Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
AN INTRINSIC MECHANISM OF ASYMMETRIC CELL DIVISION
AND EXTRINSIC MECHANISM OF STEM CELL MAINTENANCE
UNDERLIES ADULT STEM CELL BEHAVIOUR
by
Phillip Adam Karpowicz
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Graduate Department of the Institute of Medical Science
University of Toronto
© Copyright by Phillip Karpowicz, 2008
ii
AN INTRINSIC MECHANISM OF ASYMMETRIC CELL DIVISION AND EXTRINSIC MECHANISM OF STEM CELL MAINTANANCE UNDERLIES
ADULT STEM CELL BEHAVIOUR
Phillip Adam Karpowicz Ph.D., Institute of Medical Science
University of Toronto 2008
Abstract
The interplay between extrinsic and intrinsic processes as they influence a cell’s behaviour is a perennial
question in both cellular and developmental biology. In this thesis these two issues are examined in the
context of adult stem cells, a somatic stem cell present in the adult murine brain and a germline stem cell
present in the adult Drosophila melanogaster ovary. I find that both of these distinct cell types exhibit
patterns of non-random chromatid segregation in which the stem cells retain chromosomes carrying the
older DNA strands. This unusual behaviour seems to exclusively occur in the context of differentiation,
when one cell remains a stem cell and the other goes on to differentiate. Following these studies, the effects
of extrinsic processes are tested in adult murine stem cells. It is determined that such cells can only
produce neural progeny regardless of their association with foreign environments. These results argue
against the phenomenon of stem cell plasticity which is proposed in several other systems and seem to
support a primarily intrinsic-centered view of stem cell behaviour. However, the role of adhesion
mediating proteins is next studied in such cells to determine their requirement for specific environments.
The results of these experiments suggest that adult murine neural stem cells require association with
support cells expressing E-Cadherin. Because the loss of such association results in a loss of stem cell
number, these data show that intrinsic processes are insufficient to account for all stem cell behaviour.
Indeed, based on these data and the results of other studies, it is hypothesized that the extrinsic association
of stem cells in these diverse systems determines their polarity and subsequent intrinsic processes that
enable these to divide asymmetrically. The implications of this theory are discussed with a view to general
biological issues, the proximate mechanisms underlying these phenomena and the ultimate reasons these
occur.
iii
Acknowledgements
There are many people who helped with this thesis. I would first and foremost like to thank my parents for encouraging my interests in biology at a young age. My mother for bringing me petri dishes and test tubes out of her lab, and my father for putting up with my countless field trips so I could collect “specimens”. Without their remarkable upbringing it is unlikely if I would be finishing this dissertation today. Second, I would thank my supervisor, Derek, for his help and for providing myself and many other budding scientists, with what is truly an exceptional research environment. Our lab is the envy of the department, and his generosity and teaching have had an obvious impact on my development in this field. Third, I would like to thank the support staff who have patiently put up with me over these years. Our technicians Sue Runciman and Brenda Takabe in particular have been a constant source of both professional and emotional help. They will be missed in the future. Other sources of help in other laboratories were Angela Kam, Marina Gertsenstein, Milena Pelikka, Henry Hong, A.J. Wang, and Jorge Cabezas. It is thanks to them that I have been able to perform the experiments in this thesis. I would like to thank any colleagues who provided my studies with technical advice, antibodies, plasmids and animal strains. Thanks also to my friends and labmates who have been a much needed source of distraction when it was necessary.
iv
Table of Contents Abstract ................................................................................................................ ii. Acknowledgements ............................................................................................ iii. List of Tables ....................................................................................................... vi. List of Figures..................................................................................................... vii. List of Abbreviations ......................................................................................... ix. Chapter I. General Introduction to Adult Stem Cells ......................................1.
A. Introduction to Cell-Intrinsic Mechanisms of Differentiation ........9. Asymmetric stem and progenitor cell divisions The inheritance of DNA and chromosome segregation The Immortal Strand Hypothesis
B. Introduction to Cell-Extrinsic Mechanisms of Differentiation Resistance ................................................................................................20.
Classic Cadherins as adherent proteins Type 1 Cadherins and cellular compartmentalization Type 1 Cadherins and their potential role in cell signaling processes
Chapter II. Ancestral DNA Segregation in Neural Progenitors ....................32.
Summary Introduction Materials and Methods Results Discussion
Chapter III. Ancestral DNA Segregation in Drosophila Germline Stem Cells ...........................................................................................................74.
Summary Introduction Materials and Methods Results Discussion
Chapter IV. Cadherin Mediation of Cellular Contribution but Not Differentiation ..................................................................................................116.
Summary Introduction Materials and Methods Results
v
Discussion Chapter V. Cadherin Mediation of Neural Stem Cell Self-Renewal ...........167.
Summary Introduction Materials and Methods Results Discussion
Chapter VI. General Discussion .....................................................................209. Reference List ...................................................................................................228.
vi
List of Tables
Chapter IV. Cadherin Mediation of Cellular Contribution but Not Differentiation
Table 1: Results of cell sorting assays ...............................................................130. Table 2: Morula aggregates of adult NSC colonies fail In contrast to early NSCs ..........................................................................................................140. Table 3: Increased association of adult-derived NSCs after E-Cadherin overexpression and blastocoel injection .............................................................143. Table 4: E9.5- and adult-derived NSC progeny contribute to the brain, while primitive-NSC progeny do not..................................................................158.
Chapter V. Cadherin Mediation of Neural Stem Cell Self-Renewal
Table 5: E-Cadherin, N-Cadherin and their binding partners are expressed in the forebrain germinal zones..........................................................178.
vii
List of Figures
Chapter II. Ancestral DNA Segregation in Neural Progenitors
Fig 1-1: Immortal Strand Hypothesis ...................................................................38. Fig 1-2: BrdU retaining nuclei are present in clonal cell culture .........................41. Fig 1-3: Neurosphere cells retain BrdU but ESCs and fibroblasts do not ....................................................................................................................49. Fig 1-4: A subset of BrdU retaining cells are fast dividing cells .........................54. Fig 1-5: A subset of BrdU retaining cells remain undifferentiated ......................59. Fig 1-6: Cell cycle arrest reveals asymmetry in the distribution of BrdU retaining chromosomes ...............................................................................64. Fig 1-7: Imaging single neurosphere cells confirms asymmetry in chromosome segregation ......................................................................................67.
Chapter III. Ancestral DNA Segregation in Drosophila Germline Stem Cells
Fig 2-1: The Immortal Strand Hypothesis............................................................78. Fig 2-2: Chromatids are segregated asymmetrically in Adult GSCs ...................85. Fig 2-2: Chromatids are segregated asymmetrically in Adult GSCs ...................89. Fig 2-3: Chromatids are segregated asymmetrically during asymmetric GSC divisions....................................................................................94. Fig 2-3: Chromatids are segregated asymmetrically during asymmetric GSC divisions....................................................................................98. Fig 2-4: Chromatid cosegregation is abolished during symmetric divisions and in non-GSCs..................................................................................101. Fig 2-4: Chromatid cosegregation is abolished during symmetric divisions and in non-GSCs..................................................................................105. Fig 2-5: Quantifications of GSC, cystoblast and cystocyte nuclear BrdU signals .................................................................................................................112. Fig 2-6: GSCs, cystoblast and cystocyte nuclei possess no differences in antibody accessibility......................................................................................114.
Chapter IV. Cadherin Mediation of Cellular Contribution but Not Differentiation
Fig 3-1: The Neural Stem Cell Lineage .............................................................119. Fig 3-2: Cell sorting behaviours and relative transcript abundance in the neural stem cell lineage.................................................................................134. Fig 3-3: Morula aggregates discriminate between adherent and non-adherent cells ...............................................................................................138. Fig 3-4: Adult NSCs cannot persist in the blastocyst and are not pluripotent ...........................................................................................................146. Fig 3-5: Early NSC sequester outside the developing brain...............................149. Fig 3-6: E9.5- and adult-derived NSCs persist in the brain ...............................152.
viii
Fig 3-7: All cells of the NSC lineage exhibit neural potency, but only E9.5- and adult-derived NSC progeny contribute to the brain ...........................155.
Chapter V. Cadherin Mediation of Neural Stem Cell Self-Renewal
Fig 4-1: E-Cadherin is expressed in the adult murine ventricles and by in vitro colonies..............................................................................................181. Fig 4-2: E-Cadherin conditional knock-out NSCs show self-renewal deficit in vivo.......................................................................................................185. Fig 4-2: E-Cadherin conditional knock-out NSCs show self-renewal deficit in vitro......................................................................................................189. Fig 4-3: E-Cadherin and N-Cadherin antibodies reduce NSC colony formation in vitro ................................................................................................194. Fig 4-3: E-Cadherin and N-Cadherin antibodies reduce NSC colony formation in vitro. . .............................................................................................197. Fig 4-4: E-Cadherin and N-Cadherin increase NSC colony formation..............201.
Chapter VI. General Discussion
Fig 5: Model of niche-dependant SC polarization and subsequent asymmetric division. ...........................................................................................213.
ix
List of Abbreviations
Bam – Bag of marbles BrdU – 5-Bromo-2-Deoxyuridine CFP – Cyan fluorescent protein CFSE – Carboxyfluorescein diacetate succinimidyl ester DiI – 1-dioctadecyl-3-tetramethylindocarbocyanine perchlorate DNA – Deoxyribonucleic acid Dpp – Decapentaplegic dsRed-MST – Discosoma Red fluorescent protein E9.5 – Embryonic day 9.5 E10.5 – Embryonic day 10.5 E13.5 – Embryonic day 13.5 E15 – Embryonic day 15 EGF – Epidermal growth factor ESC – Embryonic stem cell eYFP – Enhanced yellow fluorescent protein FGF – Fibroblast growth factor Gal4 – Galactose metabolism transcription factor GFAP – Glial fibrillary acidic protein GFP – Green fluorescent protein GSC – Germline stem cell HTS – Hu Li Tai Shao ICM – Inner Cell Mass ISH – Immortal Strand Hypothesis Lif – Leukemia inhibitory factor MAP2 – Microtubule associated protein 2 mRNA – Messenger ribonucleic acid NSC – Neural stem cell PCR – Polymerase chain reaction PGC – Primordial Germ Cell Pnd1 – Postnatal day 1 Q-PCR – Quantitative polymerase chain reaction RNA – Ribonucleic acid RT-PCR – Reverse transcriptase polymerase chain reaction SC – Stem Cell TUNEL – Terminal transferase dUTP nick end labeling Wt – Wildtype
1
Chapter I.
General Introduction to Adult Stem Cells
2
“The universe is asymmetric and I am persuaded that life, as it is known to us, is a direct
result of the asymmetry of the universe or of its indirect consequences.” Louis Pasteur,
1874
“This ordering and arranging of new cell structure under the influence of pre-existing
cell structure I call “cytotaxis.”… This, I submit, is a second principle of cellular
differentiation, one that is quite distinct from variable gene activity. The cell
differences… are not characterized by different kinds of substances or structures, but by
different numbers or arrangements of structures… variable genic activity is decisive in
cell differentiation by determining directly the kinds and proportions of molecular
species present; but pre-existing cellular structure is also decisive cytotactically by
determining the location and orientation of these molecules and others formed from their
reactions.” Tracy M. Sonneborn, 1964
When one compares the newly-fertilized zygote to its final animal product, the diversity
and sophistication of the multicellular adult seems to defy explanation. A single
precursor, an undefined cell, is able (in some cases) to produce an entity consisting of
millions of diverse progeny and moreover, in the case of a mammal, one which houses
hundreds of different cell types exquisitely arranged so as to function together as a single
living system. How is such incredible diversity generated? How do differences arise
among cells, given that they originate from a common precursor, and how are such
differences stably maintained in the final form of the organism? This thesis attempts to
3
answer questions surrounding the diversification of cell types: how this is generated and
how it is controlled.
The zygote has been called the ultimate stem cell (Haeckel, 1877; Weissman, 2000), an
early usage of the term “stem cell” that is still adopted today to refer to an ancestral cell
(Ramalho-Santos and Willenbring, 2007). In this sense, the term has been used loosely to
describe any precursor cell and especially those ancestral cells in the developing embryo.
Others have adopted more rigorous definitions of what the term ‘stem cell’ describes and
these have primarily taken place in researchers studying tissues that undergo turnover in
adult animals (Till and McCulloch, 1961; Till and McCulloch, 1980; Temple, 2001; van
der Kooy and Weiss, 2000; Ramalho-Santos and Willenbring, 2007). In some cases such
definitions support a sharp conceptual difference between two types of precursors, stem
cells and what are called progenitor or transit-amplifying cells (Seaberg and van der
Kooy, 2003). The discrepancies between these two meanings are likely an outcome of the
systems adult stem cell biologists examine. If one accepts the distinction between stem
and progenitor cells, such a position arises neatly from studying adult tissues:
environments composed of other cells which are well organized and well established. It
follows that the behaviour of stem cells in this organized in vivo environment is also
organized and established. Yet what if this environment itself was changing? The
behaviour of a stem cell at that particular location in time and space during development
might be very different than it would be in the same cell later in life. Indeed the functions
of any particular cell might be subject to changes just as its environment evolved. This
interplay between the intrinsic characteristics of a cell and those induced by a particular
4
environment introduce a logical difficulty in categorizing cells. All cells exist in an
environment of some kind. If a cell were to take on or lose certain molecular functions as
a result of a changing environment – can it be said to be the same cell at two different
timepoints or two different cells by virtue of these differences? The changing
environment results in uncertainty whether dividing stem cells examined in the adult are
the same such dividing stem cells examined at an earlier developmental timepoint.
In this study, stem cells examined mostly in the adult will be used as a model system in
order to study the generation of cellular diversity. Such cells reside or are obtained from
relatively stable tissues compared to those in the early embryo. As will be argued, the
characteristics of adult stem cells in some fashion depend on this stability, and in turn
these cells generate offspring that themselves provide a stabilizing function in renewing
tissues. The processes described here may not be the same as those occurring in the
conceptus, but it is hoped that the information garnered will shed some light on the
ontogeny of cellular diversification as well.
Embryonic and adult stem cells possess the characteristic of multipotency, the ability to
generate multiple cell types – in the case of adult stem cells, those differentiated cells
present in the tissue of their origin (Weissman, 2000). The primary distinction between
the concept of a stem cell as a relatively undifferentiated precursor and as a bona fide
tissue stem cell is the characteristic of self-renewal (van der Kooy and Weiss, 2000).
Development is generally brief relative to the total lifespan of an animal. At some point
during development some cells arise that will persist to fulfill a stem cell function in the
5
adult (Shingo et al., 2003). It is not necessarily clear if such tissue stem cells are best
defined as differentiated cell types which are produced to provide a constant stream of
specific progeny in adult tissues, or as cells which participated in the formation of
developing tissues, and which then persisted following their completion. One reason for
this is that the extremes of a stem cell’s lifespan might not overlap cleanly with what one
calls adulthood versus development for any particular organism. Another is that, during a
stem cell’s lifespan, it is difficult to resolve between the clonal contribution of a
particular cell in development, and its ongoing contribution in the adult. It is also
important to note that these two explanations of a stem cells existence are not mutually
exclusive. A cell could both participate in the formation of a tissue and then go on to
replenish that tissue once it is formed. Nonetheless, in adult tissues, adult stem cells have
been defined as ones which persist over the lifespan of that tissue – with an emphasis on
adulthood, once development is largely complete. Under this definition, though both
adult and embryonic stem cells are precursors, not all precursors can be called stem cells.
The adult stem cell persists to fulfill an ongoing function while precursors, such as radial
glia, disappear before adulthood and have no equivalent which is known to exist
throughout a tissue’s lifespan (Alvarez-Buylla et al., 2001a; Merkle et al., 2004).
At prima facie this definition of self-renewal seems rather complex and subject to
agreement on when development starts and ends, and whether a cell can be categorized as
the same cell if it were to assume a changing function over different times. Yet the
characteristic of self-renewal is a real one. Self-renewal has been directly tested by
isolating functionally equivalent cells during long periods of time from relatively stable
6
tissues (Tropepe et al., 2000; Lin and Spradling, 1993). Whereas, in contrast, cells such
as embryonic stem cells can only be isolated at timepoints which represent only a
minuscule fraction of the total life of the animal, moreover from a tissue mass that only
exists transiently (Rossant, 2001; Smith, 2001). This ability to produce both differentiated
and functionally equivalent progeny over many divisions within a relatively stable
environment (and hence contributing to the stability of that environment) is a
characteristic I will apply specifically to adult stem cells. How is this characteristic
brought about, and is it tied to the multipotency of a stem cell as a precursor of
differentiated cell types?
A parsimonious explanation is that these two stem cell characteristics of self-renewal and
multipotency are a direct and inevitable outcome of asymmetric stem cell divisions. In
this thesis it will be argued that the asymmetric mode of division carried out by a stem
cell, is induced extrinsically. This implies such cells are competent to receive this
extrinsic information. Localized paracrine signaling gradients or juxtacrine signaling then
polarize tissue stem cells and, upon division, cause them to produce one like daughter
which remains a stem cell, and a dissimilar daughter which is intrinsically primed to
differentiate. Conceptually, this hints at the possibility one of the stem cell daughters
inherits the structural form of their parent while the other does not and is instead reset to
subsume a novel structural form. By means of this process, stem cells are able to persist
in an undifferentiated state from the time of their nascence, until the end of adulthood.
7
Two stem cells are assayed in this thesis: the in vitro and in vivo adult murine neural stem
cell and, the in vivo adult Drosophila germline stem cell. Though certainly great
differences exist between these animals, and between somatic and germ tissues, in
principle the characteristics of these stem cells in their respective tissue are one and the
same. Both are localized within restricted compartments of the neural or reproductive
organs (Chiasson et al., 1999; Song et al., 2002b; Xie and Spradling, 2000). Both neural
and germline stem cells spawn multiple progeny that replace a constantly dwindling cell
supply in their respective organs (Alvarez-Buylla and Lim, 2004; Lin, 1997). Both exist
at the outset when these organs are established and are present within them until the
animal deceases (Alvarez-Buylla et al., 2001a; Alvarez-Buylla and Lim, 2004; Lin,
1997). These similarities between vertebrate and invertebrate systems speak of an
evolutionary relationship in the mechanisms underlying these processes. As the
Drosophila germline stem cells are better characterized, due to their relative simplicity
and facile genetic experimentation, these will serve as the primary example to illustrate
stem cell behaviour. The use of this invertebrate system as a model to explain the
mammalian stem cell systems is, in some fashion, itself a hypothesis in stem cell biology.
The Drosophila ovary arises very early in development from primordial germ cells which
separate from somatic lineages during early embryogenesis (Asaoka and Lin, 2004;
Casper and Van Doren, 2006; Lin, 1997; Warrior, 1994). These cells quickly establish a
tissue structure similar to the gonads found in the adult, so that by the end of larval
development and prior to pupation – an organized environment within the ovary called a
germarium, is replete with dividing stem and progenitor cells already functioning to
8
produce eggs before eclosion. It is not known whether stem cells are specified among
primordial germ cells prior to the larval stage, but it has been observed that some
heterogeneity exists in these cells (Asaoka and Lin, 2004). However, these differences
are thought to be a product of the stem cell compartment, or niche, created around the
germline stem cells. This idea of the stem cell niche and how its effects on stem cells
might explain stem cell behaviour, will be discussed in further detail below. For now it is
sufficient to note that the germline stem cells divide to produce a germline stem cell
daughter and a germ cell progenitor daughter called a cystoblast. The cystoblast
possesses a limited division capacity to produce the oocyte and nurse cells of the fruit fly
egg. Thus the germline stem cell is both multipotent and self-renewing by virtue of its
asymmetric division mode.
Similarly, the murine neural stem cell also resides in a stem cell compartment called the
subventricular zone within the forebrain lateral ventricles (Chiasson et al., 1999;
Morshead and van der Kooy, 2001; Alvarez-Buylla and Lim, 2004; Morshead and van
der Kooy, 2001). This particular region contains both dividing neural stem cells and
neural progenitors just as the germarium described above. The neural stem cell itself is
believed to arise sometime early during development, as far as has been characterized
using a in vitro clonal colony forming assay (Tropepe et al., 1999; Tropepe et al., 2001).
In this experimental system, single dissected cells produce colonies which are able to
subclone as well as produce multiple neural cell types (Reynolds et al., 1992; Morshead
et al., 1994). Thus in vitro the adult neural stem cells possess the same characteristics of
multipotency and self-renewal as the Drosophila germline cells display in vivo. In
9
addition, because not all cells within colonies founded by neural stem cells in vitro have
the ability to subclone, and because a diversity of neural cell types is produced from these
cells, it is thought that the neural stem cells divide both symmetrically and
asymmetrically. Just as the fly stem cells, it is this asymmetric mode of division of a
neural stem cell which confers upon it the characteristics of self-renewal and
multipotency.
A. Introduction to Cell-Intrinsic Mechanisms of Differentiation
A cell always exists in some kind of environment. Thus at all times either physical or
chemical signals are present and these might affect a cell’s behaviour. In this study the
behaviour in question is differentiation – the process by which an unspecified cell turns
into a specified entity capable of performing a specialized function (Gilbert, 2000;
Alberts et al., 2002). How then can one say a cell differentiates intrinsically, according to
its own “volition” rather than by direct response to some external stimulus? There are two
fashions in which a cell can be said to differentiate intrinsically. One, the cell could be
simply insensitive to its environment, causing it to behave according to the workings of
molecular determinants within that cell regardless of external factors. Though it is true
that physical signals such as gravity are always present to affect the cell, because all cells
are equally affected by these processes we can consider the differences between these to
be principal operators of interest. In particular, differences in those molecular pathways
which specify cellular behaviour. An insensitivity caused by the inheritance or loss of a
10
particular receptor will, for instance, make two cells behave quite differently in the
presence of the ligand (Sun et al., 2005). As a result of insensitivity to a chemical present
in its environment, one cell might differentiate according to its intrinsic capability while
the other is unable to accomplish the same feat.
Two, the cell could be sensitive to outer signals but the completion of signal transduction
is impeded within that cell by molecular repressors, potentially operating at any level in
which the signal cascades within the cell, or the sensitivity of the cell is simply
outcompeted by molecular pathways that are operating within that cell prior to its
reception of a signal (Alberts et al., 2002). In this case, though the cell is competent to
receive chemical stimulus – this stimulus is unable to complete a response within that cell
by direct repression or through the competition of chemical reactions. Given these two
possibilities, I will define cell intrinsic differentiation as a process within a precursor cell
that limits the cell fates available to it regardless of external influences. This
differentiation will be said to occur as a consequence of intrinsic molecular determinants
which underlie the differentiation process causing the cell to assume a specific fate.
Asymmetric stem and progenitor cell divisions
It is now clear that a number of molecular determinants aggregate to one side of a
dividing cell, polarizing it – and allowing for the possibility of asymmetric daughter birth
if the plane of division separates molecular determinants into unequal portions (Kusch et
11
al., 2003; Betschinger and Knoblich, 2004). This scenario is a true type of asymmetric
division, a division event in which daughter cells are unequal at the moment of their
nascence, rather than determined unequally only some time after a point at which they
had been the same. During homeostasis, where stem cell and non-stem cell numbers are
maintained during stem cell divisions, asymmetric divisions explain the processes of self-
renewal and multipotency. The alternative scenario is a differentiation process occurring
subsequent to the division of equivalent daughter cells. However under homeostasis, this
second scenario would seem to further the equivalence of the two daughters unless an
exquisite control was maintained over the region containing one but not the other, or if a
stochastic cell fate program occurred in the one but not the other. It is difficult to explain
how a stochastic process generates exactly the same proportion of different progeny, in
different individuals, from the same precursors at the same timepoints in development (or
adulthood). So, while this second process is formally possible, the known phenomenon of
asymmetric cell division, presents a more parsimonious explanation for the generation of
divergent fates in the progeny of one parent.
Protein determinants are common examples of molecules that are segregated unequally in
asymmetric divisions (Freeman and Doe, 2001; Shen et al., 2002; Lechler and Fuchs,
2005; Betschinger et al., 2006; Aguilaniu et al., 2003; Lee et al., 2006; Bhat and Apsel,
2004). Interestingly, the asymmetric partitioning of receptors demonstrates that
competence to external stimuli might also be unevenly conferred to daughter cells (Sun et
al., 2005). mRNA asymmetry also has been noted to occur during an ontogeny that
primes daughter cells to assume different protein levels (Lambert and Nagy, 2002). As
12
well, organelles have been noted to be partitioned asymmetrically in some dividing cells,
meaning that entire conglomerates of proteins and mRNA may also confer dissimilar
functions to daughter cells (Rivolta and Holley, 2002; Staiber, 2007; Rusan and Peifer,
2007; Rebollo et al., 2007; Yamashita et al., 2007). The asymmetry of cell division seems
to be a common biological phenomenon, a principle by means of which a single
precursor can give rise to a diversity of differentiated cell types.
The inheritance of DNA and chromosome segregation
The sharing of nuclei among dividing cell daughters is a highly complex process as both
daughters inherit a substantial portion of genomic molecules from their parents. Semi-
conservative replication of DNA is a direct consequence of its molecular structure, and
this is understood to result in both daughter cells inheriting the exact same genome by
halving the newly duplicated chromatids into equal portions (Alberts et al., 2002).
Experimentally, the molecular replication of DNA has been confirmed to occur semi-
conservatively such that template strands are the substrate for newly replicated strands
(Meselson and Stahl, 1958b). It is overall thought that older histones are also evenly
shared between the replicated DNA helices with newer histones being interspersed
among the existing ones (Jackson, 1988; Alberts et al., 2002; Gruss and Sogo, 1992). It is
thus thought that the only importance of DNA replication and karyokinesis is to produce
daughters containing equal genomes. The separation of replicated chromatids is assumed
to be a random and more or less even process, as is the separation of template DNA
13
strands and their accompanying packaging proteins. As long as both daughters receive
one of each type of chromatid, the age and distribution of their constitutive molecules is
not thought to bear any biological relevance. Rather, the products of genomic sequences
are assumed to be the underlying cause of all biochemistry that leads to the functional
(differentiated) behaviour of the cellular entity.
Interestingly, it is not always the case that all cells of the body contain the same genome
even when these descend from a common founder cell. Mozaicism is the phenomenon
whereby chromatid crossovers or transposition induce alterations in the genetic makeup
of cells originating from the same zygote (Griffiths et al., 1996; Strachan and Reid,
2000). Recombination is a necessary mechanism in cells undergoing DNA replication, in
order to repair double strand breaks or nicks at replication forks (Helleday, 2003). Yet the
frequency of such recombination leading to strand exchange between the chromosomes
of somatic cells is thought to be low in organisms such as Drosophila melanogaster
(Tsuji, 1982), although higher rates have been observed in mouse fibroblasts (Shao et al.,
1999). Chromatid exchanges are, however, seen as undesirable anomalies when they
occur during mitoses rather than meioses when the genome of the organism is hybridized
so as to generate genetic diversity. It is furthermore known that enzymes such as
helicases, suppress the frequencies of recombination induced crossovers and thus present
a means by which such events are lowered (Wu and Hickson, 2003; Yusa et al., 2004; Hu
et al., 2005).
14
Despite these apparent exceptions to genomic homogeneity, there are a number of
organisms whose cellular genomic content is normally heterogeneous. In certain
organisms, such as the nematode P. aequorum described by Theodor Boveri, only the
germline retains complete genomic content that is degraded in somatic lineages (Gilbert,
2000). Diptheran insects such as Acricotopus have been shown to undergo a curious
asymmetry between their germline and somatic genomes (Staiber, 2006; Staiber, 2007).
