Proc. Natl. Acad. Sci. USAVol. 84, pp. 4786-4790, July 1987Biochemistry

Analysis of the tissue-specific enhancer at the 3' end of the chickenadult fi-globin gene

(chromatin/gene expression/transcription/DNA-protein interaction)

BEVERLY M. EMERSON*, JOANNE M. NICKOL, P. DAVID JACKSON, AND GARY FELSENFELDLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892

Contributed by Gary Felsenfeld, March 17, 1987

ABSTRACT In an earlier paper we identified a tissue-specific enhancer in the 3' flanking region of the chicken adult/3-globin gene. In this paper we analyze the properties of thisenhancer. Deletion analysis and transient expression assaysshow that the domain responsible for activation oftranscriptionis at most 136 base pairs long. Specific factors that bind todiscrete sequences within the enhancer DNA are found inextracts of embryonic and adult erythrocytes and in brain.These factors are specific for the tissue or the erythrocytedevelopmental stage and protect at least five discrete regions inor near the enhancer against DNase I digestion in "footprint-ing" experiments. Four of these regions reside wholly withinthe 136-base-pair functional enhancer domain, which alsocomprises a site in chromatin that is hypersensitive to nu-cleases. The nature of the binding sites and the program ofappearance of the factors during development suggest that asubset of these interactions may be responsible for the devel-opmental specificity of the enhancer.

Enhancers are cis-acting elements that are able to activatetranscription from eukaryotic promoters over considerabledistances when placed in either orientation with respect tothe promoter. Enhancers have been found in the neighbor-hood of numerous viral and cellular genes (1-3). An earlierpaper from this laboratory (4) described a sequence with theproperties of an enhancer located in the 3' flanking region ofthe chicken adult l3 (PA)-globin gene. Enhancer activity wasmeasured by transfection of appropriate plasmids into os-motically shocked primary chicken erythrocytes. The plas-mids contained the f3-globin promoter coupled to the gene forchloramphenicol acetyltransferase (CAT). A plasmid wasprepared so that aDNA fragment excised from the 3' flankingregion of the f3A-globin gene was inserted 3' of the cat gene(see Fig. 1). When this plasmid was transfected into 9- to12-day embryonic erythrocytes, there was an 80-fold stimu-lation of CAT expression. The sequence also had a strongstimulatory effect when inserted either in the reverse orien-tation or 5' of the pAglobin promoter, which is consistentwith generally observed attributes of enhancers. The enhanc-er did not function when the plasmid was introduced intochicken fibroblasts. Similar observations have been madeindependently by Choi and Engel (5), who transfected pA_globin-containing plasmids into a virally transformed ery-throid precursor cell line.We now describe the properties of this enhancer domain.

Assay of appropriate deletion mutants shows that the abilityto stimulate CAT expression resides within a 136-base-pair(bp) DNA sequence that extends from positions 307 to 432 3'of the 83A-globin polyadenylylation signal. To determinewhether cellular factors bind to the DNA in the neighborhoodof the enhancer domain, DNase I protection ("footprinting")

studies were carried out using extracts from erythrocytesisolated from chicken embryos at various stages of develop-ment. A total of five distinct protected DNA regions arelocated within or adjacent to the enhancer. The pattern ofprotection obtained with these extracts varies with thedevelopmental stage of their source. Differential extractionmethods reveal that each of the regions is protected by oneor more distinct factors. The domain defined by these bindingsites and by transient expression assays is also hypersensitiveto nucleases when it is packaged as chromatin within thenucleus.

METHODS

Preparation of Protein Extracts. Nuclei were purified fromcell preparations that had been lysed in Triton X-100 asdescribed previously (6). Nuclear extracts from adult and 12-and 9-day embryonic chicken erythrocytes were also pre-pared as described (6) except that the extraction buffercontained 0.42 M NaCl. Extracts made with 0.3 M NaCl gaveidentical binding results. Whole-cell extracts were preparedby combining nuclear extracts with the cytoplasmic materialobtained after Triton X-100- lysis. The combined extractswere centrifuged at 100,000 x g, dialyzed into 20 mM Hepes,pH 7.9/50 mM KCl/3 mM MgCl2/10% glycerol/0.5 mMdithiothreitol/0.2 mM phenylmrethylsulfonyl fluoride, andstored at -70'C. Whole-cell extracts from chicken brain wereprepared in an identical manner.Nuclear and whole-cell extracts were chromatographed on

