 nm.An energY minimization was performed using the conjugate gradient a1gorithm
and then a molecular dynamics símuíatlon was carried on at300K (27°C) and 1 atm for 200 pico
7
53
seconds. A time step of 1 fento second and perlodic boundary condltions were appílad in ali
simulations. The long-range coulomb interactions were computed using the PME (ParticJe Mesh
Ewald) [16] algorithm and for short-range coulomb and Van der Waals interactions a cut-off of 2.0 nm
was used, For temperature and pressure coupling we used lhe Berendsen algorithms [17]. The overall
three-dimensional structure of the model did not changed signifícantly through out the molecular
dynamics simulation. For a matter of comparison. the initial and final structures are depicted in figure
3b.
From tha superposition of 1TC2 on our homology mcdel, It can be seen that when the puríne
substrate ís located in the binding site it shall interact with residues Va1121.LYSI52.Tyr174.lIe175and
Glu1Bt. It is hypothesized that Tyrm and Va1121encase the purine ring while the other residues are
involved in hydrogen bond interactions.
In facto XPRT purine bínding site model differs trom the template HGPRT onlyin residues
Valj21. Tyr174,Phel80. GIUj81(lIeI13. Pheuw, Leu170.ASP171respectively). Therefore we hypothesize that
these residues must be responsible for xanthíne. over hypoxanthine selectivity. As previously
described {18]. severat subtle structural differences contribute to the efficient use of xanthioo over
other substrates. Indeed greater xanthine selectivity may not be attributed to just one or a few
particular amino acíds, sínce substrate posltionlng in the active site may play an important role ln lhis
subject. For instance, ín the human HGPRT [19,20J. guanine binds through a hydrogen bond between
NH2 and the main chain oxygen of resídue Asp2O$,while xanthine binds through a hydrogen bond
betweeo carbonyl oxygen and ASP206maio chain NH. revealing that selectMty is due to substrate shift
inside lhe purlne blnding site.
Although an entire understanding of substrate selectivíty would require a complete structural
analysis, 11is well eslablished lhat some of the described mutations are related to xanthine selectivity.
Just to name 000, as described for Tritrichomonas foetus HGPRT [21], Tyrm hydrogen bonds to
GIUle" repositioning the maio chain NH to interact with xanthine. It must be said though that thera ís
some evidence that this interaction is not critica 1to xanthine use. First. humano Trypanosoma cruzi,and Plasmodium falciparum HGPRT have phenylalarÍine at thls position, yet P. faJciparum HGPRT tsable to use xanthine effectively. Second. the Trp199Phe mutant of T. gondii HGPRT has robust
xanthine PRTase activity [22].
Folfowing the same superposition strategy, the PRPP binding site, whose residues are quite
conserved 10 type I PRTases. can be easlly identlfied ln our model (LVSw. GIY80,Tyr8$. ASPI2:1.Serl24,
Arg187).The cisgeornetry between Leuse-LysS9.also found in the structures of T. cruzi HGPRT [1023],T. foefus HGPRT [21}, and E. coli XGPRT [5,6] ís observed in our constructíen. In this conformation,
Cys NH would hydrogen bond to the pyrophosphate moiély and pos~ion GIY60to hydrogen bond to the
8
54
pyrophosphate (as observed ln the other structures). These Interaclions would not be possible had
Leuss-Lys59a trans peptide bond.
Despite molecular dynamic simulalions did no! affect the XPRT model overall folding, the
seeondary structure from the hood domain was not conserved during ali slmuíation interval. This result
sU9gests that substrate binding might influence XPRT cerrect tolding once simulation mímics an apo-
enzyme. In fact, preliminary crystallographic sludies show thal upon concentration XPRT precipitates.
unless in the presenca 01 xanthine. Olherwise, the Ioss of secondary structure in the hood domam
might be a reflex of great f1exibility in this region.
The PRPP binding domain seems to be more stable In the absence of the substrate and was
observed through out the molecular dynamics protocol.
In conclusion, lhe overaU homology model represents a reasonable description of XPRT three-
dlmensional structure, which has already baen used to ratlonalíze the binding of XPRT inhibitors
identified in our laboratory.
Acknowledgment
This work was supported in part by a research grant 99/02874-9 to O. H. Thiemann end 98/14138-2 to
G. Otiva (FAPESP). MSC and ASA received a scholarship frem FAPESP. We would like to thank the
members of the Protein Crystallography and Structural Biology Group (IFSC-USP) for helpful
discussions In lhe course ofthiswork.
9
55
I F S ( U S P SERViÇO DE BIB~IOTECf.• INFORMACAO
References
[1]. Berens, R. L., E. C. Krug, and J. J. Marr. (1995) Purine and pyrimidine metaholism. J. J. Marr and !\L
Mullcr (cd.), Biochemistry of Parasitic Organisms and its Molccular Foundations. Acadcmic Press,
London
[2]. Ullman, B, and D. Carter. (1997) Molecular aod Biochemical Studies 00 the Hypoxanthine-guanine
Phosphoribosyltransferases ofthe Pathogenic Haemonagellates.lnt. J. ParasitoL 27;203-213.
[3J. Musick. W.D. (1981) 5tructural features of the phosphoribosyltransferases and their relationship to
the humao déflciéncy dlsorders of puríne and pyrimldiOé metabcüsm. CRC Crit.RéV.Blochem.
11,1-34
[4J. Jardim, A., Bérgeson, S. E .• Shih, S., Carter. N., Lucas, R. W., Merlin, G. Mylaer, P. J., Stuart. K"
unman, B. (1999) Xantine PhosphoribosiHranferase from Leishmaní donovaní- Molecular
cloníng, bíochemícal characterization and Genetic analysis. J. Biological Chem. 274: 34403-
34410
[5J, Vos, 5., de Jersey, J., and Martin, J. l. (1997) Biochemistry 36, 4125-4134.
(6]. Vos, S.; Parry, R. J.; Duros, M. R.; Jersey, J.~Martin J. L. (1998) Structures of'free and complexed fonns ot'Escherichia coli x3l1thinc-guanine phosphoribosyltran.,fcrasc. J. MoI. Biol., 282, 875-889
(7]. Sambrook, J., Russel, D. W. (2001) Molecular cloning: a laboratory manual 3,dedition
[a]. Hershey. H. V. & Taylor, M. W. (1986) Nucleotide sequence and deduced amino acíd sequence of
Escherichia coü adenine phosphoribosyltransferase and comparíson with other analogous
enzymes. Gene. 43,287t293.[9]. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougln, F. and Higglns, D.G. (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic.Acids.Res. 25, 4876-4882.
[10]. Focia. P. J .•Craig 11I. 5. P., Eakin, A. (1998) Approachíng fue transition state in the crystal
structure of phosphoribosyltransferase. Biochem .• 37,1712Q..17127
[11]. Sali, AJ., Blundell, T. L. (1993) Comparative proteio modelling by satisfactioo of spatial
restralots. J. Moi. Biol., 234. rrs.[12]. Guddat LW. Vos 5. Martin JL, Keough DT, De Jersey J.• (2002) Crystal structures of free, IMP-.
and GMP-bound EscherichiB coIi hypoxanthine phosphoribosyltransferase. Protein science, 11
(7), 1626-1638
[13]. Laskowski, R.A.; Mac Arthur, MW.; Moss. D.5.; Thomton, J.M. (1992). Procheck version 2.
[14]. VRIEND, G. (1990). WHAT IF usar manual
[15]. Undahl, E.; Hess, B.; van der Spoel. D. (2001) GROMACS 3.0: A package for molecular
simulation and trajectory analysis; J. MoI. Mod., 7, 306.
10
56
[16]. Darden, T., Yorl<, O., Pedersen, L. (1993) Particle mesh Ewald: An N-log(N) method for Ewald
sums in large systems. J. Chem. Phys. 98,10089-10092
[17]. Berendsen. H. J. C., Postma, J. P. M., DiNola, A., Haak, J. R. (1984) Molecular dynamics with
coupling to an external bath. J. Chem. Phys. 81.3684-3690.
(18]. Heroux, A., White, E. L., Ross, I. J., Borhant, D. W. (1999) Crystal Structures of the
Toxoplasma gondii Hypoxanthine-Guanine Phosphoribosyltransferase-GMP and -IMP
Complexes: Comparison of Purine Binding Interaclions with the XMP Complex. Biochem ..
38, 14485-14494
(19]. Eads, J. C., Scapin. G., Xu, Y., and Sachettini, J. C. (1994) The crystal structure of human
hypoxanthine-guanine phosphoribosyltransferase with boung GMP. Ceu 78, 325-334.
[20]. Shi. W. X .• U. C, M .. Tyler, P. C .. Furneaux. R H,; Grubmeyer, C., Schramm, V. L., and Almo, S.
C. (1999) The 2.0 angstrom structure of human hypoxanthineguanine
phosphoribosyltransferasa in eompíex with a transition-state analog inhibitor. Nat. Strucl. Biol.
6.588-593.
[21]. Somoza, J. R, Chin. M. S., Focía, P. J .. Wang, C. C., and Fletterick, R. J. (1996) Crystal
structure of the hypoxanthine-guanine-xanthine phosphoribosyltransferase from the protozoan
parasita Trifrichomonas foefus Biochemistry 35, 7032-7040.[22]. White, E. L., Ross, L. J., Davls, R. L., He'roux, A., and 6orhani, D. W. (2000) The two
Toxoplasma gondií hypoxanthine-guanine phosphoribosyltransferase isozymes torm
heterotetramers J. 8io!. Chem., 275 (25), 19218-19223
[23]. Focia. P. J .. Craig. S. P., 11I,Nieves-Alicea. R. Fletterick. R. J., and Eakin. A. E. (1998) A 1.4
angstrom crystal structure for the hypoxanthine phosphoribosyliransferase of Trypanosoma
cnm Biochem., 37. 15066-15075.
11
57
Capitulo 111
3.1- Via glicolítica
o metabolismo celular para todos os seres vivos utiliza praticamente as
mesmas enzimas distribuídas em algumas sequênciasde reaçõesbem conhecidas
denominadas vias metabólicas. Essas vias metabólicas são responsáveis pela
manutenção da homeostase do organismo. A via glicolítica (Figura 5), por
exemplo, é responsável pela transformação de glicose em compostos cada vez
mais simples
glicolise
glucrn;e I.-(lh"'f'hate
V-NAOP+ + H.O
~~,11l+
"-poosphoghlCOllOlackllle
• ",O6-JIhosrtbõgluconate
fN
AOP+
NAOPH+ H +
eu,nbulose 5-pbosphate
Itf""v..
nlulo" ( rilx"" I 15-pl~teX5-phosphatc
scdoheptutosc gI)'C",aldchydo
7~ate X 3-phosphate
glyceraldeh)'de.. dihydroxyacetone y <rythr~ v: (li"UCtose 1Via das pentoses (não-oxidativa)3-(lhosphate phospbaIe 4-phosrhate 6-phosphate
I. +r 1.7-P,
~ ><XIoIk.1'Iulooe 7-j1hosp/ta1c
glucosc IJ-f'hosphato
1~(;6J>isoF.nerasefructose 6-foI1Osphale 1
Via das pentoses (oxidativa)
fructose I/~kphosphate
J
Figura 5: Esquema representativo da glicólise da via das pentoses em tripanosomatideos. A
enzima glicose-6-fosfato isomerase está indicada em vermelho. A via das pentoses fornece o
agente redutor NADPH e a ribose-S-fosfato, importantes no combate de agentes oxidantes e na
biosintese de ácidos nuclélcos (Figura adaptada de Hannaert et ai, 2003; [47])
58
e a concomitente formação de moléculas armazenadoras de energia, conhecidas
como ATP (adenosina-trifosfato) [45, 46]. Tais moleculas funcionam como
verdadeiras "moedas de energia" e são consumidas por enzimas em outras vias
metabólicas e demais processos fisiológicos, como por exemplo, a contração
muscular.
A via glicolítica pode ser divida em duas etapas (figura 5). A primeira,
conhecida como via de Embden-Meyerhof, é a fase anaeróbica na qual a glicose é
capturada do meio extracelular e degradada até piruvato gerando como resultado
líquido apenas duas moléculas de ATP; o piruvato (ou ácido pirúvico) pode ser
convertido em ácido lático ou a alguns derivados alcóolicos. A segunda fase da
glicólise ocorre nas mitocôndrias, depende de oxigênio (processo aeróbico) e é a
responsável pela produção de 36 moléculas de ATP (por molécula de piruvato).
Outra via crucial no metabolismo é a via das pentoses (Figura 6). Esta é
responsável pela produção da ribose-5-fosfato presente nos ácidos nucléicos e
concomitante produção de NADPH2 , coenzima necessária como agente redutor
-) em muitas reações metabólicas. A via tem como ponto de partida a glicose-6-!
fosfato e produz por descarboxilação as pentoses, açurcares de 5 carbonos. O
ciclo retoma a via Embden-Meyerhof" pela' produção de frutose-6-fosfato e
gliceraldeído-3-fosfato.
Juntamente com as Leishmania ssp, o Trypanosoma brucei e T. cruzi são
outros importantes protozoários parasitos humanos, transmitidos por insetos
hematófagos e causadores da doença do sono e doença de Chagas,
respectivamente. O T. brucei tem sido utilizado como modelo principal em
59
estudos de identificação e validação de potenciais alvos metabólicos para o
desenvolvimento de novas drogas. Trypanosoma e Leishmania são dois gêneros
da família Trypanosomatidea, ordem Kinetoplastida, são caracterizados pela
compartimentalização de parte do metabolismo energético em organelas tipo
peroxisomas, denominadas glicosomas [47].
IGllCOSEI
1 CATPAOP
A primeira etapa
IGlICOSE-6-P INAOP NAOPH2
~ 6-fosfogUcona 6-latona
na pesquisa e
1 21ácido 6- fosloglicónicor=-3 NAOPH2
kido 3-eetoglic6N<:o-6-Pt-C024 . Iribost-5-P I--,iblllosa-S-'
5~ c: tVia de -\ffUt()t'-6-P~IUfOst-5-P ~
EmbchttI- "do-htptufOst-7-P c.:gfice,.ldeido-3-P IMtyerhof -lgliç.,aldeid0-3-p 0fitOM-4-P~ fruto•• -6-P I
t I
desenvolvimento de
novas drogas
antiprotozoários é asinta••de identificação de enzimasnudeo-ldeo$
essenciais para a
sobrevivência ou
desenvolvimento dos
Figura 6: Via de formação da pentoses mostrando as enzimasparticipantes: (1) glicose-6-fosfato desidrogenase, (2)lactonase, (3)fosfogluconato desidrogenase, (4).: fosforribose-isomerase, (5) fosfopentose isomerase, (6 e 7) trancetolase e(8) transaldolase.
parasitos. A
disponibilidade de
seqüências gênicas
obtidas pelos principais projetos qenornas de parasitas permite a identificação de
enzimas e vias metabólicas exclusivas dos parasitos ou bioquimicamente
diferentes das de humanos [48]. A comparação bioquímica é a primeira evidência
para incluir uma via metabólica e suas enzimas na lista de possíveis alvos de
drogas antiprotozoários. Alguns exemplos de possíveis alvos identificados pela
análise comparativa do metabolismo de trypanosomtideos incluem (1) a via
60
glicolítica e via das pentoses, ambas apresentam os primeiros passos de reação
compartimentalizados no glicosoma, uma organela exclusiva dos parasitas; (2) o
metabolismo do composto NI-N8-bisglutationil espermidina (ou tripanotiona) pela
enzima tripanotiona redutase, o composto e enzima análogos em mamíferos são
a glutationa e a glutationa redutase; e (3) metabolismo de folato pela enzima
bifuncional dihidrofolato redutase-timidilato sintase que em mamíferos as funções
redutase e sintase estão associadas a cadeias separadas [49,48].
A etapa seguinte à identificação das vias promissoras é a validação genética
ou bioquímica das enzimas alvos. As duas principais ferramentas genéticas para
validação de possíveis alvos são o silenciamento gênico (gene knockout) e mais
recentemente o RNA de interferência (interference RNA, iRNA) [50]. Ambas as
técnicas visam à anulação por silenciamento ou a redução por interferência dos
níveis de expressão gênica [48]. A validação bioquímica requer o uso de
compostos químicos que interagem de maneira especifica e seletiva bloqueando
ou diminuindo a atividade das enzimas alvos. Esta é uma abordagem mais
) complexa, pois requer métodos experlrnentals para garantir a especificidade e!
seletividade in vivo dos compostos utlllzados [48]. Somente após as etapas de
identificação e validação é que se recomenda "um maior investimento na busca de
compostos líderes que atuem de maneira eficaz e seletiva no bloqueio da enzima
alvo.
A qllcóllse é uma importante, e em alguns casos, a única via metabólica
utilizada pelos tripamosomatideos para a obtenção de ATP. As primeiras sete, do
total de dez, enzimas da glicólise estão compartimentalizadas no interior do
61
glicosoma [45]. Uma conseqüência desta compartimentalização é que as enzimas
glicolíticas dos kinetoplastideos diferem em características cinéticas e estruturais
quando comparadas com as enzimas homólogas de mamíferos e o fluxo
metabólico da via é regulado de forma distinta. [45, 46]. Não apenas a glicólise é
localizada no interior dos glicosomas, mas também um parte significativa da via
das pentoses (Figura 6), que utiliza intermediários da glicólise para formação de
D-ribose-5-fosfato e NADPH, utilizados em processos de biosintese de
nucleotídeos e defesa contra stress oxidativo [46].
3.2- Glicose-6-fosfato isomerase
Glicose-6-fosfato isomerase (E.c. 5.3.1.9) - também conhecida como
fosfoglicose isomerase - é uma enzima intracelular que catalisa a reação
reversível entre a glicose-6-fosfato e a frutose-6-fosfato. Esta reação de
isomerização é uma etapa comum a via glicolítica, gliconeogênica e a via das
-j pentoses (Figura 5).
Em promastigotas de L. mexicana", 90% da atividade da PGI está localizada
"no citosol e o restante, menos de 10%, está associada aos glicosomas. Apesar
desta dupla localização, apenas uma cópia do gene correspondente a PGI foi
identificada e a atividade citosolica e glicosomal são bastante similares,
descartando assim a possibilidade de se tratar de isoenzimas com diferentes
localizações. A presença de enzimas glicolíticas tanto no citosol quanto no
glicosoma varia entre diferentes espécies de parasitas tripanosomatideos e pode
62
ser detectada para a maioria das enzimas desta via [51]. A PGI de T. brucei, T.
cruzi e L. mexicana apresentam menos de 50% de identidade com outras PGI's
de mamíferos e todas as três apresentam um fragmento N-terminal de
aproximadamente 50 aminoácidos que não apresenta identidade significativa com
nenhuma outra seqüência (ou fragmento) pesquisados em bancos de dados
públicos. A função deste fragmento é desconhecida e a hipótese que esteja
envolvido na sinalização para o transporte pela membrana do glicosoma ainda
precisa ser avaliada. Os resíduos catalíticos descritos nas estruturas de PGI de
coelho, de porco, humana e de Bacillus stearothermphilus são conservados nas
seqüências de trypanosomatídeos. Apesar da conservação dos resíduos
catalíticos, diferenças nos parâmetros cinéticos entre a PGI de L. mexicana e a
PGI humana foram observadas em condições experimentais idênticas levando a
necessidade de uma análise estrutural mais detalha das PGIs de parasitas e
humanos.