In this case large chromosomes called K-chromosomes are retained exclusively in the
germline cells and are lost in somatic lineages. Strikingly, the final divisions of
Acricotopus germ cells are asymmetric: producing an oocyte or sperm which retains all
K-chromosomes and somatic chromosomes and a cell which only contains somatic
chromosomes but no K-chromosomes. This is curious as the polar localization of K-
chromosomes precedes the karyokenesis of somatic chromosomes during mitoses in these
cells. Moreover, these behaviours are unusual as they demonstrate the coupling of
cellular asymmetry with asymmetries in cellular ploidy. Along a similar vein, the
protozoan Tetrahymena is a binucleate cell that contains a somatic macronucleus and
germline micronucleus (Mochizuki and Gorovsky, 2004). Tetrahymena germline nuclei
are diploid and only function during sexual reproduction. In contrast, the somatic nuclei
are not diploid (having regions excised following reproduction, and the remaining regions
endoreplicated) and are solely used to copy transcripts needed by the cell. The extra
sequences in the germ cell nuclei but not the somatic nuclei, are not thought to play any
functional role in the binucleate Tetrahymena, except as a means to target such sequences
for excision in future somatic macronuclei (Mochizuki and Gorovsky, 2004). While it is
true that both nuclei occupy the same cell, in this case again the asymmetry in DNA
15
content is coupled with a difference in the cellular function of each nuclear unit. As with
Acricotopus, somatic nuclei contain only a subset of genomic sequences available.
In both of these cases, the diploid DNA of germline nuclei are set aside unaltered in these
organisms, reminiscent of the early segregation of germ cells in germline development
(Lin, 1997; Gilbert, 2000; Casper and Van Doren, 2006) albeit one occurring at a
intracellular level than at the intercellular level. This suggests two possibilities in these
organisms. Either germ cell DNA exists strictly for the purposes of complete inheritance
of genomic sequence for unknown reasons since these sequences perform no function in
the organism. Alternatively, certain genomic sequences perform functions specifically
important in the germ cell lineages, but which are dispensable in somatic lineages. The
second possibility implies that in some cases not all chromosomes are necessary in
certain cell lineages, which might lose them and suffer no functional impediment.
Furthermore, it is formally possible that an asymmetric inheritance of certain chromatids
might improve cellular function if DNA strands specific to certain cell fates were
selectively retained or amplified in those cells.
Consistent with this notion, it has been suggested that asymmetric chromatid segregation
causes genetic heterogeneity in the developing conceptus (Klar, 1999; Klar, 2004). A
high incidence of apparent aneuploidy has been observed in neurons (Rehen et al., 2001)
and neuronal precursors (Yang et al., 2003), although the reasons for these remain
unknown. Preliminary evidence has supported the co-segregation of replicated
chromatids rather than homologs of chromosome 7 in murine embryonic stem cells
16
(Armakolas and Klar, 2006), seemingly driven by the left-right dynein motor (Armakolas
and Klar, 2007). Although these reports have generated some controversy (Haber, 2006;
Klar and Armakolas, 2006), the yeast Schizosaccharomyces pombe has been shown to
inherit distinct genomic sequences which directly bear on functional capability (Dalgaard
and Klar, 2001). In this organism, a recombination mediated imprinting mechanism
produces distinct daughter cells. This is a direct outcome of an imprint which is installed
in the lagging strand but not the leading strand during DNA replication. Daughter cells
inheriting the product of lagging strand replication are unable to produce both types of
yeast progeny in future generations, while those inheriting the leading strand product are
able to produce both lineages. Thus without the imprint, cells are not multipotent and can
only produce differentiated progeny – a behaviour that bears an intriguing similarity to
the self-renewing stem cell divisions outlined above.
The Immortal Strand Hypothesis
40 years ago researchers studying cell division by measuring thymidine analog
incorporation during S-Phase, noticed a curious phenomenon. Mitotic cells in tissues of
high turnover demonstrated heterogeneity in label following uptake of tritiated thymidine
or 5-Bromo-2-Deoxyuridine (BrdU). This was observed in diverse species (Lark et al.,
1966; Lark, 1967; Rosenberger and Kessel, 1968; Tomasovic and Mix, 1974; Potten et
al., 1978). Such cells either lost analog one divisions after incorporation (Rosenberger
and Kessel, 1968) or retained analog despite dividing many times following its
17
incorporation (Lark et al., 1966; Lark, 1967; Tomasovic and Mix, 1974; Potten et al.,
1978). As chromosome distribution between dividing daughters was assumed to be
random, these events where heterogeneity was noted implied an unevenness in the
distribution of replicated DNA. The Immortal Strand Hypothesis was thus proposed as an
explanatory framework to account for such observations (Cairns, 1975).
The Immortal Strand Hypothesis predicts that asymmetrically dividing stem cells
cosegregate chromatids so as to retain those which contain the most ancestral templates
(Cairns, 1975). The hypothesis was not intended to supplant the notion of semi-
conservative DNA replication (Watson and Crick, 1974; Meselson and Stahl, 1958b).
Rather, chromosomes containing such ancestral templates are retained in stem cells, and
each ancestral template is bound to a DNA strand synthesized from the previous round of
DNA replication. To account for the rarity of the event, this was postulated to: A) happen
only in stem cells; and B) to happen only when stem cells divided asymmetrically. Thus
stem cells which took up thymidine analog during symmetric divisions would retain the
analog, despite future divisions in the absence of the analog that normally would have
diluted this signal. Similarly, those stem cells which took up thymidine analog during
asymmetric divisions would briefly emanate signal but then lose it completely only one
division event upon its removal – even though such signal was expected to persist for a
period of time during which it would be reduced through random chromatid segregation.
The Immortal Strand Hypothesis accounted for heterogeneity in DNA synthesis signal
observed in populations of cells which were assumed to be homogenously dividing.
18
Since its inception the Immortal Strand Hypothesis has remained a controversy. Attempts
to falsify asymmetric chromosome segregation in S. cerevisiae (Neff and Burke, 1991),
mouse epidermal basal cells (Kuroki and Murakami, 1989) and hematopoietic stem cells
(Kiel et al., 2007a), the proliferating cells of Caenorhabditis elegans (Ito and McGhee,
1987; Crittenden et al., 2006), as well as murine embryos (Ito et al., 1988) have been
somewhat successful. On the other hand, research undertaken on putative stem cells in
the small intestine (Potten et al., 2002), epithelial cells of the skin (Potten et al., 1978)
and mammary gland (Smith, 2005), satellite stem cells in the muscle (Shinin et al., 2006;
Conboy et al., 2007), and a mutated in vitro fibroblast cell line (Merok et al., 2002;
Rambhatla et al., 2005) have failed to falsify the Immortal Strand Hypothesis. Because
the hypothesis states that asymmetric chromatid segregation occurs only in stem cells,
usually a rare cell population, it is exceedingly difficult to falsify. Because both
supporting and dissenting studies have applied distinct manipulations to distinct and
contrasting cell types, at distinct and contrasting periods of an organism’s development,
the hypothesis has not been unequivocally discredited. Indeed it may be impossible to
falsify it in a general sense due to substantial differences between different stem cells in
different organisms (Rando, 2007).
The original presupposition underlying the Immortal Strand Hypothesis was that it
described a phenomenon that would reduce the incidence of mutations in a tissue over
long periods of cellular replenishment (Cairns, 1975; Cairns, 2002; Cairns, 2006). By this
account, the incidence of cancer is predicted to be higher in tissues with a high turnover
as mutations in dividing stem cells would persist throughout the lifetime of an animal and
19
it even has been suggested that stem cells bearing mutations undergo apoptosis to
completely clear mutations from the stem cell compartment (Potten, 1977; Cairns, 2002).
It is unclear if these particular mechanisms need to be present, as a slow cell cycle in
stem cells relative to fast-dividing progenitors might equally explain reduced mutation
frequencies in these tissues (Dick, 2003). However, in the case of certain tissues such as
the Drosophila gonads, both stem and progenitor germ cells possess equal cell cycles
(Lin and Spradling, 1993) rendering the latter of these two possibilities ineffective as a
means to reduce mutation load in stem cells. It has been mathematically shown that in the
absence of DNA mutation repair pathways, ancestral strand cosegregation does indeed
lighten mutation load (Tannenbaum et al., 2005; Tannenbaum et al., 2006).
An interesting possibility arising from the non-random segregation of chromatids in these
stem cells is that the inheritance of a specific genomic product results in cellular
differentiation. If the expression of transcripts in either the lagging or leading strand are
dependant on epigenetic modifications of either, the inheritance of a particular strand
containing particular epigenetic modifications might result in the asymmetric expression
profile between daughter cells (Jablonka and Jablonka, 1982a; Jablonka and Jablonka,
1982b). This would be true in any of the cases described above where the asymmetric
distribution of chromosomes results in a discrepancy between daughter cells due to the
uneven inheritance of lagging or leading strand genomic sequences. The stem cell
characteristics of multipotency and self-renewal may occur as a natural and inevitable
outcome of the asymmetric segregation of ancestral strand bearing chromatids conferring
20
such properties. At present these speculations now are being re-introduced by some
researchers (Rando, 2007; Lansdorp, 2007).
In this thesis, it was hypothesized that adult stem cells segregated chromosomes in
accordance with the Immortal Strand Hypothesis.
B. Introduction to Cell-Extrinsic Mechanisms of Differentiation Resistance
As was discussed above, it is a truism that any cell exists in an environment whose
potential influences on that cells’ behaviour are undeniable. Even though certain
fundamental physical and chemical conditions are always, or nearly always, present at
standard conditions – of particular biological interest are those evolved chemical stimuli
which function during differentiation. As was discussed above, it is only possible for
cells to be unaffected by a chemical stimulus when they are not responsive to them due to
the lack of the receptor that binds the chemical ligand, or when their response is
internally blocked to prevent the transduction of a specific chemical signal. Cell extrinsic
ligands that cause precursors to differentiate are known (Placzek et al., 1993; Edlund and
Jessell, 1999; Gilbert, 2000), as are those that cause precursors to remain
undifferentiated. The second of these two will be the focus of this thesis as it is the
postulated molecular basis accounting for the asymmetric self-renewing divisions of stem
cells. The Drosophila germline niche is an example of a scenario where an
undifferentiated precursor is maintained as such by chemical signals evolved to block
21
differentiation. In both the ovarioles and testes of the fly gonad, a population of cells
adjacent to the stem cells operate to provide localized signals that maintain germ stem
cells (Xie and Spradling, 2000; Kiger et al., 2000); in their absence – stem cells
terminally differentiate into germ cell precursors then into meiotic germ cells (Lin, 1997;
Ohlstein et al., 2004; Fuller and Spradling, 2007).
The maintenance of the undifferentiated state in Drosophila ovarian germ stem cells is
reliant on Decapentaplegic (Dpp), a Bone Morphogenic Protein (BMP) orthologue, and
Transforming Growth Factor β (TGFβ) superfamily ligand that is secreted by cap cells to
the germ cells that contact them (Xie and Spradling, 1998; Xie and Spradling, 2000; Kai
and Spradling, 2004). Once bound to its receptor, Dpp drives the internal phosphorylation
of Smad proteins which transduce the ligand signal into the nucleus by binding to TGFβ
response elements that initiate the transcription of a variety of target genes (Alberts et al.,
2002; Chen and McKearin, 2003). The role of this system in maintaining the
undifferentiated stem cell state has been demonstrated in both loss of function (Xie and
Spradling, 1998) and gain of function studies (Kai and Spradling, 2004). If germ cells are
outside the sphere of Dpp influence, the inhibition of Bag of Marbles (Bam), a
translational regulator, ceases to occur and the activity of Bam activates the
differentiation of germ stem cells into germ precursors (McKearin and Ohlstein, 1995;
Ohlstein and McKearin, 1997; Ohlstein et al., 2000; Chen and McKearin, 2003). Thus the
extrinsic and localized Dpp ligand is thought to elicit the formation of a niche or
microenvironment which prevents the differentiation of a precursor stem cell that is, in
effect, primed to spontaneously differentiate into the cell types of that tissue. Interestingly
22
the male germline in Drosophila adopts the Jak/STAT pathway activated by Unpaired,
instead of Dpp (Kiger et al., 2001) – but the repressed downstream targets of both
signaling pathways is Bam (Lin, 1997). This shows that, while the ligands are different,
extrinsic resistance to differentiation may converge on similar molecular pathways and/or
adopt a similar “molecular logic”.
It is further proposed that both these niche (or cap) cells and the germ stem cells they
support, participate in a bidirectional signaling process that maintains the integrity of the
niche itself (Ward et al., 2006; Song et al., 2007). De novo niche formation appears to be
carried out by the ectopic overexpression of Notch (Song et al., 2007), by inducing and
maintaining Notch-dependant cap cells from epithelial cells present in the germarium.
Interestingly, there is evidence that germline stem cells themselves maintain the cap cell
population by juxtacrine Notch signaling (Ward et al., 2006). In turn the short-range Dpp
signals these cap cells emit act upon the germline stem cells. Such homeostasis in cellular
number arises in this tissue at its very inception (Gilboa and Lehmann, 2006), suggesting
that the niche arises early in development as a locus of stem cell phenotype (Gilboa and
Lehmann, 2004). The niche is thus a complex phenomenon; a region which affects stem
cell behaviour and is itself affected by the presence of these cells.
Similar to the Drosophila germline niche, there is evidence in mammalian neural stem
cells that signaling niches exist to maintain these cells in undifferentiated states (Alvarez-
Buylla and Lim, 2004). In particular the juxtacrine Notch signaling pathway has been
suggested to provide a maintenance effect on neural stem cells, both to mature these and
23
to allow these to persist in an undifferentiated state (Hitoshi et al., 2002a; Hitoshi et al.,
2004; Mizutani et al., 2007). It has been suggested that astrocytes (Song et al., 2002a) or
endothelial cells act as support cells of the neural stem cell niche (Shen et al., 2004).
However, the specific identity of such support cell(s) is not clear in this system, nor is the
histology of the stem cell niche well known – mostly due to the absence of a neural stem
cell marker that would make such an analysis possible. Processes extended by neural
stem cells to the lining of the ventricle (Alvarez-Buylla and Lim, 2004) as well as the
cortical protein, Prominin-1, distributed within neuroepithelial cell processes (Dubreuil et
al., 2007) suggest that neurogenic cells may be dependant on contact to the lining of the
ventricle proper. Though different ligands operate on stem cells in the mammalian brain,
similar principles gleaned from the Drosophila female germline might be shared between
these different systems. Namely that neural stem cells might be poised to differentiate
into multilineage precursors, were it not for the existence of ligands functioning to resist
differentiation. It is not necessary to go into the many and diverse extrinsic signaling
pathways that are suggested to play roles in controlling stem cell fate. It suffices to say
that it is generally thought stem cells exist in regions where an interplay of paracrine and
juxtacrine signals create a microenvironment that transduces signals specifying stem cell
behaviour. As such, these stem cells exist to provide their ultimate stabilizing functions:
to divide either asymmetrically to produce stem and progenitor daughter cells and to
possess the capacity to divide in response to perturbations in the microenvironment so
that cells can be produced in the case of injury or need (Ohlstein et al., 2004; Alvarez-
Buylla and Lim, 2004; Fuchs et al., 2004).
24
Classic Cadherins as adherent proteins
Because the niche is partially defined as a discrete locale of chemical signals, the
localization of cells within environments that might determine stem cell behaviour is of
particular interest. Proteins which serve to localize stem cells in niche compartments are
thus a critical component of the niche. In the Drosophila gonad, the position of germ
stem cells is maintained by Drosophila-E-Cadherin (DE-Cad), which binds these cells to
the cap cells that secrete Dpp (Song et al., 2002b). Significantly, increases in the
association of stem cells in the niche due to the overexpression of adhesion related
proteins increase the number of stem cells and hence emphasize the importance of such
adherence in stem cell compartments (Yamashita et al., 2003). Indeed, if the stem cells
are ablated, adjacent cells have been shown to enter the stem cell compartment and
respond to the Dpp signal in a similar fashion to stem cells (Kai and Spradling, 2003).
Such association of cells to the niche is a prerequisite to subsequent responses within this
region. This raises the interesting possibility that a non-stem cell might become a stem
cell, were it to be forcibly associated within that environment, or whether a precursor
from a particular tissue might be induced into producing cells of a widely different tissue
type following introduction into an unnatural position. In this sense the localization of
stem cells in niches may be a pathway by means of which a non-stem cell, competent to
receive and transduce information from localized signaling pathways, might take on
properties associated with that location. It also follows that the dysfunction of an niche
might deregulate stem or non-stem cell behaviour and the formation of ectopic niches,
25
might induce stem cell like properties in aberrant locations (Song et al., 2007). It is
tempting to speculate that these possibilities might be a characteristics of cell
proliferation diseases such as cancer.
The adhesion of cells to one another is dependant on extracellular proteins known to
initiate and maintain cell-cell contact (Gilbert, 2000; Alberts et al., 2002). There are
numerous adhesive proteins; all of them anchored to cell membranes which bind to
adjacent proteins likewise anchored to the membranes of adjacent cells. The Cadherin
family of proteins contains the Type 1 Classic Cadherins such as E-Cadherin and N-
Cadherin which are expressed in mammals (Takeichi, 1995; Redies, 2000). These
transmembrane proteins contain an extracellar domain which is thought to interact
homophilically with like extracellular domains in adjacent cells – resulting in a calcium
dependant bond. The precise structure of homophilic bonds is still a matter of
investigation and may occur in a variety of structural conformations (Zhu et al., 2003).
Opposite to the N-terminal extracellular domain, the C-terminal intracellular domain is
located in the cortex of the cell. It is known to interact with Catenins (Yap et al., 1998),
components of the cytoskeleton, plus some regulatory proteins that enable a dynamic
association between extracellular binding and the intracellular cytoskeleton or to regulate
the degradation of Cadherins if the cell is to change location and/or shape (Fujita et al.,
2002; Maretzky et al., 2005). The coupling of cellular adhesiveness and cell shape
integrates mammalian cells with their tissue environment.
26
Though it is not a Type 1 Cadherin, DE-Cad in the Drosophila germarium localizes
parallel to the plane of division of the germline stem cell, with the daughter stem cell
remaining apposed to the niche and the other distal daughter cystoblast undergoing
expansion and terminal differentiation. DE-Cad is actively trafficked to the site of stem
cell attachment, seemingly providing the initial polarity cue that will subsequently define
the plane of division (Bogard et al., 2007). In line with this, several studies have proposed
a role for cadherins in directing the orientation of microtubules and thus the plane of cell
division in such contexts (Le Borgne et al., 2002; Perez-Moreno et al., 2003; Betschinger
and Knoblich, 2004; Thery et al., 2007). Adhesion to a particular locale appears to prime
the localization of the mitotic spindle, orienting one daughter to ‘bud off’ opposite to the
region where cadherin is most abundant. Though it is downregulated in most of the brain
during embryogenesis, the expression of E-Cadherin is seen in the ventricles of the
developing (Rasin et al., 2007) and adult brain (Kuo et al., 2006), regions in which NSCs
reside and/or contact. In these studies it appears that the proteins Numb and Numblike
function to polarize E-Cadherin in the processes connecting radial glia to the ventricles
(Rasin et al., 2007). These observations strongly suggests a possible function of
Cadherins in associating a stem cell in a specific orientation, within its specific niche,
facilitating stem cell polarization to take place which thus subsequently permits the
asymmetry in cellular division to occur (Marrs et al., 1995; Tumbar et al., 2004). Several
candidates have been implicated in governing stem cell behaviour, such as β1-Integrin in
mammalian neural stem cells (Campos et al., 2004; Campos et al., 2006), α6-Integrin in
epithelial stem cells (Blanpain et al., 2004), and N-Cadherin in hematopoietic stem cells
(Wilson et al., 2004; Wilson and Trumpp, 2006). Although there is some evidence that
27
molecular perturbations in Drosophila lead to the non-germline stem cell daughter to
revert into a stem cell (Kai and Spradling, 2004; Brawley and Matunis, 2004), this does
not seem to appear under normal physiological conditions where replenishment of the
stem cell pool (in the event of injury) occurs only through the symmetric division of
germline stem cells (Xie and Spradling, 2000; Fuller and Spradling, 2007). This
emphasizes the importance of maintaining the association of stem cells to the niche by
adherent proteins, otherwise their loss means a permanent decrease in stem cell number.
Type 1 Cadherins and cellular compartmentalization
Type 1 Cadherins contain five extracellular domains that are structurally related to the
immunoglobin family. Calcium ions are positioned between each pair of repeats, locking
together trypsin residues on Cadherins from opposite sides of adjacent cells in a cis
orientation (Takeichi, 1995; Alberts et al., 2002). The precise nature of the chemical bond
is still debated. It has been proposed that the first extracellular domains, which are highly
specific to each Cadherin type, bind with one another other to precede the further binding
of domains 2-5 down the protein chain (Chappuis-Flament et al., 2001). It follows that
adhesion between dissimilar extracellular domains 2-5 are possible, but that the initiation
of Cadherin binding is orchestrated by the highly specific domain 1.
Though there is some controversy surrounding the specificity and strength of homophilic
Cadherin-Cadherin associations (Niessen and Gumbiner, 2002; Prakasam et al., 2006),
there is considerable evidence supporting homotypic bonds as stronger than heterophilic
28
extracellular interactions because of their differential effects at the cellular level (Nose et
al., 1988; Foty and Steinberg, 2005). It is widely thought that greater thermodynamic
stability results from bonds such as E-Cadherin to E-Cadherin than from bonds between
E-Cadherin to N-Cadherin. Perhaps this is an outcome of the specificity of the first
extracellular domain, in contrast to the heterophilic bonding of the promiscuous domains
2-5 on each Type 1 Cadherin.
Because of this greater stability cells sort themselves into structures which maximize the
most thermodynamically stable adhesions between cells: those between like-Cadherins
(Foty and Steinberg, 2005). Thus it has been proposed that the regulation of Cadherin
types plays a pivotal role in grouping cells according to their expression of cell adhesion
molecules. Once grouped, multicellular structures can adopt increasing levels of
organization – assembling cells, sometimes from distinct germ layers, into compartments,
tissues and organs (Edelman, 1984; Nose et al., 1988; Steinberg and Takeichi, 1994;
Kostetskii et al., 2001; Takeichi, 1995; Krushel and van der Kooy D., 1993; Burdsal et
al., 1993). Consistent with this notion, the regulation of Cadherin expression has been
found to subdivide neural regions during development (Matsunami and Takeichi, 1995;
Redies, 2000; Inoue et al., 2001), and it is known that germ layers express different
cadherins during early embryogenesis (Gilbert, 2000). It is thus feasible that the specific
expression of certain Cadherins affects stem cell association with specific niche
compartments, and that, moreover, Cadherins are candidate molecules for the study of the
stem cell niche.
29
Type 1 cadherins and their potential role in cell signalling processes
The adhesion of cells to one another has implications on the communication occurring
between these cells. Close association between cells might impede the diffusion or
transport of ligands between them, restricting the reaction of cells to some signals coming
from nearby regions or from the vasculature. Conversely, the association of two cells
may also facilitate communication between adjacent cells, for instance that occurring via
gap junctions (Cheng et al., 2004). Similarly juxtacrine signalling will only arise between
associated cells. In this fashion Cadherins associating two cells might play a permissive
role in establishing and maintaining signalling networks indirectly. Pathways like the
Notch pathway mentioned above, might be facilitated by the association of stem cells to
support cells by cell adhesion proteins (Perez-Moreno et al., 2003). Consistent with this
notion, E-cadherin mediated cell to cell interactions have been proposed as cell fate
determinants in primordial germ cells (Okamura et al., 2003), epithelium (Larue et al.,
1996), as well as trophectoderm (Kan et al., 2007). Though it is not clear what exact
signalling pathways are affected by the specific E-Cadherin binding, these data suggest
that cell lineage is dependant on specific cell to cell associations.
There are many potential molecular interactions between Cadherins and signalling
pathways within the cell. For instance, Cadherins are thought to affect paracrine
signalling. The canonical Wnt signalling pathway is mediated by the protein β-Catenin, a
cytoskeletal component that dynamically links actin filaments to the cell cortex by
30
binding to both Cadherin intracellular domains and α-Catenin (Jou et al., 1995). Though,
it appears, not simultaneously with actin (Yamada et al., 2005). Within the Wnt
signalling pathway, β-Catenin also participates in the formation of the TCF/Lef1
transcription complex (Alberts et al., 2002). In turn this means at least one of these
pleiotropic effects of β-Catenin may be affected by its binding to Cadherins, thus
sequestering it away from the nucleus where it transduces the canonical Wnt signal
(Hulsken et al., 1994; Christofori and Semb, 1999; Perez-Moreno et al., 2003). Hence, it
is formally possible that the expression of Cadherins in stem cells affects their
responsiveness to the Wnt ligand (Gottardi et al., 2001; Gottardi and Gumbiner, 2004). It
is not known whether the binding of extracellular Cadherin domains affects the
intracellular β-Catenin bound.
In addition, Cadherins have been recently shown to affect the Rho and Rac family of
GTPases, thus potentially affecting cytoskeletal assembly, migration and cell division
(Braga et al., 1999; Magie et al., 2002; Perez-Moreno et al., 2003; Liu et al., 2006). E-
Cadherin can influence EGF signalling, with E-Cadherin binding resulting in an increase
in EGF receptor activation (Fedor-Chaiken et al., 2003). Strangely a bi-directional
interaction between EGF receptor and E-Cadherin appears to be possible, as EGF
infusion regulates the binding of intracellular E-Cadherin to actin (Fedor-Chaiken et al.,
2003; Hazan and Norton, 1998). EGF activates the MEK-ERK cascade which is
regulated by IQGAP1, and which may be affected by the presence of Cadherins
(themselves also regulated by IQGAP1), in a similar fashion as the competition between
Wnt and Cadherin may interact through β-Catenin (Brown and Sacks, 2006). Finally it
31
has been recently noted that E-Cadherin itself reduces cell proliferation by a β-Catenin
dependant, but non-canonical Wnt pathway (Perrais et al., 2007). While it is beyond the
scope of this thesis to outline and test all possible biochemical interactions that might
occur between Type 1 Cadherins and their molecular colleagues, it is sufficient to note
that the binding of an extracellular ligand might be internalized in a variety of fashions.
These interactions might initiate the activity of a number of signalling cascades with
diverse and perhaps competing effects on the cell.
In these studies the direct molecular impacts that Cadherins might carry out by binding to
intra- or extra-cellular ligands are largely ignored. Instead, I favour the interpretation that
the simple association of a cell by a Cadherin to a location in which ligand positive
support cells are present. This effects the communication of the cell by specifically by
associating a cell with a particular environment. The reason for this is due to the methods
used in this thesis which are at the cellular and organism level rather than molecular
level. Because no experiments are presented that specifically teased apart the biochemical
interactions mediated by Cadherins, there can be no specific conclusions about these
issues. In this thesis, it was hypothesized that Cadherins mediate interactions between
stem cells and signalling pathways that control aspects of their “stemness” by
compartmentalizing cells into distinct niches composed of support cells (Niki et al., 2006;
Kuo et al., 2006). The molecular mechanisms underpinning such stemness invite future,
and more detailed, inquiry.
32
Chapter II.
Ancestral DNA Segregation in Neural Progenitors
33
This chapter has been published:
P. Karpowicz, C. Morshead, A. Kam, E. Jervis, J. Ramunas, V. Cheng, D. van der Kooy.
Support for the immortal strand hypothesis: neural stem cells partition DNA
asymmetrically in vitro. Journal of Cell Biology. 2005 Aug 29; 170(5): 721-32.
Summary
The Immortal Strand Hypothesis proposes that asymmetrically dividing stem cells
selectively segregate chromosomes that bear the oldest DNA templates. We investigated
cosegregation in neural stem cells. Following exposure to the thymidine analog BrdU,
which labels newly synthesized DNA, a subset of neural precursor cells were shown to
retain BrdU signal. It was confirmed that some BrdU-retaining cells divided actively, and
that these cells exhibited some characteristics of stem cells. This asymmetric partitioning
of DNA then was demonstrated during mitosis, and these results were further supported
by real time imaging of stem cell clones, in which older and newly synthesized DNA
templates were distributed asymmetrically following DNA synthesis. We demonstrate that
neural stem cells are unique among precursor cells in the uneven partitioning of genetic
material during cell divisions.