DNA-cellulose (Sigma), and the fraction Feluting in 0.25 M(NH4)2SO4 was used in DNase I protection f(footprinting)reactions as described previously (6).DNase I Footprint Experiments. DNA fragments from

pAcatE (Fig. 1) and pAcatF containing 3' _3A-globin se-quences 1617-2095 and '1814-2231, respectively, werecleaved with BamHI, 32P-labeled at the 5"'terminus withpolynucleotide kinase (7), and secondarily cleaved with NarI. The 700-bp fragment labeled at the BamHI end was-purifiedby gel electrophoresis, and 2-3 ng of the fragment (in avolume of 25 p1) was complexed with cellular or nuclearextracts and was treated with DNase I in the mannerpreviously described (6), except that a 1:1 mixture ofpoly[d(A-T)] and poly[d(I-C)] (Boehringer Mannheim) at aconcentration of 200 ng per 25-,ul reaction volume was usedas a nonspecific competitor.

Hypersensitive Site Determinations. Nuclei isolated as de-scribed previously (6) were incubated with DNase I atincreasing concentrations (see figure legends) in 10 mMHepes, pH 7.5/10 mM NaCl/5 mM MgCl2/1 mM CaCl2.DNA was purified, secondarily digested with HindIll, elec-trophoresed, blotted, and hybridized to an appropriate DNA

Abbreviation: CAT, chloramphenicol acetyltransferase.*Present address: Salk Institute, P.O. Box 85800, San Diego, CA92138.

4786

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 11

, 202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 4787

Table 1. Effect of deletions in the 3' domain of the I3A-globingene on CAT expression

Plasmid Insert Boundaries Activity

pAcatE Hinpl/Hinpl 1617/2095 1.0pAcatF BstNI/BstNI 1814/2231 0.9 (0.7)pAcatEMaeA5 Mae I/Hinpl 1861/2095 0.1-0.2pAcatEHphA3 Hinpl/Hph I 1617/1939 2.0pAcatEBstxA3 HinpI/BstXI 1617/1881 0.05pAcatG BstNI/HphI 1814/1939 1.6

Plasmids were derived from pAcatE (plasmid shown in Fig. 1) bydeleting portions of insert E at either the 5' or 3' end to yield plasmidscontaining the inserts given above. Erythrocytes were isolated from9-day chicken embryos and osmotically shocked with 0.25 M NH4Cl(250C) for 40 min. Total number of cells used was measured by totalhemoglobin release oflysed cells and in these experiments yielded anA412 = 18.2 (see ref. 1). Transfection was done as previouslydescribed (4) using 3 Ag of each plasmid per ml. After a 48-hrincubation in media, the cells were harvested and assayed for CATas described (4). Activity is given relative to the HinpI fragment(insert E in Fig. 1) shown in the top row. The 5' and 3' boundariesof each insert are shown as distance in nucleotides relative to thep3A-globin cap site. Restriction sites are shown in Figs. 1 and 4.

fragment that had been labeled with 32P by nick-translation(7). Further details are given in Fig. 6.

Preparation of Plasmids. Plasmids are listed in Table 1.pAcatEBstXA3: ptZHinpB2, which contains insert E (seeFig. 1) in ptZ18 (21), was digested with Pst I and BstXI; single-stranded tails were made blunt, and the plasmid was religated.The truncated inserts were excised with EcoRI/HindIII, theirends were filled, and the fragments were inserted into theHindIII site at the 3' end of pAcat (ref. 1 and Fig. 1).pAcatEHphA3: ptZHinpB2 was digested with Sph I and par-tially digested with Hph I. After recircularization, the plasmidwas opened with EcoRI/Sma I and ligated with a fragment(HindIII/EcoRI partial) from pAcat containing the A, cat gene,and SV40 sequences (see Fig. 1). The entire insert in ptZ18 wassubsequently excised and reinserted into pUC18. To prepareplasmids pAcatEMaeA5 and pAcatF, the Mae I/HinpI frag-ment or BstNI fragment derived from insert E was filled in andligated to the filled in HindIII site of pAcat. To obtain pAcatG,the BstNI/HindIII fragment from the ptZHinpB2 derivativeused to make pAcatEHphA3 was cloned into pAcat.