Do ponto de vista genético, experimentos de RNAi revelaram que a
() diminuição do nível de PGI na forma sançuínea de T. brucei resulta na inibição de!
crescimento de até 50% no primeiro dia e volta a normalidade daí em diante
(Figura 7). Essa recuperação do fenótlpo após os primeiros ciclos é um efeito
comum na forma sanguínea do T. brucei.
63
~ A~ ;' 11.!12 t 1/ !] 10'0 1. li' j~~ i!' I,
I.· .. /' AV· tl
I / / t! l /'j / ;-"'ií ,(_i' - :'L?il "r ,!l li
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4,5Days
• não-induzido
5.0 5.5 6.0 6.5 7.0 7.58.0
• selvagem • induzido
Figura 7: Representação gráfica do desenvolvimento de culturas da forma sanguínea de T. brucei
(Figura adaptada do site http://www.trypanofan.org)
o resultado dos experimentos de RNAi em T. brucei, juntamente com as
evidências bioquímicas, contribuem para a validação da PGI com potencial alvo
para o desenho de drogas anti-tripanosomatideos.
3.3- Trabalhos apresentados em;seguida
Apresento em seguida cinco artigos' relacionados com as enzimas da via
glicolítica, as glucose-6-fosfato isomerases (PGI) de humanos e Leishmania
mexicana mexicana e aenolase de Trypanosoma brucei. Os dois primeiros artigos
descrevem a clonagem, cristalização e a estrutura cristalográfica da PGI humana
na sua forma livre de ligantes no sitio ativo. A estrutura foi resolvida a 2.1Ã e
64
permitiu, pela comparação a outras PGls de mamíferos permitiu propor um
mecanismo para os primeiros passos catalíticos.
O terceiro e quarto artigos descrevem os trabalhos realizados com a PGI de L.
mexicana em colaboração com o Prof. Dr. Paul A. M. Michels (Research Unit for
Tropical Oiseases and Laboratory of Biochemistry, Christian de Ouve Institute of
Cellular Pathology, Bruxelas, Belgica). O terceiro artigo relata a cristalização e os
estudos com quatro inibidores fosforilados desenvolvidos pelo laboratório do Prof.
Dr. Laurent Salmon (Laboratoire de Chimie Bioorganique et Bioinorganique, Orsay
Cedex, França). O quarto artigo descreve a estrutura da PGI de L. mexicana e
características de seu sítio ativo em comparação com a estrutura da PGI humana
e de outros mamíferos.
O quinto artigo relata os resultados obtidos no estudo da enzima enolase de
Trypanosoma brucei onde tive uma pequena participação. Este trabalho descreve
a caracterização da enzima recombinante, sua cristalização e as observações
decorrentes da modelagem molecular por homologia com outras enolases
disponíveis.
1. Cordeiro A.T, Godoi P.H.C, Delborii L.F~ Oliva G, Thiemann O.H. Human
phosphog/ucose isomerase: expression, purification, crystallization and
preliminary crystallographic ana/ysis. Acta Crystallogr D Biol Crystallogr.
2001; 57(Pt 4):592-5.
65
2. Cordeiro A.T., Godoi P.H.C., Silva C.H.T.P., Garratt R.C., Oliva G.,
Thiemann O.H. Crystal structure of human phosphoglucose isomerase and
analysis of the initial catalytic steps. Biochim Biophys Acta. 2003, 1645
(2): 117-22.
3. Cordeiro A.T., Hardre R., Michels P.A., Salmon L., Delboni L.F., Thiemann
O.H. Leishmania mexicana mexicana glucose-6-phosphate isomerase:
crystallization, molecular-replacement solution and inhibition. Acta
Crystallogr D Biol Crystallogr. 2004; 60(Pt 5):915-9.
4. Cordeiro A.T., Michels P.A., Delboni L.F., Thiemann O.H. The crystal
structure of glucose-6-phosphate isomerase from Leishmania mexicana
reveals novel active site features. Eur J Biochem. 2004; 271(13):2765-72.
5. Hannaert V., Albert M.A., Rigden D.J., da Silva Giotto M.T., Thiemann O.
H., Garratt R.C., Van Roy J., Opperdoes F.R., Michels P.A. Kinetic
characterization, structure modelling studies and crystallization of
Trypanosoma brucei enolase. Eur J'Blochem, 2003;270(15):3205-13.
66I F S (. U S P SERViÇO DE BIB~IOTECA
INFORMAÇAO
A •.xa CtYl!OLJi!r~~H:ljhiç,. S...:~ÚOl' n8iologicalCrystallography15SN 09'J7 -444Y
Artur T. Cordeiro/ Paulo H. C.Godoj/,I> luis f. Oelboni/tGlaudus Oliva".J> and Otavio H.ThiemannA*
"1.olx",,,,,,,· <Jf Proreío C!)"1011'4(ôj>lly AOd
~t{\Ktuf"-' Bíólogy~ P"1\ysk-> 1!'I:$Vn.r:é (t." s.\.oCil~im. l1t.A.<fi:r-~tv .ufS;i1:i P.áu!t.t~ llSP'.Av, lrilbálhadt~ ~Adt-m~ .aoo. PC ai)o( .169.1.156 •. ·5'90 sa••.•C~l($- SP",8t.uil. alld
"CiittnÍjuy l~tiMt' ó!~ C*,ka . 11SPfA'Ii. TJ.uiha:h~ S.aoc,'i4;ti~.&OO. PC BtJ~ .l6iJ.13~6·>90 5.\"Cano<• sr. 6_il
t P.~1i~ .addtl/U~ Pl)A::i:fU'.:í •• Uniw-t;$~*Ci1tóli<:a d. I';;oçm do c.ld••. Me. s•••H,
(:llOOt Inte..JUlliooaIV", ••• d. Cty>1.1I1108'iiphl'Pdn.red h O#ftm.~_ .H~f~ ~
Human phosphoglucose isomerase: expression,purification, crystallization and preliminarycrystallographic analysis
íteceívoo 2 OC'-..Dbe-: 2.)00A.«epte-d \6 ,la1U3ty 20;) l
Phospboglucose isomerase (POI) i, the second enzyme in lhe&ly.;oly!lc pathwa)' and calal)'"". an atdosc-ketosc isomerizatloe.Outside lhe «U. }'GI hu bcCII found 10 fuaction aS both a cytokincand Ai • growlb tactOt. The hlWlan pgi ll<'nc was eíoned and lheexprcsscd cnzymc was puriâcd 10 bomogcncity_ Iscmcrphous Cl)'SIalswere obtaíned under IWOcondíuons anil hékmg 10 lhe 1'2.2.2, spacewoop. \VIlh unít-cell paramerers e» 8().37.b" 107.504.e" 270':;3 A. A94.7% complete dala ""I was obtained and precesscd 10 a Iintitiogrcsohuíon of 2.6 À. llH: asynwlcuic unit cOlltaills two hPOI dlnWrIacrording to dcnsíty calculauons, a seh-roration funcríon mal' sndmoíccntarreplaccment solutioo.
1. Inlroduction
PlmphogllléOSe Mllléfase (1'01; E.C. 5.3,1.9)ís a IUltltitul\ctÍOllal enzyme COIl11'0..,d ofhOModílllcn with molrcular masses rdngingfrom ltX) 10 12il I<D•. With rhe exeeption (,Isome intrecetlular para!ltes, POis are- involvedin the gJyrolytlc and glucooeogenesis p3lhwaysln mcst known organism.~ (Andersson 111 al.•1998). 1'OIs calalytA: lhe inlr:.ccUulac ísomer-ízation rea.:tiOll of o-gluoosc-.6-pbosphatc(061') 10 o--úuctose--<>1'hosphate (F6P). Theproposed Qtalytie mechanísm ÍIl\'olves severalolq>lll'ja lhé Iormatíon ai li a.-encdial Iater-Dl<:diatc. simil4r 10 tríose phospbate ísomerase,
The sequenee Wuilarity between PGli andIl<:urolffikin (NL; Faik a aL. 1988), autocríneOImility (""Ior (AMF; II &. Chittwiu, 20(0)snd diffenmtiation and ll1lltllfllion mediator(OMM; Xu te al.; 1996) indlC8t<:ti a broadcr rolef.". lhis CIIZ)l1lCin ccll {"nedon. Reeenr inves-rigation has sh<>wn the stlmularion of mouse(limoU!" ""Us' tlIOlilit)· and lhe enhancement aí
ncurite autgrowln ín prOflcnit= of D<urooalcelb by lhe addition o( Ba,-il11MI SW«fQo.
lIuffffloplúlu;'l'O! to thecnkure medium (SIUlet at, 1999).
The human hotnolt>gue hPOI and ;1$ 00·enz)tne$ bave been J1'ltliied ÍI"<>n1 severalússues with no particular tissue ~pt:clficily.bPOl has &<:<111 chtlfa~·tl:-rized by the anal;1Us oíbmnan gellétic dcíects atrecting the PBÍ gene(Xu & Beuder, 1994). Deteets ÍIl tbe hpgi lociare lhe eeuse ot mau)' autosomaí rc4'C$!IÍ\· •••
disordel1l sucll 3B haemotytic fIlIlICmia.
J:kp::nding (>ti lhe "'''''ril)' Qi rbel'Gl dcti·ciency, neonatal dearh ean occur fmm neero-logíu1 disordm.
Tbe Cl)'SIa(wgral'hlc Itructurcs of lhe rabblt,8odJ1l1$ and pig PGI enzynws bave beenprcvÍOll.ly reperred aI l"C&o1utmu. raJlgiJlgfl'ocn 2 ..3 10 6.0 À (Jetrery et a/~ 2000; Rsiao fft
aI., 1991; Mulrhead &. Sbaw, 1(14). Ahhoughlhe sequence lIinúlarity ot hpGI. c)'loldllC' and&rowfi fal:tOrll reveaí a broader cnzymc Iunc-non, 110ItruGtUl'aI data hu been obraíned forlhe hUllltl11~nzyme.The availability of a Cl)'Stalstructure of hl'Gl <:ould help clllcidJttc lheetlZ)'llle ulalylic mecllllJlí ••••• ,,4 íls substratcspedtidty. \Ve present here ti", fttst "1éCe!lSÍU!c:xpn:w.m. cry$taUitÁllioo a.nd l'reliminaryX ·ra)' charactrtir.llt;()I\ u( lhe '",,,,a,,POIent)llIe. Tbc data obtaíned íh<»\'S Ihat tbehPOI Olz}"llIe a)'Stallize& ín oondítions similar10 tbo$e of lhe rabbic homologue (Jeficry et i11~
2000).
2. Materiais and metMds
2.1. Human I'Glllxpre!lllicm, ""rüicoalion andchMa~1erizalion
TI,e. ""Ci gene "-&4 ampli1kd from li bUlllaJIbraín cDNA librA!)' (GlBOO·BRL) by lhepoIyn~t'a$C 'Min rcaet:loo (l'CR) bssed ou Ibeavaílable hlllllan l'Gl sequence (a(ÇCmon No.NM ..POO11S). Oligod~",xynueleatide prnucn;tor l'CR amplitlca!iOll (Qf.BCQ,BRL) Intro-duee botb NdeI lInd HíndUl Testrictioo sites aIlhe !I alld )' end, te$pCCt.ivdy (S' .AüA(lCl'.CCCUATGGCCO<..'TCfCACCCO<1GAC:3',,.,del; S'·AGcrAAGCITITATIOOACI'CT·ooccrOOCGC3'. lIill<UII) fQf cloning intolhe pEl"29a(+) CxprCssiOIl veetor (Novagell).111" l'CR rt3CIÍon, t<lIltainÍllg 2 pmol of eachprimer and AWroxim.4U:ly SO ng of lhe bUlMll
brlÓn cDNA. was eanitd out in a GeneAmp2400 Iher~Çl" (perkÍIt·E.l!.ner CETOS),"Ih 2.$ U af Amph"Thq DNA polymerase(Protnega) _di"g (O lhe manufllct •••.er'sÍIllItl'Urtiom. The sample \\1M subje«cd to2 nt.ín ~naturatioll lí! 3(jJ K (oJk;w«l by 30cydt$ o( dcn.t'lrlllion aI J67IC (íJ>[ OS mi••,aIlt>c.Dllg 81 313 IC101' OS mill" ••d "xlen.oon t<l
67
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
EL'iEVIER Iliooohimí<aet Riop")!,i ea Ado IM5 (2001) I P 122
Crystal structure of human phosphoglucose isomerase and analysisof the initial catalytic steps
A.T. Cordeiro", P.H.C. Godoi8,b. c.n.r.n Silva3, R.C. Garrau",G. Olivaa,l\ O.H. Thiemann" .•
'I."bomttll'). 0/ f'Nli!in CfY$tiJllogmphy muI S11lMw'aJ Bialngy. I'IU""cs .Instltlf'" qf Sfia C"r!(I$. U11il·",.<iI)· ()J Ma I'a,,/o-USP.Á\t rriJballutdlH' S'ã4ca;ridnsc 400. l!O. Bi1X J69, 1$566-590 SiíQ CiJrlos-Sl'. Bro::iJ
"CIt"",t",,,y 1=ltute of Sà<l (ÃJFÚ>'. Untwlf'$Ít)' of Mo l'á"Ú>-lJSP, Av. TrabdlhadlH' S1ú>t"'lkn$~ 4()O. 1',0. BIJI<369. 13566-590 São CarlàhW'; fI,a:/1
1("",,;...,.; 21 rebnuur 2002, reeeíved in ,",,,Atidli>nu 2 S"1'_r 2002; _q>Ied 2$ Sel'tenl\>••.2002
The seeond 1.'11Z}111" i" ti", g1y,,-olytic path ••••.•y,plt<::<>phoglu<:mi( mIK'nI" (pGl). ""talyll<.-:' IUl ílllra(,ellular aJdos.: 1.:.:10"" isomcrizatioll.II",e we describe ti", IIlUD'Ul n'C<IIl~,illalll PGl !,1n'clore (1iJ'(1I) wJvcd ill lhe ahsence of acti••e site ligarod$. CI)'Slals j""lIIlOfpholls to lho,",previously reported were used 10 eollect a 94% ()omplele data te! to a limiting resoRttion of 2.1 Â. From me comparison between lhe âeeactive site hPGl structure anel the availablc human and rabbít PGI (rl'GI) Slructurcs, a mechanism ror protcin initíal catalytic step$ Í$
proposed, Bínding or lhe pOOIIpbate moict)' of lhe wbstrale to two distind ekul\:1l1s or lhe setive sil\: às responsibtc for dtivíllg li series ofS1nlctllral chlmlll'S resnlting ín the poJarisation ar lhe aenve site histidine, priming it for lhe initial ríng~jng $ter of ClItJllysis.C 2002 Elsevier Science B.v AD rigbts reserved.
1. Iatrcduetioa
Phosphoglucose isomerase (FOI; EC5.3.1.9) is 11 cyto-solte cnzyme úlal cataíyses lhe iutercolwersion of o-glu-cose-6;)OOsI)11lI1C (GóP) and o-üuciosc-õ-phosphate (F6P~The intennediate has been eharacterised as a cis'.euediolatecompoend with lhe double bound between Ct and e2. Thereectíon ís reversíble and its directIDn is esscmlally drivenby lhe G6P and Ji6P concentratiens, rol partícípates tuglyeolysís, gluconeogenesls and the pemose phosphatepathwliy. Recently; extracellular functiOl:\$ of li neoroleukin[I], an autoerine motility fitctor [2] and 11 mataranon íilctOr[3] have also been assoclated with mammalinnPGI. Fur-themlOl'C, rol deficieucy has been ímplieated ín non-sphtr-
Âbb~: 001, phosphodl\l;(\s. ÍSOJllet1lSe; d'Ol. l30bil ~ho·dll..,.., OOl1l<:rllS.; 06P. 1I-s:lucosc.6-phosphatc; F6P. lI-l'ructosNi.pbos.pIl.úe; hl'Ol, licc .etl"" 5íIC Ibrm (lf·bumon p~hOlll_ ismnemse;6l'G, 6-phollpho'lI-gIUOOllllle
• eoa..p",idíllg auU"'t. 1.L *SSoJ6·273-80S9;Iàx: +55.16,213-9881.
1t_Il~. 1~~r4C.\l$f'.llf (Q.1J. 'll\lóm.mn).
IS7o.96391021$ • $ile frotu mal"'t O 2002 llhevic>t Scl<mçç O.V. AlI ri$hIi ~ck>~I().1()16lS157o.9G39(02)0()464.s
ocyüe haemolytíc anemia and lu other autosomal reeessivedisorders {4).
Snuctures of mammalian POis are represented in thePDa by human [5] and plg (to be published) strucrures bothwuh asulfate íon occupyíng lhe binding site ofthc substratephosphate, three rabbit POI structures (rPOI) in the form oí'lnhibitor bound complexes [6-8) and a rpm $lrUCtltte wlththe product, F6P, eomplexed to lhe acuve süe (9), thereforerepreseuting llgand-boon<i forms of ihe enzyme,
A meltistep çaUllytic meehanism has been proposed forlhe interconversion of 06P and V6P. lu 0I)e recent proposal,HistS8 ís responsible for performing lhe initial ring-openingstep by protonation of the G6P rins oxygen, aided b)' anapproptiately orÍct1tatcd \Valer molccule 01' llydrox;)'l 1011.Once the substrate is in its Iilwar fonu, the isomenzlltlollsteps are believed to take place in lhe same enzyme cavity,prillcipaUy by me aeidlbase lICtiOl1 ofOlu;lSl !1J. Desplte lheconsidcrablc progrcss madc ín 1WCIttye~s ill understaudillglhe struetural hasis (Ir catalysis, Iittlc i~known about lhemeehanism by whicll the aetive site assumes its catalyticallyactive confonnatíon. Thís has been due príncipally to tlteabscuce of a detaílcd descriptiOtl of thc ctlzyme ín itssubstrate frce formo
71
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Ai;""..1C'Yj.tllk~"'~-h.iCa S~ti<t~ o8iolugicalCrystilllugrdphy
Artur T. Cordeiro," RenaudHardré, b Paul A. M. Mkhels, e
laurent Salmon,b luis F.Oelbonid and Otavio H.Thiemann'"
·w~ ••!:)ry.~.Ji P~~ilt CtV.titllosr~t1» :p.u'Swt:h.v-;;i Bibl()gy; Ph~t:~ tl'tStiWlf..' ot MoC4ifkw. li!l~lio:'ty U:f u•.•ft..,fu, USPj
Av.lr ••••I~~...", se 400, P(J _lt.9,lJ,';;;,90 $ao c.,!<>1SP. ama, '1,.aIx>t.>IOi!í:de Cb:imÍ<t Bl()Q(''Pf\~e *1 BII)itJ,()(.ganr~,
CNRS-~-1J{811"., 1J\1í(r!\ro tk Ch~t?Moiéa;takê et de$.~!'4'tJ)( d'();üy~Ufll~ité P.••ris:,Sud XI, 9J40.s Ot$.1y {:a>tx~rr,.iU\C~ • ..-keseitf~hU~il fot r top~t."i1j f.)<~ aneltabOf".iot!tM'y .,( Siof;;:fIM~r~ CÍltís~bn • 0uv4!:
li1:l'l§1tU <I.C~lrnJ;r~tholoa:r~ lWf'AtW
HippoMlt ]'.I. 1100 Qruwds, 8efgium. alld4IIf'<mtlfida UAiv~íd:Jde·CatõJ:Q de Mí1tiU(J4!'l,.il;. ç.~ ~ Púç~dl,r Calà6, Ali, P..;JJt-h~""i> C""'s (". '';;;1, 37lO'.3551'uç •• li<!C;)ldas,"~.i. 6f.ut I
(;í 2004 hw •.••tIo~ tlnioo <liC<yV•• I~rP"_J,, 0.;.,•••••.• - alI •.•11I4<,~•••"'"
crystallization papers<<<-----<-----~"~._"~-~~~~~~~-~-
Leishmania mexicana mexicanaglucose-ê-phosphate isomerase: crystallization,molecular-replacement solution and inhibition
Gíucose-e-phosphare Isomerase (POI; EC 5.3.1.9: also oneu caííed byits oId nomenclature phospboglucose isorueruse) is an intracellularenz:,.mc lhal catalyses lhe revcrsíblc ecnversion of o-glucOM:6phOlSphutc (G6I') to n-íructose 6 phosphatc (1'61'). '111C nativeLeishmunítll'GI is a homodímcnc llIokculc oi 60 !;Da !XI monomerwith 47% sequcnoe identity 10 human POI. h hJ15 becn showl1 to bcP=CIlt in both lhe eyrosol and lhe 1l1YC(l$()WCoi l.A'ísilmaniaprollu&ugotc. 411d represents li. potential target for rational drugdesi3JI. lbe preseat ,,'Or\( deseribes lhe aystalliraiion 01 twobaclerialJy expressed Leis/múmia PUI ecnstructs, one correspondingto the natural protein and lhe otber 1(1an N·tc:mrin ••lly dele..," fonu,erySIaU. ti hO!b foem. ate iJcnrí.:al and pr"$CJlI a largc c uníl«Upara1llCtcr, •••complete dala ocl WiUi eoãeeted trow til<:NI.··rnrimúlydel"ledPUI te a resoluuce of3.3 Á in space group P6,. with uek-ceílparalll<'.tér. 11 " b : 871). c '" 354.7 À, (t " fi " 90, y " 120". AprelintÍllllry study of me firsI inhibilon 10 be C\'.1"81"d ou lheLeMlml1nút enzyme 1$also reporred.