Introduction
A single cell can produce two dissimilar progeny in two fashions. A cell can undergo a
symmetric division yielding identical daughters. If each daughter cell is then exposed to
34
different micro-environments, following that division, either might cease to resemble its
counterpart even though both had originally been spawned as equivalent cells and had
been equivalent for a brief time. Alternatively, two daughter cells could be uniquely
specified by inducing a mitotic cell to localize components on one side, and then
separating such components by varying the cleavage plane during cytokinesis (Kusch et
al., 2003). Thus each daughter would be primed to adopt a particular functional identity
due to the uneven segregation of such components. There is increasing evidence that the
latter of these may take place in dividing cells. Animal cells have been shown to
unevenly segregate determinants of molecular programs before or during mitosis to
specify the subsequent fate of their daughters. Both protein determinants (Shen et al.,
2002; Freeman and Doe, 2001; Rivolta and Holley, 2002) and mRNA determinants
(Lambert and Nagy, 2002) have been identified. Saccharomyces cerevisiae yeast have
been shown to preferentially segregate their older, oxidatively damaged, proteins away
from newly budding cells (Aguilaniu et al., 2003). Indeed, with the evidence that
S.cerevisiae (Hwang et al., 2003; Liakopoulos et al., 2003) and fruit fly germ cells
(Yamashita et al., 2003) regulate the orientation of their plane of division, there is reason
to suggest that the decision to divide asymmetrically takes place routinely.
Intriguingly, it has been suggested that DNA itself is segregated unevenly between
recipient daughter cells. Such a separation would not be a reversible one, like unevenness
in protein or mRNA distribution, both of which could theoretically be regulated
following division so that dissimilar daughter cells might eventually establish an
equivalence in certain biochemical pathways. Asymmetric DNA distribution would be an
35
immutable physical discrepancy between daughter cells that would define a division as
asymmetric by virtue of an inherent, and measurable, physical difference in cells
containing original templates and cells containing newly-synthesized DNA. Such a
separation was first interpreted from the uneven distribution of H3-thymidine in
proliferating in vitro mouse embryonic fibroblasts (Lark et al., 1966), and later
experiments suggested that stem cells (SC) in the intestinal epithelium of mice also
segregated their chromosomes asymmetrically (Potten et al., 2002; Potten et al., 1978).
Recent evidence continues to support chromosome cosegregation in mutated fibroblasts
(Merok et al., 2002). This asymmetric distribution of chromosomes in dividing SCs was
originally dubbed the Immortal Strand Hypothesis (ISH) (Cairns, 1975). Such a
mechanism was envisaged to reduce the incidence of mutations arising from errors in
DNA synthesis and repair in future progenitor cells derived from the SCs. An asymmetry
in DNA inheritance between daughter cells might also retain sequence fidelity for genes
conferring pluripotency to SCs. It has been suggested that SCs in somatic tissues actively
suppress chromosome recombination events (Potten et al., 2002; Potten et al., 1978), and
are exceptionally sensitive to DNA damage as demonstrated by the high incidence of
apoptosis in irradiated SC populations. SCs are thus defined partially by their function to
transmit a faithful copy of DNA template to future cell generations.
Many studies have failed to support the ISH in S. cerevisiae (Neff and Burke, 1991),
mouse epidermal basal cells (Kuroki and Murakami, 1989), the proliferating cells of
Caenorhabditis elegans, as well as murine embryos (Ito and McGhee, 1987; Ito et al.,
1988). These positive and negative findings are equivocal as supporting and dissenting
36
studies used distinct and contrasting cell types, at distinct and contrasting periods of an
organism’s development. Moreover, if such a mechanism manifests itself only in SCs, it
may easily be overlooked as these comprise a minority in the cell population. Evidence of
chromosome segregation in most studies to date has been undertaken retrospectively at
the population level. Thus after three decades of research, it is still an open question if
actively dividing SCs cosegregate older and newer DNA asymmetrically during mitosis.
According to the ISH, SCs cosegregate chromosomes to retain older DNA templates in
one daughter SC but not the non-SC daughter (Fig 1-1.). Given that DNA replication is
semi-conservative, cosegregated chromosomes are distinguished because they contain
one older strand, albeit one that is associated with a newer strand from one preceding
round of DNA synthesis. We predicted that symmetric SC divisions would randomize
segregation of chromosomes between daughter cells. The ISH was investigated in neural
stem cells (NSCs) using a clonal cell culture system in which brain-derived colonies,
arising from a single SC, are both self-renewing and multipotent (Reynolds and Weiss,
1992; Morshead et al., 1994). The halogenated thymidine analog, 5-Bromo-2-
Deoxyuridine (BrdU) was used to label DNA strands. We asked: 1) would SCs retain
BrdU(+) DNA strands in the absence of BrdU, if they divided symmetrically many times
in the presence of BrdU (Fig 1-2A.); and 2) would SCs retain their original BrdU(-)
37
Fig 1-1: Immortal Strand Hypothesis. During asymmetric SC divisions, chromosomes containing oldest template DNA (dark red) are segregated to SCs. DNA is replicated semi-conservatively, each chromosome contains one older template strand. Complements of old DNA-containing chromosomes are co-segregated through many rounds of asymmetric cell division, although symmetric SC divisions segregate chromosomes randomly. Thus over time, SCs contain proportionally more template-containing chromosomes than any other cells in the population which contain mostly newer synthesized DNA (yellow).
38
39
strands, in the absence of BrdU, if they divided asymmetrically once and only once in the
presence of BrdU (Fig 1-7A.).
It was expected that SCs would incorporate BrdU into newly synthesized DNA strands
copied from unlabeled DNA templates during S-Phase. A sufficiently long pulse of BrdU
would ensure that at least some NSCs would contain mostly labeled DNA (Fig 1-2A.). If
BrdU were removed following uptake, at least some SC’s DNA strands would be labeled,
and such cells would preferentially segregate these labeled strands as Immortal Strands.
SCs could preferentially retain BrdU-labeled Immortal Strands if and only if such SCs
divided symmetrically in the presence of BrdU, and thus selected and retained some
BrdU-labeled strands as Immortal Strands through multiple asymmetric divisions. This
long term labeling strategy was incorporated into the culture of NSCs (Fig 1-2B.).
Alternatively, if SCs divided only asymmetrically once in the presence of BrdU label,
they would lose the label during one asymmetric division event following analog
withdrawal. Such cells would specifically retain the original unlabeled DNA strands as
Immortal Strands; having undergone no symmetric SC divisions which might select
newly synthesized DNA strands as Immortal Strands (Fig 1-7A.).
Here we present in vitro evidence that old and new DNA templates are distributed
asymmetrically in NSC divisions in clonal population studies and at the single cell level.
40
Fig 1-2: BrdU retaining nuclei are present in clonal cell culture. (A) BrdU retention strategy: (1) Each double strand (1 chromosome) represents 10 chromosomes of a mouse cell. Cells are unlabeled for BrdU (black). (2) During multiple rounds of DNA synthesis, BrdU (green) is taken up and distributed in both symmetric and asymmetric divisions in the presence of BrdU. (3) BrdU is removed and the daughter cells now undergo DNA synthesis in the absence of BrdU. (4) BrdU should be retained if labeled chromosomes are cosegregated as immortal strands into SCs. (B) BrdU-Neurosphere Assay. Cells, from adult forebrain lateral ventricles, are cultured for 7 days at clonal density (1). Following dissociation, cells are pulsed with BrdU for 2 days, at 3 days in vitro (2). BrdU is removed and cells are passaged at clonal density for an additional 7 days (3). Finally (4): cells are examined (A), passaged (B), or differentiated (C). (C) Ten days following BrdU exposure, cell clones still contained heavily BrdU(+) cells (arrows) and BrdU(-) cells. The retention of BrdU(+), in cells seeded at clonal density, suggests that BrdU(+) cells give rise to both labeled and unlabeled progeny. (i) Bright field shows 3 day cell clumps, (ii) Histone labeled nuclei are red, BrdU labeled cells are green, merge shows overlap as yellow.
41
42
Materials and Methods
Dissection and Cell Culture: CD1 mouse forebrain ventricles were dissected as
previously described (Morshead et al., 1994). Neurosphere cells were cultured (Reynolds
and Weiss, 1992) at a low density of 2-5 cells, or 1 cell per well, as previously described
(Tropepe et al., 1997). Cultures were discarded at any time past passage 4. R1 embryonic
cells, and STO fibroblasts were donated by Janet Rossant and Andras Nagy from the
Sammuel Lunenfeld Research Institute. ESCs were grown on mitotically inactivated
fibroblasts as previously described (Nagy et al., 1993). Fibroblast cells were similarly
grown in DMEM but containing 10% fetal calf serum (Hyclone), no growth factors,
essential amino acids, sodium pyruvate or β-mercaptoethanol.
Differentiation: Neurospheres were isolated and transferred to 24 well plates (Nunclon)
coated with 15.1 mg/mL MATRIGEL basement membrane matrix (Becton-Dickenson)
diluted 1:25. Alternatively 5 cm petri dishes (Nunclon) were coated with MATRIGEL
and clones were transferred in bulk. Cells were differentiated for 7 days in serum-free
media containing 1% FBS (Hyclone). Cells were removed from MATRIGEL, using
0.25% porcine trypsin-EDTA solution (Sigma) applied for 5 minutes at 37oC.
BrdU and Dye Labeling: 0.6 μM BrdU (Sigma) was used to label synthesized DNA. To
remove BrdU, cells were centrifuged, washed, and reconstituted in fresh media. BrdU
was applied at the same concentration and time interval in ESCs and fibroblasts. Vybrant
DiI ( Molecular Probes) was administered to neurosphere cells following dissociation
using 5 μl/mL of DiI stock for 5 minutes at 37oC. CFSE (Molecular Probes) was used
43
according to manufacturer’s instructions. Cells were washed three times using serum free
media to remove dyes.
Immunofluorescence and Microscopy: Dissociated cells or colonies were coated with
MATRIGEL for 30 minutes at 37oC. Cell attachment was assessed by gently tapping
plates under microscope. Cells were also attached using CELL-TAK (Becton-Dickenson)
according to manufacturer’s instructions. Cells were fixed using 4% paraformaldehyde
(Sigma) dissolved in cold Stockholm’s phosphate buffered saline (pH 7.3) for 15
minutes. Neurospheres were equilibrated in 30% sucrose (Sigma) and StPBS overnight at
4 oC, embedded in cryoprotectant (Thermo Electron Corporation) and sectioned on a
Jencon’s OTF5000 cryostat. To detect BrdU, cells were exposed to 4 N HCl for 30
minutes. Cells were blocked using 10% normal goat serum (Sigma) in StPBS, pH 7.3,
0.3% Triton (Sigma) for 45 minutes at room temperature. Primary antibodies were
applied overnight in StPBS, 1.0% NGS, 0.3% Triton (Sigma). Anti-BrdU Bu1/75
(Abcam, 1:500), anti-Nestin (Chemicon, 1:1000-2000), anti-glial fibrillary acidic protein
(Biomedical Technologies, 1:400), anti-β-tubulin isotype III (Sigma, 1:500), anti-Ki67
(Becton-Dickenson, 1:10), proliferating cell nuclear antigen (Zymed, 1:10) and anti-pan-
histone (Chemicon, 1:500) were used. Secondary antibodies were applied at 37oC for 50
minutes in StPBS 1.0 % normal goat serum. TRITC, FITC and CY3-conjugated
antibodies (Jackson Labs, 1:250) or secondary 350nm, and 568nm Alexa Fluor antibodies
(Molecular Probes, 1:300) were used. Nuclei were sometimes counterstained with 10
μg/mL Hoechst 33258 (Sigma). Cells were photographed in StPBS or Gel Mount
(Biomeda Corp.). Cells were visualized at 40X/0,55 (dry lens) objective using a Nikon
44
DIAPHOT 200 microscope, and a 40X/0,60 Olympus IX81 microscope with the
Olympus Microsuite Version 3.2 Analysis imaging system software (Soft Imaging
Systems Corp.). Cell nuclei were counted within a known area, of 15 μm thickness to
calculate cell density. For confocal microscopy, cells were visualized at 100X/0,30 (oil-
immersion lens) objective using a Ziess Axiovert 100 LSM410 with LSM Version 3.993
imaging softare (Carl Zeiss Corp.). Photos were processed using Adobe Photoshop 6.0
software.
Cell Division Inhibition: Cells were exposed to 2 μM of Cytochalasin-D (Sigma) or 0.1
μg/mL Nocodazole (Sigma) for 24 hours at 37oC. Nocodazole inhibition was removed by
aspirating media containing mitotic inhibitor, washing with serum free media and
resuspending cells in medium containing FGF2, heparin and EGF. Cells were then fixed
25-30 minutes later.
Fluorescence Activated Cell Sorting: Cells were sorted on FACS DiVa (Becton-
Dickenson Biosciences) system. Cells were sorted at approximately 9000 events per
second, and fractions were kept on ice until plated. For each sample, freshly pulsed DiI or
CFSE cells were used to confirm positivity at the outset of each sort.
Cell Imaging: Cells were imaged at 40x/0,75 (dry lens) magnification using an Axiovert
200 inverted microscope (Zeiss). Samples were illuminated every 2 minutes during image
acquisition and images were captured with Sony XCD-SX900 digital camera, using
ImageJ software (National Institutes of Health). Cells were loaded in BrdU-containing
45
media and filmed until one division had occurred. BrdU was then immediately removed
and fresh media substituted.
Results
Clonal Neural Precursor Colonies Are Heterogeneous for BrdU
NSCs from the forebrain ventricles of adult mice can be induced to divide in vitro when
they are cultured in the presence of proliferation-inducing mitogens. These form clonally-
derived neurospheres, spherical colonies of coalescent cells which can be induced to
terminally differentiate only upon the removal of mitogens and the addition of serum.
SCs in these colonies comprise a minority of the total cells present, the majority of cells
in colonies being committed neuronal or glial progenitors that do not posses the ability to
self-renew (Morshead et al., 1998). In vivo such cells are thought to divide mainly
asymmetrically (Morshead et al., 1998). We examined the distribution of BrdU in SC
colonies grown at clonal density. It has been shown that murine cells do not take up
detectable BrdU during DNA repair, at concentrations 300 fold higher than in our
conditions of 0.6 μM (Palmer et al., 2000) making it highly unlikely that cells would take
up detectable analog during DNA repair. Following a BrdU pulse of two days, we found
that 98.6 ±0.2% of all cells were BrdU(+). Cells that were not labeled were either
postmitotic, or had a cell cycle >2 days.
46
Treatment of cells with BrdU did not alter SC phenotype. BrdU positive cells retained the
ability to self-renew, as demonstrated by subcloning secondary, tertiary and quaternary
BrdU treated cell clones following BrdU exposure (data not shown). Untreated clones
grew to an average diameter of 144 ±8 microns at 7 days, similarly to their BrdU treated
counterparts which were 149 ±5 microns in diameter. We determined that a clonally-
derived 149 micron BrdU-pulsed colony represented 3075 ±91 cells in total.
When primary SC colonies were passaged twice in the absence of BrdU, tertiary colonies
generally had one or a few BrdU positive cells 10 days after BrdU exposure (Fig 1-2C.).
In all cases, such colonies arose clonally from single BrdU(+) cells, that had not diluted
out BrdU label over ten days. This suggested either that: the proliferating founder
BrdU(+) cells were cycling at a slow rate relative to their progeny; or, were postmitotic
cells that had arisen in the first division of an actively proliferating BrdU(+) founder cell
which itself kept dividing to dilute out BrdU label; or, alternatively, were a result of
heterogeneity in chromosome segregation.
Neural Precursors Retain BrdU in Contrast to
Embryonic Stem Cells and Fibroblasts
Neurosphere cells were exposed to BrdU then proliferated in the absence of BrdU.
Population expansion was assessed simultaneously with the presence of BrdU label in
dissociated cells up to ten days following BrdU withdrawal (Fig 1-3A.). This period of
time spanned an estimated 9-10 population doublings. However, this is likely to be an
underestimate of the actual number of cell divisions as there is considerable cell death in
47
clones that was not taken into account (Karpowicz and Morshead, unpublished
observation). Indeed, since the average colony contains over 3000 cells following one
week of culture, this represents ~12 population doublings in the absence of cell death.
Over time we observed an attenuation of BrdU signal in many cells. At day 7, most cells
(33.6 ±2.0% BrdU(+)) ceased to possess any detectable BrdU signal. This is likely to be a
result of the attenuation of BrdU signal via cell divisions to a threshold at which the
presence of BrdU is so slight that it cannot be detected by immunocytochemistry using
our detection protocol. Despite this severe loss, there was a striking perseverance of
BrdU labeled cells at 10 population doublings, day 10, with 8.7 ±1.3% of cells exhibiting
varying levels of BrdU(+) signal.
We repeated this exact experiment using the R1 embryonic stem cell line (ESC) (Nagy et
al., 1993). R1’s are a SC population, possessing the characteristics of self-renewal in
vitro and multipotentiality in vivo. R1 cells did not retain BrdU (Fig 1-3B.). Over a nine
day period, we observed approximately 8-9 doublings. This demonstrated that the
population doubling rate of BrdU-treated R1 cells was similar to that of neurosphere
cells. By day 7 (6 doublings) only 1.3 ±0.4% of cells possessed traces of the analog, and
this was extinguished completely at day 9.
We assayed a second group of cells: the STO/SNL fibroblast cell line, transformed cells
derived from embryonic mice that were passaged >40 times. Fibroblasts are not thought
to be SCs. Like R1’s, STO fibroblasts did not retain BrdU (Fig 1-3C.). By 5-6 population
48
Fig 1-3: Neurosphere cells retain BrdU but ESCs and fibroblasts do not. (A) Proportion of BrdU-labeled cells (bars) and population expansion (line) in adult neurosphere culture. 98.6 ±0.2% of 62,500 cells plated are BrdU(+). At day 3, cells have achieved two population doublings, and at 7 days, 7 doublings. 8.7 ±1.3% of cells retain BrdU signal at the 10 day timepoint of 10 population doublings. (B) Proportion of BrdU-labeled cells (bars) and population expansion (line) in the R1 ESC line. Between 2 and 4 days, embryonic cells have reached the threshold during which BrdU is lost, demonstrated by a dramatic decrease from 81.1 ±3.2% to 13.0 ±1.2% cells labeled. ESCs lose all BrdU signal after 7 doublings evidenced by day 7 (6 population doublings). (C) Proportion of BrdU-labeled cells (bars) and population expansion (line) in the STO fibroblast cell line. At day 6, cells achieve 3 populations doublings demonstrating that fibroblasts have 2X the cell cycle time as neural precursors. At day 12, and <7 doublings, fibroblasts BrdU signal is abolished.
49
50
doublings, at day 10, only 18.6 ±0.7% of the cells retained any BrdU signal, and this was
completely eradicated at day 12 which corresponds to <7 doublings.
In both ESCs and fibroblasts, BrdU extinction was noted when cells were expanded over
7 population doublings. A mouse cell which contains 40 BrdU(+) chromosomes and
which halved chromosomes containing BrdU label in each division symmetrically would
indeed dilute this number to one single chromosome following five to six division events.
On average, 7 cell divisions in the absence of BrdU are sufficient to extinguish the label
if cells partition BrdU-labeled chromosomes randomly. In contrast to fibroblasts and
ESCs which are thought to divide only symmetrically, NSC colonies contained cells able
to retain the analog well past this 7-division dilution threshold.
We attempted to see if NSCs would eventually dilute out all BrdU through symmetric
divisions. BrdU-exposed SC colonies were passaged four times in the absence of BrdU.
Overall this represents >25 doublings, and indeed in only a few cases were we able to
find BrdU labeled cells in colonies maintained past 14 such doublings (not shown). NSCs
do not divide asymmetrically exclusively, but can certainly divide symmetrically, as
evidenced by the formation of multiple secondary colonies arising from a single
subcloned NSC colony plated at clonal density (Morshead et al., 1994). Only cells that
have not divided symmetrically more than 7 times retain BrdU at a detectable level.
Symmetric divisions in neurosphere culture may account for the eventual loss of all BrdU
signal in all cells, and asymmetric divisions may explain the retention of the BrdU signal
in contrast to ESCs and fibroblasts.
51
BrdU Retaining Cells Are Not Quiescent
If BrdU-retaining cells were postmitotic or relatively mitotically stagnant, such
heterogeneity in cell cycle within the neurosphere cell population would explain the
contrast between these cells and embryonic cells or fibroblasts.
1-dioctadecyl-3-tetramethylindocarbocyanine perchlorate (DiI) is a lipophilic fluorescent
dye that associates with cell membranes and carboxyfluorescein diacetate succinimidyl
ester (CFSE) is a cytosolic dye that renders cells fluorescent upon uptake. We reasoned
that cells initially positive for either such dyes would subsequently halve their fluorescent
dye intensity following each division, as the dye was redistributed among the daughter
cells. This would enable the separation of fractions of cells that were dividing quickly
from their quiescent counterparts, before such cells were examined for the presence of
BrdU. DiI has already been proven amenable to fluorescence activated cells sorting
(FACS) analysis (Malatesta et al., 2000) and there is no evidence that DiI can be passed
between adjacent cells (Malatesta et al., 2000; Johansson et al., 1999). Nonetheless, we
cocultured neurosphere cells that had been exposed to DiI, with GFP(+)/DiI(-)
neurosphere cells in high cell density aggregated colonies for one week. We confirmed
that none of the GFP(+) cells took up DiI label, confirming that the dye cannot be shared
between adjacent cells (not shown).
Neurosphere cells were exposed to BrdU then immediately pulsed with DiI. We sorted
cells to confirm that these cells were also DiI positive. 97.6 ±0.7% of cells emitted a high
52
DiI signal by FACS. These results confirmed our starting population was positive for
both indicators of cell proliferation.
The BrdU(+)/DiI(+) cells were proliferated for one week in the absence of BrdU, then
sorted into DiI(HI+) and DiI(LOW+) fractions. Over one week, the DiI signal was
diminished in most of the cells as shown by the shift in DiI intensity (Fig 1-4A.). We
collected 9.7 ±2.2% of the cells as a DiI(HI+) fraction and 63.1 ±7.4% of all cells as the
DiI(LOW+) fraction, leaving a buffer fraction of ~30% cells between the two groups to
reduce contamination between them. DiI signal was assessed by visual inspection to
confirm that DiI(HI+) cells were indeed strongly positive for the membrane dye (Fig 1-
4B.), whereas DiI(LOW+) cells displayed no signal (Fig 1-4C.).
Of the DiI(HI+) group 70.6 ±4.6% of cells were BrdU(+) (Fig 1-4D.)which was expected
as slow cycling cells which did not dilute DiI through cell divisions, might fail to dilute
BrdU though cell divisions. The remaining 29.3 ±4.6% of the DiI(+) cells were BrdU(-).
These cells could be postmitotic cells that did not synthesize DNA during BrdU
exposure, and also did not divide to dilute the DiI label. As these cells occupy 2.9% of
the total cell population, it is conceivable they are the same cells as the 1.4% of cells that
did not label with BrdU in neurosphere culture immediately following exposure to the
analog.
Within the DiI(LOW+) group we observed many BrdU(-) cells (75.7 ±3.0%) (Fig 1-4E.)
which was expected as the neurosphere cells had already demonstrated a loss of BrdU
53
Fig 1-4: A subset of BrdU retaining cells are fast dividing cells. (A) Distribution of DiI, initially and after one week in vitro. DiI signal decreases as a result of DiI dilution via cell proliferation. DiI pos. indicates DiI(HI+) fraction and DiI neg. indicates DiI(LOW+) fraction. (B) DiI(HI+) fraction of slowly dividing neurosphere cells where DiI signal is vivid. (i) Shows dissociated cells in bright field, (ii) Shows DiI signal in red. (C) DiI(LOW+) fraction of rapidly dividing neurosphere cells where DiI signal is noticeably lower than in DiI(HI+) fraction. (i) Shows dissociated cells in bright field, (ii) Shows DiI signal in red. (D) Data shows DiI(HI+) population (10% of total). As expected, slowly cycling cells do not greatly attenuate BrdU or DiI. The BrdU(-) population may be the same 1% of cells that are BrdU(-) immediately following BrdU exposure. (E) Data shows DiI(LOW+) population (63% of total). A subset of BrdU(+) cells are DiI(LOW+) after extended cell proliferation in vitro. BrdU retention in rapidly cycling cells suggests these are cosegregating their DNA. (F) Comparison in clonal sphere formation between DiI(HI+) and DiI(LOW+) fractions. The majority of neurospheres arise from the fast-cycling DiI(LOW+) population [7.5 fold increase over DiI(HI+)]. This suggests SCs are in this actively proliferating fraction.
54
55
label through symmetric divisions, and the extinction of both cell division indicators was
predicted. Intriguingly, this actively dividing fraction also contained 23.1 ±2.7% weakly
or moderately BrdU(+) cells, and 1.2 ±0.2% heavily BrdU(+) cells. Altogether these
occupied 15% of the total cell population. Together with the 7.1% of BrdU(+)/DiI(HI+)
cells above, this is lower than the 33.6 ±2.0% of cells we originally gathered during our
analysis of BrdU retention at day 7 of neurosphere culture (Fig 1-3A.). Nonetheless,
1.2% of these cells had BrdU(+) signals at a strength that was qualitatively equivalent
with that of cells immediately following BrdU withdrawal. The retention of DNA label in
fast proliferating cells during one week of culture was suggestive of the cosegregation of
BrdU(+) chromosomes during asymmetric cell divisions.
We reproduced these results using CFSE instead of DiI (not shown). In addition, we
quantified the intensity of fluorescence emitted by cells immediately following CFSE
exposure which was found to be >4000 higher than that diluted by cells proliferated for 7
days. Indeed we calculated that the level of intensity emitted by even the highest CFSE
fluorescent cells, at 7 days culture, reflected at least 12 population doublings. This is the
number of divisions one would expect in a single neurosphere clone of >3000 cells at this
timepoint. Moreover, when we diluted the concentration of initial CFSE dye applied to
cells to approximate 7 population doublings (7 halvings of that concentration), we found
that cells treated with this concentration were still >250 times more fluorescent than those
exposed to undiluted dye and allowed 7 days to dilute it. We thus confirm that in 7 days
proliferation conditions, most neurosphere cells are proliferating and undergo over 7
population doublings, at which BrdU fluorescence is diluted past the threshold of
56
detection in ESCs and fibroblasts. However, a subset of proliferating neurosphere cells
retain BrdU.
In vivo, stem cells are thought to divide slowly (Morshead et al., 1994), but based on our
evidence we predicted this was not the case in vitro. If stem cells divided slowly, it would
follow that they would be enriched in the DiI(HI+) fraction. We assessed each fraction
for secondary colony forming ability (Fig 1-4F.), which is indicative of stem cell
presence via self renewal. The DiI(LOW+) population gave rise to 7.4 (±1.5) times as
many spheres as the DiI(HI+) population at clonal density. This suggested that this fast-
dividing DiI(LOW+) fraction contained most if not all of the stem cells. Subcloning the
DiI(LOW+) and DiI(HI+) fractions revealed that not one secondary sphere arose from the
DiI(HI+)-sphere cells though many secondary spheres arose from the DiI(LOW+)-
sphere-cell population. This suggests that the DiI(HI+) spheres arose from progenitor
cells that were unable to self-renew whereas self-renewing stem cells were fully restricted
to the DiI(LOW+) fraction. What is more, 24% of the DiI(LOW+) population contained
BrdU(+) cells.
Some BrdU-Retaining Cells Express Markers of Proliferating,
Multipotent Precursors
In vivo neural precursor cells are positive for Nestin, a filament protein that is present in
proliferating neural precursors (Lendahl et al., 1990). We observed that all cells in
proliferating clones were Nestin(+) at 4 days following BrdU removal, and that every
clone contained one or more BrdU(+) cells (Fig 1-5A.). At 4, 7 and 10 days under
57
proliferation conditions, all colonies derived from BrdU-exposed cells were composed
entirely of Nestin(+) cells, and contained no GFAP(+) cells (a marker of astrocytes), or β-
3-Tubulin(+) cells (a marker of neuronal cells) (not shown). We then stained cells at 10
days following BrdU removal for Ki67, a cell proliferation marker, and found that
79.1±7.5% were Ki67(+). At both these timepoints we confirmed that every single cell
colony contained Ki67(+) cells and that BrdU(+) cells also displayed Ki67 positivity (Fig
1-5B.). We found similar results using PCNA, another marker of proliferation. This data
suggests that under proliferation conditions all colonies are composed of cycling
Nestin(+) cells.