RESULTS

The /3A-globin 3' enhancer activity resides within a DNAsegment 479 bp long (insert E, Fig. 1) extending from

+ 1617

IBs M Bx H

I+ 2095

E

FIG. 1. Schematic diagram ofthe parent plasmid pAcatE (see ref.5). About 1 kilobase ofDNA containing the 5' flanking region of the,pA-globin gene from -1000 to +43 (A) is fused to the cat codingsequence (8) (CAT) and the simian virus 40 (SV40) splice site andpolyadenylylation signal. (These elements are not drawn to scale.)Insert E contains 479 bp of DNA from the 3' flanking region of thePSA-globin gene, starting 110 hp from the globin gene polyadenylyla-tion signal (position 1617 relative to the cap site). Arrows in insert Emark restriction sites used to construct deletion mutants for transientexpression assays (see Table 1). Bs, BstNI; M, Mae I; Bx, BstXI; H,Hph I.

positions 1617 to 2095 relative to the cap site (4). We made useof the constructions described in Fig. 1 and Table 1 to studythe effect of deletions on the activity of the plasmids intransient expression assays. As shown in Table 1, constructsstarting at nucleotide 1814 (pAcatF) or terminating at nucle-otide 1939 (pAcatEHphA3) have activity equal to or greaterthan pAcatE. On the other hand, deletion from the 5' side asfar as the Mae I site, 244 bp from the 5' end of segment E,results in a decrease in activity by a factor of 5, and deletionof the 3' end of the segment from nucleotide 1881 on (at theBstXI site) results in nearly complete loss of activity. Thedomain sufficient for full enhancer activity is, therefore,located in the DNA sequences between nucleotides 1814 and1939 of insert E (pAcatG).Binding of Factors from Cellular Extracts to the Enhancer

Region. It is to be expected that DNA sequences withregulatory functions will be the sites of binding by cellularfactors. To determine the pattern of binding to the I3A-globinenhancer, we carried out a series of DNase I protection(footprinting) experiments with cellular extracts from eryth-rocytes derived from 5- or 12-day embryos and from adults.The results obtained with each extract for various ratios oftotal protein to DNA are shown in Fig. 2. There are distinct

AD 12D 5D. , I ,_I

mactc1 2 34 5 6 7 8910111213*i VI. _

k a a mA

vi

III

I'I

FIG. 2. Footprint analysis of the ,A-globin enhancer region usingextracts of erythrocytes at various developmental stages. A 700-bpBamHI/Nar I DNA end-labeled restriction fragment from plasmidpAcatF (see Table 1) was incubated with proteins extracted fromwhole erythrocytes at the developmental stages shown and wasdigested with DNase I. Lanes: 2-5, adult erythrocytes at 135, 65, 20,and 10 ,ug/ml, respectively; 6-9, 12-day embryonic erythrocytes at240, 160, 40, and 20 ,g/ml, respectively; 10-12, 5-day embryonicerythrocytes at 250, 125, and 50 ug/ml, respectively; 1 and 13,digests of protein-free DNA; m, 32P-labeled Hpa II digest of pBR322(size markers); a, ct, and c, DNA sequencing ladders used asmolecular size markers. Reaction products were analyzed on an 8%polyacrylamide/8 M urea gel. Roman numerals at left refer toprotected sequences in Fig. 4.

Biochemistry: Emerson et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 11

, 202

1

4788 Biochemistry: Emerson et al.

vi

-vI

-AD 12D 5D BR -m a ct c 1 2 3 4 5 6 7 8 9 10I; ~~~A 20 t

ma.*in311N.**! "T,I1.1 6 *S .,l IIH|kis

FIG. 3. Footprint analysis similar to that in Fig. 2 except that a6% polyacrylamide/8 M urea gel was used to resolve region V.Lanes: 2 and 3, adult erythrocyte extract at 135 and 65 ug/ml,respectively; 4 and 5, 12-day embryonic erythrocyte extract at 240and 160 ,ug/ml, respectively; 6 and 7, 5-day embryonic erythrocyteextract at 250 and 125 ,4g/ml, respectively; 8 and 9, whole-cell extractfrom chicken brain at 150 and 100 ,ug/ml, respectively; 1 and 10,protein-free DNA digests. Size markers and sequencing ladders areas described in Fig. 2.