1, Introduclion
Glocose.j\.phot;phate isomerne (PGI; EC$,3.1.9) ls an Ílltraer:UullIr eDZyme that alta-Iy~"$ lhe revendble CQ1lVCntoC! of o 1.',lu<'OSC6p1tosphatc (061') 10 ofiuct""" 6phOlil>h31c(F6P), ThÔ$uomcriz.-tlOll r<:acôon is ti. <:ommÓll&tep in lhe g1y(O/ytk, t1U1:OIlé:Otenc:si&andpellto<se-pllO$phale .,.rhwa)$.
PUI ""$ bem studied ín lhe Kinelopl.a$l.idaas a pownd.d larget (or lhe design (lf novelínltlbltOOl bceanse of lhe dilten:nces betweealhe host (h",llan) and .,.rn.mc glycolyticpathwflys and lhe dependente oi tllé parasíle.0Jl t1y«>lysu- Rt«ttdy, RNA-imerk.rcoo:.(R.."<Ai) slUdies have tcvealcd lha! dé.creasillglhe levcl oi PUl ín ·bloodstrelUll-{orm 1iyp-mW.roma bruél!i POI n:,,"II' in li 50% growthinhibillÓll (R.:admcnd er el; 2(03). This n::sultis índlealÍ\'e ai lhe central role tha! PUI pIay,ín lhe paruite llIetllbo!i$lll.
ln úúhm<miq mexican« mnk«nllI'ronu~gOl"s, rol ""livil)' .", ",<lU"}' (90%)detc:cted 10 lhe cytosol .vd lhe remaind"r ísIooatiu<l to perQxisomc,1ikc organclícs csllcdglyCO$Om~ Th.:. rol I<:thity ín lhe tworompWlllCllt$ coald not be attlibUled todirrerenl illoell1.yme' owing to protein .im;·laTiI)' and li .mgl" 1'(,1 1l"11C ;$ prellKnt in lhebaploid gMOlllé (NyanlC I!J <l/~ 1994), Glyro·_mll pr~e.llt ÍIlaHKíneloplll$dda and arekt)own. 10 conl{llll1111cntaliu lhe llnt seven~"IlZ}'1Ut:$ Qf lhe gI)-\'O/ytic palhwa)' válh
R«.~ivM u- j\UgU:iI lfi(}:I
Accept.;W 1l r~uJl~' 2{."'4
important eonsequences Cor lhe regulatloo ofti", r.Iyoolytic tlm: (Micbcls I!J lII, 2000),
PGI C3taJytic resldues are ..-eU conserved ínL. IMxiC4lUl, T. cru:i and Tl>ruc"; asldentilk.dby lhe nlígolUL-u1 of thcír _ino,.cid sequeneeswilh those of .ubbit (kffcry I!J sI., 2000), plg(Davics &: Muirbelld, 20(2). hUlllall (COrdéiroI!J <11., 2OQ) and Badl1J1$ (Suo <I di,. 1999), tbectyslld strncrures of whidl hsve been descnbedprevi._I,., 1hi, pauem ti wrm:n'ed resklues."p,gesl$ Ihal lhe kinelopl3$dd 1'Gb wrc aeemmon rCllÇÚQn mechanisrn wilh otber l'Ob,NevenhdClió" <fit!.,..",,,,,. CIIn be observedbetween lhe llIanunaJlan an<l parasíuccnr.ymes. A d«atlcd compari$Ol1 of lhe huma ••and LeislIIIUlllí4 POI stnICtUl'CS i$ critica! 10investigole wbctber these dínerencClió C"<Ul beexplcited in Ieture struc:turc,t!ir«:lcd <1m!;<ksign,
ln lhe prescnt work, we dc~bc lhe !iri!Sl1CéWiíul exptellSÍ.OJl, Q")'$Idll:tation andpreliminary X -ray cluI.ra.::tcrízation of lhel~;"'l!mallío 1'01 ''''~yull',f'ur tbis purpoStl, 1W"exprCS&ioo COIl!IlmCt5 'RUe prepared,OllcronWnÍllg tltO fuU-1entth gcm: (PGHJ1/)anda SC«lIld COIlSlnll:t (drol-Lm) ín whleh lhe S'end of lhe gene lhal rodes lIll N-IetnÜllal""'10"11"" unique to lhe LeíshnumútPUI wasdeletcd. Heng<lnal crystals wítb alara" ellnil·cell paramet« were é)htain«l4nd ~aly:re<l by"'·rfl}' di1fractioll, The initial pha$int data fordPGI-Lm were obtalrte<l. AMit\onal1y. weItaw compare<l lhe inltibit<>ry elfC:C1$ Q{ fOllr
001: 10,1 1O!1S09Q74449(1400371l2
77
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Ei«. J. 8/("" ••"". 271, 276$-2772 (2004) e FEHS 2004 d<li:I().llll!j.I4J2·103).2()04.ll4105.x
lhe crystal structure of glucose-6-phosphate isomerase fromleishmania mexicana reveals novel active site featuresArtur T. Cordeiro', Paul A. M. Michelsz• luiz F. OelhoniJ and otávio H. Thiemann'ILilboratQf")' of ProJcill Crys/aUography.mJ Struaural Biology. PI,pk:s III.titult: of SJo C<U/"$.Univr:rsil)' of SJo Paulo.s.w Cartos-St». BrtLtíl; lkSl'l1rclt Unit for l',opi<',ll Diseases and Ldhorillt>ry of Bk><ltemistry. Cluistiún de Duve Insütute ofulf"iar Patltoiogy. Brusseú. Be/gium; Jpolllijkia Vni""rsidade Ca16/iro ik Minas Gerais. P(lj."'Os de Caldas-MG, Bra::iI
Olllrose-ó-phOl>'!'hate ísomerase calal)'= lhe reversibleaklose-ketose isomerizatíon of n-glucose-õ-phosphate 10
D-rruClose-ó-plKl6phate ill glytoly$i$ and gl uccueogeuesis,aud in the n:cycling ar llC.'tose-6-pIKJSphall! in lhe pentoscphosphate pathway. Theunicellular protezoans, Trypan-ÔSOItIll brucei, T, cruz; and úísllm(ll/ia spp .• of the orderKineroplasüda are important human parasites responsi blefor African skepíng síckness, Olagas' dísease and leish-maníases, respectivdy, lu these parasites, glycolysis is auimportant (and in some CIlSCSthe Ollly) metabolic palhwayfor ATP suppJy. TIIC firsl $C\'CIlof the JO I!1JZylllCll thatpartidpate in glrcolysis, as well as ao importam fractionof ihc enzymes of the peatose pbospbate pathway, areÇ()lUpartluentali7..OO in peroxisome-like olllMCJIes called
glycnsornes, The dependence of lhe parasites ou gJycol}'l>1s,the ímportanee of' tbe penrose phosphate pathway índefense agalllsl o.ú:lative stress, and the uuíqoe compart-rnt.'I1tnJiz3lÍoll of thesc palbways, point 10 lhe enzymeseontained in lhe glycosorne as potenüal largCls for drugdesign, The present repon de~cribcs thc first crystalk»graplúc structure of a parasíte (Leishmll1tia mexiCt1l1a)glucose-6-phosphate ísonu:rase. A cemparíson of thealumie $lfUCIUrc: of L, mexicana, human and othermammahan POIs, whích lúgldights unique feamres ar lheparnsíle'lI I!1JZyIlIC,is pn."Si.'11lOO,
Ki!ywtJrdr:l~; I,fKl6I,hoglucc:1Seisornerase; glycoly-$&s;SullSlraJe..cnz.)-lUt:;human POI.
uixhl/li1llia mexicana is a humau protozoan pathogenbeIonging 10 lhe order Kinctoplasiída 11.21.AIllong lhekinetoplastid organisms, severa! human parasues are pre-sento inclu<:ting TrYJXUI()$(}1fI(1l>rucgi, T. cnIZÍ and variousl.éixhmallia specics that are responsíbk for diSC3ses SllCll asAfrican slecping sickrn:ss, Olagas' disease and Icishmaui-ases, respectivdy, oausing selÍOUS beahb probJems intropical and subtropicaJ ateall, wlúch, in severa! cases, arefataJ ir Jcft uutreated. This $CClUlno is aggravatcd by a lackof ctrcctive, available drugs for lhe treatment or infeeredindividuaIs, and lhe ICllOClS or drug-rcsisl:mt para$Ílestrains, l..ei!lhmuniaínfeclíon ma)' lead to disorders that
c_~ to Q. H. Thiomalin, LaborlItocyoI'Prtllein Oy$kú-Iography and Structural BioIot!Y,~Ii of PhysiC$ and lnr. •.-mau:., l'b)$iCs buiitule or S30 ~ Universily (lI" São Paulo,A'i'mue Traballmdor SãOca~ 400. 1'0 Do» 369. 13!i(j6...SOO.SãoCWJos.SP, BladI. FU:: .• SS 16273 9881,l'd.: .• 55 16 27) ~9.fl.tn~l:1Il~@j(~'lUII'.br 'A~Í<IHS:u-Fru6P, o-fructme-6-phasphole; D-G1c6P,u-JluOOlle-6-phó$phatc; drol-lnl., N-1mi1ínaIIy del«ed 81-.ó-pIlosphate~., f_ Le~Ú1_.dc.-; POr.~pb<I$pIlalc~ POI.Lm,~llIospIUile OOmeta~ fOOIl.l..d.IIIt_fa~,~~to iIomeríI$e([l.C. 5.3.1.9).NIJU; Thcl'OlIlD.éc>de rói' ÜIe $OluIiOOlo1ruc:tllrl$ pr~ m~f1IUf JlIt~pIlP$phate ÍIOUII:I_ ful/.lcu&thPOI-1m is lQSO $Q(I ot ÜIe (<mil wilh ÜIe 48 «$Íd\le$ dclet.t ftUm
1ti N-it:rminm (dl'GI,I.m). IQlt{Rawd 3 Oecember 2003,tmted 3J Matclt2004,~ (> MlIy2OO4)
82
can manifest themsclves in three ditTcmlt cliniçaJ forras -cmaneous, visceraI and mucocutaneous Jeishmaniasís .depending ou the .úisllmatia sptclcs iuvoMd, The aetualtreauuent for lcishmaniasis Í$ based mainly ou antimQJÜaJcompounds that.4lC oflow spcci1icity a.nd cause undcsirablcside.ctTects [1.2).
GlycoJysis is an important, and in some cases lhe only,mct3bolic pailtway for lhe ATP supply of tllCSCparasites,TIIC 6l'$t $C\'CIl of tllC JO ellzymes tlllÚ partíeipatc jngl)Ullysis are OOIllpal1mcnlaliz.cd in pcroxisomc-like Ofgatl-elks callcd g)ywsorllt'll (3), a characil:ristic of alI members oflhe Kinetoplastída. order. A cooscqlletle<: of this oQ!1lueUarJocalizatiou i$ lhat lhe kinetopl4stid g/ycol}1ic enzymesdifrl.T 111mall)'kinetie and slmctllmlproperties from thcircounll!rparts ín !)tbt-r llrganisms,and Iba! the Uux. throngllthe p..'lthway is regulaled in a dítTcmlt manncr (2,3J. Notonly gIycolysís is found in gl)WSOlllCS; also found is asigniticant Craction of many enzymes ar lhe peatosephosphaic pluhway [4,Sl. whích uses sngars for ihe fonna-
. tion af D-ribo.se-5-phosphate for nucleotidesyntht:$is andNADPH, for biO$)'nihetic~ and for dcfenseagIÚIIsto.~t stress, 11Us.plOCe$$ iS aJso ycry important for lhetr:ypanosolllCS and kishmanias, particuJàrly to eombatoxidativc aUack 1>y lhe bost. TIlI!fCíort;, both lhe gJyoolyticand pemose phosphatc patll\\'l1y$ haee been indicated aspromi$ingdrogtàrtef$I2,6,7].
Glul.XlIIe.fl-phospbáteisomerase (oClen $ÚII calíed by ilsold name, pflO$p~ Í!ioml:rIlSe;POl)is lhe $COOndemyme lU glywJyijs and eataIy;!J:s tbe te'VI!1$ible akíose-ketose isomerization ar trgllléOse 6-ph<J$p1làlc (P-01c6P) toD-fructose 6-pbosphaíe (o-Frn6p). lt is also lIllenzytlllllielink betweenglycoly$.isand the pentose phospbatepathway.
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Eur. J. Hlochen». 270. 3205-3213 (2()(tl) 1<,) FEHS 2(~13 <1",:10. Hl46fj.14J2-!U.B.20()3.!)J692.x
Kinetic characterization, structure modelling studiesand crystallization of Trypanosoma brucel enolaseVéronique Hannaertt, Marie-Astrid Albertl, Oaniel J. RigdenZ, M. Theresa da Silva Giotto:J,Otavio ThiemannJ
, Rimará C. Garratt', Joris Van Roy', Fred R. Opperdoes' and Paul A. M. Michelst
IRrseard. Unnfor Troptcal Dísnases, Chrístían de Duve lImúlI'" (>fCcllu/llr P,'l/wlo!:y illld lAbiIr<110ry (>1BWd,,'!míslrr.Unh'u.,ilé Cl11lwli./u" de 10.""11". BrU!,~,J., lJdgíllm; 'CENARGENíEMBRAP,4. flms/lia-D.P. 8,.,711;~lnsfilulO de Física de ,'Wio C-llr!o,,,. {lniw.~r#dadc de Sdo Paulo, São Carlos SP. Dnl.;?il
111 this article, we report the resulta 01' an analysís of lheglyeolytic enzyme enolase (2-phuspho-o-gly\Xrate hydro-lase) of Tryponosoma brucei. Enolase activity was detectedin both bíoodstream-form and procycle insect-smge try-panosomes, althougíi a 4.5-fold lowcr speci6c activity waslound 111lhe cnltured procyclic homogenatc, Subcellularlocaâzauon analysis showed that lhe C'IIZ}mc is onJy pre-sem in the cytosol, The 1'. brucei enolase was expressedtil Escherichia roli 1100 purified to homogeneity, The l:in-enc propertíes of lhe bacterially expresscd enzyme showedstrong similarity 10 those values Iound for lhe natural1: bT'UCti enolase presenr in li C)'IOSOtic reli fraction,indicating li proper foldíng ar the CIIZ}U1C in E. to/i. Thekinetic properties of T. lsucei enolase were also studiedin comparison with enolase frorn rabbit rnuscíe andSoccharomyces cerevisioe. Funcuonally, simílanties werefound to exíst betweea lhe three enzymes: lhe Mic./mdisconstanr (K,,) and KA values for lhe subsrraies alie! Mg>+are "e.ry simíbrc Diffcrences in pH oprima for aelh·ity,
inhibition by excess Mg1';' and susceptíbiliues 10 1110no-
valeat ions showed lhat lhe T. bruce! euoíase behavesmore lilre the yeast CIIZ)'IUe. Alignment of the amino acidsequences of 7: bruce! enolase and other eukaryotic andprokaryotic enoíases showed that ruost residucs involved111 lhe binding or jls hgands are well eonserved. StrucruremOOelling of lhe T. bruéei enzyme usíng lhe availableS. eerevisiae structures as Icmplale:s indicated that thereare some at)'pícaJ residues (one Lys and two C)'S) dose tothe 1: bruce: active site. As ihese residues are absent Iromtlie humau host enolase and are therelore polclltiaJlyíntercstíng filf drug design, wc iniuated attempts todetermine lhe three ..dímensíonal structure, T. bruce« eno-lase crystals dífi'r.u;ting aI 2.3 Â. resohn ion were obtainedand \\111 pernut us 10 pursue the determination ofstrucmre,Ãeywordr; enolase; 7Typatlosoma brucei; kineties; ml1IC! unomodelling; c.ryslalli7.,atíon.
Enola ..se (211I!ospho ..o-glyeerate hydrolase, EC 4.2.1.1 I)eatalyses lhe revcrsible dchydrauon of {)-2-phosphogl)'-ccrate (roA) to phoslllKlimolpyruvalc (PEP) in bothglycoly'llÍ-~ and glucoueogenesis. '1111.': enl)'llle has beenstudied from a large variety OfSOll.TCCS (includingArclt:lcbactt.'1'Ía, Eubacteria and Euka ryota) and found10 be highly conserved. This conservation is particularly
C«U'$p")"k,,,:~ 10 V, lI"ilU'áeJ:t. ICl'·TJtOP 74-39, A'ílUlJeHiPJl<X'I&t~ 14, 8-1100 Btlllilicl$. Bclg.i\Ull.Fax: 32 n6! ss 53, 'lei.: :12 2i64 74 72,F~nWl: h""'-laert@I"'l'.ud.oc.,beAbbr(!Yil1tilm~: IUí4. 4·1(2S,3Sj-3-carboxyoxír.m-l-)1=bon}1-L·!eu·é)iamldoJwlyl.@:\llIlÚdínll;GAJ>O!1. ~!yéttàldell)<d..,.3-pl,(.Ilphaled"h~IOg@~ U)H. I&."lale dcl,)'dmB!"J3se; PHP. '~'OSflbp.(JlPlpyl'l1vau,; ]>(h\.I>-2-pltOOl,h(l9)'C\ltálé;PGAM. phO$ph(l~-mate mutase: PGK,. phOI!pho,ilycemle bRas:; PYK,.pyruvate IúuWle.m}.IW$: e<l<daie!2·pllOlpbó,·~!\.I)~", hydtolase (OC 4.2.1.11);gfycw.dd..ltyde-).pI>osphalcdehydu)l!Clme (Se 1.2.1.11); ""'taledclIydrOgén* (I'!C 1.1.1.27); l,ht'lSj,botlYC\lral~ \dna$e (F,C 2.7.2.3);lmO$l,llÔ.sI)'CCI'lIUl l'l,lÜMe (I'.C ,.4.21); pyr\J.~'lIte kinMe (1-<::027. L4(j).(Rt>:dwd 2() l'ebnmry 100,\ revim 12May 1003,1lC«pl<d 4 June ::(03)
90
app:ncnl at lhe catalytic site and h.1S 100 to enzymcsfrom diversc !>-pccies sharillg many similar kinetic prol"erties, F..l'I(lIare from all eukaryotes analysed, and rrommany prokaryotic species, is a dimer, with idcnticalsubunits havillg a molecuJar mass of 40 0005Q 000 111;however, octamenc enelases have been reported 111 avariely of bacteria (2,3].