One week after BrdU removal, individual colonies were isolated and exposed to
differentiation conditions for an additional week. This span of time encompassed a total
of two weeks since BrdU-exposure. Clones were examined for the presence of BrdU and
Nestin in conjunction with GFAP. GFAP(+) cells displayed BrdU(+) nuclei (Fig 1-5C.)
as did Nestin(+) cells (Fig 1-5D.). Within a single differentiated neurosphere there were
1.9 ±0.4% Nestin(+) cells, and of these 63.4 ±6.7% were BrdU(+). All coexpressed
GFAP. If the cosegregation of BrdU-labeled DNA occurs in SCs, then these results are
consistent with previous findings which demonstrate the co-expression of Nestin and
GFAP by NSCs (Doetsch et al., 1999; Imura et al., 2003; Morshead et al., 2003). This
data shows that the majority of cells possessing markers of undifferentiated, proliferating
neural precursors, also retain BrdU label, during 7 days differentiation and 14 days after
exposure.
58
Fig 1-5: A subset of BrdU retaining cells remain undifferentiated. (A)All clones at 4 days following BrdU exposure are Nestin(+). (i) Bright field shows 4 day clone, (ii) Nestin is blue, (iii) BrdU labeled nuclei are green, (iv) Merge shows Nestin in blue, Histone labeled nuclei in red, BrdU labeled cells are green. (B) All clones 10 days following BrdU exposure contain Ki67(+) cells. Note strong Ki67 positivity of BrdU(+) cell (arrow). (i) Bright field shows clone, (ii) Ki67 expression is red, (iii) BrdU labeled nuclei are green, (iv) Merge shows Ki67 in red, BrdU labeled cells are green, Hoechst labeled nuclei are blue. (C) 14 day post-BrdU differentiated clone, with arrows indicating GFAP(+) cell nucleus. (i) Bright field, (ii) Merge shows GFAP in red, BrdU in green. (D) 14 day post-BrdU differentiated clone, with arrows indicating Nestin(+) cell nucleus. (i) Bright field, (ii) Nestin is blue, (iii) Merge shows Nestin in blue, Histone labeled nuclei in red, BrdU labeled cells in green. (E) Clones arising from 7 day differentiated spheres (total of 17 days post-BrdU). Cells show high Nestin(+) and undifferentiated cell morphology. (i) Bright field shows clone, (ii) Nestin is blue, (iii) BrdU labeled nuclei are green, (iv) Merge shows Nestin in blue, Histone labeled nuclei are red, BrdU labeled cells are green. (F) Numbers of Nestin(+) clones arising, from neurospheres exposed to differentiation conditions following BrdU removal. 3 DIV refers to clones that have been 17 days without BrdU, and 7 DIV clones have been without BrdU for 21 days. Nearly all clones at 3 DIV arise from BrdU(+) cells. The total number of SC colonies is slightly higher than this number (some taking longer to start proliferating), suggesting that all clones at 3 DIV are SC colonies.
59
60
We took differentiated neurospheres from differentiation conditions and replated them at
clonal density in proliferation conditions, to see if these undifferentiated cells would
subclone. Most cells subcloned, remained differentiated as assessed by their obvious glial
or neuronal morphology. Such cells did not divide and displayed low, if any, Nestin
positivity. Interestingly, a proportion of cells did not appear to be differentiated neurons
or glia by morphology, displayed high Nestin(+), and divided rapidly (Fig 1-5E.). From
2000 cells removed from the differentiation substratum and examined at 3 DIV, ~8
secondary clones arose, and of these 6 had at least one BrdU(+) cell present despite a
total of 17 days culture having elapsed since BrdU exposure (Fig 1-5F.). Hence, we
suggest that secondary clones obtained following one week of differentiation arise from
BrdU(+) cells, which themselves persist as undifferentiated BrdU(+)/Nestin(+) precursors
under differentiation conditions. On average 11 neurospheres, arising from differentiated
colonies, were produced for every 2000 cells plated. We suggest that these neurospheres
at 7 days are the same cell clones examined at 3 days.
This data reveals that self-renewing NSCs persist in differentiation conditions, and that it
is likely that some of these retain BrdU. It is extraordinary that undifferentiated and
cycling Nestin(+)/BrdU(+) cells would persist in clones composed of an average of 3000
cells, but which in some cases grew to large 300 micron clones numbering up to 15,000
cells. All clones contained BrdU positive cells. Such a phenomenon is strongly
suggestive of chromosome cosegregation in NSCs, because such cells must have already
achieved >7 cell doublings, a timepoint at which we have shown BrdU to be no longer
detectable in symmetrically dividing STO or R1 cells.
61
Cell Cycle Arrest and Real Time Imaging Confirm Asymmetric Segregation
Of Older and Newly-Synthesized DNA
We asked whether in vitro neural precursors could distribute DNA asymmetrically using
cytokinetic and karyokinetic inhibitors and immunofluorescence. 10 day post-BrdU cells
were exposed to an actin binding protein, cytochalasin-D, to arrest them during
cytokinesis, although karyokinesis had already occurred. Such treatment resulted in the
recovery of many binucleate cells, composing approximately half of the total cell
population. This complete dissociation of cells, including binucleate cells, into a single
cell suspension was verified on a hemocytometer. Though most BrdU(+) binucleate cells
displayed equivalent BrdU signal in (Fig 1-6A.) we found instances of cells which had
one labeled nucleus and one unlabeled nucleus (Fig 1-6B.). Such cells had been arrested
by mitotic inhibition over a period of 24 hours, meaning that it is likely that many of
these cells had a cell cycle of <24 hours. Thus, it is likely that at least 10 divisions
occurred in these cells over 10 days in neurosphere culture. Notwithstanding 10
consecutive divisions, a subset of cells cosegregated BrdU-labeled chromosomes into one
nucleus and remained positively labeled in contrast to the majority of cells examined at
this timepoint. Quantification revealed that 78.3 ±4.5 binucleate cells had two unlabeled
nuclei, 11.4±2.7% had equally labeled nuclei, and 10.3 ±1.9% exhibited BrdU signal in
only one of the daughter nuclei (Fig 1-6C.). No evidence of uneven BrdU(+) signal in
fibroblast cells treated with cytochalasin-D was found (not shown), in contrast to neural
cells.
62
A similar experiment was repeated, but this time using the mitotic inhibitor Nocodazole.
Upon removal of mitotic inhibitor, cells were allowed to continue mitosis during which
they were fixed at ten minute intervals from 10 minutes to 60 minutes. Mitotic stages
were identified by nuclear and chromosome morphology. BrdU localization was assessed
at late anaphase or telophase, when chromosomes were condensed and a complete
separation of forthcoming daughter cell chromosomes was evident. We observed the
uneven distribution of BrdU in the chromosome of cells arrested during mitosis by high-
power confocal microscopy (Fig 1-6D.), although inhibitor inefficiency and orientation of
non-adherent neurosphere cells impeded quantification. As well, we cannot resolve
whether the demonstration of asymmetric BrdU localization in single mitotic cells is due
to a dilution of BrdU to the threshold of detection in some of these cases.
We continued the above experiment, but allowed single dissociated cells 2 hours to
complete division upon removal of nocodazole. Consequently, single mitotic cells
became cell doublets. We again found unevenly labeled daughter cells similar to the
results obtained with cytochalasin-D treated cells (Fig 1-6E.), as well as cell doublets
which were BrdU(-) or evenly BrdU(+)(Fig 1-6F.).
Thus far our results did not examine asymmetric DNA partitioning within living
individual mitotic cells. We made use of a real time imaging system to track cell division
within clones arising from single neurosphere cells. Clones were filmed and then fixed at
varying timepoints, and cell lineages were reconstructed. Unlike our studies so far, we
did not expose cells for an extended time to BrdU. Instead, cells were plated in BrdU-
63
Fig 1-6: Cell cycle arrest reveals asymmetry in the distribution of BrdU retaining chromosomes. (A) BrdU distribution in a cell arrested during cytokinesis, 10 post-BrdU. Arrows indicate symmetric BrdU(+) nuclei in same cell. (i) Bright field shows binucleate cell, (ii) Histone labeled nuclei are red, (iii) BrdU is green, (iv) Shows merge of histone and BrdU. (B) BrdU distribution in a cell arrested during cytokinesis, 10 days post-BrdU. Arrows indicate BrdU positive nucleus, adjacent to BrdU negative nucleus, in same cell. (i) Bright field shows binucleate cell, (ii) Histone labeled nuclei are red, (iii) BrdU is green, (iv) Shows merge of histone and BrdU. (C) BrdU distribution in binucleate cell population treated with Cytochalasin-D. Uneven segregation of labeled DNA to daughter nuclei occurs in 10% of the binucleate cell population. (D) Confocal microscopy of BrdU-exposed cells arrested during karyokinesis, 10 days following BrdU exposure. Upon removal of inhibitor, cells were timed for fixation at late anaphase or telophase. Mitotic cells were observed segregating labeled DNA non-randomly to one daughter in top row (arrows), as opposed to the even segregation of BrdU in bottom examples (arrowheads). BrdU labeling was confirmed at all focal planes. (i) Bright field shows mitotic cells, (ii) Histone labeled nuclei are red, (iii) BrdU is green, (iv) Shows merge of histone and BrdU. (E) Cell doublets arising from 10 day post-BrdU cells inhibited during karyokinesis. Cells released from inhibition were allowed to complete mitosis. Uneven labeling of BrdU(+/-) daughter nuclei was again apparent (arrows). (i) Bright field shows 2 cells, (ii) Histone labeled nuclei are red, (iii) BrdU is indicated by green, (iv) Shows merge of histone and BrdU. (F) Cell doublets arising from 10 day post-BrdU cells inhibited during karyokinesis. Cells released from inhibition were allowed to complete mitosis. Some doublets displayed evenly labeled BrdU(+) daughters (arrows) or unlabelled, BrdU(-) doublets (arrowheads). (i) Bright field shows binucleate cells, (ii) Shows merge of histone labeled nuclei (red) and BrdU (green).
64
65
containing medium and allowed to undergo DNA synthesis to divide exactly once. We
reasoned that, just prior to mitosis, each mouse cell would contain 40 pairs (4N) of
BrdU(+) chromosomes to be distributed to both daughters. Following division in BrdU,
both daughter cells would contain 40 chromosomes, half unlabeled with the original
unlabeled DNA template strand and half labeled with the new and BrdU(+) synthesized
strand (Fig 1-7A.). Therefore each cell daughter would be positive for BrdU signal at the
two cell stage, when BrdU was removed. Whereas in our previous work we inferred
immortal strand retention in SCs by the presence of analog, here we examined the loss of
newly synthesized BrdU(+) DNA and retention of older, unlabeled DNA in SCs. Two
asymmetric divisions, the first in the presence of BrdU, the second in the absence of
BrdU, would result in a dissociation of labeled and unlabeled DNA strands. Daughter
SCs would retain the original unlabeled strands.
Fifteen clones were traced and their lineages retrospectively established. The progeny of
each clone were stained for the presence of BrdU (Fig 1-7B.). In 6/15 clones we noted at
least one division event in which asymmetric DNA segregation occurred. Indeed, in 5/15
clones, segregation was observed within only one division event after BrdU removal (Fig
1-7C.). This data suggests unlabeled DNA templates originally present in the founder cell
that have been cosegregated in cells, as immortal strands one round of DNA synthesis
following BrdU uptake. The complete dissociation of a mouse cell’s 40 BrdU(-) and 40
BrdU(+) DNA chromosomes in one such event, has a calculated probability of just 1.8 X
10-10 percent, and should not occur at this high frequency if segregation is random. Our
results are shown summarized (Fig 1-7D.). That cells remain labeled for up to five
66
Fig 1-7: Imaging single neurosphere cells confirms asymmetry in chromosome segregation. (A) Schematic showing BrdU imaging strategy. (1) Each double strand (one chromosome) represents 10 chromosomes of a mouse cell. Cells are unlabeled for BrdU (black). (2) During DNA synthesis, BrdU(green) is taken up for exactly one division in the presence of BrdU. (3) BrdU is removed and the daughters enter a second round of DNA synthesis in the absence of BrdU. (4) Division events following the second round of DNA synthesis should show BrdU asymmetry if groups of unlabeled chromosomes are cosegregated as immortal strands into SCs. (B) A clone imaged in real time. Following one division event, BrdU was removed, and colony was fixed following 2 further cell divisions in the absence of BrdU. Arrow indicates a cell which has cleared all BrdU signal. (i) Bright field shows clone, (ii) Histone labeled nuclei are red, (iii) BrdU is indicated by green, (iv) Shows merge of histone and BrdU. (C) Lineage diagrams from 4 clones traced (ii, iii and iv show asymmetric DNA partitioning). Clone [ii] is the same shown in figure 7B. Each lineage represents divisions of one single cell, plated in the presence of BrdU, which is taken up during the first division initially labeling daughter nuclei (green), as demonstrated in clone [i]. BrdU was removed after this one division, and cells continued proliferating until analysis. Note, the presence of BrdU(+) is inferred in parental cells from their offspring. Dead cells were observed to disintegrate while imaging, prior to analysis. (D) Summary of clones traced. 6 out of 15 clones demonstrated asymmetric partitioning of new and old DNA.
67
68
divisions upon BrdU uptake (Fig 1-7C.), shows that asymmetric BrdU partitioning
observed in these experiments is not due to cell nuclei being at the threshold of BrdU
dilution in this experiment.
Using the same strategy, we plated cells in the microwells of Terasaki plates in the
presence of BrdU. We confirmed that single cells were initially present in each well, and
following overnight incubation, wells containing cell doublets were scored before the
removal of BrdU. Cells were then allowed to proliferate for four days, prior to the
removal of mitogens and addition of serum and substrate to initiate cell differentiation.
Colonies were then assessed for BrdU, β-3-Tubulin and Nestin. We examined 29 clones
and found that 9 of these showed asymmetric BrdU partitioning, while 13 showed
asymmetry in cell fate, containing a mixture of both Nestin and β-3-Tubulin positive cells
(not shown). Strikingly, 8 of the 9 clones with asymmetric BrdU partitioning also
demonstrated concomitant asymmetric cell fate. Within asymmetric clones, all β-3-
Tubulin(+) cells were BrdU(+), but only 37.8±12.2% of the Nestin(+) cells colabeled
with BrdU; suggesting that some progenitors and/or stem cells shed newly synthesized
DNA preferentially. None of the clones in this experiment produced the number of
offspring expected from 7 population doublings, the number at which BrdU would be
reaching its threshold of dilution. These results suggest that: A) asymmetric DNA
partitioning is correlated with asymmetric cell fate; and B) that only undifferentiated
precursors cosegregate and retain their original unlabeled DNA, while labeled DNA is
passed on to cells destined to differentiate.
69
Discussion
NSCs are Nestin(+) mitotic cells that incorporate BrdU in vitro and clonally give rise to
great numbers of Nestin(+) neural precursors, which can be differentiated into neural
cells. Colony cells are functionally heterogeneous; only a subset have the ability to form
secondary colonies in culture, demonstrating that SCs divide symmetrically to produce
equivalent progeny. We have shown that:
1) During long-term BrdU exposure, symmetric divisions result in the uptake and
subsequent dilution of BrdU signal, a phenomenon that is consistent with semi
conservative DNA replication and the ISH. Yet in vitro NSCs retain BrdU unlike
ESCs, fibroblasts, and some of the neural progenitors arising from NSCs.
2) Under proliferation conditions neurosphere cells are actively dividing, though
they exhibit some heterogeneity in cell cycle.
3) NSCs are fast dividing cells in vitro. Under proliferation conditions, cells which
retain BrdU are mitotically active and it is the fast-dividing cell population which
produces SC colonies.
4) Under differentiation conditions, a proportion of BrdU(+) cells retain Nestin, and
the majority of colonies subcloned from differentiated colonies are founded by
Nestin(+), BrdU-retaining cells.
5) Cell division symmetry can be partially defined by DNA inheritance, and is
correlated with asymmetry in the fate of cells arising within a clone. Asymmetric
divisions are exhibited by asymmetric BrdU localization in single mitotic cells.
Real time imaging reveals that BrdU labeled DNA is asymmetrically partitioned
one division immediately after BrdU uptake; a timepoint at which a mitotic cell
70
would have to segregate in the range of 40 BrdU(+) chromosome to one daughter
but not the other. The great discrepancy between BrdU(+) and BrdU(-) nuclei
observed in these real time imaging experiments, and the high frequency at which
they occur, argue against a stochastic nature to this process. Asymmetric DNA
segregation explains how a single clone of 3000 cells, representing 12 cell
doublings, retains BrdU label.
We conclude that in vitro, NSCs are unique in the uneven partitioning of genetic material
during some division events.
The expectation that cells would retain a full complement of labeled chromosomes has
been used to invalidate the ISH (Ito et al., 1988). This expectation is false, because cells
dilute BrdU-containing chromosomes randomly through symmetric divisions, and may
segregate varying ratios of BrdU-labeled and unlabeled chromosomes as Immortal Strand
bearing chromosomes. Indeed, BrdU heterogeneity among immortal DNA strands is
entirely consistent with the cosegregation phenomenon. For example, if a single SC had
one half of each chromosome strand labeled with BrdU, it would possess 40 one-half-
labeled, and 40 non-labeled chromosomes immediately after DNA synthesis had taken
place. If such a cell was to divide symmetrically, it would randomly obtain between 0-40
of the labeled chromosomes to be consequently segregated as Immortal Strands. Thus a
cell will not be indelibly marked with analog as a result of DNA synthesis according to
the ISH. This is consistent with our results.
71
It has been suggested that chromosome cosegregation confers a means for SCs, that arise
in the embryo and which divide in the animal until senescence, to avoid passing
potentially deleterious mutations, occurring as a result of errors in DNA synthesis and
DNA repair to their progeny (Cairns, 2002). SCs may also need to avoid recombining
chromosomes, since recombination might obviate or at least attenuate any benefits
accrued through the segregation of older chromosomes. Suppression of recombination in
SCs would itself provide a mechanism to avoid loss of heterozygosity events that could
lead to cell transformation (Tischfield and Shao, 2003).
Studies on the mollusk (Tomasovic and Mix, 1974), demonstrated a surprising retention
of incorporated DNA label in cells within continuously regenerating tissues of the adult
animal. Cells from the adult mouse have been found to retain thymidine analog (Potten et
al., 1978; Potten et al., 2002). However, investigations of cosegregation during
development have failed to observe DNA label retention in murine blastocysts or morula
in vivo (Ito et al., 1988), nor in the embryos of C.elegans (Ito and McGhee, 1987).
Similarly, our evidence does not support the ISH in ESCs derived from the 3.5 day
blastocyst of early murine embryos. Further work needs to address this discrepancy
explicitly.
Template strand retention might attenuate the end replication problem in telomeres
during DNA synthesis and thus allow a SC greater divisions without the need for
telomerase or other related mechanisms. The occurrence of symmetric divisions in SCs
means that the end replication problem would still apply to SCs, although these may
72
possess an overall greater potential number of total divisions, before becoming senescent,
relative to non-SCs. Consequently, we hypothesize that SCs cosegregating older
chromosomes possess a greater proliferative capacity than non-SCs in the absence of
enzymatic telomere length maintenance.
The effect of old and new mitotic spindle bodies may have an effect on the fate of
daughter cells in bacteria (Ackermann et al., 2003), and mammals (Cayouette et al.,
2003). It is possible that older chromosome strands could be associated with these events.
Indeed a microtubule/centrosomal asymmetry mechanism in both protein (Liakopoulos et
al., 2003) and mRNA (Lambert and Nagy, 2002) localization during cell division itself
has been shown. The mitotic spindle apparatus could possess an intrinsic asymmetry that
would cosegregate immortal-strand-bearing chromosomes. A molecular basis for such an
uneven chromosome segregation is unknown, but a theoretical model for such a system
has been proposed which would involve sequence recognition of either leading or lagging
templates in dividing cells (Jablonka and Jablonka, 1982a). It is possible that leading
versus lagging DNA synthesis might prime chromosomes for separation during synthesis
itself. The yeast, S. Pombe, uses a DNA strand-specific imprinting mechanism to produce
daughter cells, where only one of the two changes its mating cell-type by the process of
mating-type switching (Dalgaard and Klar, 2001). Such an asymmetry is conferred at the
template level, where an imprint is installed only during lagging strand replication, but
not in that of the leading strand. The lagging strand imprint permits subsequent DNA
recombination by a double strand repair mechanism which differentiates daughter cell
chromosomes. In this system it appears that inheritance of specific chain of the parental
73
chromosome is crucial for cellular differentiation and asymmetry between daughter cell
progeny. Without the imprint cells do not maintain the multipotent lineage and can only
produce differentiated progeny, behaviours that bear intriguing similarity to the
multipotent nature of self-renewing SCs in multicellular eukaryotes. We envision such a
mechanism to be primarily epigenetic, though progeny arising asymmetrically from the
SC lineage might carry sequence differences as a result of errors in DNA synthesis. The
uneven segregation of DNA pattern in an endlessly cycling cell might be sufficient to
define the epigenetic persistence of the SC itself.
The pioneering efforts of Meselson and Stahl (Meselson and Stahl, 1958a), demonstrated
that the semi-conservative replication of DNA resulted in equal partitioning of genetic
material, overall have suggested a fundamentally random nature to the distribution of
genetic copy between generations. It has been generally assumed that eukaryotic
chromosomes are randomly distributed to daughter cells and that daughter cell
asymmetry is not a result of DNA asymmetry, but a rather a result of genetic product
differences. This may not apply to all mitotic inheritance; our results here support the
hypothesis that a small population of neural cells retain their original DNA when dividing
asymmetrically; and that these cells possess NSC characteristics.
74
Chapter III.
Ancestral DNA Segregation in Drosophila Germline Stem Cells
75
This chapter has been submitted for publication: Phillip Karpowicz, Milena Pellikka,
Dorothea Godt, Ulrich Tepass, Derek van der Kooy. DNA is partitioned asymmetrically
in the germline stem cells of Drosophila melanogaster.
Summary
The Immortal Strand Hypothesis proposes that asymmetrically dividing stem cells
cosegregate chromatids to retain ancestral DNA templates. Using both pulse-chase and
label retention assays, we show that asymmetric partitioning of DNA occurs in germline
stem cells (GSC) in the Drosophila ovary as these divide asymmetrically to generate a
new GSC and a differentiating cystoblast. This process is disrupted when GSCs are
forced to differentiate through the overexpression of Bag of Marbles, a factor that impels
the terminal differentiation of cystoblasts. When asymmetric division is genetically
disrupted through the ectopic expression of Decapentaplegic, a ligand which maintains
the undifferentiated state of GSCs, the non-random partitioning of DNA is similarly
abolished. These results suggest asymmetric chromatid segregation is uniquely coupled
to mechanisms specifying cellular differentiation via asymmetric stem cell division.
Introduction
76
During mitosis, dividing cells segregate their replicated chromatids into each daughter to
ensure the inheritance of the complete genome. This repeated replication of DNA
presents a problem to a long term dividing cell such as a stem cell (SC). If segregation is
random, and DNA is potentially copied from a previous copy, replication errors will
accumulate in frequently dividing SCs and their progeny. The Immortal Strand
Hypothesis (ISH) (Cairns, 1975) proposes that DNA is segregated non-randomly between
recipient daughter cells, as a means through which SCs might lower their mutation load
(Cairns, 2002). According to the ISH, asymmetrically dividing stem cells cosegregate
chromatids in order to retain ancestral DNA templates in the SC daughter (Fig 2-1A.).
Given that DNA replication is semi-conservative, such chromosomes are distinguished
because they contain one ancestral strand associated with a newer strand from the
preceding round of DNA synthesis. This asymmetry in DNA molecule inheritance
between daughter cells might also segregate differences in chromatin architecture to
retain sequence fidelity and enzyme accessibility (Jablonka and Jablonka, 1982a;
Jablonka and Jablonka, 1982b) for genes conferring pluripotency to SCs, and might allow
non-SCs to adopt a novel chromatin architecture. Hence, the ISH also provides an
attractive single-factor explanation for the epigenetic persistence of the self-renewing SC
and the concomitant differentiation of the non-SC.
There is some data to suggest the separation of older and newer chromosomes following
DNA replication in vitro (Karpowicz et al., 2005; Lark et al., 1966; Merok et al., 2002) as
77
Fig 2-1: The Immortal Strand Hypothesis. (A) When SCs divide asymmetrically (blue), producing a daughter SC and a daughter non-SC, chromatids containing ancestral DNA templates (indicated in red) are segregated to SCs. DNA is replicated semi-conservatively, thus chromosomes contain newly synthesized strands (indicated in black) associated with ancestral template strands. When SCs divide symmetrically (black), chromosome segregation is random. (B) Schematic of the germarium, the region in which GSCs (red), cystoblasts (green single cells) and cystocytes (green clusters) reside. Note that the GSCs are the germ cells occupy positions adjacent to the tip of the germarium. More differentiated cytocytes appear further down from this area, forming cysts with 16 nuclei that mature into follicles.
78
79
well as in vivo (Potten et al., 2002; Potten et al., 1978; Smith, 2005; Shinin et al., 2006;
Lark, 1967). Though notable, these studies remain equivocal because cells demonstrating
asymmetric DNA segregation could not be identified unambiguously as SCs, and because
it is not clear that cosegregation of ancestral strand bearing chromosomes is coupled to
the differentiation program of the non-stem cell counterparts.
The ovary of the fruit fly, Drosophila melanogaster, contains germaria with a germline
stem cell (GSC) population that can be identified unambiguously (Ohlstein et al., 2004).
Each germarium is known to possess either 2 or 3 SCs (Fig 2-1B.), that divide
asymmetrically to give rise to daughter SCs and cystoblasts. The cystoblast progeny of
GSCs undergo a further four divisions to produce a cyst containing 16 nuclei, which
matures into a follicle, and which develops into a single egg. This asymmetric division of
GSCs to produce a GSC and cystoblast daughter continues throughout the lifetime of the
female fly. Here we demonstrate that asymmetric segregation of DNA in the dividing
GSCs occurs in vivo. We show that this process ceases when differentiation is
molecularly perturbed to induce symmetric stem cell divisions, and moreover, unlike
GSCs, the differentiated progeny of GSCs segregate DNA randomly.
Materials and Methods
Fly Stocks and Dissection: Wildtype, w1118, c587-Gal4; UAS-Dpp, w; P[hsp70-bam]11d
and P[hsp70-bam]18d stocks were maintained at 25oC. For retention experiments, BrdU
80
stock (25 mg/mL in 40% EtOH) was applied to medium at a final concentration of 0.2
mM. For pulse-chase experiments, female prepupae were selected and maintained at
25oC on apple plates. Heat shock was performed one day prior to injections as described
(Ohlstein and McKearin, 1997). Pupae were fixed to slides using double-sided scotch
tape and injected at 3 days pupation with 1.0 mM BrdU (Sigma) dissolved in Ringer’s
buffer (pH 6.9), or with 1.0 mM BrdU (Sigma) together with 100 mM BrdU thymidine
(Sigma) dissolved in Ringer’s buffer (pH 6.9). Injections were done using 25o ground
capillary needles directly into the abdomen of the pupa. Subsets of BrdU-injected pupae
were injected 24 hours following BrdU infusion, with 100 mM BrdU thymidine (Sigma)
dissolved in Ringer’s (pH 6.9). Pupae were maintained at 25oC, ovaries dissected in 10
mM PBS and fixed 12 minutes at room temperature with 5% formaldehyde diluted in
PBS (Roche). Following fixation, ovaries were washed 3 X with PBS + 1.0% Triton
(Sigma) and triturated using a 1c.c. syringe and 30G1/2 tip (Becton-Dickenson) to
dissociate ovaries.