regions of protection, which vary with the source of theextract. A total of four such regions can be seen in Fig. 2. Thedomain defined by these binding regions extends from posi-tions 1825 to 1922 relative to the cap site and, therefore, isentirely contained within the 136-bp positive regulatorydomain defined above by deletion analysis. By using differentelectrophoretic conditions (Fig. 3), a fifth binding site isresolved, just outside the 3' boundary of this domain.The positions of the binding regions within the DNA

sequence are shown in Fig. 4, and a summary of the patternsof protection for each of the whole-cell extracts is given inTable 2. It is evident that only region IV is protected byextracts from 5-day erythrocytes, in which the gene is notexpressed, whereas extracts from 12-day embryonic eryth-rocytes, in which the 1A-globin gene is expressed, stronglyprotect regions II-V but protect region I weakly, if at all.Extracts of adult erythrocytes, in which pA-globin expressionis deactivated, show a pattern of protection like that of 9- and12-day cells, except that region I is strongly protected. Incontrast, whole-cell extracts of chicken brain (Figs. 3 and 5)contain factors that protect only regions I and V.

Table 2. Summary of binding activities to /3A-globin enhancer

RegionTissue Extract I II III IV V

ErythrocytesAdult Whole cell + + + + +

Nuclear + - + - +12-day Whole cell ? + + + +

Nuclear - - + + +/-9-day Whole cell ? + + + +

Nuclear - - + + +/-5-day Whole cell - - - +

Chicken brain Whole cell + ? - - +Nuclear factor I +

Data are derived from experiments shown in Figs. 2, 3, and 5 forwhole-cell extracts as well as experiments not shown for 9-dayextracts and all nuclear extracts. Region numbers correspond tothose at the sides of gels and on the sequence in Fig. 4. +/-, Weakinteractions; ?, interactions that are probably missing but for whichsome cuts within the site are decreased in intensity.

Since region I contains a sequence resembling the consen-sus sequence for a nuclear factor I binding site, we examinedthe binding of purified human nuclear factor I to this region.As shown in Fig. 5, nuclear factor I does protect this regionagainst DNase I digestion. However, the amount of nuclearfactor I required to provide nearly complete protection (20Atg/ml, lane 6) must be compared with the amount ofrelatively impure brain extract (50 ug/ml, lane 3) thatprovides at least as much protection. It is clear that thefactors present in brain extract must bind much more tightlyto region I than does pure nuclear factor I.To determine whether the five protected regions reflect the

binding of distinct factors, we have carried out similarexperiments with nuclear extracts from adult and embryonicerythrocytes. The permeability properties of erythrocytenuclei result in selective leakage of certain proteins into thecytoplasm during isolation (P.D.J. and G.F., unpublisheddata). As shown in Table 2, nuclear extracts protect only asubset of the regions protected by the corresponding whole-cell extracts. Examination of the patterns of protectionconferred by the ensemble of extracts leads to the conclusion(see Discussion) that protection of each of the five regions isassociated with an independent factor.

Hypersensitivity of the Enhancer Domain. A nuclease hy-persensitive site has been identified in nuclei from both5-day-embryonic and adult chicken erythrocytes, which islocated 300-500 bp 3' of the end of the 13A-globin coding

* * * * *

ATGGGGCGATGTCTGTAGAAATGAGTTTTCTCACTGACACAGAGGAGTCATATATTTAATAGAGAATAAABs tN

* * I * .*I *

CAAAGTGAAGGCTTTAATCCTCCCTGGATCATTT AA).(A) ____________Mae BstX

A G C CAG CTljKfjCAGI1(A,9)--___ _ _______------(53H( h

TTGTTTATGCACTTCTTCACCCTACGCTGCCCATTCTGCTGCTCTCGTGAGGGAj-----(A) ------------(9) ------------(5)

* TI

( D ,b )

c*m

*

ICACAGACC_ _ _ _ _

*

* * * * * * *

noTCAATAGTAGTAACTATTAATGATGTTCTGGAACTAAAAATCAATTGGTGTCATTTGCATGCAAAC

FIG. 4. Summary of data from studies of factor binding and chromatin DNase I hypersensitivity. The sequence is numbered from the,pA-globin gene cap site. Black sequence blocks are the protected regions in DNase I footprinting. Roman numerals correspond to those in thefigures and Table 2. Dashed underlining shows the positions of discrete hypersensitive DNase I cutting sites within the nucleus. The length ofeach such line reflects uncertainty in determination of the exact position of the cut, rather than the actual length of the hypersensitive sequence.