High-resofution crysUtl structures are known for lheenolases fl'Olll lobster and Sat."CharoJIIl'ces eereYisiae, bothas apoenzyme structures and ~Jéxes with substratesand ínJúbltot:l [4-7). lbese 1\\'0 enola.'leShave very simíla.ramino-scid stquences and íhree-dimensional structures.F..aoh monomer of enolase contains two domains. Tbc largeC-tenninal domain ís an eightfold Il/P barrel of somewhatunusual Iypc, with a topoJogy whicll diffcrs Irom lha!eommouly observed 111 lriosepttmph.alc i.•.nnerase audmany other proteins, The active site of enolase ís J'lfl'St,.111
at thc C terminas of 1his barrel, The $maU or N-tcrntin:ddomain wraps around lhe oulslde or lhe rnain domam [StMO$tof the iutersubunh coutacts are between lhe smalldomain of one rnonomer and lhe largedomain of the other,Kiretic expcrirneul$ have dcmollstratcd thaí bindinl!. of twometal íons 10 each tII01l0111el is required for activity (?< 11)-l'hey further Sllggcsted the prcsence 01' a third, inhibítory,
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Capitulo IV
4.1- Rastreamento de inibidores a partir de extratos de plantas
e animais marinhos
Durante séculos o homem utilizou-se de plantas e extratos derivados destas
como unica fonte de agentes terapeuticos [52-54]. No inicio do século XIX as
plantas passaram a representar a principal fonte de substancias para o
desenvolvimento de medicamentos em decorrencia do desenvolvimento da
química farmaceutica. Atualmente, apesar do grande desenvolvimento da sintese
organica e de novos processos biotecnologicos, 25% dos medicamentos prescritos
nos paises industrializados sao originarios de plantas e 40% de todas as novas
drogas desenvolvidas possuem a participacao de produtos de origem natural
[52]. Alguns exemplos importantes podem ser mencionados como a Asplrína'"
(Bayer) ou ácido acetilsalicílico. Este composto não é encontrado em plantas mas
é o resultado de uma modificação estrutural símples, uma acetilação de
compostos com conhecidas atividades antiinflamatórias e analgésicas como a
salicina e a saligenina, isoladas de Salix alba L. Outro exemplo consiste na
papoula (Papaver somniferum L.), de onde se obtem o ópio com conhecidas
propriedades soporíficas e analgésicas.
A quimioterapia atualmente disponível para tratamento de infecções causadas por
Leishmania esta distante de ser satisfatória. A resistência aos antimoniais
99
pentavalentes, que tem sido as drogas recomendadas para o tratamento da
Leishmaniose visceral (VL) e cutânea (CL) por mais de cinqüenta anos, esta
atualmente disseminada na Índia. Apesar de novos fármacos terem sido
disponibilizados em anos recentes para o tratamento de VL (Arnêlsome'",
Miltefosine) problemas de tratamento persistem [55-58]. A busca por novos
fármacos persiste, com os bisfosfonados (residronato e pamidronato) e derivados
de plantas como as licochalconas A e alcalóides qulnolínlcos tendo sido reportados
como tendo atividade contra infecções experimentais em sistemas modelo.
Diversos alvos em potencial para o desenvolvimento de fármacos têm sido
identificados em estudos bioquímicos e moleculares e em alguns casos em sido
validados. Os alvos moleculares, temas deste trabalho, envolvendo a via de
recuperação de purino nucleotídeos permanece como um alvo em potencial de
grande interesse [56-58].
Este aspecto revela a grande importancia que as plantas e outras fontes de
produtos naturais têm frente ao desenvolvimento de novos fármacos. Nesta
perpsectiva, vem sendo empregada a busca por composotos com atividade
inibitória das enzimas alvo de Leishmania. Para o desenvolvimento dessa linha de
investigação, sob a estreita e frutiferà colaboração com os laboratórios de
química e isolamento de produtos naturais do Prof. Dr. Paulo Cezar Vieira
(Departamento de Química, Universidade Federal de São Carlos - UFSCar) e Prof.
Dr. Roberto G. S. Berlinck (Instituto de Química de São Carlos, Universidade de
São Paulo - USP) emprendemos o rastreamento de extratos de origem vegetal e
de animais marinhos até a obtenção de compostos puros.
100
4.2- Trabalhos apresentados em seguida
Apresento em seguida sete artigos relacionados com o rastreamento de de
extratos ea caractrização da atividade inibitória de diversos compostos.
Os primeiros tres artigos tratam do isolamento e caracterização estrutural de
compostos isolados de Adiscanthus fusciflorus (Rutaceae), a isopimpinellina (5,8-
dimethoxy-psoralen), skimmianine (7,8-dimethoxydictammine ou 4,7,8-
trimethoxyfuro[2,3-b]quinoline), e o 3-(5,7-Dimethoxy-2,2-dimethyl-2H-
benzo[b]- pyran-6-yl)propionic acid. Estes compostos foram isolados de extratos
de A. fusciflorus em uma abordagem guiada pelos ensaios bioquímicas de inibição
da APRT de Leishmania. O estudo estrutural por difração de ralos-X de
monocristais dos compostos se ostra importante do ponto de vista do desenho
racional de novos compostos derivados por fornecer um maior conhecimento da
molecula em questão.
O quarto artigo aceito para publicação .se refre ao isolamento da cumarina
Aurapteno (7-geranyloxycoumarin), isolada de Esenbeckia febrifuga (Rutaceae)
por ensaios guiados pela inibição do crescimento de L. major em cultura. Esta
abordagem foi possível graças a implantação da sala de cultivo de parasitas e
células de mamíferos no Grupo de Cristalografia de Proteínas e Biologia
Estrutural. Representa um avanço significativo por permitir o estudo bioquímico e
celular dos compostos isolados como exemplificado nesta publicação e na
seguinte.
101
o quinto artigo submetido para publicação se refere aos ensaios de inibição
bioquímicos com as PRTases (APRT, HGPRT e XPRT) de Leishmania assim como
aos estudos de inibição do crescimento do parasita e seletividade frente a células
humanas.
Finalmene o sexto artigo relata, em uma revisão em colaboração com o Prof. Dr.
Roberto G. S. Berlinck (Instituto de Química de São Carlos, Universidade de São
Paulo - USP), os avanços e nossa modesta contribuição no isolamento de
compostos derivados de animais marinhos e fungos marinhos.
1. Napolitano H.B., Silva M., Ellena J., Rocha W.C., Vieira P.C., Thiemann
O.H., Oliva G. Redetermination of skimmianine: a new inhibitor against the
Leishmania APRT enzyme. Acta Crystallogr E Struc. Rep. 59: 01503-01505
Part 10, 2003.
2. Napolitano H.B., Silva M'., Ellena J., Rocha W.c., Vieira P.c., Thiemann
O.H., Oliva G. Redetermination end compara tive structura/ study of
isopimpinellin: a new inhibitor against the Leishmania APRT enzyme. Acta
Crystallogr E Struc. Rep. 59: 01506-01508 Part 10, 2003.
3. Silva M., Napolitano H.B., Ellena J., Rocha W.C., Vieira P.C., Oliva G.,
Thiemann O.H. 3-(5,7-Dimethoxy-2,2-dimethy/-2H-benzo[b ]-pyran-6-
yl)propionic acid: a potentia/ inhibitor against Leishmania. Acta Crystallogr
E Struc. Rep. 59: 01575-01577 Part 10, 2003.
102
4. Napolitano H.B., Silva M., Ellena J., Rodrigues B.D.G., Almeida A.L.C.,
Vieira P.c., Oliva G. and Thiemann O.H. Aurapten, a novel coumarin with
growth inhibition against Leishmania major promastigotes. Braz. J. Med.
Biol. Res., No Prelo.
5. Silva M., Silva C. H. T. P., Rocha W. c., Castilho M. S., Vieira P. C., Oliva G.
and Thiemann O. H. In-vivo and in-vitro effect of four alkaloids of
Adiscanthus fusciflorus: Inhibition of phosphoribosyl transferases activity
and antileishmanial effect. Submetido.
)
6. Berlinck R.G.S., Hajdu E., da Rocha R.M., de Oliveira J.H.H.L., Hernandez
I.L.C., Seleghim M.H.R., Granato A.C., de Almeida E.V.R., Nunez C.V.,
Muricy G., Peixinho S., Pessoa C., Moraes M.O., Cavalcanti B.C.,
Nascimento G.G.F., Thiemann O.H., Silva M., Souza A.O., Silva c.t.,
Minarini P.R.R. Challenges and rewerds of research in marine natural
products chemistry in Brazi/. J. Nat. Prod. 67 (3): 510-522 2004.
103
organic papers
Ma, Ct)'jt.ll~'ophia $«1<.onf
S'ruclure ReportsOnllne
H. B. NapolilanO;· M. Silva:J. Ellena," W. C. Rocha,bP. C. Vieita," O. H. Thien'<IOn"and G. Olival
""'\;MO<I< n",,,,des.\cC~\JSP.C,Pe,wJ~'.13Sf>1.'70 Sh C.u!"" SP. 6r •••W•••• d~~b. QWIniG:~u~SC.tr~c~~\.li 676,1J%~·*tOS SJu Cark» SI", Sr-ud
lCoyi".ot'<S'jflgi;H:.ryu,li X-'f'W $tW:1y
7·1W(M_<t«: 0.0.002,1.1I:_.".o.l>lwR iáélót • 0.104O.u.·",,'P"_ ._ • 12.lt
fw <k\ •• !< <>11_ "_ koy <fl<I~._.JA,~ny dttNfld fmM 1h~ -arM':!"!'.~
http;~'NJj,_u·Qtsfe·
4) lOO! " __ I UtW>rt '" CJy,1AI~I'<intóll .n Grt<It 6<iUin ~11lsh!> "'~
Redetermlnatíon of skimmianine: anew inhibitor against the leishmaniaAPRT enzyme
11", lill" compound (nhernillive narnes 7,8-dimélhoxydiclllm·mine and 4.7,s-tI'imellloxyfuro{2,3-b)quinolinc), CHHnNO •.IS a natural product extracted from Adiscamhu« fll$c{ffoms(RUIIlCil<IC), Our biochemical tests show that il has inhibitoryacuvíry "tlllinst the enzyme adenlne phosphorjbosyl-transferase (APKD from Leisnmenía. a tropical parasitceausing endemíc disease in poor eountries 11cl)'$tallizes in lhecentrosjmmctríc space group n/c, with oue molecule inibeasymmetríc unit, and has at least two C-H···O íntermote-cular íntemctions, leading 10 lhe íormarion of centrosyrn-mctric dímers.
CommentLeíshmauiasis i$ a dísease causcd by a protozoal parasito otlhe arder Kiuetoplastid. According to tbe World Heath()rganilalion reports (WH(), 1998), S8 eountries are alTectt.>d,wíth 12 million iafected peoplc and approxlmatcly 3SQmillionpeople at m.The need for 11<l!\\'deugs for the crcatmel1( 01 lheIelshmaniasís inrectíoll$. contes ftom a lack of sare drugs andthe seríous sccondary elTects observed in available "hemo-therapy (McGree"y & Marsden. 1986). lhe purine nucleotidesalvage palhway íu Kinetoplaslid ís a potentíal target for lhedevelopment of new drugs, ()\Ving to its dependence on lhalbíosymhctic palhway (Detens et ai., 1995). lu Kínetoplastid.lhe phosphoribosyltransferase (PRThse) protein Iamíly isresponsíbíe ror purine nuclcolide salvage. Looking ror newbioacuve substances, poteutially useful against Icishmaniasis.\IIe used the PRThse adenlne phosphadbQS.yltransferase(APH.T) trom I~ UJl'ffllolllC as li mudei system to sereen lheinhibitoty capaeity ar several smaUmoleculc compounds fromBrazílian plants,
lhe screenmg was pertormed u_ing lhe APlU inbibitoryassay, cíther iu the preseuce of extlllClll ar wilh Ihc puriticdcompound, and was monitofed specttoj>hotometrícatly (Tuttle& Krenilsk)', 1980).lhe lÍlte compound, (I).was isolated (rumA. fim:iflorus e:ttracts and has been structuratly investigawdbecause ar its inhibitory /lctivity agninst APRT. Enzynlaliclelt$ or (I) /lI 50 Ilglml shaw an ínhibítion activity of 68%.Further invcstigalions by molecalar dooking and dynamicsÍlllulation$ will be perfonned to study lhe interaetiaU$
l\4J!r~1\o'HI ~~i1>fti\' lD,-l~Att:.t'j)t'ltd $o 'X1;:Wf1~f 1(,"0$
(Jflhn~ te,. ~~l'of!1' lOOJ
001: li). lW7JS'H'OOSl4&)3()1~91Jetectre n ít:: ft;pri r!t
104
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
organic papers
Acta (tystallographica. Section E
Structure ReportsOnlineISSN '6DO-5 ~68
H. 8. Napolitano,·· M. Silva,aJ. Ellena," W. C. Rocha,"P. C. Vieira,b O. H. Thiemann'and G. Oliva"
"nstituto de F(s,icatH SIQC.IQ5.0SP. Cx Postal369; 13560-97D S~ C~Io~ SP, 8ralil, endb[)ept.o. QuímC:lt. UFSCar, Cx Posul 676.13565-905 S50 Cadcs SP. Srazil
lCey indiutôri
5;.gl"cry'''' X-r.ySbJdyT-120KMe'. G'(C C) - 0,002 ÀRfactt>r - 0,044wRfactor - 0.124D.ta-tõ-pararneb!r ratiô - 11.4
For details of how the$ol! key indicatOrs wereilutcn'lelticaUy .rived trom lhe If"tide. seehttpJljournals...íuCt.Gr"e.
li) 2003 ."",rnational Unkl<l ofC'yltállographyPrinte<l inCreat Britain ali rie~r'ese~
Redetermination and comparative structuralstudy of isopimpinellin: a new inhibitoragainst the leishmania APRT enzyme
The title compound (altemative name 5,8-dimethoxy-psoralen), CuHl<PS, ís a natural product extracted fromAâiscantbus fusciflorus (Ruraceae). Our biochemical testsshow that thís compound luis inhibítory activíty against theenzyme adeníne pbosphoribosyltransferase (APRT) fromLeisbtnania, a tropical parasite causíng endemíc dísease inpoor countríes, lt crystalliz.es in the centrosymmetric spacegroup P2ic. with one molecule in the asymmetríc unit, and hasat least lVI'O C-H- . ,O intennolecular interactions, leading tothe formatíon of centrosymmetric dímers,
Recelved 28 'vI) 2003Acceped 8.Sf':ptemoor 2003Onlio.:!: 18 Sep1ember 2003
CommentLeíshmaníasís ís a dísease caused by a protozoal parasite ofme order Kínetoplastid, Accordíng to the \Vorld HeathOrganízation reporta (WHO, 1998), 88 countries are atfected,wíth 12 millíon infected people and approximately 350 míllíonpeople at risk. The need for new drugs for the treatment ofle:isbmaniasis in1ections Comes from a lack of safe drugs andthe seríous secondary effects observed in avaílable chemo-therapy (McGreevy & Marsden, 1986). Loolcing for newbíoactive substances, potentíally useful against le:ishmaniasis,we used tbe PRrase adenine phospbonl>osyltransferase(APRT) trem L. tarentolo« as a model system to screen theinhibitory capacity of severa! small moleeule compounds fromBrazilian planta The screening was performed using theAPRT inbibítory assay, e:ither in the presence of extracts orwíth the purified compound, and was monitored spectro-photometrically (Tuttle & Krenitsky, 1980). The titlecompound, (I), was isolated trem A. fuscifiorus extracts andluis been structurally investigated beeause of íts inluDitoryactívítyagainst APRr. A comparative study between (1) andanother ínhíbítor ,slcinunianine (11) (Napolitano et ol., 2003).against the APRT enzyme Will be performed.
~\O~oAo
OCR3
(I)
Enzymatíc tests of compounds (I) and (lI) at 50 j1gtml showinhibitíon activíties of 50% and 68%, respectively. Furtherínvestigations by molecular docking and dynamic simulationswíll be performed to study the interactíons betweencompounds (I).and (11) andthe APRT active site. The new
DOI: '~.1107/S1600536803019925p!l':t't:.iwf'tn te r{~~::Ffr~r~I
Acta cryst. (2003), ES9, o1SQ6.-clS0801506 H. B. Napolitzno eU' .Ó» c,,H'QO'
107
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
organic papers
k1a Cty5taiJog.-aphica Section E
Stn.rcture ReportsOnlineISSN 1600S368
M. Silva," H. B. NapolitallO"·J. Ellena," W. C. Rocha,bP. C. Vieira,b G. Oliva" andO. H. Thlemann"
&lnsl;tutode Físjc;:a. de Sâc Cartos . USP,CI{ pOs.tal 369~ 13560·:970 ..São Carlos SP,Bfazll, and ItDepto.Químk:a - UFSCar,Cl( posla1676, 13565-905 - Sâc Carlos, SP,8razil
Coue$pXdence e-mail: hamikon.if.~c.(Jsp.b
Ke" Í01dÍcalors
Síngle-aystal X-eay .WdyT· 120 KMe." O'(C-<:I • 0.002 ÁR factar a 0.033•••R lactor • 0.090Data ..•.o-pafarnder ratia '" 9.8
FIlr detaíls 01 h<lW the~' key indicator!o W\!fe
aUlOrn21.1cally deived 110m the at'licle, seehUp:l/jutJrnals.iua.orgfe.
11) 2()Q, Inler03li"".1 Uni"" 01 CI)'SI;IlIogl>phyPrin~d in Greal Britain .,.all rishts resesved
3-(5,7 -Dimethoxy-2,2-dimethyl-2H-benzo[bl-pyran-6-yl)propionic acid: a potential inhibitoragainst leishmania
The title acid, C1óH2DO" was extracted from AdiscanthusfusciflonlS (Rutaceaey and is shown to inhibít adeninephosphoribosyltransferase (APRT) enzyme activity. Thiscompound crystallizes in the centrosymmetric space groupC2Jc with one molecule in the asymmetric unir. There is onestrong hydrogeu bond, with ÚD" ,0.1. = 2.6238 (12) À aud0D-H·· ·O.t = 171.1 (17)" involvingthe COOH group,forming a cyclíc dimer about a center of symmetry. Thepacking of the molecules is addítionally stabilized by one C_oH···O [Co·· ·OA = 2.9820 (16) À aud Co~H·· ·0.1. =101.8 (10)°) and two C-·H···:rr intermolecular hydrogenbonds.