Immunostaining: The following antibodies were used: 1) rat monoclonal anti-BrdU
Bu1/75 (Abcam, 1:500), 2) mouse monoclonal anti-pan-histone (Chemicon, 1:500), 3)
rabbit polyclonal anti-VASA (courtesy of Paul Lasko, 1:2000), 4) mouse monoclonal
anti-HTS 1B1 (courtesy of Howard Lipshitz, 1:1). Secondary 568 nm or 633 nm cross-
adsorbed Alexa Fluor antibodies (Molecular Probes, 1:300) were used excepting BrdU
secondary stain which was amplified using Biotin-conjugated antibodies (Jackson, 1:250)
followed by Streptavidin-DTAF (Jackson, 1:300). Samples were washed 4 X with PBS +
1.0% Triton and blocked with 5.0% normal goat serum (Sigma) or 5.0% normal donkey
81
serum + 0.1% bovine serum albumin (Sigma) prior to addition of each antibody. Nuclei
were counterstained with 5.0 μM Sytox Orange (Molecular Probes). BrdU staining
positivity was confirmed by staining negative control samples not exposed to BrdU. In
such control germaria, unexposed to BrdU, background fluorescence emitted a signal
approximately ten fold lower than germaria exposed to BrdU for 24 hours.
Microscopy and Analysis: Samples were mounted on glass slides using Goldmount
(Molecular Probes). Germaria were visualized and photographed under confocal
microscopy, using a Plan-Apochromat 100x/1.40 oil-immersion lens objective on a
LSM510 (Carl Zeiss). Confocal sections of <1 micron thickness were taken every ~2
microns spanning the entire germarium. Detection settings were kept constant when
comparing 24 hour BrdU versus 24 hour BrdU + thymidine injection controls.
Quantification of fluorescence in each raw confocal section was done using ImageJ
software. Confocal sections were examined to locate the largest section of each cell’s
nucleus, and these were outlined to determine fluorescence emitted by that cell. Graphs
shown depict means and standard error of the mean for the average nuclear BrdU signal
normalized to GSCs, calculated for each individual germarium. Statistical analysis was
carried out using Graphpad Prism 4.0, in most cases comparisons between normalized
GSC and cyst nuclei quantifications was carried out by t-tests, with comparisons between
multiple groups (Fig. 2-2F., 2-4.C. & 2-4G.) carried out by ANOVA with Dunnett post-
test as required. Comparison between quantifications done by VASA versus HTS staining
were carried out using an unpaired t-test. For figures, photos were processed using Adobe
Photoshop 6.0 software.
82
Results
GSCs Partition DNA Asymmetrically In Vivo
GSCs are known to cycle approximately once every 24 hours in the germarium (Lin and
Spradling, 1993). The cell cycle of cystoblasts in the germarium can be estimated by the
synchronous maturation time of the mono-nucleated cystoblast into the 16-nucleated cyst
over four days (Lin and Spradling, 1993), meaning that the cystoblasts and cystocytes
also possess approximately 24 hour cycles. Importantly, GSCs divide only
asymmetrically, with only the cell next to the cap cells of the germarium persisting as a
GSC. We applied the halogenated thymidine analog, 5-Bromo-2-Deoxyuridine (BrdU) to
label DNA strands in these germ cells.
We predicted that a pulse of BrdU would result in the transient incorporation and
subsequent preferential clearance of BrdU in asymmetrically dividing GSCs as opposed
to their cystoblast and cyst cell progeny (Fig 2-2A.). Following cell division in BrdU
which occurs once every 24 hours, both daughter cells would contain 4 pairs of
chromosomes, each chromosome half-unlabeled with the original unlabeled DNA
template strand and half-labeled with the new BrdU(+) synthesized strand (Fig 2-2A.). At
this timepoint all germ cells would be evenly labeled for BrdU. However after this
timepoint, a thymidine chase injection, would result in a lowering of BrdU signal.
Chromosome cosegration according to the ISH would result in reduction of BrdU signal
83
one GSC division after the administration of thymidine chase (Fig 2-2A.). The complete
loss of all BrdU labeled chromosomes by random chance would have an unlikely
probability of 1:128, or 0.78%, assuming each chromosome was equally detectable.
Although Non-GSCs would also lower their BrdU signal during their symmetric
expansionary divisions, these would still be quantifiably more BrdU positive if
cosegregation of BrdU containing templates occurred in GSCs but not the adjacent non-
GSCs. On average, GSCs would lose BrdU more rapidly than cystoblasts or cyst nuclei
only one division after uptake according to the ISH. Conversely, if segregation of DNA
in these cells was fully random GSCs and non-GSC germ cells would be equally labeled
for BrdU.
Fruit flies were injected at day 3 of pupation, a stage in which germaria are already
present and where GSCs are already dividing to give rise to follicles (Bhat and Schedl,
1997). The injection of BrdU into pupae ensured controlled delivery of analog into the
animal, and allowed for cells to be exposed to BrdU at the same developmental
timepoint. We identified germ cells by the presence of the germline marker VASA
(Lasko and Ashburner, 1988), and identified the two VASA(+) cells adjacent to the cap
cells as GSCs (Lin and Spradling, 1993). Upon 24 hours incubation, following the
injection of BrdU all germline cells of the germarium, including GSCs, cystoblasts and
all cyst nuclei were strongly positive for BrdU (Fig 2-2B.). We quantified the
fluorescence emitted by BrdU(+) in confocal sections through the centre of these nuclei
(n= 18 germaria sampled), and found that within each germarium, the signals emitted by
GSCs, cystoblasts and cyst nuclei were equivalent at 24 hours (Fig 2-2D.). These results
84
Fig 2-2: Chromatids are segregated asymmetrically in Adult GSCs. (A) Schematic showing BrdU Pulse-Chase strategy. (1) GSC (yellow) possesses four pairs of chromosomes (double strands). Ancestral strands are depicted in red. Initially, all strands of DNA are unlabeled for BrdU (red or black). (2) Following the first division, newly synthesized DNA (green strands) were copied from unlabeled strands during DNA replication in the presence of BrdU(green) (3) Thymidine is now infused and outcompetes residual BrdU as the daughters complete a second round of DNA replication prior to the next cell division (new strands are marked in black). GSC daughter (yellow) now shows BrdU loss relative to non-GSC daughter (white) which retains highly BrdU-labeled DNA strands. Note that symmetric divisions shown at right (white cystoblast cells), result in a dilution but not outright depletion of BrdU label. The ISH predicts that if all four cells were compared after 2 cell divisions, the GSC (yellow) would emit reduced BrdU signal relative to the average in its non-GSC cell progeny (white). (B) Confocal section of a germarium dissected 24 hours following BrdU injection. All germ cells, marked blue with VASA, are labeled for BrdU in green. Arrows indicate GSC, counterstained nuclei are in red (Sytox Orange). Confocal sections showing the centre of nuclei (i.e. those of the GSCs) were used for fluorescence quantification. (C) Confocal section of a germarium dissected 48 hours following BrdU injection and 24 hours following thymidine chase. Middle row shows enlarged views of GSCs. Last row shows only cystoblasts and cystocytes in a confocal section adjacent to GSC section. Note lower signal in GSCs (arrow).
85
86
were calculated by comparing BrdU signals emitted by 10 germ cells closest to the
terminal filament in one individual germarium. Cells further down from these cells were
not included in this analysis. The average signals from the 2 GSCs relative to those
emitted by the next 8 germ cells (closest to the terminal filament) were obtained (see Fig
2-5A.) and then ratios from each germarium were averaged together. The equivalence
between GSCs and their progeny observed at the 24 hour timepoint again suggested these
cells were dividing at a similar rate, as any discrepancies in cell cycle between GSCs and
non-GSCs should be manifested as an average difference in the signals emitted by these
cells.
Drosophila pupae were injected with BrdU as before, but following 24 hours exposure,
the same pupae were injected with thymidine at 100-fold higher concentration than the
BrdU. 24 hours following this thymidine infusion, germaria were dissected and BrdU was
visualized as before (Fig 2-2C.). We again calculated the fluorescence emitted by
cystoblasts and cystocyte nuclei relative to the average fluorescence emitted by 2 GSCs
in that same germarium. These discrepancies within each germarium were quantified as
before (see Fig 2-5C.). Interestingly, GSCs now demonstrated significantly lower signal
than non-GSCs (Fig 2-2E.) 24 hours after the BrdU signal had been equivalent between
GSCs and non-GSCs (n=35 germaria sampled). This result suggested nonrandom
chromatid segregation occurs in GSCs.
The germarium of the fly contains 2-3 GSCs and, in our analysis to this point, we
conservatively estimated that only 2 GSCs were present in each germarium. We now
87
reexamined our quantification and compared two GSCs with the next two most adjacent
VASA(+) germ cells which might be either GSCs or cystoblasts. This comparison
revealed that following thymidine chase, one of these adjacent cells most resembled
GSCs by BrdU intensity and the other resembled the remaining 6 germ cells (Fig 2-2F.)
scored within each germarium (n=35 germaria sampled). We repeated the same 24 hour
BrdU injections then 24 hour thymidine injections, and made use of the marker Hu-li Tai
Shao (HTS), which can be used to unambiguously identify GSCs regardless of whether 2
or 3 of these are found in each germarium (Yue and Spradling, 1992; Zaccai and
Lipshitz, 1996). Using HTS, we found 5 / 17 germaria contained 3 GSCs instead of 2. We
confirmed our previous observations that DNA is segregated asymmetrically between
GSCs and their progeny one division after thymidine infusion (Fig 2-2G.) (n=17 germaria
sampled). Indeed, the ~90% fluorescence difference between cystoblasts and GSCs
identified by HTS staining was significantly greater than the ~50% difference observed
between cytoblasts and GSCs identified by position and VASA positivity (t = 1.340, df =
16, p<0.05).
Pupae were injected with BrdU and again allowed 24 hours to elapse before the injection
of a thymidine chase. This time, however, pupae were allowed to eclose upon completion
of pupation, and flies were harvested 72 hours following thymidine injection. We again
assayed for BrdU presence (n=11 germaria sampled) and found that 96 hours following
the timepoint at which BrdU was equivalent between GSCs and non-GSCs, and 72 hours
following thymidine chase, a significant discrepancy between GSCs and non-GSCs
remained present in these germaria (Fig 2-2H.). Despite three rounds of DNA synthesis
88
Fig 2-2: Chromatids are segregated asymmetrically in Adult GSCs. (D) Germ cells at 24 hours following BrdU infusion emit equivalent fluorescence. Graph shows signal emitted by germ cell progeny (“Cyst Nuclei” includes cystoblast and cystocytes) as normalized to stem cell founders. There are no significant differences between GSCs and their progeny at this timepoint (p>0.05). Quantifications were established from three separate experiments (n=18 germaria sampled in total). (E) Following thymidine chase, GSCs emit significantly lower BrdU signal than cystoblasts or cystocytes. Graph shows increase in signal emitted by germ cell progeny as normalized to stem cell founders. Asterisks indicate that BrdU signal was found to be significantly lower in GSCs than their differentiated progeny at this timepoint (t = 5.421, df = 34, p<0.05). Quantifications were established from three separate experiments, in which signal emitted by 8 non-GSCs is normalized to 2 GSCs for each germarium (n=35 germaria sampled in total). (F) If 3 GSCs are present in each germarium rather than two, one cystoblast possesses nearly the same signal as GSCs. Graph shows signal emitted by Hi-BrdU(+) cystoblast versus Low-BrdU(+) cystoblast as normalized to stem cell founders (F3,139=14.56, p<0.05). Note that no significant difference exists between GSCs and Low-BrdU(+) cystoblast (p>0.05, Dunnett post-test). Quantifications were established from three separate experiments, in which signal emitted by germ cells shown is normalized to GSCs for each germarium (n=35 germaria sampled in total) (G) HTS staining confirms that following BrdU pulse injection and thymidine chase injection, GSCs emit significantly lower BrdU signal than cystoblasts or cyst nuclei. Confocal section shows a germarium following BrdU injection and thymidine chase. Note lower signal in GSCs (arrow), the signal in the adjacent non-GSCs is higher than shown in confocal sections above and below the plane of the GSC. Germ cell spectrosome is marked blue with HTS, and BrdU in green. Arrows indicate GSC, counterstained nuclei are in red. Graph shows significant increase (asterisks) in signal emitted by differentiating germ cell progeny as normalized to stem cell founders (t = 5.179, df = 16, p<0.05). Quantifications were established from BrdU signal emitted by non-GSCs as normalized to GSCs for each germarium (n=17 germaria sampled in total). (H) 96 hours after BrdU injection and 72 hours following thymidine infusion, GSCs still emit significantly (asterisks) lower BrdU signal than cystoblasts or cyst nuclei (t = 6.025, df = 10, p<0.05). Quantifications were established from BrdU signal emitted by non-GSCs as normalized to GSCs for each germarium (n=11 germaria sampled in total).
89
90
(over three days) in which cystoblasts and cyst nuclei had divided symmetrically to
further dilute their BrdU label, their signal was still higher than the low BrdU signal
emitted by the GSCs.
Thus far, our results were consistent with the prediction derived from the ISH, however
incomplete BrdU chase and differences in nuclear packaging could also account for these
observations. As well, the incomplete loss of BrdU signal in GSCs, subsequent to
thymidine chase, did not seem to support complete chromosome segregation as predicted
by the ISH.
First, to confirm that the thymidine chase was lowering the BrdU signal, we injected fruit
flies at day 3 of pupation with a mixture of BrdU and thymidine. Thymidine was added at
a 100:1 stoichiometry relative to BrdU, as applied in the experiments above. We again
compared germaria 24 hours following injection and found that all germ cells now
emitted a weaker signal than would be the case in the absence of thymidine (n= 15
germaria sampled). These germaria were quantified as above. No significant difference
between GSCs and other germ cells was observed (see Fig 2-5B.). The reduction of BrdU
signal confirmed that, following a BrdU pulse, a thymidine chase would reduce BrdU
signal in this system. Furthermore, this signal in GSCs pulsed with BrdU and chased with
thymidine was similar to the baseline detected in BrdU/thymidine coinjection (compare
Fig 2-5B. and 2-5C.). This suggested that GSCs were losing most of the initially BrdU-
labeled chromosomes following thymidine chase, and that the signal detected was due to
incomplete chase of BrdU.
91
Second, germaria were stained using a pan-histone antibody to ascertain if cells of the
germarium emitted any discernable discrepancies in overall nuclear signals. Though germ
cells possessed equivalent BrdU signals upon BrdU incorporation, uneven histone signals
might reveal differences in DNA packaging or antibody penetrance among these cells.
We found that no significant differences existed between GSCs and their 8 closest germ
cell progeny (Fig 2-6.) (n=12 germaria sampled). Furthermore the area quantified via
confocal sectioning of the germ cell nuclei examined, possessed no significant
differences in size (data not shown), suggesting that no appreciable nuclear differences
existed between GSCs and their adjacent germ cell progeny.
These data show that, even though BrdU incorporation in GSCs is equivalent to non-GSC
germ cells, analog signal is selectively lost in GSCs relative to non-GSCs one round of
DNA replication after its initial incorporation. This significant difference persists for at
least three days. Differences in the distribution BrdU-labeled DNA between GSCs and
differentiating daughter cells are not likely to be the result of the random segregation of 4
pairs of fly chromosomes into one daughter cell. Randomly occurring cosegregation of
all BrdU-labeled chromatids into one cell has a probability of 0.78%. Following a BrdU-
pulse and thymidine-chase, a >10% lower fluorescence between GSCs and their daughter
cells was noted in 45 / 52 germaria and, of these, a >50% lower fluorescence in 26 / 52
germaria. The occasional observation of even or nearly-even BrdU distribution between
GSCs and their progeny, may be due to the lack of cell division synchrony between these
cells or due to background levels of the BrdU signal – as are observed when BrdU is
92
coinjected with 100-fold higher doses of thymidine (see Fig 2-5B.). We therefore suggest
the differences in BrdU signal are a result of differences in the segregation of BrdU-
labeled DNA between GSC daughters.
GSCs Retain BrdU Following Developmental Exposure
An implication from the ISH is that the same DNA strands should be retained in the
GSCs over long periods of time. The embryonic gonad contains about ~12 primordial
germ cells (PGCs) which expand to a population of ~100 by the middle of the third instar
(Gilboa and Lehmann, 2006). We reasoned that if GSCs were specified between
embryonic and the end of larval development from PGCs, expansionary symmetric
divisions of PGCs in BrdU would label their DNA and would result in detectable
retention of BrdU-labeled DNA in the future adult GSCs. The assumption of this strategy
was that PGCs of larvae raised in BrdU-containing medium would undergo symmetric
divisions before switching to an asymmetric mode of division sometime during the late-
larval to early-pupal stage. After this they would retain BrdU-labeled strands as immortal
strands (Fig 2-3A.).
We attempted to raise wildtype larvae in BrdU medium to pupation, but found that all
pupae died unless larvae were moved at the middle of the 2nd instar to BrdU-free
medium, presumably due to BrdU toxicity. This shorter exposure time resulted in
approximately 50% lethality, but the surviving flies seemed normal. At the 2nd instar, the
population of PGCs is ~60 which represents roughly two population doublings (Gilboa
and Lehmann, 2006). Larval ovaries examined at this stage (Fig 2-3B.) had incorporated
93
Fig 2-3: Chromatids are segregated asymmetrically during asymmetric GSC divisions. (A) Schematic showing BrdU retention strategy. PGC (yellow) possesses four pairs of chromosomes (double strands). All strands in the embryo are unlabeled (black). Following exposure to BrdU, at most all strands will become labeled (green) during multiple symmetric divisions. As the cell begins to divide asymmetrically in the absence of BrdU, GSCs retain labeled chromosomes more frequently than non-GSCs. The ISH predicts an initially labeled GSC (yellow) will retain BrdU signal which is successively diluted in non-GSCs. (B) Confocal section of 2nd instar ovary at the timepoint when larvae are transferred from BrdU-containing medium to fresh BrdU-free medium. All PGCs are marked blue with VASA, BrdU in green, and counterstained nuclei are in red. (C) Confocal section of adult germarium 10 days following BrdU removal. Germ cells are stained for VASA in blue, BrdU in green. Arrow marks position of GSC, nuclei are counterstained in red. Note strong BrdU signal in GSC even at this late timepoint.
94
95
BrdU in 53.6 ± 9.4% of their germ cells (n=5 ovaries sampled). This result suggested
some heterogeneity in cell cycle exists in the larval PGCs.
BrdU-exposed larvae were allowed to complete pupation and were collected at various
timepoints 9-13 days after exposure to BrdU. Even though numerous divisions had
presumably occurred between the 2nd instar and adulthood, we found GSC-labeled
germaria at all timepoints examined (Fig 2-3C.). Using the VASA method of GSC
identification, the number of labeled GSCs was between 17-29% per germarium. The
frequency of BrdU(+) GSCs stayed constant from day 9 up to day 13 following larval
exposure (no significant differences at any timepoint, F3,83=0.4118) (Fig 2-3D.), in
contrast to non-SC germ cells whose frequency significantly declined over this period of
time (F3,83=3.956) (Fig 2-3E.) (n=14 to 40 germaria sampled at each timepoint).
Moreover, the BrdU signal emitted by labeled GSCs is significantly higher than that of
non-GSCs at the 9 day timepoint (n=7 germaria) through to the 13 day timepoint (n=5
germaria) (Fig 2-3F.). We confirmed this observation using the HTS method of GSC
identification and found that at the 10 day timepoint 32.1 ± 8.6% of GSCs were labeled
per germarium (n=14 germaria sampled), similar to the results obtained using the VASA
antibody (compare to 10 day timepoint in Fig 2-3D.). The retention of BrdU label in
GSCs following only two symmetric divisions of these cells in the presence of BrdU and
potentially >9 asymmetric divisions in the absence of BrdU, supports the notion that
labeled ancestral strands are retained in these dividing cells. Indeed the long timespan
over which a nearly unchanging proportion of GSCs retain BrdU is surprising given the
incomplete labeling of PGCs in the 2nd instar ovary. Our observation that 54% of PGCs
96
are labeled at the 2nd instar are consistent with heterogeneity noted in PGCs at early
timepoints (Asaoka and Lin, 2004). It is possible that a subset of GSCs are set aside
during early gonad development and these do not divide to take up BrdU at all or might
divide asymmetrically, thus shedding BrdU-labeled DNA one division after uptake. A
2.7% daily loss of GSCs also has been observed in germaria (Ward et al., 2006) which
might account for the slightly lower, albeit non-significant, number of marked GSCs at
later stages (compare 9 to 13 day timepoint in Fig 2-3D.). These data suggest wildtype
asymmetrically-dividing GSCs retain BrdU preferentially, if and only if it is administered
during their symmetric expansionary divisions.
Since the last population doubling of PGCs in BrdU during the 3rd instar was not assayed
in the above experiment, we placed larvae reared in normal medium into BrdU-
containing medium at the 2nd instar. Flies were collected as above, and it was again noted
that approximately 50% of the animals died. Germaria from the surviving flies were
examined at 9 days following exposure. Unlike our prior results, only 5.0 ± 5.0% of
GSCs retained label in this assay (n=10 germaria sampled). Either GSCs did not divide
symmetrically to take up BrdU at these late larval timepoints, or one symmetric division
in the presence of BrdU was insufficient to result in the retention of BrdU at later
timepoints. This assay reveals that if BrdU is not administered at critical moments during
cell development, the retention of analog in GSCs is not observed and indeed is not
predicted by the ISH.
97
Fig 2-3: Chromatids are segregated asymmetrically during asymmetric GSC divisions. (D) Graph shows proportion of labeled GSCs per germarium at 9 (n=55 germaria), 10 (n=15 germaria), 11 (n=15 germaria) and 13 days (n=14 germaria) following BrdU removal. There is a slight but non-significant decrease in the frequency of labeled GSCs (~10%) between day 9 and day 13. (E) Graph shows proportion of BrdU labeled VASA(+) non-GSCs, per germarium at 9 (n=55 germaria), 10 (n=15 germaria), 11 (n=15 germaria) and 13 days (n=14 germaria) following BrdU removal. (F) Quantification of BrdU signal emitted from GSCs versus closest 10 non-GSCs in germaria. Graph shows the percentage decrease in signal emitted by germ cell progeny relative to stem cell founders. Asterisks indicate that BrdU signal is significantly higher signal in GSC nuclei at 9 days (t = 46.37, df = 6, p<0.05) as well as at 13 days (t = 27.98, df = 4, p<0.05). Quantifications were established from germaria containing BrdU positive GSCs (n=7 germaria sampled at 9 day timepoint, and n=5 germaria sampled at 13 day timepoint). Error bars for GSCs are high because we include all BrdU(+) and BrdU(-) germ cells in these analyses, even though only 50% of PGCs are labeled at the 2nd larval instar.
98
99
Asymmetric DNA Partitioning is Coupled to Asymmetric GSC Divisions
GSCs are maintained in an undifferentiated state by the BMP family member
Decapentaplegic (Dpp) (Xie and Spradling, 1998) released by cap cells. Dpp signaling
causes the phosphorylation of Mothers against Dpp in GSCs which, in turn, activates the
transcription of genes involved in cell division and fate of these SCs. The over-expression
of Dpp is thus thought to maintain germline cells in an undifferentiated SC-like state
throughout the germarium (Kai et al., 2005). We performed our BrdU / thymidine
injections on pupae overexpressing Dpp, whose germaria develop into large cysts of
undifferentiated and continuously proliferating germline cells. 24 hours following BrdU
injection all Dpp overexpressing germline cells were equivalently labeled (n=4 germaria
sampled; data not shown). Interestingly, 24 hours following thymidine infusion the
germaria of these mutants showed the similar BrdU signal among the GSCs versus the 8
closest germline cells (Fig 2-4A.). Quantification confirmed that the equivalence present
among germ cells at 24 hours BrdU pulse, persisted following 24 hours thymidine chase
(Fig 2-4B.) (n=9 germaria sampled). This suggested that asymmetry in chromatid
segregation is dependant on the presence of the localized, cell-extrinsic Dpp signaling
pathway.
We sought to test these mutants using the BrdU Retention assay described above. c587-
Gal4 X UAS-Dpp transgenic stocks were raised in BrdU-containing medium to the
middle of the 2nd instar, transferred to BrdU-free medium, and recovered 9 days
following BrdU exposure. It was noted that no significant differences existed between the
percentage of BrdU(+) cells at the GSC position and GSC-like cells elsewhere in the Dpp
100
Fig 2-4: Chromatid cosegregation is abolished during symmetric divisions and in non-GSCs. (A) Confocal sections from the Pulse-Chase experiment in the context of Dpp overexpression. Section shows c587-Gal4; UAS-Dpp germarium dissected 48 hours following BrdU injection and 24 hours following thymidine chase. All germ cells, marked blue with VASA, are labeled for BrdU in green. Arrows indicate position of GSC. (B) Results of the Pulse-Chase experiment in the c587-Gal4; UAS-Dpp line. Dpp overexpressing germ cells emit equivalent fluorescence following thymidine infusion. In an environment where Dpp maintains all germ cells in an undifferentiated GSC-like state, we observed no significant differences (p>0.05) among any germ cells present in these mutants. The term “GSC Nuclei” refers to nuclei of cells at GSC position, and “Cyst Nuclei” refers to the closest 8 other germ cell nuclei although all are undifferentiated. Quantifications were established from two separate experiments (n=9 germaria sampled in total). (C) Results of the BrdU Retention experiment in the c587-Gal4; UAS-Dpp line. Graph shows proportion of BrdU(+) nuclei at GSC positions as compared to GSC-like nuclei throughout the Dpp overexpressing germarium at the 9 day timepoint (n=14 germaria). “GSC” refers to nuclei of cells at GSC position, and “non-GSC” refers to other GSC-like nuclei, although all are undifferentiated. Frequency of labeled germ cells were normalized relative to that of wildtype GSCs at day 9 (see Fig 2E.). There are no differences in BrdU retention between wildtype non-GSCs and any germ cells in the Dpp overexpressing germarium (p>0.05).
101
102
overexpressing germarium (Fig 2-4C.) suggesting that ectopic Dpp exerts an effect on
asymmetric BrdU distribution (n=14 germaria sampled). Moreover, the percentages of
labeled GSC-like cells in the c587-Gal4 X UAS-Dpp germaria were similar to non-GSCs
in wildtype germaria, showing that the average probability of a symmetrically dividing
GSC to retain BrdU following exposure is 8-13% (Fig 2-4C.).
Asymmetric DNA Partitioning Occurs in GSCs but not Other Germline Cells
Expression of Bag of Marbles (Bam) protein is suppressed by Dpp signaling in GSCs and
Bam is required for differentiation in cystoblast daughters exiting the stem cell niche
(Chen and McKearin, 2003; Ohlstein et al., 2000). Thus the overexpression of Bam by
heat shock has been shown to empty the germarium and GSC niche by forcing all
germline cells to differentiate via symmetric divisions (Ohlstein and McKearin, 1997).
We predicted that differentiating cystoblasts and cystocytes would not segregate
chromatids asymmetrically as opposed to GSCs. We tested the uneven segregation of
BrdU labeled DNA in two different strains of flies containing heat-inducible Bam
transgenes. Pupae were heat shocked 24 hours prior to BrdU injection, and were injected
in a state where GSCs and their progeny were differentiating under the control of ectopic
Bam expression. At the 24 hour post BrdU infusion timepoint, all germ cells from
P[hsp70-bam]11d flies (n=5 germaria sampled) and P[hsp70-bam]18d (n=5 germaria
sampled) flies were equally labeled for BrdU (data not shown). However following 24
hours thymidine chase, again no asymmetry in BrdU signal was observed in the P[hsp70-
bam]11d mutant germaria (n=7 germaria sampled) (Fig 2-4D. and 2-4E.) nor in the
P[hsp70-bam]18d strain germaria (n=6 germaria sampled) (Fig 2-4F.).
103
Next, the Bam overexpressing germaria were examined by the BrdU Retention assay.
P[hsp70-bam]18d larvae were raised on BrdU as above, and heat shocked two days prior
to examination at day 9 following BrdU removal (Fig 2-4G.). While non-heat shocked
P[hsp70-bam]18d demonstrated identical frequencies of BrdU(+) GSCs versus non-
GSCs as the wildtype strain (data not shown), heat shock reduced the frequency of
labeled cells at the GSC position to the same level as labeled germ cells anywhere in the
germarium (Fig 2-4G.). These data show that asymmetric DNA partitioning occurs only
in GSCs and not all germline cells. These data indicate that asymmetric chromatid
partitioning does not occur in differentiating germ cells, but only in asymmetrically
dividing GSCs.