Symbols in parentheses near each dashed line show the cell type in which the measurement was made [adult (A), and 5-, 9-, or 12-day embryoniccells]. The smeared cutting pattern found in adult nuclei is not shown. Arrows mark the BstNI, BstXI, Mae I, and Hph I restriction sites usedto generate the deletions analyzed in Table 1 (also indicated in Fig. 1).

1 790

1 860

1 9 30

2000

2070

A A

Proc. Natl. Acad. Sci. USA 84 (1987)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 11

, 202

1

Proc. Natl. Acad. Sci. USA 84 (1987) 4789

-A BR NFIma ctc 1 2 3 4 5 6 7 8 9

40-M

ADNA AD

MI 2 3 4 5 M 6 7 89 10 M

B9D 5D

10 9 8 7 6 5 4 M 3 2 1 M

ago - U

VI

vi

III

I

do o

5 If9*

lP TI'FiI'l _ _:_ _ _ aw. aL M._ .._- M _ _ _

0- r

I-Iur.

it.

II ;Ia_

I1-ll

aw - *- -i

-a ;

U-mI2

3;-1

:=

Z

_ _-_ _

FIG. 5. Footprint analysis of the I3A-globin enhancer region usingan extract from chicken brain or purified nuclear factor I. Lanes: 3-5,the DNA fragment described in Fig. 2 was digested with DNase Iafter incubation with a whole-cell extract from chicken brain at 50,100, and 150 ,Ag/ml, respectively; 6-9, DNA was incubated withpurified nuclear factor I from HeLa cells at 20, 10, 4, and 1 gg/ml,respectively; 2, extract from adult cells at 135 ,Ag/ml; 1, protein-freecontrol. Size markers and sequencing ladders are as described in Fig.2. The gel was 8% polyacrylamide/8 M urea.

sequence (9). Recently, the position of this site has beengiven as 375 bp relative to the 3' end, and a second site 675bp from the end has also been described (10). To map theformer site more precisely, the experiments were repeatedwith a radioactively labeled probe from a region closer to theenhancer domain.The location of the probe sequence and the results of

blotting experiments carried out with it are shown in Fig. 6.Strong DNase I cutting sites are observed in erythrocytes atall stages of development from 5-day embryo to adult, thoughthere is some stage-dependent variation in the precise posi-tions of the cutting sites. These sites are all located eitherwithin or immediately adjacent to the 135-bp domain thatcarries the enhancer activity, as shown in Fig. 4. In additionto the relatively sharp bands, digestion of adult erythrocytenuclei results in a smeared pattern of cutting that extends inthe 5' direction from the enhancer (lanes 7-9). A smearedpattern containing just visible discrete bands is seen in digestsof protein-free DNA. Some of these cutting sites may beshared with some of those found in erythrocyte nuclei, whichreflects the intrinsic sequence preferences of the enzyme, butthe pattern is neither as distinct nor as intense as it is inerythrocyte chromatin.

DISCUSSION

We have shown that the stimulatory activity of the chicken,3A-globin enhancer is contained within a 136-bpDNA domain

a

w 819 (1877)* 711 (1769)* 552 11610)- -402

a a

-S~:of:

Hind III Sac I

cap___=zz _-500 bp - robe.S.

FIG. 6. Analysis of DNase I hypersensitive domain in the 3'flanking region of the IA-globin gene. Nuclei were digested for 30 minat 20'C with various amounts of DNase I in approximately 2.5-foldconcentration steps. The DNA was purified, digested with HindIll,electrophoresed in a 1.5% agarose gel, and transferred toGeneScreenPlus (DuPont). The blot was incubated with the 32p_labeled HindIII/Sac I probe shown in the diagram at the bottom,which also shows the entire 83A-globin gene. The approximatelocation of the hypersensitive domain (H.S.) is indicated; thepositions of the cutting sites are given in Fig. 4. (A) Lanes: 1-5,protein-free DNA at DNase concentrations of 1-42 ng per mg ofDNA; 6, adult erythrocyte nuclei (no DNase I); 7-10, adult eryth-rocyte nuclei at DNase concentrations of 28-444 ng per mg of DNA.(B) Lanes: 4-10, 9-day erythrocyte nuclei at DNase concentrationsof 1.8-444 ng per mg ofDNA; 1-3, 5-day erythrocyte nuclei at DNaseconcentrations of 94-590 ng per mg of DNA. Lanes M inA and B aresize markers prepared by restricting chicken DNA with HindIll andalso separately with a variety of other restriction endonucleases withcutting sites in the domain. These reaction products were pooled.