Receíved 3 Juiy 2003A""ep1e<j 22 Septembe< 2003ÚfIfjne 30 Se(:i.elnber 20G3
Comment
The title carboxylic acid, (I), has been investigated because ofits interestíng inbibitory activity agaiust adeníue phospho-ribosyltransferase (APRT) from Leishmania tarentolae whichis a member of the pbosphoribosyltransferase (PRTase)family. The PRTases are responsibJe for the salvage oí purine,pyridine and pyrimidíne nueleotides, as well as aromaticamino acids. Most organísms syuthesize adeuine nucIeotidesby both the de novo and the salvage pathways. lu contrast,protozoan parasites are strict purine nucIeotide auxotrophsbecause of the absence of a purine de novo biosynthetícpathway (Berens et al.; 1995). Thereícre, these mieroorgan-isms are absolutely dependem on scavenging pre-formedpuriue nucleotides from the host or the media [Ullman &Carter, 1997). To look for new potential anti-leishmania drugs,we used the APRT trom L. terentoleess a model system toinvestiga te the inhibitory capacity of A. fusciflorus extracts.The sereeníng was performed using a spectropbotometricassay (Tuttle & Krenitsky, 1980); the ICso oi pure compound(I) is 147 jiM. lu view of this interest, we have extracted tbetitle compound, (I), and, present bere its crystalstructure,
OMe
(I)
Compound (I)crystallizes in the centrosymmetric spacegroup C21c with one molecule in the asymtnetric unit, Tberefined moIecular structure, together witbtbe atom-Iabeííngscheme, are shown iu Fig. 1 (Jobnson, 1965). Aílthe bonddístances and angles are close tonormalvaíues (ATIen et al.,
DOI: 10.11071S16O()5.l68OJ02107XOI%3Ctt<)11 ic reprint
M, Silva era! .• C,.t·t,.P5 01575Mta CtySt. (200)). ES'I, 01575-01577
110
I F S ( U S P SERViÇO DE f318~IOTE• INFORMAÇAC
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Aurapten, a novel coumarín with growth inhihition against Leishmania ItUljor
promastl gotes
11B. Napolitano', M. Silva', J. Ellcna', 8.1).0. Rodrigues', A.L.C. Almcída', 1'.C. Vícira2 O.
Olival and O.H. Thiemann'
'l..aoorat(lrio de Proteína, Cristalografia e Biologia Estructural, Instituto de Física de São Carlos,
Universidade de São Paulo, São Carlos, 8P, BrasillDcpllrtantçnto de Química, Universidade Federal de São Cartas São Caríos, SI\ Brasil
Correspondence:
O.H. Thiernann, Laboratório de Proteína, Cristalografia e Biologia Estructural, Instituto de Física
de São Carios, USP
Av. Trabalhador ~lcnse. 400, 13566-590 São Caríos, SP,13rasil
Fax: +55-16-273-9881, E-mail: tlú[email protected]
Research supported in part by FAPESP (No. 99/02874-9 to O.H. Thiemann), H.B. Napolitano
and M. Silva are recipienl ofFAPESP scholarship.
Abstract
\}
Several natural compounds have been identified for lhe treatrnent of leishmaniasis. Among them
are some alkaloids, cbalcones, lactones, tetralones and saponins, The new compound reported
here, 1-geranylox-ycoumann, caíled aW'aptcn, belongs to lhe chemical class ofthc coumarins IInd113$ a moleeular mau af 298.37 glmol. The compund was extracfed from lhe Rutaceae speeies
E$enbeçJ..:iafobrifuga. The compound was purified from ao hexane exlract starting from 407,1g of
dricd leaves and followed by four silica gel chromatographic fractionalion steps using ditrerentsolvents as lhe mobile phase. The resulting 41mg ar compound shows significam growthinhíbition with an U),l4 af 30J4\.f<'lgainst fbe tropical paradte Leuhman!« major, whieh causessevere clinical manifestations in humans and ia endemic in lhe tropical and subtropical regions. In
lhe present study we invelltigaled lhe alomie structure of aurapten in arder to de.••crmine lhe
113
2
existence of common structural motifs that might be related 10 othcr coumarins and potcntially to
orher identífied Inhibitors of Leishmania growth and viability. This compound has a comparable
inhibitory activity of other isolated molecules. The aurapten is a planar molecule constituted ar an
aromatic system with electron delocalization. A hydrophobic side chain consisting of tcn carbon
atoms with two doublc bonds and negative density has been idcntified and may be relevant for
further compound synthesi$.
Kcy words: Coumarin, Auraptcn (7-geranyloxycoumarin), X-rays, Leishmania, tnhibitor.
Introductlon
Lcishmaniasis 15 li disease caused by a protozoan parasito of the order Kinetoplastida.
According to fhe World Health Organization (1), 12 million infected people exist in gg countries,
with approximately 350 million people being at risk. ln view of lhe lack of safe dmga and lhe
serious secondary effects caused by available chemotherapy (2), there ia a need for new droga for
the treatment of leishmaniasis infections, Therefore, lhe discovery of nove! classes of ínbibitors
em be an importam step which conlributes to overcoming the drug resisrance of LeishJtlania (3).
11\\1use of pltytothcrapy to (real human díscases lias its roots in pre..historical times and
mosl of lhe effective drugs currently available are obtained from plants (4). The biodiversity
existing ín Bra.zilian is a potential source of many new bio~tive molecules to be studied and
explored (5).
ln a search for new bioactíve substances potcntially useful against Ieishmaniasis, we II!ICd
L. major Friedlín (WHO MHOM/IU80/FriOOlin) cells as li model system to screen SntilU
molecule compounds obtained (rom Brazílian planta. The screening \VáS dane using an in "No
culture assay in lhe preseace or absence of lhe purified compound and lhe parasite growíh rate
\VaS monitored tnieroscopical1y. This appr<laéh pennitted us to identi(y a new compound wbich
was subsequenüy shown to be 7-geranyloxycoumarin (aurapten). Tbe compound belongs to the
class of collmanns and shows significanl growtlt inhibition of L major promastígores aI
coneentra1ions af miccograms per ml,
Material and Methods
E~tractlon orthe plant Inhlbltor
114
TI1C leaves of Esenbec*iafebr{fllga (Rutaccae) were COllCCICdin Piracícaba, sr, Brazil,
by Prof. Ricardo Ribeiro Rodrlgues (Escola Superior de Agricultura Luíz de Queiroz, ESALQ,
code 84295) in February 2000 and extracted according 10 lhe procedure illustrated in Figure I and
descríbcd below.
Ground Ieaves (407.7 g) were submíncd to a flrst exiractlon step witlt 4.5 L of hexane,
resulting in 9.S g of exnact aftcr lhe solvem was removed, The extract was fractionated by silica
gel chromatography through a 30 em high column measuring S em in diameter using li
hcxane!ethy/ acetate (100:0, 9:1, 8:2, 7:3, 1:1,0:1(0) and an eihyl acetate/methanol (100:0, 9:1,
7.5:25,6:4, 1:1,0:1(0) gradient system, From this purification 30 fractioas of250 mL each were
collected, Fraction 14 (hexane:ethyl acetate 8:2) wasfurther fractíonated on a 3 x 26 em silica gel
column using a gradient system \vilh hexane, methylene chloride and mclhanol (hexane 100%;
hexane/methylcnc chloride 100:0, 90:10, 80:20, 70:30, 1:1; methylene chloridc/methanol 100:0,
90:10,70:30,1:1,0:100). The 79 Iractions (25 mL each) were collected and, based on thin-layer
chromatography (Tl.C) 011 silica gel (0.25-mm thick silica gel, Merck PF 254, hexane/methylene
chloride/aceton 3:1;0.5), anel detected with, Vaniline Aeid, UV Iight 254 and 360 nm and
Dragendorff reagent, ciglll fractions were pooled. Fraction four was submined to
chromatographic separation on a 2 x 31 em silica gol column diluted isoeratieally with 3:1:0.5
hexane, methylene chloride and acetone. This step resulted in 87 fractions (25 mL each), twelve
of which were pooled afler TI.C analysis as above, Fraction tWD was submlued 10
chromatographíc separation 011 a silica gel column ou a 1 x 20 em silica gel colunm usingmethylene chloride as the mobile phase resulted in 24 fractions (25 mL each), four of which were
pooled after Tl.C analysill. Fraction four rcsulled in IIn amorphous yellow solid (47 mg) which is
7-geranyloxycoumarin (aurapten) according to NM'R IH, Uc spectra and OCIMS, lhal was
crystalhzed by vapor dítTusion, at room temperature, from hexane/methylene chloride 2:1. The
purity of lhe compound was confirmed by Tl.C (O.25-mm thick silica gel, Merck PF 254,
Darmstadt, GermaIlY). NMR and GClMS.
Parasãe assays
Stock solutiollS of aurapten were prepared in dimethyl sulfoxide (DMSO) aI 5.0 mg/mI.
Further dilutions of aurapten Were made directly in lhe L. major culture médium immediately
bcforc use. ln aU expcrimenlS the final eoncennatíon of DMSO lcss than 0.5% (vN). a
concentration lha! does not affect parasite growth rale, mobility ar morphology (6).
115
4
L. mujor Fricdlin promastigotes wcre grown to 11 concentration 01' 1.S X 104 cclls/ml in
M199 (Gíbco Laboratories, New York, NY, USA) supplemented with 10% feral bovine serum
(FBS), ]() ml\l adenine, 10 rng/rnl penicillin, 10 mgfml streptomycin, O.25~'. hemin chloride,
0.1%, biotin, and 1.01'.1 HEPES. p11 7.5. The parasire culturcs wcrc prcpared with or without
auraptcn aI final conccntrations 01'2.0, 5.0, 7.0, 10.0 and 15.0 jJ.glml. Thc effect 01' aurapten ou
parasite growth was monitored by counring in uiplicare in a Nebauer chamber after 48-h
ineubation ai 26"C.
Crystallographle characteeizauon or aurapten
Aurapten was crystallized from 2:1 hexane/methylene chloride by vapor diffusion at
room tempcrature. 'I1lC typical crystal was yellow aud was needíe shaped, X-ray diffraction was
carried out using 11 Nonius KappaCCD düTraclomcler ai roem temperature, The structure was
solved by direct methods using the SHELXL97 software (7) and was refined anisotropically with
full-matrix least-squares on P using SI-fiLXI.97 (7). The hydrogen atoms were placed at the
calculated position, eXG<:pIfor those ínvolved in If-bcnds, found 011 difference maps and funher
reflned. Final índices were: RI(F.) = 0.0895 and WRz([tl) = 0.2723 for 165 refíned paramcters,
11lC crystallographic parameters for CI9Hll~ are: :M., '" 298.37, Orthorhombic, space group
Pnma [No. 621 Z 4, a'" 6.557 (1) A, b 7.117 (2) A. C" 35.650 (2) A, V 1664.0 (9) A3•de
1.191 Mg.m'l, ''1. (Mo Ka.) = 0.71073 A, ~ = 0.104 mm", 3205 measured reflecnons, 1616 unique
(R;•• = 0.0301) 1579 of which were eonsidered for calculatlon purposes 3$ obscrvcd wirh aa 1 ;;:20(I). Tbc crystallographie data were depQs.iled in the Cambridge Crystallographíc Data Centre
([email protected]) under accession number 232201.
RC$Ulu and Díscussíon
We investigated and characterized lhe antiproliferatlve activity of the coumarin (7-
geratl)'loxyooumarin), or aurapten, with a moleeuler mass of 298,37 s/moi agaiMt L. májor
Friedlin promastígotes lu axeníc cultures. As shown in lligure 2, L. major promastígote growtb
was significantly íllhibitcd 1»' aurapten, with an LD5U oí 30 p..M. '1'hi& valuc rcprcsenl$ a
significant inhibitory aetivity agaias! L. major and ís similar 10 those obtained for other inhibitors
isolated from Cllherplalllli (8). The negative control, eorresponding 10th.: parasite ín the presence
of DMSO, thc auraptcn solvent, sbowed no dctectable inhibition of gtowth, elteratíon in cell
morphology or motility ar lhe concentraíions tested.
116
Mosr studies directed at lhe detection of plant scccndary metabolites wiih lelshmanicidal
activily have been done U$ing lhe promastigote form of lhe parasite because of its easier
mainrenance under in vitro conditions, However, since lhe promastigote is not lhe infective Iorm
ar the parasito in vcrtebrate hosts, thesc evaluations have only a suggcstivc valuc of lhe possiblc
leislunanicidal activity oflbe compound tesred,
There are several active compounds obtained from medicinal plants traditionally used
worídwide for lhe treatment of leishmaniasis. Among these active molecules, described in lhe
recent literature are quinoline alkaloids, isoquinoline alkaloids, Indole alkaloids, terpenes,
acetogenins, and Iignans (9). Other natural compounds with antileishmanial activity are
coumarins, chalcones, lactones, tetralones, and saponins (9). 111e compound described here
belongs to thc class of lhe coumarins and its activity agains! Leishmania promasugotes is reported
here for lhe Iirst time.
To unambiguously assígn lhe structure ar this inhibitor and to gain insight into commonstructural motifs related 10 other cnumarins and other Ieishmania mhibitors, its crystal structnre
was determined, and several structural features emerged. This new information will be valuable
for the developmenl of a new anti·Leishmanía drug since resistanee to lhe currentíy available
drugs such as antímonials and ampbotericin B has emerged (3).
The refined molecular structure together wilh lhe atom-numbering Behemo is shown in
Figure 3. The molecule is a derivative of cinnamic acid Ihat contains an aromatic system with
elecrron delocalizatlon. 111e1'e is also li hydrophobic side chain consishng of teu carbon atoms
with two double bonds with negative density, Ali bond distances and angles are close 10 normal
values (l0,1l) and lhe molecule is planar, as can be seen in Figure 3. TIRe double weak
intermolecular ínteractions of type C-H O support lhe molecular packing (12) shown in Figure
4. They are lhe intermolecular C8··~IJ8 oi' and C6--H6 ... oz' [s}'mmetry code: i) 1+:\:,y, z]
bydrogen bonds between two neighbor molecules. The distance and dihedral angles between
donor and acceptor are 3.38 (1) A, 180 (5)0 and 3.27 (1) A, 172 (5)°, respectively, TIlc last ofllte
intermolecular hydrogcn bonds CS-H5 ... 02u lsYmmctty code: ii) O.Stx, ')', 1,S-zJ tinldng these
rwo ruoleculcs shows 3.34 (1) A of distance and 163 (3)0 of dihedral angle between donor and
acceptor, The planarity shown in 11Iemoleculareonfigw:ation and lhe intermoíecular interactionsare consístent with typical $1rttctural features observed in anlj·LeishmunÍa inldbitars e13·1S).
Figure 5 shows the L. major culture in lhe presence and absence oí the inhíbiror, Forty-
eight h afier lnoculation, a significant decrease in sut\1ving promastigotcs \Vai observed ín lhe
presence 01' aurapten (Figure 5b) at afinal concemration of 30 w.1. The surviving parasites
sll()\\'ed abnormal morphology ,\\;111the preseaee of largc vacuoles and low flagcllum motilily.
117
This preliminary cvaluation 01'auraptcn's acrivíty using promastigorcs yieldcd intercsting results
indicating that lhe compound should be investigared further as a potenrial antÍ-Leishmania
compound,
Acknowledgments
We would like 10 thank lhe members of the Protein Crystallography and Structural
Diolog)' and Bíophysics Groups (IFSC, USP) for helpful discussions during thc course of lhe
sludy. We would like 10 express our gratitude 10 the organizers of lhe ACA Summer Course in
Small Molecule Crystallography, August 4- t 3, 2003, for the single crystal díffractíon experimento
Reterences
J. WHO (1998). World IIealth Organization, htlp:/!www.who.intltdr/diseasesJleish!
diseaseinfo.htm.
2. McGreevy PD &. Marsden PD (1986). Campbell WC &. Rew RS (Editors),
Chemotheraphy cfl'arasitic Diseases. Vol. 1. Plenum Press, Ncw York.3. Croft SL (2001). Morntoring drug resistance in Leishmaniasis. Tropical Medicine and
International Health, 6: 899-905.
4. Carvalho PD &. Ferreira ElL (2001). Leislunaniasis p11ytotherapy. Nature's leaderahip
againstan ancient disease. Fttoterapia, 72: 59')..6) 8.
5. Elisabctsky E & Shanlcy P (1994). Ethnopharmacology ín tlw Brazilian Amazon.
Pharmaoology and Therapeuttos, 64: 201-214.
6. Zhai L, Chen M, Blom J, Theander TO. Christensen SD & Kharazmi A (1999). The
antileishmanial activity of novel oxygenated chalcones and their mechanism of actíon, Journal o/
Anümtorobial Chemotherapy, 43: 793-803.
7. Shcldrick GM (1997). SHELXL97. Rcfinemctrt oflargc small-molecule structures usillgSHELXL-92. In: Plack, IID. Pilrkállyi L & símon K (EdiIOTli), Crystallographto Computing 6.
Oxford UnivCl-sityPress, New York.
8. Chaa-Bacad M1 &. Pena-Rodrígues LM (2001). PIant natural producl$ with
leishmnnicidal activity. Natural Product Reports, 18: 674-688.
9. Akendcngue B, Ngou-Milama E. Laurens A & Hocquemiller R (1999). Recent advanccsin the fíght against Ieishmaniasis with natural products, Parasite, 6: 3-8.
118
10. Farrugia LJ (1997). ORTEP-3 for Windows - a version ofORTEP-lII with a Graphical
User Interface (OUI). Journal of Apphed Crystallography, 30: 565.
11. Allen FH, Kennard O & Taylor R (1983). Systematic analysis of structural data as a
research teehníque in organic chcrnistry.Accounts of Chemtcal Research, 16: 146-153.
12. Spck AL (2003). Singlc-crystal structure validation \vith lhe program PLATON. Journal
of Applted Crystallography; 36: 7-13.
13. Napolitano IID, Silva M, Ellena J, Rocha WC, Vieira PC, Thiemann OlI & Oliva G
(2003). Rcdctcrmination and comparative structural study of Isopimpinellín; a new inhibitor
against lhe Letshmania APRT enzyme. Acta Crystallographica, E59: 0I5()6....()1508.
14. Napoíftano IID, Silva M, Ellena J, Rocha WC, Vi eira PC, Thiemann OlI &, OIiv3 G
(2003). Redetermination of skimmianine: a new inhíbitor against lhe Letsbmania APRT enzyme.
Acta Crystallographtca. E59: 01503 or 505.
15. Silva !vi, Napolitano fID, Ellena J, Rocha WC, Vieira PC, Oliva G & Thiemann Oli
(2003). A potential inhibitor against Leishmania, 3-(5,7-Dimethoxy-2,2-dimethyl-21I-
benzolb lt»Tan-6-yl) propionic acid. Acta Crystallographica; E59: 01 S75-0 1S77.