Asymmetric DNA Partitioning is Dependant on the Plane of Division of GSCs
The plane of GSC division is, in part, influenced by asymmetric segregation of the
spectrosome and its associated protein, HTS (Deng and Lin, 1997). Following a 24 hour
BrdU pulse, it was noted that unlike the other lines thus far, not all germ cells took up
BrdU. This suggested in the absence of HTS protein, the cell cycle of GSCs and non-
GSCs is slower which accounts for the increase in labeled non-GSCs in the retention
experiments carried out on these lines. We therefore carried out the BrdU quantification
analysis on only the labeled GSCs and non-GSCs within each germarium. At 24 hours
BrdU exposure, the closest 8 non-GSC germ cell nuclei emitted 0.96±0.19 of the signal
in GSCs (n=5 germaria sampled, p>0.05, data not shown). This equivalence persisted so
that following BrdU pulse and 24 hour thymidine chase, non-GSC nuclei emitted
104
Fig 2-4: Chromatid cosegregation is abolished during symmetric divisions and in non-GSCs. (D) Confocal sections from the Pulse-Chase experiment in differentiating GCs. Section of w; P[hsp70-bam]11d germarium dissected 48 hours following BrdU injection and 24 hours following thymidine chase. (E) Results of the BrdU Pulse-Chase experiment in the c587- w; P[hsp70-bam]11d line. Following thymidine chase w; P[hsp70-bam]11d germ cells display equivalent fluorescence. As Bam overexpression forces all germ cells to differentiate into cystocytes, no significant differences (p>0.05) were observed among germ cell nuclei present. “GSC Nuclei” refers to nuclei of cells closest to cap cells and “Cyst Nuclei” refers to the next closest germ cell nuclei. Quantifications were established from n=7 germaria sampled in total. (F) Results of the BrdU Pulse-Chase experiment in the P[hsp70-bam]18d line. A similar phenotype to w; P[hsp70-bam]11d is observed in P[hsp70-bam]18d germ cells at 48 hours following BrdU pulse and 24 hours following thymidine infusion. Again, we observed no significant differences (p>0.05) in BrdU signal among mutant germ cell nuclei present. Quantifications were established from n=6 germaria sampled. (G) Graph shows BrdU(+) germ cell frequency in the P[hsp70-bam]18d strain with and without heat shock. “GSC” refers to nuclei of cells closest to GSC position, and “non-GSC” refers to other germ cell nuclei, although all are differentiating. Frequencies of labeled cells were normalized relative to that of non-heat shocked control GSCs. Upon heat shock, administered at day 6 following BrdU removal, BrdU(+) nuclei at GSC position decrease to the same levels as all non-GSCs and as those in wildtype germaria (p>0.05).
105
106
0.81±0.13 of the average signal within the GSCs per germarium (n=9 germaria sampled,
p>0.05, data not shown).
Next, HTS1/Wt and their HTS1/ HTS1 siblings were assayed using the BrdU Retention
assay to quantify the proportions of labeled germ cells. However in HTS1/Wt control flies,
GSCs were labeled at an equal frequency to non-GSCs in day 9 germaria unlike the
previous control lines examined thus far. Indeed, the frequency of labeled germ cells was
much higher in these in HTS1/Wt control flies (data not shown) again confirming that the
cell cycle of GSCs and non-GSCs in this strain was reduced during development. As
BrdU retention could not be tested using this assay, it is sufficient to note that the Pulse-
Chase results show that chromosome segregation is reduced when the plane of GSC
division is randomized.
Discussion
We find evidence to support the segregation of ancestral DNA to GSCs of Drosophila
melanogaster in vivo. Two separate lines of evidence, the pulse-chase strategy and the
retention strategy, do not falsify the ISH.
In the pulse-chase experiments, GSCs, cystoblasts and cystocytes take up equivalent
amounts of BrdU during 24 hours. Following a 24 hour thymidine chase, BrdU is lost in
GSCs but not cystoblasts. If DNA is segregated randomly, differences between GSCs and
107
their daughter cells should not be observed among the germ cells of the Drosophila
germarium. However, this very difference is predicted by the ISH because GSCs divide
asymmetrically in the pupa, thus incorporating and shedding BrdU during successive
divisions. Conversely, the BrdU retention strategy demonstrates a striking retention of
labeled DNA strands in the GSC lineage when BrdU is administered at early larval
stages. This is consistent with the ISH because expansionary GSC divisions in BrdU
cause GSCs to select BrdU-labeled strands as ancestral strands, to be retained during later
asymmetric divisions when BrdU is no longer present. The late larval ovary is thought to
develop a niche similar to that of the adult (Gilboa and Lehmann, 2004) which implies
that GSCs divide asymmetrically at later larval stages. Our examination of germaria
when larvae are placed on BrdU during the 2nd to 3rd instar, suggests that GSCs do not
retain BrdU when exposed at this time. We thus conclude that the asymmetric
segregation of chromosomes only occurs in conditions when GSCs divide
asymmetrically. Strictly speaking, the ISH presupposes that all ancestral strand bearing
chromosomes are cosegregated. However, it remains possible that only a subset of the 4
pairs of chromosomes is selectively retained in GSCs.
The incorporation of BrdU into DNA has been shown to affect the physical nature of
DNA strands resulting in possible alterations in protein-DNA binding (David et al.,
1974), increases in the radiosensitivity of DNA (Dewey et al., 1966) and increases in
sister chromatid exchange (Taguchi and Shiraishi, 1989). In all germaria examined in our
studies, animals were viable and germline cells and follicles (of non-mutants) appeared
normal. However, we note the toxicity of this analog when larvae are raised in it for
108
extended periods. Increased DNA strand exchange or increased DNA repair cannot
explain our results as these would only reduce rather then magnify the differences we
report between GSCs and their progeny. If additional exchanges between BrdU-labeled
and unlabeled DNA occur, these offer another reason why the loss of BrdU signal is
incomplete in GSCs in the BrdU pulse-chase experiments and why not all GSCs are
found labeled in the retention experiments.
GSCs forced to undergo terminal differentiation fail to segregate DNA asymmetrically.
In these conditions, brought about by using heat-inducible Bam – germ cells appear to
undergo normal random DNA segregation. These results demonstrate that asymmetric
DNA segregation does not occur in all germ cell progenitors but is a feature unique to
GSCs in this system. In conditions of indiscrete daughter cell identity, brought about by
Dpp overexpression – GSCs divide symmetrically to produce two SC daughters and the
uneven segregation of DNA between daughter GSC and daughter cystoblast does not
occur. This suggests that asymmetry in chromatid segregation is coupled to mechanisms
specifying cell division asymmetry in GSCs.
GSCs are maintained in an undifferentiated state by proximity to Dpp signaling sources
(Xie and Spradling, 1998; Chen and McKearin, 2003). Is there evidence to think that the
divisions of GSCs are intrinsically asymmetric as well? Localization of the DE-Cadherin
protein (Song et al., 2002b) between GSCs and cap cells, promotes GSC contact with
regions high in Dpp. It has been proposed that the Drosophila orthologues of
adenomatous polypsis coli tumour suppressor protein tether microtubules to the cadherin
109
complex that maintains fixed spindle orientation of GSCs in the fly testes (Yamashita et
al., 2003) and it has been shown these GSCs segregate new and old centrosomes
(Yamashita et al., 2007) to the gonialblast and GSC, respectively. Additionally, female
GSCs seem to segregate spectrosome (de Cuevas and Spradling, 1998) organelles
unevenly between GSC and cystoblast daughter cells; and data show that the plane of
GSC division is, in part, directed by asymmetric segregation of the spectrosome and its
associated protein, HTS(Deng and Lin, 1997). We suggest that asymmetric segregation of
DNA demonstrates another example of intrinsic partitioning of molecules that correlate
with asymmetric germline cell divisions in vivo. We predict that mutants for the HTS
protein, whose GSC divisions are randomized from their normal plane (Deng and Lin,
1997), also may subsequently randomize the asymmetric segregation of ancestral strand
bearing chromosomes.
The partitioning of intracellular components does not fully commit a non-SC daughter to
differentiate, given reports that early SC progeny are competent to revert into SCs by
dedifferentiation mechanisms (Brawley and Matunis, 2004; Kai and Spradling, 2004).
Such findings show that asymmetric partitioning of the spectrosome and its associated
proteins, HTS and Bam do not invariably determine cystoblast fate (de Cuevas and
Spradling, 1998; Deng and Lin, 1997). Yet it is possible that in contexts where SC-
progeny dedifferentiation is observed (Brawley and Matunis, 2004), intrinsic cell division
asymmetry is restored and that intrinsic partitioning of components is reset. It is possible
that proximity to sources of ligands, such as Dpp, polarizes GSCs in order to carry out the
asymmetric segregation of organelles and molecules. Hence, ancestral DNA template
110
retention might not irreversibly commit GSC fate, but the reselection of ancestral strands
may occur during the reversion of germ cell progeny into GSCs were dedifferentiation to
occur in GSC progeny.
Studies on mouse cells (Karpowicz et al., 2005; Lark et al., 1966; Merok et al., 2002;
Potten et al., 2002; Potten et al., 1978; Smith, 2005; Shinin et al., 2006), mollusks
(Tomasovic and Mix, 1974), fungi (Rosenberger and Kessel, 1968) and plants(Lark,
1967) show that chromatid cosegregation may occur in a wide variety of organisms,
although C.elegans has been shown to not retain ancestral DNA strands (Ito and
McGhee, 1987). Our findings that insect GSCs demonstrate non-random chromatid
segregation in vivo, adds to this diversity. Recent reports have shown that in mouse cells,
differentiation programmes are correlated with non-random segregation of sister
homologues (Armakolas and Klar, 2006). Such findings are similar to those observed in
yeast (Dalgaard and Klar, 2001), in the sense that both occur during phases of cellular
differentiation mediated by cell division asymmetry. Similarly we find that when
differentiation via self-renewing asymmetric division does not occur, non-random
chromatid segregation is abolished. In line with these studies, we hypothesize that
asymmetric DNA segregation may be a universal mechanism to promote or repress genes
expressed by particular chromosomes whose presence is involved in the generation of
discrete cell types.
111
Fig 2-5: Quantifications of GSC, cystoblast and cystocyte nuclear BrdU signals. (A) Shown are five representative quantifications of germaria at 24 hours following BrdU infusion. Graphs show fluorescence signals (arbitrary units) emitted by germ cells. In all cases, GSCs, cystoblasts and cyst nuclei emit equivalent fluorescence (p>0.05). These types of quantifications were averaged in Fig. 2. (C). (B) Shown are five representative quantifications of germaria at 24 hours following BrdU plus Thymidine infusion. Graphs show fluorescence signals (arbitrary units) emitted by germ cells. Thymidine is present at 100 fold higher stoichiometry than BrdU, resulting in a lower signal intensity emitted by all cells (compare Supplementary Fig 1.b. with Supplementary Fig 1.a.). Indeed, using the same detection settings on the confocal microscope, we assayed the drop in fluorescence emitted from samples infused with BrdU alone, or BrdU in conjunction with thymidine. GSCs pulsed with BrdU alone were found to have 2.3 times greater signal than that emitted by GSCs pulsed with BrdU + thymidine, meaning that the signal emitted by BrdU/thymidine infused GSCs was around 40% of that emitted by GSCs infused with BrdU alone (n=15 germaria sampled in total). (C) Shown are five representative quantifications of germaria 48 hours following BrdU pulse and 24 hours following Thymidine chase. Graph shows fluorescence signals (arbitrary units) emitted by germ cells. After Thymidine infusion, fluorescence signal drops significantly in GSCs but not in cystoblasts and cyst nuclei (t = 7.363, df = 40, p<0.05). Indeed GSCs pulsed with BrdU and chased with thymidine have no significant differences in fluorescence signal compared to those co-injected with BrdU plus thymidine (p>0.05). These types of quantifications were averaged in Fig. 2. (D).
112
113
Fig 2-6: GSCs, cystoblast and cystocyte nuclei possess no differences in antibody accessibility. Histone signal emitted by germ cell progeny as normalized to stem cell founders. There are no significant differences (p>0.05) in histone intensity between GSCs and their progeny (n=12 germaria sampled from three separate experiments). Nuclei also possess no significant size differences (not shown).
114
115
Chapter IV.
Cadherin Mediation of Cellular Contribution but Not Differentiation
116
This chapter has been published: Phillip Karpowicz, Tomoyuki Inoue, Sue Runciman,
Brian Deveale, Raewyn Seaberg, Marina Gertsenstein, Lois Byers, Yojiro Yamanaka,
Sandra Tondat, John Slevin, Seiji Hitoshi, Janet Rossant, Derek van der Kooy. Adhesion
Is Prerequisite, But Alone Insufficient, to Elicit Stem Cell Pluripotency. Journal of
Neuroscience. 2007 May 16; 27(20): 5437-47.
Summary
Primitive mammalian NSCs, arising during the earliest stages of embryogenesis, possess
pluripotency in embryo chimera assays in contrast to definitive NSCs found in the adult.
We hypothesized that adhesive differences determine the association of stem cells with
embryonic cells in chimera assays, and hence their ability to contribute to later tissues.
We show that primitive NSCs and definitive NSCs possess adhesive differences, due to
differential cadherin expression, that lead to a double dissociation in outcomes following
introduction into the early- versus mid-gestation embryo. Primitive NSCs are able to sort
with the cells of the inner cell mass and thus contribute to early embryogenesis, in
contrast to definitive NSCs which cannot. Conversely, primitive NSCs sort away from
cells of the E9.5 telencephalon and are unable to contribute to neural tissues at mid-
embryogenesis, in contrast to definitive NSCs which can. Overcoming these adhesive
differences by E-Cadherin overexpression allows some definitive NSCs to integrate into
the inner cell mass but is insufficient to allow them to contribute to later development.
These adhesive differences suggest an evolving compartmentalization in multipotent
117
NSCs during development, and serve to illustrate the importance of cell-cell association
for revealing cellular contribution.
Introduction
Neural stem cells (NSC) arise during the earliest stages of embryonic development and
persist in the mouse into adulthood (Fig 3-1.). Leukemia Inhibitory Factor (Lif)
dependent primitive-NSCs can be derived from embryonic stem cells (ESC) or dissected
from the early epiblast (Hitoshi et al., 2004; Tropepe et al., 2001). These give rise to
Fibroblast Growth Factor (FGF) dependent NSCs which, in turn, give rise to Epidermal
Growth Factor (EGF) dependent NSCs, and both of these can be derived from germinal
regions of the brain throughout the lifetime of the animal (Chiasson et al., 1999;
Morshead et al., 1994). This characterized lineage suggests that primitive-NSCs, whose
repertoire of descendants includes FGF and EGF dependents, would be thus more potent
than their progeny. Indeed, like ES cells, primitive-NSCs can differentiate into all three
germ layers suggesting they retain properties of earlier pluripotent cells (Tropepe et al.,
2001), whereas adult NSC progeny demonstrate functional contribution when injected
into the forebrain ventricles of adult mice (Herrera et al., 1999).
Several studies have indicated that SCs arising in later developmental periods may have
pluripotency approaching that of the earliest pluripotent cells. The assessment of potency
or transdetermination has been a straightforward categorization of the progeny of cells by
118
Fig 3-1: The Neural Stem Cell Lineage. Beginning at E5.5, Lif-dependent primitive-NSCs (yellow) arise from the early epiblast and transition into FGF-dependent definitive NSCs by E8.5 (red). These, in turn, give rise to EGF-dependent definitive NSCs (blue) at timepoints past E13.5, and both definitive NSC types continue to self-renew for the lifetime of the animal.
119
120
their expression of lineage markers. It has been argued that blood SCs are competent to
produce a variety of non-hematopoietic cell types (Krause et al., 2001) including neural
cells (Brazelton et al., 2000; Mezey et al., 2000). In addition, adult NSCs have been
claimed to contribute to blood cell types (Bjornson et al., 1999) as well as endothelial
cells (Wurmser et al., 2004). These data are remarkable as such cell types are sequestered
from their respective germ layers early in embryonic development. Some studies have
gone so far as to suggest a generalized pluripotency to adult NSCs (Clarke et al., 2000),
and SCs derived from the adult bone marrow (Jiang et al., 2002) rivaling that of ESCs.
However, the contribution of adult NSCs to early embryogenesis has not been replicated
(Tropepe et al., 2001; D'Amour and Gage, 2003; Greco et al., 2004), and the claims of
plasticity of blood SCs have been cast into doubt (Wagers et al., 2002). In particular it is
now known that cellular fusion events may confound these reports of potency (Terada et
al., 2002; Ying et al., 2002; Wang et al., 2003; Alvarez-Dolado et al., 2003). Thus it
remains unclear whether SCs can retain pluripotency into the adult stages of the life cycle
of the animal.
A confounding factor in studying plasticity is the correct association of SC with a tissue,
via compatible cell adhesion pathways. In transplantation assays into adult and
embryonic hosts used to assess SC potency, cells are assumed to persist in the tissues into
which they are transplanted, so that comparative assessment of contribution from
different cell types is solely a product of the ability of SCs to generate multiple
differentiated cell types. However, the role of cell-cell association via adhesion is an
understood mechanism in the compartmentalization and morphogenesis of tissues during
121
development (Edelman, 1984; Takeichi, 1995). Molecular adhesion is responsible for the
sequestration of cells into different tissue germ layers and the intercellular affinity of
cells within a tissue. The differential adhesion of cells via cell adhesion molecules results
in the sorting of cells into thermodynamically favorable structures (Foty and Steinberg,
2005) which maximize both homophilic adhesions over heterophilic adhesions (Nose et
al., 1988), and stronger homophilic adhesions over weaker ones (Steinberg and Takeichi,
1994). In this way, cells are sequestered into distinct compartments of the embryo,
sometimes corresponding to distinct molecular programmes between the cells in these
regions (Matsunami and Takeichi, 1995; Inoue et al., 2001). Therefore it is formally
possible that a pluripotent SC might possess the ability to produce multiple cell types
within a compartment provided it remains in association with that compartment. Both
studies suggesting plasticity and those failing to report plasticity, mentioned above
(Bjornson et al., 1999; Brazelton et al., 2000; Mezey et al., 2000; Clarke et al., 2000;
Tropepe et al., 2001; Wagers et al., 2002; Jiang et al., 2002; D'Amour and Gage, 2003;
Greco et al., 2004) have in no case taken into account cell sorting phenomena in the
interpretation of their results.
We hypothesized that that SC pluripotency declines as ontogeny advances. Primitive-
NSCs were predicted to possess greater potency than Adult NSCs. However, adult FGF-
dependent NSCs and those derived from the E9.5 embryo were predicted to possess
equivalent potency, because adult FGF-dependent NSCs persisting in the adult were self-
renewing progeny arising at E9.5 and maintained as such in the adult. Our results confirm
these predictions. We further predicted that adhesion-mediated compartmentalization is
122
necessary to elicit SC contribution. This was is indeed the case, as early NSCs with the
potency to generate neural lineages in vitro were unable to do so if introduced into the
brain compartment without a prerequisite associative ability. In contrast, adult and mid-
embryonic NSC types are able to contribute in these same assays. When introduced into
pre-implantation stage embryos, it is now the early NSCs that are able to associate and
thus contribute, while the later NSCs, as well as SCs isolated from the adult retina,
cannot. Overcoming such adhesive discrepancies by the overexpression of the
appropriate adhesion protein is, however, insufficient to overcome this dearth of
contribution. Adult NSCs who are experimentally induced to integrate with the inner cell
mass of the pre-implantation embryo, via E-Cadherin overexpression, are nonetheless
unable to contribute to early embryogenesis. These results suggest that appropriate cell-
cell adhesion is necessary to allow NSCs to demonstrate their differentiative potential in
vivo. However, restriction of potency is not directly related to restriction in cell adhesive
interactions, but a fundamental property of maturing NSCs. We thus suggest that
adhesion and potency mechanisms exist as parallel but discrete programmes in NSCs
during development.
Materials and Methods
Dissection and Cell Culture: CD1 mice, CFP mice, eYFP mice or embryos, or dsRed-
MST mice were dissected and their NSCs cultured as previously described: 1) for E9.5
embryonic forebrain ventricles (Tropepe et al., 1999); 2) for adult mouse forebrain
ventricles (Reynolds et al., 1992; Morshead et al., 1994); 3) for primitive-NSCs (Tropepe
123
et al., 2001); and 4) for retinal SCs (Tropepe et al., 2000). Cells were grown for one week
before use. R1 or eYFP ESCs were grown on mitotically inactivated fibroblasts as
previously described (Nagy et al., 2002).
Cell Sorting Assays: Cells were dissociated mechanically, except ESCs which were
dissociated using trypsin as described (Nagy et al., 2002). Two populations of interest
were mixed in equal parts at a total density of 300 cells/μL in media containing growth
factors needed for the survival of both groups of cells used. 1mL of such cell suspensions
were cultured in 24 well plates (Nunclon) on a shaker at 37oC, overnight. Telencephalic
E9.5 cells were dissected immediately preceding cell sorting as described (Tropepe et al.,
1999). Aggregates were examined by fluorescence microscopy 1 hour following mixing
to confirm random distribution of cell populations. Aggregates were then examined after
overnight incubation.
Embryoid Bodies: Adult NSC colonies and ESCs were cocultured in equal parts using
the hanging drop embryoid body formation technique (Dang et al., 2002). Briefly, 30,000
cells were aggregated in 15% fetal calf serum (Hyclone) as hanging drops for 2 days.
Aggregates were then cultured at 37oC, on uncoated plates (Falcon) using a shaker, for an
additional 2 to 5 days. Aggregates were collected and allowed to settle to the bottom of
conical test tubes (Falcon) by gravitation prior to fixation using 2% paraformaldehyde
(Sigma) dissolved in cold Stockholm’s phosphate buffered saline (pH 7.3). Aggregates
were then washed 3 X 10mL Stockholm’s and equilibrated in 30% w/v sucrose (Sigma)
124
at 4oC. Samples were then embedded in cryoprotectant and sectioned on a Jencon’s
OTF5000 cryostat at 15 micron thickness.
Chimeras: Cells were centrifuged at 1,500rpm and resuspended in ~1mL of serum free
media. Cells were dissociated mechanically into a single cell suspension and counted on a
hemocytometer. Cells were reconstituted at 5-20,000 cells/μL for blastocyst injections or
50-100,000 cells/μL for ultrasound guided injections. Morula aggregations, carried out
using 3 day colonies of cells, and blastocyst injections were carried out as described
(Nagy et al., 2002), using ICR host morula and ICR pseudo-pregnant recipients. E9.5
chimeras were carried out essentially as those described (Slevin et al., 2006), using high
frequency ultrasound microscope Veve-660TM with 40 MHz probe (Visualsonics). For
each assay, 14-69nL of serum free media containing 1,400-14,000 cells were injected
directly into the telencephalic ventricle of E9.5 embryos. Following each procedure, the
embryos of one pregnant dam were sacrificed and dissected to confirm the presence of
injected cells in the telencephalon 1-2 hours after injection. Since the brain is one
continuous tube at this timepoint, random cell leakage throughout the forebrain and
sometimes into mid and hindbrain regions was unavoidable.
Plasmid Construction and Retroviral Infection: The pMXIE retroviral construct has
been described (Hitoshi et al., 2002a). To generate the pMXIE-E-Cadherin construct,
Human E-cadherin cDNA was amplified by PCR in 50μL volume consisting of 1 μM of
sense (5'-CCCTCGCTCGAGGTCCCCGGCCCAG-3') and antisense (5'-
CCTCTCTCGAGATCTCTAGTCGTCCTCG-3') primers, 2.5 mM Mg2+, 0.3 mM dNTP,
125
1μL of TaKaRa LA Taq polymerase (TaKaRa) and pLKpac1 Human E-Cadherin plasmid
(a gift from Dr. Reynolds) as a template. PCR parameters included, denaturation at 95ºC
for 30 seconds, annealing at 60ºC for 60 seconds and extension at 72ºC for 180 seconds
for 20 cycles. The amplified DNA fragments were digested with XhoI and BglII and
ligated to the XhoI-BamHI site of the pMXIE retroviral vector plasmid. 100,000 cells
were exposed to virus at a ratio of 10 virus particles to 1 cell in the presence of 5 ng/μL
hexadimethrine bromide (Sigma). Cells were incubated with retrovirus in 250μL cell
culture media (containing EGF and FGF) for 90 minutes while being centrifuged at
1000rpm at room temperature. Cells were then resuspended, recounted and plated as
described above. Prior to use, colonies were examined to confirm retrovirus integration
and transgene expression by fluorescence microscopy. Only GFP(+) colonies were
picked for use in morula aggregations.
Quantitative PCR: Messenger RNA was extracted using the RNeasy Microkit (Qiagen).
1.0ug of RNA was converted to cDNA using oligo dT20 (Invitrogen) and Superscript III
Reverse Transcriptase (Invitrogen). Real-time PCR reactions were run using SYBR
Green (Applied Biosystems), and analyzed using the ABI Prism 7000 sequence detection
system. Cadherin levels were determined using the comparative CT method with GapDH
as reference. Primer pairs sequences used were: Cdh1 forward –
TCATTTTGCAACCAAGAAAGGA, reverse – CCGCGAGCTTGAGATGGA; Cdh2
forward – TCTGTTCCAGAGGGATCAAAGC, reverse –
TTGGATCATCCGCATCAATG; Cdh3 forward – GCCAGGACTCTGAAGTTTGC,
126
reverse – CAAGTTCAAGCCCTGAGAGG; GapDH forward –
CACACCGACCTTCACCATTT T, reverse – GAGACAGCCGCATCTTCTTGT.
Embryo and Pup Dissection: Embryos and pups were fixed using 2% paraformaldehyde
(Sigma) dissolved in cold Stockholm’s phosphate buffered saline (pH 7.3). E10.5
embryos were fixed for 1 hour at room temperature on a shaker. E12.5 embryos were
fixed for one hour on a shaker, then bisected sagitally and fixed for an additional hour at
room temperature on a shaker. E13.5 embryos were decapitated, heads fixed for one hour
on a shaker, then bisected sagitally and fixed for an additional hour at room temperature
on a shaker. Pnd1 pups were anaesthetized with isofluorane gas, and perfused with 2mL
Stockholm’s and 2mL 2% paraformaldehyde. Brains were then dissected from cranium
and further fixed in 2% paraformaldehyde overnight. Embryos and pups were immersed
in Stockholm’s containing, 30% w/v sucrose (Sigma) until equilibrated at 4oC. A mixture
of 30% sucrose and cryoprotectant (Thermo Electron Corporation) was then applied for
24-48 hours to each sample on a shaker at 4oC. Samples were then embedded in
cryoprotectant and sectioned on a Jencon’s OTF5000 cryostat at 15 micron thickness.
Immunofluorescence and Microscopy: Sections or embryos were washed 3 X 10
minutes with Stockholm’s PBS plus 0.3% Triton detergent (Sigma). Sections were then
blocked using 1% bovine serum albumin (Sigma) + 10% normal goat serum (Sigma) in
Stockholm’s, pH 7.3, 0.3% Triton (Sigma) for 60 minutes at room temperature. Primary
antibodies were applied overnight in Stockholm’s, 1.0% NGS, 0.3% Triton. Anti-Nestin
(Chemicon, 1:1000), anti-β-tubulin isotype III (Sigma, 1:500), anti-HNF3-β (Hybridoma
127
Bank, clone 4C7, 1:100), anti-Brachyury (Santa Cruz, 1:200), and anti-glial fibrillary
acidic protein (Sigma, 1:400) were used. Sections were washed 3 X Stockholm’s and
blocked again using the same conditions above. Secondary antibodies were applied at
37oC for 2 hours in StPBS 1.0 % normal goat serum. Goat-anti-Mouse or Goat-anti-
Rabbit 568nm Alexa Fluor antibodies (Molecular Probes, 1:300) were used as
appropriate. Nuclei were counterstained with 10 ug/mL Hoechst 33258 (Sigma). Cells
were photographed in Stockholm’s or serum free media; embryos in Dulbecco’s; and
sections mounted and coverslipped using Gel Mount (Biomeda Corp.). Embryo
photographs were taken under 1X/0,75 (dry lens) objective using a MZFLIII Leica
microscope with a Nikon CoolPI 3.34 mexapixel digital camera mount. Section
photographs were taken under 40X/0,55 (dry lens) objective using a 40X/0,60 Olympus
IX81 inverted microscope with the Olympus Microsuite Version 3.2 Analysis imaging
system software (Soft Imaging Systems Corp.). Confocal photography was undertaken
with a Leica TCS2 confocal microscope with Leica HC PL APO 20X/0,70 objective; pin
hole at Airy unit 1; with confocal sections taken approximately every 5 microns. All
photos were processed using Adobe Photoshop 6.0 software.