in the 3' flanking region of the gene. As a first step in studyingthe mode of action of this enhancer, we have used DNase Ifootprinting to investigate the binding to this domain offactors present in whole-cell extracts of erythrocytes atvarious stages of development. A total of five regionsprotected against DNase I digestion are observed (Figs. 2-5and Table 2); four are within the domain and one is 45 bpbeyond its 3' end. Distinct patterns of protection are ob-served for each developmental stage, and these, in turn,differ from the pattern obtained with extracts from brain. Wehave also made use of the permeability properties of eryth-rocyte nuclei to achieve a partial fractionation of factors.The results summarized in Table 2 allow us to conclude

that each of the five protected regions involves one or moreindependent factors. For example, the pattern observed withadult nuclear extracts shows that protection at sites II and IVis not generated by factors binding to I, III, or V, whereas theresults obtained with 9- or 12-day nuclear extracts show thatbinding to II is not always correlated with binding to IV.Therefore, the factors binding to sites II and IV are distinctfrom each other, as well as from I, III, and V. Similararguments apply to each of the other factors.We can compare the pattern of binding with the activity of

deletion mutants in transient expression assays (Table 1).Deletion of the 3' portion of the domain, starting at the BstXIsite, removes protected regions III and IV and reduces theenhancer activity by a factor of 20. Deletion from the 5' sideas far as the Mae I site, which removes region I and overone-half ofregion II, reduces the enhancer activity by a factorof 5-10; the truncated domain still provides stimulation oftranscription by nearly an order of magnitude. In interpretingthese results, it must be kept in mind that each protected

Biochemistry: Emerson et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 11

, 202

1

4790 Biochemistry: Emerson et al.

region is likely to be larger than the actual binding site andthat the larger regions could, in principle, include the bindingsites of more than one component. It should be noted that inboth ofthe constructs in which only region V is deleted (Table1) there is a 1.6- to 2-fold increase in CAT activity, suggestingthat region V may contain a negative regulatory element.The multicomponent structure of the I3A-globin enhancer is

like that of other enhancers (1-3, 11, 12). It is likely that, asin the case of other enhancers, each component contributesadditively to the overall enhancer effect, though furtherdeletion studies are obviously necessary to establish this. Ifwe assume, for the sake of argument, that the program ofappearance of specific binding factors during development isrelated to the role of the individual components of theenhancer, then Table 2 provides hints as to the possible roleof some of them. For example, factors binding to region I areeither absent or only weakly present in extracts from 9- or12-day embryonic cells, in which the f3A-globin gene is active;such factors are present in extracts of brain and adulterythrocytes, suggesting that this regulatory element may notfunction in stimulation of globin expression but might servean inhibitory role in cells where the gene is not active. RegionI contains a sequence that is partially homologous to theconsensus sequence for the binding sites of nuclear factor I(13-15) and the related TGGCA protein of chicken (16).However, it does not bind purified human nuclear factor I asstrongly as it does factors present in erythrocyte extracts(Fig. 5).The data summarized in Table 2 suggest that specificity of

cell type and developmental stage might be conferred on theenhancer by interactions with either region II or IV, or both,although a similar role for the rather simple sequence con-tained in region III cannot be excluded. The fact that regionIV is the only one protected by factors present in 5-dayembryonic cells may mean that this region is not a soledeterminant of specificity for 1A-globin expression. Cautionmust be exercised in drawing such conclusions, however,since the generation of similar footprints is not a guaranteethat identical factors are involved. Furthermore, it should bekept in mind that chain termination signals may also bepresent in the 3' flanking region; although it is clear that insertE (Fig. 1) functions by stimulating transcription (ref. 5;J.M.N., unpublished data), some binding elements near thisregion might be involved in termination mechanisms.