119
Figures
SUlca Gel Chrom.Hexane/Ethyl Acet.Ethyl Acet./Methanol
ractlo
Silica Gel Chrom.Hexane, Methyl Chiar.,
Methanol
Silica Gel Chrom.Hexane, Methyl Chlor.,
Acetone
7..geranyloxycoumarin '(Aurapteno) 47mg
Figure 1. Fíow diagrant of dte aurapten Isolatíon procedere, Individual steps ate déscribed ia
Material and Mcthoos. The solventsused for elntion of lhe chromatography cotumn are listed inlhe boxes on the Ieft side. Acet •• acetate; chrom, '" chromatography; chlor. ee chloride. Sílica gel
columa cflluents were monilored by Tl.C to select fraclions for futthcr pUlification.
120
100
90
80
70
~ eoe...c: 50.2:ã 40:c.E
:90
20
10
OO 1 2 3 4 5 6 7 8 9 10 11 12
aurapten concentration (llg/mL)
Figure 2. Atlli1\1ishmanialactMty of aurapten againsl Leishmania major FriedJin promastigOlCS.CA'lI\swere cultivated in the presence of different concentrations 01' aurapten and counted aíter 48
h. l1\chcight of lhe bars indicares de percentsgc or growth inlúbition at eaeh concenrraríoncompared to lhe conrrol experiment containing only the aurapten solvem DMSO. The
experiments were performed three times indcpcndently and each counting was performed intriplicate, Data are reported as means ± SD.
121
1 r,
Figure 3. X-my ctystal100Jllphic structure ofthe aurapren. Displacement ellipsoids are sbown at
lhe 30% probabitity Ievel, Carbon and oxygen atoms are labeled for clarity.
Figure 4. A view of auraplen's pacl;ing showing C-ILO interactions. Symmetry codes (i) and
(ii) correspoad to {l +x, s. zland [Oo5+x, Y. 1.5-z1 respcctively.
122
11
Figure 5. Leishmania major promllsugote culture. Promastigotes were culturedin M199 mediumsupplemented wilh 10% fetal bovino sernm ar 26"e alld cell víabiliry was estimated by counting
in a Neubawer chamber after 48 1101' incubation in fhe presence or absence of lhe inhibitor, A,
Negative control without aurapten in lhe presence of 0.5% DMSO. 8, Condition containing 30
~tM aurspten and 0,5% DMSO. C attd D are expansions ar Figures A and R, respecnvely(indícated by lhe squares in A and B) showing lhe different morphological characrerisnce of lheparssite in tile presenee of aurapten, Vacuoles are indicatcd by the arrow,
123
1 In-vívo and In-vttro effeet of'feur compounds of Adiscanthus fuscifloms: Inhlbítlon of2 phosphoribosyl transferases ;lcth'it~,and antilelshmanial effeet,3
4 M. Silva' •C. H. T. P. Silva', W. C. Rochab, M. S. Castilho', P. C. Vieira", G. Olival and O. lI.3 Thiemann"(,
7 x Laboratory 01' Protein Crystallography and Structural Biology, Physics Instituto of São8 Carlos, University of São Paulo, USP, Av. Trabalhador Sãocarlcnse 4{){),PO Box 369,9 13366-590, São Carlos-Sl', Brazil. b Chemistry Department, Federal University 01' São
10 Carlos - UFSCar, PO Box 676, 13565-905, São Caríos, Brazil;II
12 * Conesponding authot- e-rnail: thiemanu@it~sc.usp.hr, Phone: (55- 16) 3373-8089, Fax:
13 (53-16) 3373·9&&1.
14
15 Objectives: The aim ofthis stud:r was the screeníng of nonll.eisllmm,in lnhíbitors,1617 Methods: PJant ertraets ofwere fl"actionated guided by APRT eOZ)'J11einhibition. The18 inhibitol'8 obtaíned were further tested lu XPRT and HGPRT enzymes, The19 antilcishmanial propertíes or the seleeted moleeules were anal}'Zed on in vuro L major20 pl'Ontalo"tigote,sculture in I-il-o. The Jnteractíons between útltibitol'8 and lhe enzymes21 were IlnalY'.loob)' computatíonal moleeular docklng.2223 Results: Iloul" selected allmloid$ ftnd eumarínes present inJubitory propenies lu both24 systents nsed, the bloehemlcal PRTasc assay nnd the ln ,,1tl'OLeishmauia inhibUion.2526 COl1cJuslons: The resulta rcported here conccming the inhibitiol1 or PRTase enzymes27 and IA major promastigote parasítes Indícate that the four natural moleeules selected28 can be further cxplolted as Iead rompounds in a ratlonal drug design approach or29 compound optimization against haman leishmaniasis.3031 Abbreviations: 5' -phospho-o-d-ribosyl-L' -pyrophosphate • PRPP;3233 Keywords: Leishmania, phosphoribosylíransferase, natural product, alkaloids, cumarine,34 Adi,scanhus tuscttlona.3536 Intreduetlen
37 lu countries of África, Asia, Middle East and Latiu America t leishmaniais has been
38 identífied as a serious public health problem by file World Health Organization (\VHO) and
39 the disease is also endemic in tire southern countries of Europe. lu the last two decades the
40 appearanee of cases of co-infectíon of AIDS and Leishmanta have added 11 new dimension
1
124
41 to the problem 2.3. 'lhe peopling of new habitats and thc increased human mobility has
42 taken leishmaniasis to regions previously unaffected, such as lhe North American region 4.
43 111Cestimated prevalencc of 12 million infected and 350 million lives IIt eminent risk of
44 infection reflects the global dimension to leishmaniasis as public health concem s.45 To oppose this scenario, new drugs and new formulations of old drugs are either approved
46 or on clinícal trial, rendering the current Ieishruaniasis cbemotherapy more promising tlU111
47 it has been for several years ". lu spite of the progress, antileishmanial drugs in use are
48 generalíy toxic, expensive and dcmanding long-term treatment with hospitalization, Those
49 aracharacteristics attributable to low target specifícity 7 and eontribute to a general
SO inefficaey of lhe eurrent treatment approaches. The new drugs and formulations may
51 alleviate, but is doubtfully alter significantly, the current global scenario -. Therefore, there
52 is a great and urgent need for the development of new, effective and safe drugs for the
53 treatment of leishmanlasis.
54 TIu: institution of a rational therapeuric regimen for lhe treatment of parasitic
55 diseases depends 011 the exploitation of fundamental biochemical disparities between
56 parasite and hest, One of the most striking metabolic discrepencies between parasites and
57 human is the purine pathway !I.II. Whereas mammalian cells can synthesize the purine
S8 heterocyele de novo, ali Kinetoplastida studied are auxotrophic for purines 12,13. In these
59 organisms lhe enzymes that enable the organism to scavenge host purines are the
60 hypoxanthine-guanine phosphoribosyltransferase (HGPRT; EC 2.4.2.8),. adenine
61 phosphoribosyltransferase (APRT; Ee 2.4.2.7) and xanthíne phosphoribosyltransferase
62 (XPRT; EC 2.4.2.22) 12.13. Unique features of lhe purine salvage pathway of Leishmania
63 and Trypanosoma constitute the basis for the susceptibility of these genera to several
64 pyrazelopyrirnidine analogs of naturally oecurriág purine bases and nueleosídes 1l.13-IS.
65 A rich source of nove! lead compounds for the drug diseovery process has beco the
66 sereening of natural compound sourees such as plants, animals and mieroorganisms. Brazil
67 isreeognized as a repository of a large, and mostly unexplored, biodiversity with a vast
68 potenlial to yicld novel therapy alternatives,
69 III the present study we used lhe Lei$hmanía I'RTase enzymes as targets to screen
70 tbe inhibitory capacity of several small molecules compounds from Brazilian plants. We
71 describe ín thís communícaiion four new PRTase inhibitors and theír respectivo
2
125
72 amilcisbmanial activíties. 11l.! sclcctivity ol'lhc compounds was tested against human and
73 Leishmania cells and the molecular basis for the compound inhibition was investigated by
74 molecular docking techniqucs with each Pk'Iase. Such systematic approach oí'
75 investigation identified lhe alkaloids and 11 cumarine as lead compounds and are used in
76 their further improvement.
77
78 Materiais and mcthods
79
80 Pnrificatton q[ enzymes and inhibitors. L. tarentolae APRT, HGPRT and 1_ major XPRT
81 enzymes were purified from Escherichta coli in recombinant expression systems as
82 described previously 16.17•
83 The skimmianíne, isopirnpinellin, y-fagarine and dictamine inhibitors were purified from
84 roots and leaves of Adisoanthus fusciflorus (Rutaceae) colleeted from lhe region of Manaus
85 in the Amazon Statc of Brazil, The purification protocol includes successive extractions
86 with hexane and methanol as deseribed previously 18.19. The struoture of the tested
87 compounds is shown in Figure 1.
88
89 Hnzymatic assay and inhibitor Screening. The AI'RT, HGl'RT and XJ>RT activity aod
90 inhibition assay were performed as deseribed previously in a speotrophotometric assay aí
91 lhe wavelengths of259. 255 and 254 respectively 20. The principIe of'the assay permits to
92 explore the rale oí' change in absorbance res\llting írom the ccnversion of the enzyme
93 specifie substrates to the resulting nueleotide. 111C nssays were earried out at 25"C in a
94 reaction mixture 01' 500 J1L containing the following reagents: 100 mM Tris-HCI pU 7.4,
95 100 Jt>.1PRI)P and 5 mM MgCh. lhe APRTassay contaíned 50 .~ Adcnine, HGPRT 40
96 J:tMguanine, and the X"PRT assa)' 50 ~f xanthine and no MgCh was added. Ali PRTase
97 reactíons were initiated by the addietion of ~nzyme to n final concentration of 2•.•.g!mL and
98 monitored during 1 mio for APRT and HGPRT and 30 seconds for XPRT assay,99 1110 screeníng 01' natural products with inhibitory activity against lhe Leishmania
100 Pltrases was perfonned in triplicate using the standard aetivity assay deseribed. The
101 illhibitors stock solutíons were prepared til dimethyl sultoxide (DMSO) at I mg/mL.
102 Further dilutions were performed in the assay reaotion buffer inunediately prior to use. Tbe
3
126
103
104105
106
107
108
109no111
112113
114
115
Il6
117
118
119
120
121
122
123124125
126
127
128129130
131
132
133
final conccntratron 01" DMSO in lhe enzymatic rcaction did not exceed 5% (v/v), a
concentration at which lhe solvem did not affect lhe activities of the PRTases tested,
Cell culture and inhibition assClJ'S. L. major promastigotes were grown in Ml99 (Gibco
Laboratories) supplemented with 10% heat inaetivated fetal bovine serum (FBS), 10 mM
adenine, 10 mg/ml, penicillin, 10 mg/ml, streptomycin, 0.25% haemin chloride, 0.1%
biotin and 1.0 M Hepes pI ( 7.5 at 26"C. '111einhihitory effect of each compound was tested
ín promastigote cultures at 1.5xI04 cells/ml, with and without inhibitors in 12 well plates, 2
mlJwell. 111e concentrations of inhibitor tested were 2.0, 5.0, 7.0. 10.0 and 15.0 I1g/mI.•.
Cells were counted in a Newbawer ehamber in six independent experiments after 4811
ineubation at 26"C. In ali experiments lhe final conc'Cntration of DMSO was kept lowcr
than 0.5% (v/v), a concentrarion that doesn't show evidence of affecting the parasite growth
rate, mobility or morphology 21.
Human U937 promielocytes (,,'0118 were used to test the seleetivity of the inhibítors, The
cells were cultured ín RPMI1640 media at 37°C in a 5% C{}zatmosphere. A concentration
of L5xlOs cells/ml, were ineubated in the presence or absence of ínhíbitors and DMSO in
12 well plates, 2 mlJwell, and counted in a Newbawer chamber after a period of 48b.
Growtb inhibition protection experiments were carried out as deseribed for L. majorpromastigote assays. lu each culture, in triplicate, were added 50J.lM and 500J.lM of each
purine (adenine, guanlne, xanthine and hypoxanthine) as weíl as lhe ínhíbitor
(skimmianinc. dietamine, 1'-fagarine and isopimpinellin) at the LDso concentration of each
compound. Controla without inhibitors with added purines and with inhibitors in the
absence of'purines were performed in parallel.
Docking procedure. Docking simulations were performed with the (',oLD 2.1
software 22. which does flexible doeking lISing li genetic algorithm, 111eparameters used in"this algoritlnn were originally optimized from a set of 305 complex struetures with
coordinates deposited in tbc Protein Data Bank (PDB). Among lhe pararneters llvailable in
the programo we used a population equivalem 100000 operations, 95 mutatións and 95
crossovers, Docking ealculations were done in the interior of spheres of 15 A radiua with
origine at: AlaS() (Cj3 atom) of lhe APRT strueture; Asp126 (001 atom) of the HOPRT
4
127
134 structure and ValI21 (C'{J atom) of the XPRT model. The ten orientations of highest score
135 for each compound W':"'fC then selected using the score Iunction denominatcd Goldêcore.
136 On lhe basis 01' this function, lhe program classifies the oricntations 01' lhe moleeules in a
137 decrea sed order 01'affinity (score) with me Iigand site ofthe receptor.
138 Before the docking calculations and after remova! of ligands aud the
139 crystallographic waters from the active sites ofthe APRT and HGPRT structures, as well as
140 the XPRT model, we added and oriented hydrogens of the side chains aflita residues of the
14 J respeetive aetive sites. Charges and atomic potentials were assigned to me protein
142 structures and model using the Insight 11program 23.
143144 Results145
146 Eifocl of isolated compounds on lhe inhibtnon of Leishmanta PRTases. The recombinant
147 APRT enzyme from Letshmania tarentolae was used to guide the purifícatíon of novel
148 PRTase inhibitors In this approaeh we screened lhe inhibitory activity of 1.126 extractss
149 from Brazilian plants, the best four inhíbítors selected from Adiscanthus fusctfloru«
150 (Rutaceae) are shown in figure 1. '111e inhibitors selected using the Leishmanta APRT were
151 then tested for their inhíbitory capacity in nGPRT and XPRT enzymatic assays sinee it will
152 be interestíng from the standpoint of a lead compound to be able to inhibit all three
153 enzymes simultaneously. 111e inhibitory activity of each seleeted compound (Figure 1) on
154 the three PRTases and on lhe L. major promastigotes are shown in table I,
155 The eflect of eaeh compound 'isolated from A. fuscifloms 011 the Letshmanta PRTases is
156 shown in Figure 2. Ali 4 ínhibirors exhibited a clear linear concentration dependem effect.
157 ln comparison wíth the control experimenta with solvem (DMSO) alone the compounds
158 showed a signíficant eflbct 011 the PRTases activity (p<O.05).
159 A correlation of dictarnine, r-fagarine and isopimpinellin inhibitory effect OVer each
160 PRTuses ís observed. Skímmianíne however'showed a distinct seleotivity for both XPRT
161 and HGPRT. whereas it inhibíted APRT activity at a similar level asthe other three
162 cornpounds,
163 The leso calculated for each inhibitor agaínst lhe PRTa.'les was caleulated and is shown in
164 Table1. The inhibitory effect of skimmianine 011 I1GPRT and XPRT activity is 100 fold
5
128
165 higher as its activity with APRT. Ali other ccmpounds show a similar inhibitory activity
166 over eaeh PRTase, reflecting a low selectivity of'those inhibitors for lhe enzymes.
167
168 ElTéc( (I' isolated compounds on lhe in-vttro growth cfLeishmania 11/(90r promastigotes
169 and human promyeloctte cells. Figure 3 shows the effeet of the alkaloids and lhe cumarine
170 on the ín-vitro growth of L. major promastigotes. Ali four compounds exhibited a clear
] 71 concentration-dependent inhibitory effect, III comparison with lhe control, the compounds
172 showed a significant inhibitory effect on the in-vitro growth of L. major promastigotes at
173 concentraíion of20 pg/ml, and above (P<0.05).
174 Table I shows the U)SQ values of the four compounds 01\ the in-vitro growth of L. major
175 promastigotes and human promielocytc cells. The LD5fJ values on the prornastigote and
176 human cells are equal, reflecting a lack of oellular selectivity. A small difference is though
177 observed on the effect 01' skimmianine, that shows a redueed eífeet ou L major
178 promastigotes (LD5O""98~M) wen oompan ..•d to the human cells (245Jl~f).
] 79 Control experimenta have been performed to evaluate the effect of DMSO on the growth of
180 lhe L. major promastigotes and human promielocyte cells. No significant Ievel of growth
181 inhibition was detected at the concentrations used in the tests as well as no morphological
] 82 alterations were observed by phase contrast microscopy (Data not shown),
183
184 Effcct of lhe addttton o[ purines to lhe Letshmama eu/fure. The observed bíochemícal and
185 eell culture eífeets of the eopounds is not obviously a linked phenomeaon, To ínitíally
186 idcntify anycorrelation we used lhe addition of purines (adenine, guanine, hypoxanthine
] 87 and xarahine) to lhe cuhure media in an nttempt to identify a possible protection or survtvo!
188 rescue that could be suggestive of a correlation between the bioehemical and cellular
189 observations.
]90 Table 2 shows the inhibitory effect (iu % gro'\\1h inhibition) of each a1akaloid and cumarine
191 in the presence of two differentcolllXntralions 01' puriues, 50plof and 500pM cacho Except
192 for dictamine; the other compounds (skimmianíne, isopimpinellin and r·fagarine) aífected
193 less severely tllegrowth ofthe parásites, The data is preliminary, but reveals an interesting
194 possibility of correlation.
195
6
129
196
197
198
199
200201
202203
204205206207208209210
211
212
213
214215216217218
219
220
221
222223
224225
226
Molecular fitness of tbe isolated compounds in the PRTase acttve site. To obtain a
molecular understanding of the type of interactions occurring between the alkaloid and
cumarinc compounds and lhe targetcd enzymes, molccular docking cxperiments werc
perforrned. Those experiments used as targct molecules lhe molecular structurcs of lhe
Leishmania APRT and HGPRT and lhe molecular model of lhe Leishmania XPRT
determined in our group 16.11. lu general, lhe docking results obtained with GOLD 2.1
(Table 1) for lhe compounds here studied agree with the enzymatic inhibition experimente
shown in 'fabio 1.
Clear interactions of each inhibitor with amino acid side ehains are observed from
this analysis. The top scoring interactions are shown io figure 4a-c.
Discus..'Iion
Scientífic evolution of medicinal plants has, in the past, provided lhe basis of
modem medicíne. Several compounds from higher plants are currently being evaluated in
various laboratories as potential antiparasitic agents for malária, trypanosomiasis and
leismaniasis 24. The search for bioactive molecules normally begins with the sereening of
severa I plant extraets, isolation of bioactive fractions and identification of the active
componente when feasible 25. MOl>1 of lhe studies directed toward the detection of plant
secondary metabolites with lcisbmanicidal activity have been done using the promastigote
form of the parasite due to the facility to maintain under in vttro condítious 16. In spite of
that one of the critica! points of the Ieishmaníasis phytotherapeutical research is the lack of
good and rapid sereening methods to find potential plants and to evaluate them 27. For a
rational drug desígn approach il is paramountto understand lhe molecular target enzyme
whose inhibition is intended, The enzymes of the purine salvage pathway have been
considered as appropriate targets by different laboratories 9-12. lu this context, the inhibition, . .