Fluorescence Activated Cell Sorting: Cells were sorted on FACS DiVa (Becton-
Dickenson Biosciences) system. Cells were sorted at approximately 9000 events per
second, and fractions were kept on ice until plated. At the outset of each experiment, CD1
(GFP-negative) adult neurosphere cells and GFP transgenic adult neurosphere cells
served as negative and positive controls, respectively, to set the gates for cell sorting.
Collected cells were allowed 1 day to recover from sorting, at normal growth conditions.
128
Fluorescence microscopy confirmed the positivity of retrovirus infected cells just prior to
use. To confirm E-Cadherin presence, retrovirus infected cells were dissociated
mechanically and blocked for 30min at 37oC, in Dulbecco’s PBS (pH 7.3) + 10% normal
goat serum (Sigma). Cells were then exposed to 2μg/mL primary anti-E-Cadherin
antibody ECCD2 (Zymed, 1:500), in 1mL Dulbecco’s + 3% goat serum for one hour at
37oC. Cells were then washed 2 X 10mL Dulbecco’s, and exposed to Goat-anti-Mouse
633nm Alexa Fluor antibody (Molecular Probes, 1:300) for an additional hour in the
same conditions as the primary. Cells were then washed 2 X 10mL Dulbecco’s and
sorted. ESCs served as positive controls to confirm the efficacy of the E-Cadherin
antibody.
Results
In Vitro Cell Sorting Assays Reveal Adhesive Differences Between SCs
Cell to cell adherence can be directly compared by coculturing two types of cells at high
density overnight (Foty and Steinberg, 2005). Though initially randomly assorted in
aggregates, each cell type will sort in such a way that minimizes free adhesive surface
proteins, and maximize the strongest protein-to-protein contacts. Additionally, cells with
very weak affinity, might completely sort away from one another if adhesive forces
holding them together are insufficient. Aggregates examined using this method were
scored according to the qualitative categories shown (Table 1.).
129
Table 1: Results of cell sorting assays. Labeled target cells were mixed with unlabeled cell as in equal portions. Cellular aggregates were examined following overnight incubation and scored into categories as depicted in table: A) Target cells within host cells, a sphere-within-sphere configuration; B) Target cells completely outside host cells, a reverse sphere-within-sphere configuration; C) Most target cells peripheral to host cells, but some target cells within central regions; D) Complete sorting out, in which target and host cells possess little adherence; E) Random sorting process, a complete mottling of target and host cells. Brackets indicate percentages of aggregates scored in these categories.
Table 1. Cell Sorting Assay
Target Cells
A
B
C
D
E
Total Aggregates
Assayed
Embryonic SC + E9.5 Dissected Germinal Cell
82 (85%)
14 (15%)
96
Primitive NSC + E9.5 Dissected Germinal Cells
64 (100%)
64
E9.5 NSC + E9.5 Dissected Germinal Cells
59 (100%)
59
Adult NSC + E9.5 Dissected Germinal Cells
2 (2%)
79 (98%)
81
Embryonic SC + Adult NSC
5 (5%)
73 (71%)
24 (23%)
103
Primitive NSC + Adult NSC
84 (85%)
15 (15%)
99
E9.5 NSC + Adult NSC
45 (82%)
10 (18%)
55
Adult NSC + Adult NSC (positive control for random mixing)
82 (100%)
82
130
131
We cocultured ESCs, primitive-NSCs, E9.5-derived definitive NSCs and adult definitive
NSCs in pairs with each other and with cells dissected from the E9.5 telencephalic
germinal zone. In each case, one group of cells was eYFP(+) and the other unlabeled.
With the exception of ESCs, these cell types were dissociated manually and not through
the use of enzymes which might digest external adhesive proteins. Thus cells would
retain their autochthonous component of extrinsic adhesion proteins which enzymes have
been noted to alter (Olsson et al., 1998). We reasoned that such cocultures would
establish predictions as to the behaviour of cells transplanted into the early mouse morula
and the E9.5 telencephalon, the embryonic stages in which the differentiation capacity of
such cells would be tested. All aggregates were initially observed as randomly sorted, and
the following phenomena were observed only after overnight incubation. ESCs or
primitive-NSCs sorted away from E9.5 germinal zone cells in aggregates, in contrast to
E9.5-derived or adult-derived NSCs which sorted randomly with E9.5 germinal zone
cells in aggregates (Fig 3-2A., B. and C.). As well, ESCs or primitive-NSCs sorted away
from adult NSCs, with primitive-NSCs possessing nearly no adherence to the adult cells.
This suggests that the early embryonic SCs have little affinity for the later embryonic and
adult SCs nor for E9.5 telencephalic cells present in the later stages of neural
development. E9.5-derived NSCs sorted into the center of aggregates when cocultured
with adult NSCs (Fig 3-2A. and C.), suggesting that the stronger adhesion was that
between the E9.5 NSCs themselves than that between the adult NSCs themselves (Fig 3-
2B.) or between the E9.5 and adult NSCs. In some cases, we found that adult NSCs also
sorted to the periphery of aggregates when cocultured with ESCs, suggesting a similar
132
interaction. These results were consistent in a large population of aggregates examined,
and are shown summarized (Table 1.).
We predicted that these cell sorting behaviours resulted from different expression of
cadherins in cells in the NSC lineage. To test this, samples were tested for relative
cadherin transcript abundance by quantitative PCR. We found that E9.0- and adult-
derived neurosphere cells expressed N-Cadherins at over two orders of magnitude higher
amounts than ESCs and primitive-NSCs (Fig 3-2D.). In contrast, E-Cadherin was
expressed by ESCs and primitive-NSCs over one hundred times higher than in E9.0- and
adult-derived neurosphere cells (Fig 3-2E.). These data correlate with the inability of
ESCs and primitive-NSCs to intermingle with adult cells and those derived from the mid-
gestation (E9.5) embryo. Moreover, E9.0 neurosphere cells express four hundred times
higher levels of P-Cadherin than adult neurosphere cells (Fig 3-2F.), this could account
for the observation that the E9.5 cells sort within the center of E9.5-NSC/adult-NSC
cocultures. Though these cells possess similar N-Cadherin levels, the additional P-
Cadherin adhesion presumably results in tighter association of E9.5 cells to each other
than to the adult cells – driving these into central regions of the aggregates.
We infected adult NSCs with a E-Cadherin / GFP-expressing construct and collected
GFP(+) cells by fluorescence-activated cell sorting (FACS) seven days following
infection. We confirmed that 78.1 ± 2.3% of GFP(+) cells reacted positively with E-
Cadherin antibodies. Forcible overexpression of E-Cadherin protein (which is present in
ESCs) was sufficient to alter the cell sorting observed in cocultures of adult NSCs and
133
Fig 3-2: Cell sorting behaviours and relative transcript abundance in the neural stem cell lineage. (A) Overnight, target and host cells sorted into distinct regions of aggregates: (i) Shows mixing experiments between unlabeled E9.5 germinal zone cells with primitive-NSCs (green), in this case both populations of cells are sorted apart. (ii) Shows that when E9.5-derived NSCs (green) are mixed with unlabeled adult NSCs, the more adhesive E9.5-derived cells sort into the center of aggregates. (iii and iv) Show that mixing of both E9.5- and adult-derived NSCs (green), respectively, with unlabeled E9.5 germinal zone cells is random. (B) Random Aggregates: Panels (i) to (iv) depict four serial confocal sections taken at 10 μm intervals. These show that two adult-derived NSC populations, one non-fluorescent and one YFP(+) (green) sort randomly. Aggregate is outlined in white. (C) Sphere-within-sphere Aggregates: Panels (i) to (iv) depict four serial confocal sections taken at 10 μm intervals. These confirm that adult-derived NSC (green) sort to the outside of the non-fluorescent E9.5-derived NSC. Aggregate is outlined in white. (D) Graph shows the amount of N-Cadherin mRNA expressed by ESCs, primitive-NSCs (pNSC), E9.0-derived NSCs (E9.0), and adult-derived NSCs (aNSC). In this case levels are normalized to primitive-NSCs, the lowest expressing group. (E) Graph shows the amount of E-Cadherin mRNA expressed by ESCs, primitive-NSCs (pNSC), E9.0-derived NSCs (E9.0), and adult-derived NSCs (aNSC). In this case levels are normalized to adult-NSCs, the lowest expressing group. (F) Graph shows the amount of P-Cadherin mRNA expressed by ESCs, primitive-NSCs (pNSC), E9.0-derived NSCs (E9.0), and adult-derived NSCs (aNSC). In this case levels are normalized to adult-NSCs, the lowest expressing group.
134
135
ESCs when these were cultured as embryoid bodies for 7 days in vitro. Control retrovirus
overexpressing adult NSCs sorted in the center in only 6/32 of the embryoid bodies
observed. In contrast, 49/56 E-Cadherin overexpressing adult NSC / ESC embryoid
bodies demonstrated increased localization of adult-derived cells with ESC derived cells
in the center of aggregates. Of these, approximately 35.2 ± 5.0% of E-Cadherin(+) adult
NSC progeny were near the center of 7 day embryoid body sections examined (n=19, E-
Cadherin overexpressing adult NSC / ESC aggregates sampled).
Thus our data suggest that cellular adhesion between cells of the NSC lineage varies
considerably during development, but that such discrepancies can be experimentally
modulated.
Adult NSCs and Retinal SCs Do Not Adhere to the Early Embryo
The morula aggregation technique involves the juxtaposition of SC colonies with the 4-8
cell stage mouse embryos, prior to the development of the E3.5 blastocyst stage.
Following overnight incubation, ESCs associate specifically with the inner cell mass
(ICM) and will give rise to the regions of the entire embryo if such chimeras are
implanted into a pseudopregnant host (Nagy et al., 2002). This assay is dependent on
cellular adhesion and sorting as a means of introducing cells of interest into the ICM.
Based on our observation that ESCs and adult NSCs did not sort randomly in vitro, and
that these contain different cadherins expressed in widely differing levels, it was
predicted that morula aggregates of adult NSCs and morula would not result in the
introduction of adult NSCs into the ICM overnight. Indeed, in contrast to primitive-NSCs
136
which were successful in colonizing the ICM, adult NSC colonies in no case were
successfully integrated into the ICM (Fig 3-3.). We also attempted the aggregation of
adult retinal SC colonies, but like adult NSCs these did not sort with the embryo (Fig 3-
3.). These results, shown summarized (Table 2.), might explain the rare to non-existant
recruitment of adult SCs in early embryos (Clarke et al., 2000; Tropepe et al., 2001;
D'Amour and Gage, 2003; Greco et al., 2004). Even if such adult NSCs possess
generalized pluripotency, the inability of such cells to associate with the ICM results in
the failure of these cells to contribute prima facie. The few instances where cells
remained associated with the trophoblast cells that surround the blastocyst (Table 2.),
indicate that rare association of adult cells in the early embryo is possible.
Adult NSCs, Induced to Adhere to the Early Embryo, Cannot Produce
Non-Neural Cell Types
Since our data indicated that adult NSCs could be induced to intermingle in vitro with
ESCs by E-Cadherin overexpression as described above, we attempted to introduce E-
Cadherin overexpressing adult NSCs into the ICM by morula aggregation. E-Cadherin
overexpressing adult NSCs showed a modest increase in associating with the ICM and
trophoblast of the embryo (Table 2.). The residual presence of N-Cadherin in the adult
cells might explain why these failed in most cases to aggregate with the early embryo,
even when E-Cadherin was overexpressed. The few embryos which contained adult
NSCs did not result in the detectable contribution of such cells in any part of the
developing conceptus, when these embryos were reimplanted following aggregation.
137
Fig 3-3: Morula aggregates discriminate between adherent and non-adherent cells. Early ESC-derived primitive-NSCs (green) are competent to colonize the ICM as they adhere to these cells, following overnight incubation, as shown in merge of brightfield and fluorescence (i). Brightfield photos show that (ii): Pigmented Adult Retinal SCs (dark); and (iii) LacZ(+) Adult NSCs (blue) are not competent to colonize the ICM. Both (ii) and (iii) colonies remain outside of host embryo. Either LacZ and fluorescent protein markers were used in these experiments. Asterisks indicate position of ICM.
138
139
Table 2: Morula aggregates of adult NSC colonies fail in contrast to early NSCs. Examination of morula aggregation, following overnight incubation reveals that unlike primitive-NSCs, adult definitive NSCs and retinal SCs cannot adhere to early embryonic cells. Introduction of such cells into the blastocyst is predicted to fail, prima facie, as such cells do not persist in a non-adherent environment. Overexpression of E-Cadherin in adult definitive NSC colonies allows a small percentage of these to sort into the ICM, in contrast to wildtype adult NSC colonies. Note the increase in both ICM and trophoblast association by the introduced cells.
Table 2. Morula Aggregations #embryos
total #aggregated cells in or next to ICM
#aggregated cells in trophoblast
%aggregated cells in or next to ICM
%aggregated cells in trophoblast
Adult Retinal NSCs
357 0 0 0 0
Adult Forebrain NSCs
496 0 31 0 6.3
E-Cadherin Overexpressing Adult Forebrain NSCs
229 7 34 3.1 14.8
Primitive NSCs 75 65 0 86.5 0
140
141
We next attempted to introduce adult cells by injection into the blastocoel cavity of the
blastocyst, in an attempt to improve the access of the adult NSCs. Unlike previous studies
(Clarke et al., 2000; D'Amour and Gage, 2003; Greco et al., 2004) we examined
blastocysts for the presence of introduced cells 12-16 hours following blastocoel injection
and before reimplantation (Fig 3-4A.). Significantly, E-Cadherin/GFP expressing adult
NSCs associated with the blastocyst ICM in ~37% of the cases, in contrast to control
adult NSCs (GFP only) which only associated with the blastocyst ~3% of the time (Table
3.). Again, that the E-Cadherin overexpressing adult NSCs maintained their constitutive
expression of N-Cadherin explains why this frequency is not higher. The exact location
of the adult cells was confirmed by confocal microscopy with some of the adult cells in
the ICM (Fig 3-4A, i.), apposed to the ICM (Fig 3-4A, ii.) or in the blastocoel cavity but
not near the ICM (Fig 3-4A, iii.). Interestingly, in 22 / 73 instances (~30%) the control
adult NSCs were expelled from the blastocyst overnight similar to the morula
aggregations, with the majority either remaining unattached to the ICM in the blastocoel
cavity or dying overnight (see Fig 3-3: iii.). We implanted all blastocysts containing adult
NSC progeny and examined the embryos at E4.5 and E6.5. Control adult NSC injected
blastocysts showed no presence of the transplanted cells at E4.5 and E6.5. Similarly, at
E4.5 E-Cadherin overexpressing adult NSCs were no longer present in the developing
embryo, but we were able to visualize adult cells in the extraembryonic tissues of 4 / 34
embryos recovered at E4.5 (not shown). Despite the increased frequency of association
between E-Cadherin overexpressing adult NSCs and that of normal adult NSCs, the
contribution of these adult NSCs was not like that of ESCs which associated with the
ICM, and which persisted up to E6.5 in all cases examined (Table 3.).
142
Table 3: Increased association of adult-derived NSCs after E-Cadherin overexpression and blastocoel injection. Ratios showing association of blastocyst injected cells with ICM following overnight incubation. Control cells only persisted in the ICM <3% of the time. Indeed in ~30% adult NSC colony cells were expelled from the embryo overnight, the remainder persisting in the blastocoel cavity where they cannot contribute to the epiblast. E-Cadherin overexpressing adult-NSCs associated with the ICM in ~37% of this cases, a substantial increase. However, ESCs integrated with the ICM in all cases examined. Number of samples examined is indicated in brackets.
Table 3. Blastocyst Injections % Associated w/
ICM at E3.5
% Associated w/ Epiblast at E4.5
% Associated w/ Epiblast at E6.5
Adult Forebrain NSCs (control retrovirus)
2.60 (n=77) 0 (n=9) 0 (n=9)
Adult Forebrain NSCs w/ E-Cadherin Overexpression
36.98 (n=204) 0 (n=34) 0 (n=19)
Embryonic Stem Cells
100.00 (n=90) Not Determined 100.00 (n=20)
143
144
The E-Cadherin overexpressing adult NSCs, following blastocoel injection and overnight
association with the ICM, were examined by marker analysis. Blastocysts were stained
for the proteins Nestin and glial-fibrillary-acidic-protein (GFAP), believed to correspond
to neural cell types. All transplanted adult NSC progeny in the blastocyst were positive
for Nestin (Fig 3-4B.), and 3 / 9 transplanted cells were positive for GFAP after overnight
incubation (not shown).
Adult NSCs Potency is Restricted in Embroid Body Coculture
The pluripotency of ESCs can be assessed via the in vitro differentiation of embryoid
bodies. Marker-based characterization of germ layer progenitors, using genes such as
Brachyury (Kubo et al., 2004) for mesodermal progenitors, can be employed in such
assays to characterize the differentiated cell output of ESCs. Since adult NSCs sort away
from ESCs in in vitro coculture, we examined the potency of adult NSCs by the forcible
association of these cells with differentiating ESCs in embryoid bodies. Association of
adult NSCs with non-neural cells has been reported to transmogrify neural cells into non-
neural cell types (Wurmser et al., 2004). We similarly assessed adult NSC plasticity in
embryoid bodies by mixing equal numbers of marked adult NSCs, infected with a
GFP/E-Cadherin retrovirus, and unlabeled ESCs. We investigated these aggregates for
the presence of neural (Fig 3-4C: i.) and early non-neural markers (Fig 3-4C: ii.). We
used the markers Nestin for neurectodermal cells (n=7 aggregates), Brachyury for
mesodermal cells (n=8 aggregates), and HNF3-β for endodermal cells (n=6 aggregates).
The marker GFAP was chosen to assess differentiated NSC progeny (n=5 aggregates).
Sections, of embryoid bodies grown up to day 7 in the presence of high serum, were
145
Fig 3-4: Adult NSCs cannot persist in the blastocyst and are not pluripotent. (A) Following injection of cells into E3.5 blastocysts, adult dsRed-MST (red) / E-Cadherin overexpressing (green) cells are: (i) Inside ICM; (ii) Apposed to ICM; or (iii) Inside blastocoel cavity but not associated with ICM. Panels (i): #1-8 show sequential confocal slices demonstrating the presence of introduced cells in relation to ICM (asterisks), (ii) and (iii) are shown as merged confocal z-stacks. Variability in E-Cadherin levels, evidenced by GFP expression (green) is likely due to variability in the insertion sites of the retroviral cassette. In some cases the blastocysts expanded overnight, enlarging blastocoel cavity greatly: (i) versus (ii). (B) All adult cells remained Nestin positive following blastocyst injection and overnight incubation in n=6 embryos examined. Embryos were also stained for GFAP, and 3/9 adult dsRed-MST(+) cells showed weak GFAP positivity in n=3 embryos. This suggests that most adult cells remained neural and were not dedifferentiated, nor transdifferentiated following blastocyst injection. (i) Brightfield; (ii) Blastocyst nuclei counterstained with Hoechst (blue); (iii) Adult dsRed(+) NSC progeny (red); (iv) Nestin (green); (v) Shows merge of (iii) and (iv). Following fixation, GFP fluorescence emitted from E-Cadherin retroviral gene expression was quenched allowing for the examination of these proteins by immunohistochemistry. (C) We cocultured E-Cadherin overexpressing (green) adult NSC progeny with ESCs in embryoid bodies for 7 days. During this time, most E-Cadherin transgene expression was shut off by the differentiating NSC progeny. (i) Sections revealed that adult cyan-fluorescent protein (+) NSC descendants (Blue) were Nestin positive (red). Insert shows a close-up demonstrating colocalization of Nestin and Adult NSC-derived cells. (ii) Sections showed that in no case were adult NSC descendants (Blue) positive for HNF3-β (red). Arrow indicates positively marked adult NSC progeny. Embryoid bodies are outlined for clarity.
146
147
sampled to determine the ratio of marker positive to total cells in the population. 33.1 ±
4.9% Nestin(+) and 26.7 ± 10.4% GFAP positive progeny arose from the adult-derived
NSCs, yet these produced zero HNF3-β or Brachyury progeny. Despite close association
of E-Cadherin overexpressing adult NSC progeny with differentiating ESC progeny,
NSC progeny expressed only neural cell markers in all 7 day embryoid body sections
examined. We then assessed differentiation in four day embryoid body cocultures but
found no appreciable differences to those at day 7 (not shown). This experiment suggests
proximity does not induce pluripotency in these in vitro conditions.
Adherence is Necessary for Stem Cell Recruitment
The early embryonic brain was assayed next as a host to characterize potency differences
between cells of the NSC lineage. We used the method of Ultrasound Guided Injection
(Olsson et al., 1997) to inject cells into the E9.5 telencephalic ventricle in order to assess
their potency therein. 1400-7000 labeled cells were introduced into the E9.5 forebrain
(Fig 3-5A.), and the animals examined at several timepoints afterwards. We assessed the
relative contribution of cells in the NSC lineage: primitive-NSCs; E9.5-derived definitive
FGF-dependent NSCs; and adult-derived definitive FGF- as well as adult-derived
definitive FGF+EGF-dependent NSCs. At E10.5, 24 hours following injection, cells
descended from primitive-NSCs appeared scattered as single cells or doublets within the
ventricle of the brain (Fig 3-5B.). At E12.5, clusters of injected cells were apparent
within or near mantle regions of the brain. Such clusters were randomly scattered through
the fore and mid-brain regions, as the introduced cells had access to mid brain areas via
the ventricular cavity at the E9.5 timepoint. It was observed that cells derived from
148
Fig 3-5: Early NSC sequester outside the developing brain. (A) Depicted are 1400 labeled primitive-NSC progeny (green) as seen in whole mount of the E9.5 forebrain (indicated by asterisk) one hour following ultrasound guided injection. The presence of all other cell types assayed was similarly confirmed, in a subset of embryos, immediately following injection. (i) Shows brightfield of whole mount; (ii) Shows GFP(+) transplanted cells in same embryo. (B) Single primitive-NSCs (green) were seen within or attached to the walls of the telencephalic ventricle 24 hours following transplant. (i) Shows brightfield of E10.5 brain section; (ii) Shows GFP(+) transplanted cells; (iii) Shows merge. Asterisk indicates ventricle. (C) 72 hours following transplant, colonies or rosettes of cells descended from primitive-NSCs were observed in or near the presumptive mantle regions of the forebrain. (i) Shows brightfield of E12.5 brain section; (ii) Shows GFP(+) transplanted cells; (iii) Shows merge. Mantle region is indicated by asterisk. (D) By E13.5, primitive-NSC rosette shaped colonies had grown considerably, and were now completely outside the brain but beneath the ectoderm. Merge shows brightfield of E13.5 brain section and GFP channel, with mantle region indicated by asterisk.
149
150
primitive-NSCs had moved through the ventricle, passed through germinal regions, and
into presumptive mantle regions of the E12.5 embryo (Fig 3-5C.). By E13.5 primitive-
NSC colonies had been completely expelled from the brain and clustered as large
ectodermal rosettes sandwiched between mantle regions and the ectoderm (Fig 3-5D.). It
is surprising that large clumps of cells could move so readily through a mass of early
neural tissue, however it is possible that the cells move prior to proliferation, such that
single cells or small clusters begin to proliferate into larger rosettes only after they reach
their final position outside of the brain. Similar to the inability of adult NSCs to adhere to
the early mouse embryo, primitive NSCs cannot adhere to the mid-gestation embryonic
brain due to differences in cadherin expression (see Fig 3-2D., E. and F.). However,
primitive-NSCs are competent to give rise to neural cells, both when differentiated in
vitro or when introduced into the blastocyst six days earlier in embryogenesis (Tropepe et
al., 2001).
The E9.5- and adult-derived NSC progeny (not shown) also were present in the ventricle
at E10.5, as small clumps or single cells. At E12.5 clusters of adult or E9.5 definitive
NSC descendants were associated with both germinal zones proximal to the ventricle as
well as mantle regions. The E9.5-derived and adult-derived definitive NSCs introduced
into the E9.5 embryo were not sorted out of the brain, and were detected in brains
recovered at post natal day one (Pnd1). E9.5-derived NSC progeny were visible in whole
mounts of Pnd1 brains (Fig 3-6A.) as were adult-derived NSC progeny (Fig 3-6B.), and
upon closer inspection cells of both descents possessed differentiated morphology. Since
151
Fig 3-6: E9.5- and adult-derived NSCs persist in the brain. (A) E9.5 NSC-derived cells (green) remain in the developing brain, following transplant into the E9.5 telencephalon, and are widespread at Pnd1. (i) Shows wholemount of brain; (ii) Shows regions derived from GFP(+) E9.5 definitive NSCs. In contrast to ES-derived primitive-NSCs, which were no longer present at this timepoint, cells remain in or next to ventricles in a scattered fashion at Pnd1 (iii), as shown in merge of brightfield and GFP channel. Note the differentiated morphology of the transplanted cells. Ventricles are indicated by asterisks in sections. (B) Adult NSC-derived cells (green) are also present at Pnd1, following transplant into the E9.5 telencephalon. (i) Shows wholemount of brain; (ii) Shows regions derived from GFP(+) Adult definitive NSCs. Similarly to the E9.5-derived definitive NSCs, the progeny of adult definitive NSCs remain in or next to ventricles and are scattered throughout these regions at Pnd1 (iii), as shown in merge of brightfield and GFP channel. Similar to the E9.5 NSC progeny, adult NSC progeny also display a differentiated morphology but in fewer cells than the E9.5-derived NSC descendants (see also Figs 7A, 7B). Ventricles are indicated by asterisks in sections.
152
153
the E9.5-derived NSCs were grown in FGF alone, while the adult-derived NSCs were
grown in both FGF and EGF, we repeated the adult-derived NSC ultrasound injections
using adult-derived cells that were grown in FGF alone. We found no differences in
contribution between adult-derived NSCs grown in FGF alone, versus those grown in
EGF + FGF (not shown).
We characterized transplanted cells using the neural progenitor marker, Nestin, as well as
β-3-tubulin, a marker of late neuronal progenitors and early neurons, and MAP2, a
marker of neurons. We found that in brains examined at pnd1, approximately 12 days
following transplantation, both E9.5 definitive NSCs (Fig 3-7A.) and adult definitive
NSCs (Fig 3-7B.) gave rise to populations of Nestin(+), β-3(+) and MAP2(+)
descendants which possessed obvious differentiated morphology. Sections of primitive-
NSC colonies that had sorted outside of the E13.5 brain also possessed Nestin and β-3
positive progeny (Fig 3-7C.), but these did not possess any obvious differentiated
morphology and the proportion of MAP2(+) cells was much lower. Nonetheless,
quantification of cell populations in sections sampled revealed that all three NSC cell
lineages produced Nestin, β-3-tubulin and MAP2 marked cells (Figs 3-7A., B. and C.).
These data show that while all three cohorts derived from the NSC lineage possess the
potency to generate neural and neuronal progeny, only the adult- and E9.5-derived cells
which express appropriate levels of N-Cadherin are competent to contribute to the
developing brain when injected into the E9.5 telencephalon.