It is not surprising that the enhancer domain coincides witha region within the nucleus that is hypersensitive to attack byDNase I. Other enhancers share this characteristic (see, forexample, refs. 17-20), as does a 200-bp domain in the 5'flanking region of the 83A-globin gene (9). In the latter case,hypersensitivity reflects the absence of a normal nucleosomeand its replacement by other sequence-specific proteins thatbind there. The hypersensitivity of the 3' enhancer domainstrongly suggests that a nucleosome is missing here also andpresumably has been replaced by the factors present in thenuclear extracts. If that is the case, the cuts made by DNaseI should occur at sites not occupied by factors. The resultsshown in Figs. 4 and 6 are not inconsistent with such a model,but conclusive data will require higher resolution studies.The results discussed here provide the necessary informa-

tion for further dissection of the functionally active DNA

components of the enhancer and for isolation of the factorsthat bind to each. We note that the domain is hypersensitivein 5-day embryonic cells, in which the 3A-globin gene is notexpressed, and that such cells contain one or more factorsthat bind to region IV of the enhancer. It is possible that thisis part of the developmental pattern of 3A-globin geneexpression. Another possibility (5) is that this enhancerserves the second function of acting on the embryonice-globin gene, which is expressed in 5-day cells. The enhanc-er is approximately equidistant from the promoters of the3A.-globin and E-globin genes, and it may be that the modu-lation of factor binding during development leads to selectiveinteractions with the two promoters. This raises the possi-bility that some of the factors are selective inhibitors ofenhancement of either /3- or E-gene expression. Given theavailability ofassays for activity both in primary erythrocytesand virally transformed cell lines, it is possible to test thishypothesis.

We thank Drs. P. Rosenfeld and T. Kelly, Jr., for a gift of nuclearfactor I, Dr. T. Kimura for a gift of 5-day embryonic erythrocyteextract, and Dr. Marc Reitman for constructing and assaying theplasmid pAcatG.

1. Khoury, G. & Gruss, P. (1983) Cell 33, 313-314.2. Serfling, E., Jasin, M. & Schaffner, W. (1985) Trends Genet. 1,

224-230.3. Yaniv, M. (1984) Biol. Cell. 50, 203-216.4. Hesse, J. E., Nickol, J. M., Lieber, M. R. & Felsenfeld, G.

(1986) Proc. NatI. Acad. Sci. USA 83, 4312-4316.5. Choi, O.-R. & Engel, J. D. (1986) Nature (London) 323,

731-734.6. Emerson, B. M., Lewis, C. D. & Felsenfeld, G. (1985) Cell 41,

21-30.7. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Labora-tory, Cold Spring Harbor, NY).

8. Gorman, C., Moffat, L. & Howard, B. (1982) Mol. Cell. Biol.2, 1044-1054.

9. McGhee, J. D., Wood, W. I., Dolan, M., Engel, J. D. &Felsenfeld, G. (1981) Cell 27, 45-55.

10. Caplan, A., Kimura, T., Gould, H. & Allan, J. (1987) J. Mol.Biol. 193, 57-70.

11. Zenke, M., Grundstrom, T., Matthes, H., Winterzith, M.,Schatz, C., Wildeman, A. & Chambon, P. (1986) EMBO J. 5,387-397.

12. Sen, R. & Baltimore, D. (1986) Cell 46, 705-716.13. Rawlins, D. R., Rosenfeld, P. J., Wides, R. J., Challberg,

M. D. & Kelly, T. J., Jr. (1984) Cell 37, 309-319.14. Nagata, K., Guggenheimer, R. A. & Hurwitz, J. (1983) Proc.

NatI. Acad. Sci. USA 80, 6177-6181.15. Siebenlist, U., Hennighausen, L., Battey, J. & Leder, P.

(1984) Cell 37, 381-391.16. Leegwater, P. A., van der Vliet, P. C., Rupp, R. A., Nowock,

J. & Sippel, A. E. (1986) EMBO J. 5, 719-724.17. Parslow, T. G. & Granner, D. K. (1982) Nature (London) 199,

449-451.18. Mills, F. C., Fisher, L. M., Kuroda, R., Ford, A. M. & Gould,

H. J. (1983) Nature (London) 306, 809-812.19. Zaret, K. S. & Yamamoto, K. R. (1984) Cell 38, 29-38.20. Theisen, M., Stief, A. & Sippel, A. E. (1986) EMBO J. 5,

719-724.21. Mead, D. A., Szczesna-Skorupa, E. & Kemper, B. (1986)

Protein Eng. 1, 67-74.

Proc. Natl. Acad. Sci. USA 84 (1987)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 11

, 202

1