01' the three phosphoríbosyl transferases (PRTases) of the pathway; adenine, guanine-
hypoxanthine and xanthine PRTases, is necessery, We present in this paper four nCW L.
major prornastigotea inhibitors with bíoactivíty similar at Pentostam, a commercial
leishmanicida 21. Although of moderare inbibition capaeity 26, their selection process
represents a novel approaoh, This strategy permitted usthe selection alld isolation of
7
130
227 alkaloids and a cumarine, whieh are the most importam group 01' natural compounds with
228 antileishmanial activity 24. In recent years a few attempts for screening medicinal plants
229 uscd for lhe treatment 01' leislunaniasís havc been carried out in Spain, Sudan and Guinea-
230 Bissau. These studies have confirmed lhe irnportance 01' mau)' plam species as potcntial
231 source for the isolation 01'novel compounds with leishmanicidal activity 26.
232 All four compounds (Figure 1) selected from our screening approach showed an inhibitory
233 activity against the Leishmania PRTases in a concentration dependem manner (Figure 2).
234 The inhibition effect ou eaeh individual PRTal>c ís very similar for dictamine.
235 isopirnpinellin and y.fagarine and varies from an IC~ of 260J.11'vf ror dictarnine against
236 APRT to 80llM for y-fagarine against HGPHT (Table I). The inhibitor skimmianine
237 however, presented a marked seleetivity for XPRT and HOPRT (1.1 J.lM and 1.8 ~IM.
23& respectively) over APRT inhibition (142 f.lM).
239 This selectivity 1S also revealed, although to a Iesser extent, in lhe in-vitro Leishmania
240 promastigote and human promyelocite culturc assays. From the four inhibitors selected,
241 only skimmianine has shown a small selectivity (2.5 fold) egainst Leishmania cells (LD50
242 of98 ~IM) over human promyelocite cells (LD50 of245 ~lM) as shown in table 1. This result
243 doesn't mean that the compounds are acting specifically 01\ the PRTases in-vivo, but it
244 representa a first indication that they may be good starting eompounds, In an attempt to
245 understand if there is a correlation between the biochemical inhibition of the PRTases and
246 tbe growth inhibhíon of promastigotes severa I experiments must be performed in the future.
247 An initial experiment trying to proteet lhe promastigote cells from the purified compounds
248 using a mixture 01' purine nucleotides in the eulture media revealedthat with lhe exception
249 of dictamine, the other alkaloids (skimmianíne, and y-fagarine) and the cumarine
250 isopímpinellín, affected Iess severely lhe growth of the psrashes (Table 2). lhe data is
251 preliminary, but reveals an interesting possibility of correlation.
252 Ali three alkaloids and the cumarine represent lead compounds that can be interesting
253 starting poínts ín a ratíonal based drllg d~ign approaeh, For this sim, we used lhe
254 molecular docking teehnique to address the imeraetíon of'eaoh inhibiror with each PRTasc.
2SS III general, lhe docking resulta obtained with C'JOLD 2.1 for lhe eompounds here studied
256 agree with the enzymatic inhibition experimente shown in Table I,
8
131
257 Concerning APRT. thc experimental affinity order for the activc site is thc following:
258 skimmianine » isopimpinellin > y-fàgarine » dictamine. In other words, skimmianine and
259 isopimpinellin have similar leso valucs and lhe)' are above lhe values obtained for 1-
260 fagarine and dictamine, This last compound has the lowest and far IC5(j "alue amongst ali
261 the inhibitors, From the Table ]) the Goldxcore of lhe compounds concerning lhe APRT
262 strueture is very similar to the order obtained in the experimental work, lhe fitness of both
263 the skimmianine (46.11) and isopimpinellin (45.97) with the enzyme 1S very similar and
264 they are higher than lhe scores obtained for y-fagarinc (44.28) and dictamine (42.42).
265 Analyzing thetop-ranked solutions obtained with C'JÜLD for these 4 compounds inside ale
266 APRT active site, dictamine is the only molecule that does not perform any strong
267 hydrogen bond with residues of APRT, theoretically. Skimmianine is hydrogen bound to
268 both the conserved Lys102 and Lys105 residues, Similarl)', isopimpinellin has strong
269 hydrogen bonds with the side chain of Arg316 as welí as lhe side chain of Lys 102. Ou the
270 other hand, the GOLD result obtaincd forj-fagaríne suggests that this molecule interaet by
271 hydrogen bond with the LyslO2 side chain. Top-ranked solution of skimmianine inside the
272 APRT active silo is shown in Figure 4a.
273 Concerning HGPRT, the experimental ICso values (Table 1) reveal skimmianine and
274 dietamine as the best and the worse inhibitofS, respeetively. Our theoretícal resulta (Table
275 1) agree with the enzymatic inhibition experiments, suggesting skimmianine as the ligand
276 with highest Goldâcore (37.91). Ou the other hand, dictamíne has the lowest score (34.93)
277 and could be theoretically lhe worse Inhíbitor, Analyzing the top-ranked solutíons obtained
278 with GOLD for these 2 alkaloids inside the HGPRT active site, skimmianine is strongly
279 hydrogen bound to lhe nitrogen atom of'the ASPI29 main chain (Figure 4b).
280 Concerning XPRT, our docking resulta (Table 1')suggest skimmianine as the best inhibitor
28t (Goldâcore = 49.95). ln fact, the experimental IC~o value obtained from the XPRT
282 inhibition with this alkaloid is the lowest (1.1 ILM) amongst ali the 4 inhibitors (Table 1).
283 TIw GOLD top-ranked solutions for skimmi~nine iriSidc the XPRT actíve site suggests a
284 strong hydrogen bond between the nitrogen atom of'tbe ASP123 main chain of the enzyme
285 and lhe oxygcn atom of'the furane rins of'the inhibitor, whieh are separated by a distance of
286 2.3 A (Pigure 4c). 'file results obtained with GOLD for XPRT must be analyzcd with a
9
132
287 certain caution because we have used a homology model and not a structure obtained by
288 single crystal Xvray diffraction techniques.
289 lu couclusion, three alkaloids and li cumarine havê bcen selected by biochemical assays
290 directcd towards lhe Leishmania Pk Tascs and furthcr characterized by theír ability to
291 inhibit the growth of L. major promastigotes in culture. A parallel experiment testing their
292 selectivitywas performed with human promyelocite cells,
293 The correlation of'the bioehemical data withthe culture data has been preliminary obtained
294 by demonstratíng 11 protecting effect of li mixture of purines in the presence of lhe
295 inhibitors.
296 Furthermore, a rnolecular doekíng analysis has been performed to access the struetural
297 elements involved in lhe binding of eaeh inhibitor to lhe active site of each Pk'Iase,
298 indicating the structural elements involved in selectivity and binding for further exploration
299 ín a rational drug enhancement program,
300 Those compounds isolated from a Brazilian plant show prormsmg results as lead
301 compounds for future studies toward the development of an effective antileishmanial
302 compound.
303
304 Acknowledgmcnt
305 This work was supported in part hy a researeh grant 99/02874-9 to O. H. Thiemann and
306 98/14138-2 to G. Olivs (FAPESP). MS receíved a scholarship from FAPESP (# 00/14709-
307 1). Wc would Iike to thank U1C members of lhe Protein Cryslallography and Struetural
308 Biology Group (lFSC-USP) for helpful discussions in the course ofthis work,
309
310 Referellces311312 1. UNDp/WB!WHO (1989). The Leihmaniasis. In Tropical Diseases: Progress in313 IntemationaI Research, 1987-1988. WHO speeial prognun for research and traíning314 in tropical diseases ninth program report, World Hcalth Organizatioe, Geneva,315316 Z. Olliaro, P. L. & Bryceson, A. D. M. (1993). Practical progress and new drugs for3 I 7 ehangil1g pattems of leisbmaniasis, Parasitology Today. 9, 323·8.318319 3. Alvar, 1.. Gutierrez-Solar, B., Pachon, I., Calbacho, E., Ramirez, M., Valles, R. et320 ai. (1996). AIDS and Letshmonia infantum: new approaches for a new321 cpidemiologica1 problem, Clouos 111 Dermatol<fgY. 14, 541,..6.
10
133
I F S ( U S P SEHVIÇO DE BIB~IOTECl'.• INFORMAÇAO
322323 4. Enserink, M., (2000). nas leishmaniasis becornc endemic in the US? Sctence. 290,324 1881-1882.325326 5. Modabber, F. (1993). Leishmaniasis. In Tropical Disease Research. Progress327 J991- 92. (UNDPíWorld BaukfWHO special programme for research and training328 in tropical diseases), pp. 77-87. World Health Organization, Geneva.329330 6. Croft, S.L, Urbina, 1./\.& Brun, R. (1997). Chemotherapy ofbuman Icishmaniasis.331 lu Typanosomiasts and Leishmantasis CAB InternationaI24S-S7.332333 7. lwu, M.M., Jackson, 1., E. & Seuster, B.G. (1994). Medicinal plants ín the fight334 against leishmaniasis. Parasitology Today. 10, 65-ft335336 8. Simon, C., L. (2001) Monitoring drng resistance in leishmaniasia, Tropical337 Medicine and International Health. 6,899-905.338339 9. Hyde,J.,E. (1990) lu lIydc,J.E. (ed.), Molecular Parasitology, Vau Nostrand340 Reinhold, New York, pp. 181-228.341342 10. Hassan, H., F. & Coombs, O., H. (1986). A comparative study of the purine- and343 pyrimidine-metabolising enzymes of a range of trypanosomatids, Comparative344 Biochemistry and Physiology Part B: Biochemistry and Molecular Btology. 84B,345 217·223.346347 11. Berens, R., L., Drug, E.C. & Mau, 1., J. (1995). Bioehemistry of Parasitíe348 Organisms and Its Molecular Foundations (1.1. Msrr, M. Muller, eds), Academic349 Press Limited, London, 89-117.350351 12. Ullman, 13. & Carter, D. (1997). Molecular and blochemical studíes OU the352 hypoxanthíne-guaníne phosphoribosyltransferases of the pathogenic353 haemoflagellates. Intemauonal Journal of'Parasitology. 27, 203-13.354355 13. Ullman, B. & Carter, D. (1995). Hypoxamhine-Guanine Phosphoribosyltransferase356 a.s a Therapeutio Target in Protozoal Infections, Irfectious Agents and Disease. 4,357 29-40.358359 14. Hochstadt, J. (l978)Methods Enzymol; 51,558-67.360361 15. Palella. T., D. & Fox, 1., H. (1989)' In Scnver,C.S,. Bcaudct,AL, Sly,\V.S. and362 Valle,D. (eds.), The metabolic basis of ínherited diseases, MacGraw-Hitl, New363 York, pp. 965-1006.364365 16. Silva, M., Silva, C., H., T., P., Iulek, 1., Oliva, O. & Thiemann, O., H. (2003).366 Crystal structure of adenine phosphoribosyltransferase (APRT) from Leishmania367 tarentolae: potential ímplicanons for APRT catalytic mechsnism, Blochlmlca et368 BíophysicaActa.16%.31-9.
11
134
369370 17. Monzani, P .• S., Alfonzo, J.. D. Simpson, L., Oliva, G. & Thiemann, O .• H. (2002).371 Cloning, characterization and preliminary crystallographic analysis of Leishmania372 hypoxanthine-guanine phosphoribosyltransfcrasc, Biochimtca et Biophysica Ael.373 1598,3-9.
374375 18. Napolitano, H., R., Silva, M., Ellena, J., Rocha, W. C., Vieira, r.C., Thiemann, O.376 H. & Oliva, G. (2003). Redetermination of skimmianine: a IlCW inhibitor against the377 Leishmanla APRT enzyme, Aera A era Crystallographica. r'..59, 1503-5.378379 19. Napolitano, H., B., Silva, M., Ellena, J., Rocha. W. C., Vieira, P. C.• Thiemann, O.380 H. & Oliva, O. (2003). Redetermination and comparative structural study of381 isopimpinellin; a new inhibitor agaínst the Leishmanta APRT enzyme, Acta382 Crystallographica.E59 .•1506-8.383384 20. Tuttle, J.,V. & . Krenitsky, T.A. (1980). Purine phosphoribosyltransferases from385 Leishmanta donovani, Journal of Biological Chemistry. 255, 909-16.3&6387 21. Zhai, L.. Chen, .M., Blom, J., Theander, 1'. O., Christensen, S. B. & Kharazmi, A.388 (1999). 11w antileishmanial activity of nove! oxygenated chaleones and their389 mechanism of action. Journal of 'Antimicrobial Chemotherapy. 43, 793-803.
390 22. Verdonk, M. L., Cole, J. C., Hartshorn, M. J.. Mulrray, C. W. & Taylor, R. D.391 (2003). Improved Protein-Ligand Doeking Using COLO. Proteins. 52.609-623.
392
393 23.!n!{ÍghtlI User Guide, (1997). Aceelrys Scientific Support. 97, 1-103.
394
395 24. Akendengue, R., Ngou-Milama, E., Laurens, A. & Hocquemiller, R. (1999). Recent396 advances in the figbt against Ieishmaniasis with natural products, Parasne. 6,3-8.397398 25. Zerehsaz, F., Salmanpour, R.. Handijani. F. et ai. (1999). A double-blínd399 randomized clinical trial ofa topícal herbal extraet (Z-HE) V5. systemic meglumine400 antimoniate for the treatment of cutaneous Ieishmaniasis in lran. Imemational40 t Journal of'Dermatology. 38, 610-12.402403 26. Manuel. J. C-B. & Luis, M. poR. (2001). Plant natural products with Ieishmanicidal404 activity. Natural Products Reports. 18, 674-88.405406 27. Paulo, R. C. & Elizabeth • I. F. (2001). Leishmaniasis phytotherapy namre's407 Ieadership agaillSt a11ancíenr disease. Fttoterapia: 72, 599-618.408
12
135
409410 FIGURES411412
413414415416
B OCH3
~
'<:::::
~
OCH)
O OCH3
Figure 1. Chemical structure of'isolated compounds. (A) Dictamine (B) y-fagarine (C)isopimpinellin (D) skimmianine.
13
136
417
1001901
i=jl.5 50-ç. ~()
:iO~~·~~~~~~·~~~~~O~S~~
Oictamine V·F~ $kí_ •.•• lsopimp"*n
XPRT Contro! - DMSO
2o~~1.~1~a~so~n~~~~~~~~10~1~,~"~n~
Al'ItT XPRT HGI'RT
418419 Figure 2. Effeet ofthe four oompounds on the Leishmania PRTases. The results are from420 six experimenta in triplicate and are given as percentage 01' inhibition. The vertical lines421 represem the amplitude of the standard deviation from the statistical analyses of the422 obtained menu. DMSO-Control: Control experiment of inhibitory effect of DMSO on the423 enzyme activity, showing a much reduced effect even at the higher concentration of70 11M.424 The numbers in each bar indicate the concentration of the compound tested, 10 ~IM, 25 11M.425 50 ft!vf and 70 fl~t
14
137
426
100
90
~ 80_!:1l'lil 70
[60•...[50..j 40c
.Q;ê30s:.\;;-- 20t.
10
- r+- ri-
~
.ri-1- J + ri- +1
t rI- ri-- ,+ri- ri- r+-..
i i i i m i i .. I i i i i iI J \a :,! 2 ~ ~ 2 :e ~ .. l! :,! 2 :!! ~oIsopImpinellin Sklmnuanine
427428 Figure 3. Effect of the four isolated compounds on lhe in-vitro growth of L. major429 promastigotes. Promastigotes (1.5 x 104 cellsání.) were incubated ín the presence of430 compounds for 48 h. The resulta are Irem six experiments in triplicate and are given as431 percentage of inhibition. 'file vertícal lines represem the amplitude of the standard deviation432 from the statistical analyses of'the obtained menu.
15
138
433
434435
436437
438439440 Flgure 4. Top-ranked solntíon obtained with GOLD for (A) slómnúanine-APRT complexo Selected441 residues ofthe active si1eare shown, with the hydrogen bonds represented by tÜlShedtines in yellow442 with theLysl02 and Lys105 residues. (B) skimmianine-HGPRT complexo The.hydrogen bonds are443 represented by dashed tines in yellow with the Asp129 and Lys157 residues and (C)skimmianine-444 XPRT complex. Hydrogen bonds represented by dashed lines ín yellow with the TytS9 and Asp123445 residues,
16
139
446 TABLES447448 Table 1. Effect of 4 compounds on the enzymatic activity of PRTases, L. major449 promastigotes, human ecll and top-ranked solutions obtaine ..ed with GOLD 2.1 interactions.450451 "111e results of lhe enzymes inhibition are from three independent experiments in triplicate452 and measured by spectrophotometric method at the wavelength 259, 255 and 254
• Enzymes IC5(I(JlM) Enzymes Gold..score Cell cultures L050(JlM )Compounds 1---===-..,....,=
APRT X HGPRT APRT PRTT5ictã!;line 262 "2Sõ'-" '''42AfIsopimpmellin 142 142 45.97 46.76 35.64 25 20
Skimmianine 142 2 46.11 49.95 37.91 245 98
y-fugarine 151 120 82 44,28 43.18 35.02 70 69
453 respectively .454 b The results 01' the in-vitro inhibition of mammal cells are from two independent455 experiments in tríplicate and measured by Newbauer chamber,456 c The resulte of lhe in-vitrc inhibition of L. major promastigotcs are from six independent457 experiments in triplicate and measured by Newbauer chamber,458459460461462463464465466467468 Table 2. Effect of'the additionof'purines (adenine, guanine, hypoxanthinc and xanthine) ou469 the protection ofL major promastigotes against the four selected compounds,470
PUMe concentration Sklmmlanlne Isopimpinellln y.Fagarlne DictamlneOIJM O a o o
5O\JM -8 -55 -220 7.4500IJM -650 -122 ·80 o..471 The resulte are presented m % inhibition oí' gro\\-1h oompared to the no punnes added
472 experiment, The negative numbers represem â stimuletion of growth.473
17
140
510 J ,vat Prod 2()().1,67 51()-522
Reviews
ChaIlenges and Rewards of Research in Marine Natural Products Chemistry inBrazilJi
RobClto C. S. Borltnck."! Eduardo I Iqjdu,' Rosana M. da Rocha! .Jaíno H. H. L de Ohveíra.!Isara L. C, lIernandez.lMírna J L R. Seleghtrn.' Ana Claudia Cranato.! Éríka V. R. de Aímelda.'Cecília V. Nunez.1 Guilherme Munry.' Solange Peíxtnho.! Claudia Pessoa,' Manoel O. Moraes,"Bruno C. Cavatcantt," Glsleuc G. F. Nasetmeuro.» Otavio Tluernann.v Mareio Sllva.'-' Ana O. Souza.Celto L. Stlva.? and Paulo R. R. Mmaruu"
Instituto de QulmJc~ de Silo Cnrlos. Unínusidad", de Suo Paul". CP 780. CEP 13560·970. Silo Cerlos; SP. Bruzit. MuseuNttt:i<lluj!, t.tlli\:rl'sfrJo(/t" Ft!dI!Y'i1l da RkJ lk~ .hJlud,.o~ (Jr.IÍTitit rtn 8wJ Fí.sl.U.!~/fI# 20940·tJ4t1. Ria dt:' .Innelro, RJ"8nuilDeparunncmo do Zoologi«. !../nÍversi<fad.,f«k'mJ dtJ Paauu». Cemro P<l}j(C<;I1Í(:<l. 8J .531 .!)!J(). CP /fJ(12l1.Curitib«. Pal"illlà.Bmzil. Deperuunano de Biologia. Urüvorsidode F<-d""aJ t:R4 &!JhkJ, Sall'ad(q~ BA. Breri). L,~bcràtbd<l de OJ'loo[ogíaE'xpeâmet1rn1. Universided« FM#'aJ do C•••••rã. Foruslez«; CE. 8J-aziJ,Faculdade de CR-t'JCJJ.sda Saude. Ullivl.'NiwUR-Al(fwdi.ff,' de Pír:u:ícab.1, PiJ'àt:.'JblJ. oSP, Bmzi). Insrituto * Fit.ica di' São C.lrlos, lJnil't-l'Sld:uk de $."10 Paulll .• Sâo Carlo;;. SI'.Br.3ZiJ, eod J:Jep.1l'Uimcnto *Bioquunica t' lmufloJogia. P'<>c.Jda<k *Af<.dicln., de Ribcirac Preto. Unil'crsídadc' de Sào Paulo,Ribciráo PI'C!W. SI'. BJ-aziJ
J«,ai\"f!'d Sli'ptli'mbcr 25. 2003
BrôzjJ ts hlessed wtth a great btodtverstry. whtch consttrutes one of fhe mosr unportanr sourees ofblllloglcalJy actlve cempounds, even If I1has bf.én laffle1y underexplored, As ls the case ti! the Amazonand Auanuc ramforesrs. the Braztltan martne fauna rernatns praeueally unexpíored In me searrh fornew btologlcally uctive: natural products. Constderíng 111mmaríne organlsms have been shewn to be oneof lhe mos! promtsfng sources <Ir IlClWblrlllniw rmnp<lllllds ror the trentment of dtfferern 11uman dt~N1SL"',rhe 80!Xl km of rhe Brazíltan roi\stlln" represents a gmat pctentlaí for flndlng new pharrnacotogícallyactlVí, secóndalY rnetabollres. Tbls I'"vi"w presants lhe starus nf martne natural products chenusrry ínBraztl, tncludlng results reportod by dilT•.reut research groups wuh ernphasls 011 lhe tsolauon, structuruelUCldallon, anel evaíuauon ar bíologlcaí acuvtues of natural products tsotated Irorn sponges. aseídtans,oeroeorats. and Opísrobranch mollllsks. A brief'uvcrvíew ofrtw. Iírst Brazífían progrnm on rhe isolatlon ofrnaríne baerería and fung!. dírected toward the producuon ar blologlcally acnve compounds, ts alsodtscussed, The curtem muludíscípünery collaboratíve program under development at the Universidadede São Paulo proposes to establísh a new paradígm roward the managomcnt of tho Brazílían marínebíodlversíty, integrating research 011 lhe spectes drversíty, ccelogy, taxonomy, and biogoography of marínctnvertebrates and rnlrroorganlsll1s, Thts pmgram also includes a broad sereeníng program of Brallll<lIlmartne btoresources. W search for ecuve compounds uiar may be of ínterest for the deveíopment of newdrug leads.
IntrodudionFrem •• hlstortcal perspectíve, 8t'rgrrl<uU\'s reports on
sponge sterols! and nucleosldes2 are eonstdered rhe startlngpotnt of martne natural products chermsrry, However,Tahara's studícs on the nature of Tntraodonudae nshpotson (tetrodowxlns).l the mvesttganon cf'sterols from thekíngdom Antrnalta by Dorée4 end Henze,s and the studyof caretenotds from marlne animais by Lederer' cannor beoveríooked, But ít WU$ (111)'durtng the 1960:>(hal conunu-
•n...w OQ •.!t" M.tthcw Suffn••• :\wa"llocWr" presemed a, lhe 43rdAMual M<HtI"8 De u •• Amori<.n Sotkoly "'1'1""''''''''11',0»' •••<1Úse l.<lMon_ W.U S)'IIl"""lum.N_Brun~'kk. NJ. July27~31. 2002,D<dk.tooto tlw 50 ",a~ of tbe c"ntro <Icl3lolog!. M",inb. or til. Unlv••.•kb<lc <IcSão P""lo.
'To ",1_, ••••.•.••".._ • .n....ldbe .ddt,,_. r.l: +55·\lh?1399S4.p",,! -+55162739®Z. E"'''''II: '8.t.o'11••ck<1Jqoc••••pbl'.
, tn.uru<" do Qtdlt'Ka do $1. c....to>, U••I' •••••ld'.Ododo s•••P.uIG., 1>"._ N ••••"'nAl.tJnlv ••.• kbd> Podor.! dó RI<>do 1'''''''0.t ~"t1t~tu()tk ~~. Un'wnid8:c~ PMltwál d!:.PlultuA.i Depattam •••to do 1'l1<>1<>@l. lint""hkIodo 1".",,,,,,1 do 00111>.',,.,.J,.n.,.1<lrJo do>~ &"",1" •••.•"'1. U,d""",ld.d. 1'•••• ,.1 do <:00.10.* •.•"",1<1••.1. do>Ciê(.<!,..d. &tldó.I.J •• ,,,,,I<I,koclo M.loo;••,. do>1'I""d ••••• ,Q In,(.l(Qtq ck f'l •.k_ • $,", C:UIOl~Uulwr:J:ltf* do »~P.-.•.•lo.9 o.p;oru>m~nto"" .BIoqufmk •• Imvncolotlta. P.<uld."" "" "~<In. ""
Rft>tlit-iío·Pt'~I-4.
OI.lS research oí manne natural products began, maínly dueto the advanees in the tnstrumenrarton for srructureeíncídatíon auá ísolauon techníques as well as lhe avalioablllty of scuba for ccllectten of maríne organtsms, Hígh-llghrs of lhe achievNnents 111manne natural producrs havebeen rccently revíewed and tllu$ll'nte the structural CQUI-plmdry and potenr bíologícal aenvtnes of Ilwny naturalproduets tsotared from dl1:'furent urganlslllS of the martneenvtronment.! Although Brazll has the second mos! éXW~l$I\<" coastltnc aftcr Australía, üw development of theehomístry af martne orgatúsms from Brazíl has beenhampered for many years beeause lhe maín Iocus ofBraztlían natural products chcnusts has been dírec ted wlhe study of medíctnal plants and plant chemoraxonomy.
ChalJéngésBt'azilian Geógt'3(1by: The Impact on Mal'lne Bi6di
vel',sity. Bl'n:r.U 11I',r;3 roast ulXllIl 80!Xl 15m ill lengtl'l.adJaccnt W o\'el' 800 000 kn~ orcolltlnenlal shelf, sproadingtrem 4" N ar Cape Oran.ge w 3••° S at Chu1. A dMslon (:IrthiS "tiSt MM [nu. !\e('tórs 11lI$ bef,n pmp<lSkl baS«! ()Il
I'rilnarUy geologlc and geographle Cril:l!ria.M w(, haw
#I 2004 A",,,r"',,,, Cht>ffilcal Somty and Ameri<wl Sodc!ty Ili Pharrna«>gl105Yl'ubli$hoo on Web OIJ2mOO~
tO.I021/np030·1316 CCC: $27.50
141
Para acesso ao artigo completo entre em contato com o
autor ou com o Serviço de Biblioteca e Informação -
IFSC - USP ([email protected])
Capitulo V
Conclusões
Os trabalhos apresentados nesta tese são referentes a uma das linhas de
pesquisa que eu coordeno. Esta linha de pesquisa visa o emprego da estrutura
molecular e da busca por inibidores na biodiversidade brasileira. Essa busca tem
como objetivo obter novos inibidores das enzimas alvo que possam ser estudados
por processos de Docking e técnicas de química medicinal.
Os trabalhos se iniciaram com a clonagem e caracterização das três PRTases de
Leishmania de interesse para o projeto, a APRT, HGPRT e XPRT. Foi iniciada em
paralelo a clonagem e caracterização da APRT humana, visando não somente
obter o conhecimento de sua estrutura, mas também para ser utilizada em testes
comparativos de inibição com a APRT de Leishmania major.
Desse esforço resultou a publicação da estrutura cristalográfica das APRTs de
Leishmania e Humana, a obtenção e resolução da estrutura da HGPRT e a
modelagem molecular da estrutura da XPRT de Leishmania. A analise da
estrutura da HGPRT de L. tarentolae se encontra em fase de redação do artigo
para submissão.
Essas enzimas forma empregadas em testes de rastreamento por inibidores em
ensaios bioquímicos empregando extratos de plantas, animais marinhos e da flora
microbiana. Uma serie de compostos foram obtidos desses ensaios e diversos
154
puderam ser cristalizados e tiveram sua estrutura resolvida em colaboração com
o Prof. Dr. Javier Ellena (IFSC - USP). Desse trabalho resultaram três publicações.
Os trabalhos de ensaios com inibidores foram estendidos, visando testar a sua
eficácia sobre o parasito e as células de mamíferos. Com isso foi implantada e se
encontra em funcionamento, uma sala de cultivo de parasitas e células de
mamíferos. Os testes celulares foram realizados com diversos inibidores e
resultaram na identificação da atividade celular de quatro compostos. Este
trabalho foi recentemente submetido para publicação.
Esta abordagem representa uma linha inovadora implantada no laboratório e com
potencial de ser aplicada a outras enzimas e inibidores, aprofundando a
investigação e caracterização de compostos de interesse.
Uma linha de investigação paralela levou aos estudos com a enzima glucose-6-
fosfato isomerase (PGI) de Leishmania. Essa enzima foi donada e caracterizada.
Assim como foi feito para a APRT de Leishmania, também iniciamos a
investigação da PGI humana.
) Obtivemos com sucesso a resolução da estrutura da PGI humana que resultou na!
publicação de dois trabalhos. Estes trabalhos contribuíram com o conhecimento
geral do mecanismo catalítico das PGIs.
A PGI de Leishmania mexicana foi donada a partir de dois fragmentos genicos
cedidos por nosso colaborador, Prof. Dr. Paul A. M. Michels (Research Unit for
Tropical Diseases and Laboratory of Biochemistry, Christian de Duve Institute of
Cellular Pathology, Bruxelas, Belgica). Com a donagem dessa enzima e a
obtenção da proteína recombinante iniciamos ensaios de inibição com quatro
155
compostos desenvolvidos pelo Prof. Or. Laurent Salmon (Laboratoire de Chimie
Bioorganique et Bioinorganique, Orsay Cedex, França) e ensaios de cristalização.
Resultou deste trabalho a publicação de dois artigos, descrevendo a clonagem,
cristalização e atividade inibitória dos compostos testados. O segundo artigo
descreve a estrutura cristalográfica da PGI de Leishmania e características
peculiares do sitio ativo da enzima.
Estas linhas de pesquisa continuam ativas e representam uma modesta
contribuição a área de Parasitologia Molecular e Estrutural
156
Referencias:
[1] Garrett, L. (1994) em "The Coming Plague"
[2] UNDP/WB/WHO (1989). The Leishmaniasis. In Tropical Diseases: Progress in
International Research. 1987-1988.
[3] http://www.who.intltdr/
[4] Woese, C et aI. (1987) Microbiol. Rev. 51:221-227.
[5] Simpson L, Aphasizhev R, Gao G, Kang X. (2004) RNA. 10(2):159-70
[6] Hannaert V, Saavedra E, Duffieux F, Szikora JP, Rigden DJ, Michels PA, Opperdoes FR
(2003) Proc Natl Acad Sci U S A.;100(3):1067-71.
[7] Belli, A., Zeledon, R, de Carreira, P., Ponce, C., and Arana, B. (1993). Arch. Inst. Pasteur
Tunis. 70, 489.
[8] Momen, H. (1998). Emerging infectious diseases - Brazil. Emerg. Infect. Dis. 4, 1-3.
[9] Ashford, RW., Desjeux, P., and deRaadt, P. (1992). Parasitology Today 8,104-105.
[10] Lainson, R, Braga, RR, de Souza, A.A., Povoa, M.M., Ishikawa, E.A., and Silveira, F.T.
(1989). Ann. Parasito!. Hum. Comp. 64, 200-207.
') [11] Lainson, R and Shaw, J.J. (1972). Br. Med.;'BulI. 28, 44-48.
[12] Lainson, R and Shaw, J.J. (1979). Therole of animais in the epidemiology of South
American Leishmaniasis. In Biology of the Kinetoplastida. W.H.R Lumsden and D.A. Evans,
eds. (London and New Yourk: Academic Press), pp. 1-116.
[13] Lainson, R and Shaw, J.J. (1987). Evolution, classification and geographical distribution.
In The Leishmaniases in Biology and Medicine. W. Peters and R Killick-Kendrick, eds.
(London: Academic Press), pp. 1-120.
[14] Lainson, R and Shaw, J.J. (1989). Ann. Parasito!. Hum. Comp. 64, 3-9.
157
[15] Desjeux, P. (1992). World Health Stat. 0.45,267-275.
[16] Schnur, L.F. and Greenblatt, C.L. (1995). Leishmania. In Parasitic protozoa. J.P. Kreier,
ed. (London: Academic Press), pp. 1-160.
[17] Momen, H., Pacheco, R.S., Cupolillo, E., and Grimaldi Junior, G. (1993). Biol. Res. 26,
249-255.
[18] Lu, H.G., Zhong, L., Guan, L.R, Ou, J.O., Hu, X.S., Chai, J.J., Xu, Z.B., Wang, C.T., and
Chang, K.P. (1994). Am. J. Trop. Med. Hyg. 50, 763-770.
[19] Strelkova, M.V., Shurkhal, AV., Kellina, 0.1., Eliseev, L.N., Evans, D.A, Peters, W.,
Chapman, C.J., Le Blancq, S.M., and van Eys, G.J. (1990). Parasitology 101 Pt 3,327-335.
[20] Alencar, J.E. and Neves, J. (1987). Leishmaniose visceral (Calazar). In Doencas
Infecciosas e Parasitarias. R Veronesi, ed. (Rio de Janeiro: Guanabara), pp. 724-738
[21] Mardsen, P.D. and Arruda, Z. (1987). Leishmaniose tegumentar americana
(Leishmaniose cutaneo-mucosa). In Doencas infecciosas e parasitarias. R Veronesi, ed. (Rio
de Janeiro: Guanabara), pp. 739-752.
[22] McGreevy, P.B. and Marsden, P.D. (1986). Protozoan Infections of Man: American
Trypanosomiasis and Leishmaniasis. In Chemoterapy of Parasitic Diseases. W.C. Campbell
and RS. Rew, eds. (New York: Plenum Press), pp, 115-127.!
[23] Geary, T.G., Edgar, A., and Jensen, J.B. (1989). Drug Resistance in Protozoa. In
"Chemoterapy of Parasitic Diseases. W.C. Campbell and RS. Rew, eds. (New York: Plenum
Press), pp. 209-238
[24] Kubinyi, H. (1998). Curr. Opino Drug. Disc. Dev. 1,4-15.
[25] Hyde, J.E. (1990). The Molecular Approach to Rational Chemotherapy. In Molecular
Parasitology. J.E. Hyde, ed. (New York: Van Nostrand Reinhold), pp. 181-228.
[26] Hollar, L., Lukes, J., and Maslov, D.A (1998). J. Eukaryot. Microbiol. 45, 293-297.
158
[27] Maslov, D.A., Nawathean, P., and Scheel, J. (1999). MoI. Biochem. Parasitol, 99, 207-
221
[28] Marr, J.J. and Berens, RL. (1983). MoI. Biochem. Parasitol. 7, 339-356.
[29] Marr, J.J. and Ullman, B. (1995). Concepts of Chemoterapy. In Biochemistry and
Molecular Biology of Parasites. J.J. Marr and M. Muller, eds. (London: Academic Press), pp.
323-336.
[30] Lafon, S.W., Nelson, D.J., Berens, RL., and Marr, J.J. (1982). Biochem. Pharmacol. 31,
231-238
[31] Berens, RL., Krug, E.C., and Marr, J.J. (1995). Purine and pyrimidine metabolism. In
Biochemistry of Parasitic Organisms and its Molecular Foundations. J.J. Marr and M. Muller,
eds. (London: Academic Press),
[32] Musick, W.D. (1981). CRC Crit. Rev. Biochem. 11, 1-34.
[33] Victor, J., Greenberg, L.B., and Sloan, D.L. (1979). J. Biol. Chem. 254, 2647-2655.
[34] Natalini, P., Ruggieri, S., Santarelli, 1., Vita, A., and Magni, G. (1979). J. BioL Chem. 254,
1558-1563.
[35] Giacomello, A. and Salerno, C. (1978). J. Biol. Chem. 253, 6038-6044.
) [36] Yuan, L., Craig, S.P., McKerrow, J.H., and Wang, C.C. (1992). Biochemistry 31, 806-810.
[37] Hassan, H.F. and Coombs, G.H. (1986). Comp. Biochem. Physiol. 84B, 217-223.!' '.
[38] Ullman, B. and Carter, D. (1995). Infect. Agents Dis. 4, 29-40.
[39] Ullman, B. and Carter, D. (1997). Int. J. Parasitol. 27, 203-213.
[40] Marr, J.J. (1991). J. t.ab. Clin. Med. 118, 111-119.
[41] Palella, T.D. and Fox, LH. (1989). Hyperuricemia and gout. In The metabolic basis of
inherited diseases. C.S. Scriver, A.L. Beaudet, W.S. Sly, and D. Valle, eds. (New York:
MacGraw-Hill), pp. 965-1006.
[42] Martinez, S. and Maar, J.J. (1992). N. Engl. J. Med. 326, 741-744.
159
[43] Gallerano, RH., Sosa, RR, and Marr, J.J. (1990). Am. J. Trop. Med. Hyg. 43, 159-166.
[44] Craig, S.P. and Eakin, AE. (1997). Parasitology Today 13, 238-241.
[45] Michels, P.AM.; Hannaert, V. & Bringaud, F. (2000) Parasitol. Today, 16,482-489.
[46] Verlinde, C.L.M.J.; Hannaert, V.; Blonski, C.; Willlson, M.; Périe, J.J.; Fothergill-Gilmore,
L.A; Opperdoes, F.R; Gelb, M.H.; Hol, W.G.J. & Michels, P.AM. (2001) Drug Resist.
Updates, 4, 50-65.
[47] Hannaert, V. Bringaud, F. Opperdoes, F. & Michels, P. (2003). Kinetoplastid Biol. Dis., 2,
11-41.
[48] Cowman, A & Crabb, B. (2003) Trends in Parasitoloqy, 19,538-543.
[49] Croft, S. & Coombs, G. (2003). Trends in Parasitology, 19,502- 508.
[50] Ullu, E. Djikeng, A Shi, H. & Tschudi, C. (2002). Phil. Trans. R SocoLond. , 357, 65-70.
[51] Nyame, K; Do-Thi, C.D.; Opperdoes, F.R. & Michels, P.AM. (1994) Moi Biochem
Parasitol, 67, 269-279.
[52] Cragg GM, Newman DJ, Snader KM. (1997) J Nat Prod.; 60 (1):52-60 ..
[53] Newman DJ, Cragg GM, Snader KM. (2000) Nat Prod Rep.; 17 (3):215-34.
[54] Newman DJ, Cragg GM, Snader KM. (2003) J Nat Prod.; 66 (7):1022-37.
[55] Hoet S, Opperdoes F, Brun R, Quetin-Leclercq J: (2004) Nat Prod Rep.; 21 (3):353-64.
[56] Coukell AJ, Brogden RN (1998) Drugs; 55 (4):585-612.
"[57] Croft SL, Coombs GH. (2003) Trends Parasitol.;19 (11):502-8.
[58] Sundar S, Rai M. (2002) Curr Opin Infect Dis.;15 (6):593-8.
160