154
Fig 3-7: All cells of the NSC lineage exhibit neural potency, but only E9.5- and adult-derived NSC progeny contribute to the brain. (A) Pnd1 sections show that GFP(+) E9.5 NSCs transplanted into the E9.5 telencephalon make both Nestin(+) cells (i) and β-3-tubulin(+) cells (ii) following transplantation into the E9.5 brain. Transplanted cells are shown in green, markers of interest are in red, nuclei are counterstained with Hoechst (blue), yellow indicates double-labeled cells. Sections sampled (n=3 pups) were scored for total number of marked cells as a percentage of the total number of transplanted cells (iii). The E9.5-derived NSC progeny included substantial numbers of Nestin, β-3-tubulin and MAP2 positive cells. (B) Adult GFP(+) NSCs also give rise to Nestin(+) cells (i) or β-3-tubulin(+) cells (ii) following transplantation into the E9.5 telencephalon. Transplanted cells are shown in green, markers of interest are in red, nuclei are counterstained with Hoechst (blue), yellow indicates double-labeled cells. Sections sampled (n=3 pups) were scored for total number of marked cells as a percentage of the total number of transplanted cells (iii). Similar to the E9.5-derived NSCs, the adult-derived NSC progeny included substantial numbers of both Nestin, β-3-tubulin and MAP2 positive cells. (C) After transplantation into the E9.5 telencephalon, sections of GFP(+) primitive-NSC colonies in E13.5 embryos show the presence of neural markers, Nestin(+) (i) and β-3-tubulin(+) (ii). Transplanted cells are shown in green, markers of interest are in red, nuclei are counterstained with Hoechst (blue), yellow indicates double-labeled cells. The rosettes shown were sorted outside of the developing brain. Sections were sampled (n=3 embryos) for total number of marked cells as a percentage of the total number of transplanted cells (iii). The primitive-NSC progeny included Nestin and β-3-tubulin positive cells, demonstrating that the founder cells retain neural potency in vivo even as they are sorted outside neural tissues. Note that lower proportions of MAP2(+) cells are observed arising from these transplanted cells than E9.5- and adult-derived NSCs.
155
156
Our data suggest that after the E9.5 timepoint, definitive NSC progeny were not sorted
out of neural tissues in contrast to primitive-NSC progeny (Table 4.). Although both
E9.5- and adult-derived cells seemed able to persist in the Pnd1 brain, the E9.5 cells
appeared to persist more readily as viewed by whole mount (Table 4.). Unlike the
primitive-NSCs, the adult- and E9.5-derived definitive NSC progeny did not produce any
rosettes.
These results are consistent with the in vitro cell sorting data described earlier, in which
both adult and E9.5 cells sorted randomly among E9.5 telencephalic cells which, in turn,
sorted apart from the primitive-NSCs. Indeed the sorting of E9.5 cells into the center,
when these are co-cultured with adult cells, also represents an adhesive characteristic that
might explain the relative increased contribution of E9.5 donor cells after transplantation
into the E9.5 brain, compared to adult donor cells. Adhesion differences as assayed by
relative cadherin transcript expression (see Figs 3-2D., E. and F.) (and not potency
differences between definitive NSC progeny or primitive NSC progeny and the cells of
the embryonic brain) underlie these contribution discrepancies.
157
Table 4: E9.5- and adult-derived NSC progeny contribute to the brain, while primitive-NSC progeny do not. In contrast to primitive-NSCs, E9.5 and adult definitive NSCs persist following injection into the telencephalic ventricle of E9.5 host embryos. Neither E9.5- or adult-derived NSC progeny formed rosettes, or were sorted outside the brain proper. Surprisingly the primitive-NSCs, which possess the potency to contribute to all germ layers in blastocyst chimeras, completely fail to contribute to the E9.5 brain and are sorted outside of the brain between E12.5 and E13.5. Asterisk indicates that positive chimerism scored is due to the presence of rosettes/colonies of transplanted cells in mantle regions only.
Table 4. Transplantations Into E9.5 Telencephalon # E10.5
embryos w/ donor cells present
# E12.5 embryos w/ donor cells present
# E13.5 embryos w/ donor cells present
# PND 1 pups w/ donor cells present
Early Lif/FGF-Dependant NSCs
12 / 30 10 / 32* 0 / 9 Not Determined
E9.5-Derived NSCs
11 / 13 10 / 23 Not Determined 10 / 14
Adult-Derived NSCs
6 / 7 4 / 21 Not Determined 3 / 16
158
159
Discussion
E-Cadherin is the earliest expressed cadherin in the mouse embryo and is responsible for
blastomere compaction as well as being involved in the earliest morphogenic events in
mammalian embryogenesis (Larue et al., 1994; Neganova et al., 2000). Following these
events, cells within the developing neural tube downregulate E-Cadherin to give way for
the expression of N-Cadherin as well as other cadherins and integrins which will
compartamentalize the various regions of the nervous system (Shimamura and Takeichi,
1992; Redies, 2000). This evolving regulation of cadherins partially explains the eventual
separation of cells in different tissues which are spawned from a common source during
development.
Cell sorting assays and quantitative PCR reveal that substantial adhesion discrepancies
exist between ESCs and their descendants, cells of the NSC lineage, although in vitro
NSCs are distinguishable only by their requirements for different exogenous growth
factors (Tropepe et al., 1999; Tropepe et al., 2001). Taken together our data suggest that:
1) Primitive-NSC progeny and ESCs possess different adhesion molecules than
either E9.5 germinal zone cells, adult NSC progeny or E9.5 NSC progeny.
2) ESCs and primitive-NSC progeny possess compatible adhesion molecules with
the early mouse morula.
3) E9.5 NSCs and their descendants, as well as adult NSCs and their descendants,
intermingle randomly with E9.5 germinal zone cells. These definitive NSC
160
populations possess compatible cell-cell adhesion molecules with E9.5 germinal
zone cells.
4) In spite of this compatibility with germinal zone cells, the E9.5 and adult derived
NSC progeny show adherence differences. E9.5 cells sort into the center of
aggregates undertaken between E9.5- and adult-derived NSC descendants. Thus
the adhesion of E9.5 NSC progeny to one another is stronger than the adhesion of
adult NSC progeny to one another, as well as that of adult NSC progeny to E9.5
NSC progeny.
These behaviours observed in culture account for similar sorting events when cells are
introduced into the tissues of the developing conceptus. We conclude that as ESCs
transition to primitive-NSCs, they retain an adhesive character that is compatible with the
early murine ICM when introduced into the blastocyst in vivo. Primitive-NSCs then
transition into an adhesion profile that is compatible with the early neural tube, but not
the pre-implantation embryo, and become dependent on exogenous FGF. Such cells
finally transition in the adult to a loosely-bound profile that appears to be less adherent
with the early neural tube or with progeny of E9.5-derived NSCs, but remains FGF-
dependent. These adhesive changes correlate to growth factor dependence alterations in
the primitive-NSC to definitive-NSC transition, but adhesive changes between E9.5-
derived definitive NSCs and adult-derived definitive NSCs do not seem to correlate with
any alterations in growth factor dependence.
We have observed a sphere-within-sphere configuration arising between cocultures of
adult NSC progeny and ESCs, as well as adult NSCs and E9.5-derived NSC progeny.
161
Such sorting behaviours are thought to be a result of: a) the two different cell types
expressing different levels of the same cadherin; b) the central cells expressing an
additional cadherin not present in the surrounding cells; or c) heterophilic binding
between two different cadherins which allows the cell types to adhere but which is
weaker relative to the homophilic binding of the central cells. Any of these three
possibilities accounts for the increased binding stability of the central cells that leads to
this outcome (Foty and Steinberg, 2005), however our analysis favours the co-expression
of N- and P-Cadherin that drives ESCs and E9.5-derived NSCs into the center of
aggregates when these are cultured with adult-NSCs. On the other hand, the complete
sorting out of primitive NSC progeny from E9.5 dissected germinal zone cells, adult
NSCs and the embryonic brain when introduced into the E9.5 embryo, can either be
explained in a similar fashion by relative adherence or, alternatively by relative
adherence and repulsion. Primitive NSC progeny and the other cell types might be
actively repulsed by one another. The Ephrin/Eph receptor signaling pathway could be
responsible for the active movement of primitive NSC progeny away from the E9.5-
derived or adult cells as such interactions are known to produce repulsive interactions
(Pasquale, 2005). We cannot rule out this possibility at this time, although if such
repulsion were the only factor then one might expect complete separation between
primitive NSC progeny and the E9.5 or adult cells following a 24 hour in vitro cell co-
culture. As this complete separation was not observed, it seems reasonable to assume
there is some low level adherence between these cells. Such low adherence would
compete weakly against a stronger repulsion that would separate these populations but
162
maintain some level of association between them leading to a sorting out of these
populations.
The frequency of adult NSC contribution to non-neural tissues in blastocyst chimeras is
exceedingly low: 6 per 600 embryos assayed (Clarke et al., 2000). Aggregations of adult
neural and retinal SC colonies with morulae, demonstrated a sorting out phenomenon
caused by intercellular adhesive discrepancies which pre-empt any possibility of chimeric
contribution by aggregated cells. The failure to replicate (Tropepe et al., 2001; D'Amour
and Gage, 2003; Greco et al., 2004) initial reports (Clarke et al., 2000) of adult NSC
plasticity, may be due to our observation that only <3% of adult cells actually associate
with the ICM. Thus these studies, which have carried out <100 blastocyst injections,
would have only undertaken <3 actual blastocyst assays to support their conclusions, and
moreover it is unclear if these assays have tested NSCs themselves which are a rare
population, or simply the progenitors arising from NSCs. It was therefore not clear
whether such cells did not possess pluripotency, or were simply unable to colonize the
inner cell mass of the blastocyst.
The overexpression of relevant cadherins, in this case E-Cadherin, demonstrates that the
modification of cell-cell adhesion is successful in associating NSCs with the cells of
inner cell mass. While control adult NSCs were cleared from the blastocyst following
overnight incubation (such cells either died or were sorted outside of the trophoblast
layer), ~37% of E-Cadherin transfected adult NSCs associated with the ICM of murine
blastocysts. Nonetheless, this increased association of NSC progeny did not alter their
163
baseline characteristics, and thus adult E-Cadherin overexpressing cells continued to
express the neural markers, Nestin or GFAP. Similarly, embryoid body cocultures of E-
Cadherin overexpressing NSC progeny and ESC progeny demonstrated that NSCs only
generate Nestin(+) and GFAP(+) cell types typical of NSCs under these conditions.
Despite hundreds of blastocysts attempted, and despite the successfully association of
such cells with the ICM or central regions of embryoid bodies through the forcible
expression of E-Cadherin, we were unable to find a single instance of the pluripotency of
adult NSCs. This suggests that the alteration of adhesion characteristics is independent of
cellular potency in these cells, and that such cells cannot be induced to display
pluripotency by association with pluripotent cell types. These results are consistent with
previous data (Greco et al., 2004) demonstrating that neural cells retain a neural
phenotype despite introduction into the early embryo (D'Amour and Gage, 2003; Greco
et al., 2004). We conclude that adhesion-mediated association of NSCs with pluripotent
ESCs is insufficient to alter the fate of NSC progeny.
Cell sorting behaviours were then shown to be critical for the contribution of competent
cells within transplanted brain regions. Primitive-NSCs were unable to contribute to the
murine brain following transplantation into the telencephalic ventricles of E9.5 embryos
because they were sorted from within the germinal regions through the mantle regions,
and then to the outside of the brain proper, at timepoints as early as E12.5 to E13.5: 48 to
72 hours following transplantation. This is unusual as the primitive NSCs possess the
competency to contribute to the embryonic brain, when aggregated with morula, and have
demonstrated the ability to form neurons and glial cells in differentiation conditions in
164
vitro (Tropepe et al., 2001). Indeed, it is likely that these neural-competent cells passed
through the ventricular zone compartment or niche where endogenous NSCs were located
during their cell-sorting journey within the brain. Such results are reminiscent of cadherin
mutations in development which have been shown to cause competent cells to fail in
contributing the appropriate cells within tissues, and instead to form rosettes due to an
adhesion failure during organogenesis (Kostetskii et al., 2001). Conversely, definitive
NSC colonies derived from the E9.5 telencephalon and the adult subventricular zone,
both of whom sort randomly with E9.5 dissected germinal zone cells, were both found to
contribute both Nestin positive and neuronal progeny when introduced into the E9.5
telencephalic ventricle. These data show that cell sorting and compartmentalization play a
role in cellular contribution, independent of a cell’s ability to produce differentiated
progeny.
Nevertheless, adult definitive NSC progeny produced fewer cell descendants than E9.5
definitive NSC progeny after transplantation in the E9.5 brain. In support of this, it was
also noted that adult NSC progeny contributed to the murine brain at a lower frequency
than the E9.5 progeny. We interpret this discrepancy in chimeric contribution to result
from sorting behaviours observed in aggregates which demonstrate that E9.5 NSC
progeny are more tightly adherent than those produced by adult NSCs, perhaps enabling
the E9.5 progeny to maintain a presence in the embryonic telencephalon. Similar
adhesive properties have been demonstrated to bias cellular contribution in cells taken
from rostral versus caudal regions, when assayed in E15 embryonic chimeras (Olsson et
al., 1998). Because we observed the sphere within sphere configuration arising between
165
mixtures of the E9.5- and adult-derived NSC descendants, it is possible that such biases
are a result of higher levels of N-Cadherin in E9.5 NSCs and their progeny relative to
adult NSCs and theirs, or to the additional presence of cell adhesion molecules in E9.5
NSC descendants versus those from adult NSCs.
It is clear that compatible cell-cell adhesion phenomena may confound SC transplantation
assays, by precluding cellular contribution, and for this reason chimera assays should be
interpreted carefully before conclusions regarding cell potency can be established. Our
experiments further demonstrate fundamental changes in adherence in cells of the NSC
lineage during development, suggesting an evolving compartmentalization of the SC
niche during neurogenesis that does not necessarily correspond to changes in NSC
growth factor responsiveness or NSC progeny differentiation.
166
Chapter V.
Cadherin Mediation of Neural Stem Cell Self-Renewal
167
This chapter will be submitted for publication: Phillip Karpowicz, Sandrine Williame-
Morawek, Brian DeVeale, Tomoyuki Inoue, Derek van der Kooy. E-Cadherin Regulates
Neural Stem Cell Self Renewal.
Summary
E-Cadherin, a cell adhesion protein, has been shown to take part in multiple processes
including the compartmentalization, proliferation, survival and differentiation of cells. E-
Cadherin is expressed in the adult and embryonic forebrain germinal zones in vivo, and
in colonies of cells derived from these regions and grown in vitro. Mice carrying E-
Cadherin floxed genes crossed to mice expressing Cre under the Nestin promoter,
demonstrate defects in the self-renewal of stem cells both in vivo and in vitro. The
functional role of E-Cadherin in vitro is further demonstrated using adhesion-blocking
antibodies in vitro which specifically target cadherin extracellular adhesive domains.
Adult neural stem cell colonies decrease in the presence of E-Cadherin antibodies in a
dosage-dependant manner, in contrast to P-Cadherin antibody. Upon overexpression of
normal E-Cadherin and a mutated E-Cadherin, containing no intracellular binding
domain, in adult NSCs through retroviral transduction an increased number of colonies
are observed. These data suggest it is specifically E-Cadherin adhesion that is
responsible for these effects. These data show the importance of E-Cadherin in the neural
stem cell niche, in vivo as well as in vitro, where alterations in cellular proximity
168
mediated by E-Cadherin regulates the self-renewal of NSCs by limiting the number of
expansionary symmetric divisions of these cells.
Introduction
Factors influencing stem cell (SC) behaviour are of interest both for their biological
insights as well as their possible therapeutic utility. Adult SC populations, such as neural
stem cells (NSC) (Alvarez-Buylla et al., 2001b) are generally localized within the
subependymal zone of the forebrain (Morshead and van der Kooy, 2001), a region which
can be thought of as the NSC niche. The notion of a niche which influences SC
maintenance has emerged as a compelling theory that explains certain SC characteristics
(Ohlstein et al., 2004; Alvarez-Buylla and Lim, 2004). Factors which operate within and
which comprise the SC niche, are thought to determine cell behaviour within that
localized environment (Kai and Spradling, 2003), as well as accounting for both the
persistence of the SC in that environment and its persistence within its niche throughout
the lifetime of the animal.
In particular, short range factors in the niche might operate to comprise a restricted
microenvironment in which the division of SCs would produce daughter cells in
drastically different contexts. Thus, by virtue of its slightly different position – one
daughter might retain the same SC behaviour as its parent, being retained in the SC niche,
whereas the other would assume a different fate. Examples of such short range signals are
169
gap junctions, which have been shown to influence the proliferation of neural progenitors
(Cheng et al., 2004), and the Notch juxtacrine signaling pathway, which has general
effects on neural development and specific effects on the maintenance of NSCs (Louvi
and Artavanis-Tsakonas, 2006; Hitoshi et al., 2002a; Campos et al., 2006).
One aspect of the niche which is poorly understood is the mechanism by which NSCs
remain in the subventricular zone. Candidates for anchoring cells in any tissue region are
cadherins, cell adhesion proteins which are thought to play a role in the morphogenesis of
diverse tissues (Takeichi, 1995). It is currently understood that cadherins of the same type
bind homophilically and drive cells to sort together to self-assemble into aggregates
which maximize such homotypic adhesion events (Foty and Steinberg, 2005). Consistent
with this, vertebrate cadherins are thought to be involved in the compartmentalization of
different neural regions during development (Redies, 2000).
E-Cadherin is transiently expressed in the developing diencephalons and mesencephalon
of mouse embryos (Shimamura and Takeichi, 1992) where it is believed to participate in
the segmentation of the developing brain (Matsunami and Takeichi, 1995). Though it is
downregulated in most of the brain during embryogenesis, the expression of E-Cadherin
is seen in the ventricles of the developing (Rasin et al., 2007) and adult brain (Kuo et al.,
2006), regions in which NSCs reside and/or contact. In these studies it appears that the
proteins Numb and Numblike function to polarize E-Cadherin in the processes
connecting radial glia to the ventricles (Rasin et al., 2007). A potential role of this protein
in NSC behaviour could be wide-ranging. In the fly gonad, Drosophila E-Cadherin has
170
been shown to associate germline SCs to aggregate with a group of cells that signal to the
SCs and which, in part, defines the SC niche in that system (Song et al., 2002b; Ohlstein
et al., 2004; Yamashita et al., 2003). Mouse E-Cadherin has been shown to facilitate
survival in epithelial cells of the mammary gland (Boussadia et al., 2002) and the skin
(Tinkle et al., 2004) in vivo, and, interestingly, has been shown to induce Rac1 activity
which increases epithelial cell proliferation in vitro (Liu et al., 2006). Curiously recent
findings show that E-Cadherin decreases cellular proliferation in a variety of cell lines, by
a β-Catenin dependant but non-canonical Wnt signaling pathway (Perrais et al., 2007).
Moreover, E-Cadherin has been also found to have effects on the differentiation of
murine germ cells (Okamura et al., 2003) and epithelia (Larue et al., 1996). These
characteristics: survival, proliferation and differentiation are classic outcomes arising
from SC loss or dysfunction and support E-Cadherin as a player in NSC behaviour.
We thus examined the loss and gain of E-Cadherin in NSCs of the adult mouse brain.
NSCs arise during development and are thought to contribute to neurogenesis in the
embryo and the adult (Tropepe et al., 1999). Such NSCs can be characterized in vitro
using a clonal cell culture system in which single cells dissected from the adult or
embryonic neural regions demonstrate both self-renewal and multipotentiality (Reynolds
et al., 1992; Morshead et al., 1994; Tropepe et al., 1999). It is unknown whether in vivo
niches are recapitulated in vitro but, the effects of Notch signaling in culture suggest that
some aspects of the native NSC niche do take place in vitro (Hitoshi et al., 2002a). Our
results suggest that E-Cadherin is expressed by NSCs and regulates NSC self-renewal
and NSC and/or progenitor proliferation in vivo. Ex-vivo culture of NSCs are consistent
171
with these observations and furthermore suggest that NSC niches are recapitulated in
vitro, thus confirming their use in the retrospective analysis of these cells.
Materials and Methods
Animal Dissection and Cell Culture: E-Cadherinfloxed/+ (Boussadia et al., 2002) and
Nestin-Cre (B6.Cg-Tg(Nes-cre)1Kln/J; Jackson Laboratory) mice were crossed to obtain
a E-Cadherinfloxed/+; Nestin-Cre strain which expresses Cre specifically in the nervous
system. This was then backcrossed with E-Cadherinfloxed/foxed to obtain the E-
Cadherinfloxed/floxed ; Nestin-Cre strain (EcadΔ/Δ). E-Cadherin+/+ ; Nestin-Cre offspring
from these crosses were used as wildtype controls (EcadWt/Wt). CD1 and B57 wildtype
mice, EcadWt/Wt and EcadΔ/Δ mice were dissected and their NSCs cultured as previously
described: 1) for E9.5 and E13.5 embryonic forebrain ventricles (Tropepe et al., 1999); or
2) for adult mouse forebrain ventricles (Reynolds et al., 1992; Morshead et al., 1994).
Cells were cultured at 10 cells/μL following dissection, and passaged thereafter at 5
cells/μL in all experiments. Antibodies against E-Cadherin (ECCD-1 and ECCD-2;
Zymed), N-Cadherin (Sigma), or P-Cadherin (Zymed) were dissolved in water and added
to media just prior to application, at the concentrations indicated in the text.
Plasmid Construction and Retroviral Infection: The pMXIE retroviral construct has
been described(Hitoshi et al., 2002). To generate the pMXIE-E-Cadherin construct,
Human E-cadherin cDNA was amplified by PCR in 50μL volume consisting of 1 μM of
172
sense (5'-CCCTCGCTCGAGGTCCCCGGCCCAG-3') and antisense (5'-
CCTCTCTCGAGATCTCTAGTCGTCCTCG-3') primers, 2.5 mM Mg2+, 0.3 mM dNTP,
1μL of TaKaRa LA Taq polymerase (TaKaRa) and pLKpac1 Human E-Cadherin plasmid
(a gift from Dr. Reynolds) as a template. PCR parameters included, denaturation at 95ºC
for 30 seconds, annealing at 60ºC for 60 seconds and extension at 72ºC for 180 seconds
for 20 cycles. The amplified DNA fragments were digested with XhoI and BglII and
ligated to the XhoI-BamHI site of the pMXIE retroviral vector plasmid. To generate the
pMXIE-N-Cadherin construct, pMXIE was first cut using XhoI and BamHI. An oligo
containing the sites SalI-BamHI-XhoI-BglII, in that order, was digested with SalI and
BglII. The cut products were ligated to modify the MCS of pMXIE to contain BamHI,
XhoI in the correct sequence, allowing for the insertion of the Human N-Cadherin cDNA
(a gift from Dr. Blindt) following its excision from the pCMX plasmid using BamHI and
XhoI. 100,000 cells were exposed to virus at a ratio of 10 virus particles to 1 cell in the
presence of 5 ng/μL hexadimethrine bromide (Sigma). Cells were incubated with
retrovirus in 250μL cell culture media (containing EGF and FGF) for 90 minutes while
being centrifuged at 1000rpm at room temperature. Cells were then resuspended,
recounted and plated as described above. Prior to use, colonies were examined to confirm
retrovirus integration and transgene expression by fluorescence microscopy.
Immunocyto/Immunohisto-Chemistry and Microscopy: Adult mice were
anaesthetized, and perfused using 4% paraformaldehyde (Sigma) dissolved in cold
Stockholm’s phosphate buffered saline (pH 7.3). Following perfusion, brains were
dissected from cranium and fixed overnight at 4oC, in 4% paraformaldehyde. Brains were
173
then washed with Stockholm’s and equilibrated in Stockholm’s containing, 30% w/v
sucrose (Sigma) at 4oC. Samples were then embedded in cryoprotectant (Thermo
Electron Corporation) and sectioned on a Jencon’s OTF5000 cryostat at 15 or 20 micron
thickness. NSC colonies were coated with MATRIGEL for 30 minutes at 37oC. Cell
attachment was assessed by gently tapping plates under microscope. Cells were fixed
using 4% paraformaldehyde (Sigma) dissolved in cold Stockholm’s phosphate buffered
saline (pH 7.3) for 15 minutes. Sections or colonies were washed 3 X 10 minutes with
Stockholm’s PBS plus 0.3% Triton detergent (Sigma). To detect BrdU, cells were
exposed to 4 N HCl for 30 minutes. Samples were then blocked using 1% bovine serum
albumin (Sigma) + 10% normal goat serum (Sigma) in Stockholm’s, pH 7.3, 0.3% Triton
(Sigma) for 60 minutes at room temperature. Primary antibodies were applied overnight
in Stockholm’s, 1.0% NGS, 0.3% Triton. α-E-Cadherin (ECCD-1, Zymed, 1:500; ECCD-
2, Zymed, 1:1000; G-10, Santa-Cruz, 1:100), α-N-Cadherin (GC-4, Sigma, 1:100), α-
BrdU Bu1/75 (Abcam, 1:500), α-β-tubulin isotype III (Sigma, 1:500), α-pan-histone
(Chemicon, 1:500), and α-glial fibrillary acidic protein (Sigma, 1:400) were used.
Samples were washed 3 X Stockholm’s and blocked again using the same conditions
above. Secondary antibodies were applied at 37oC for 50 minutes (for colony
immunocytochemistry) or 2 hours (for section immunohistochemistry) in StPBS 1.0 %
normal goat serum. TRITC, FITC-conjugated antibodies (Jackson Labs, 1:250) or 488nm
and 568nm Alexa Fluor antibodies (Molecular Probes, 1:300) were used as appropriate.
Nuclei were counterstained with 10 ug/mL Hoechst 33258 (Sigma). Sections were
mounted and coverslipped using Gel Mount (Biomeda Corp.). Photographs were taken
under 40X/0,55 (dry lens) objective using a 40X/0,60 Olympus IX81 inverted
174
microscope with the Olympus Microsuite Version 3.2 Analysis imaging system software
(Soft Imaging Systems Corp.). All photos were processed using Adobe Photoshop CS2
software.
Fluorescence Activated Cell Sorting: Cells were sorted on FACS DiVa (Becton-
Dickenson Biosciences) system. Cells were sorted at approximately 9000 events per
second, and fractions were kept on ice until plated. At the outset of each experiment, CD1
(GFP-negative) adult neurosphere cells and GFP transgenic adult neurosphere cells
served as negative and positive controls, respectively, to set the gates for cell sorting.
Cells were dissociated mechanically and blocked for 30min at 37oC, in Dulbecco’s PBS
(pH 7.3) + 10% normal goat serum (Sigma). Cells were then exposed to 2μg/mL primary
anti-E-Cadherin antibody ECCD2 (Zymed, 1:500), in 1mL Dulbecco’s + 3% goat serum
for one hour at 37oC. Cells were then washed 2 X 10mL Dulbecco’s, and exposed to
Goat-anti-Mouse 633nm Alexa Fluor antibody (Molecular Probes, 1:300) for an
additional hour in the same conditions as the primary. Cells were then washed 2 X 10mL
Dulbecco’s and sorted. ESCs served as positive controls to confirm the efficacy of the E-
Cadherin antibody.
Cell Death Detection: Terminal transferase dUTP nick end labeling (TUNEL) labeling
was carried out using a Fluorescein In Situ Cell Death Detection Kit (Roche Applied
Science).
175
PCR and RT-PCR: Tail clip DNA and messenger RNA were extracted using the
DNeasy Tissue Kit (Qiagen) and RNeasy Mini/Micro Kits (Qiagen), respectively.
Genotyping was carried out using primer sequences: Cdh1 forward –
GAATTCTGAACATCATTATCAGTATTTA, reverse –
TGACACATGCCTTTACTTTAGT; Cre forward –
GCGGTCTGGCAGTAAAAACTATC, reverse – GTGAAACAGCATTGCTGTCACTT;
IL2 forward – CTAGGCCACAGAATTGAAAGATCT, reverse –
GTAGGTGGAAATTCTAGCATCATCC. Transcript detection was carried out using
one-step RT reactions in the RNeasy Kits (Qiagen), either on bulk cultures or single NSC
colonies, with the following sequences: Cdh1/E-Cadherin forward –
CGTGATGAAGGTCTCAGCC, reverse – GATGGGGGCTTCATTCACG, Cdh2/N-
Cadherin forward – CCTGGAATGCGGCATAC, reverse –
GAAGATCAAACGCGAACG, β-Catenin forward –
CATGTTCCCTGAGACGCTAGA, reverse – CAGAGTCCCAGCAGTACAACG, α-
Catenin forward – TTTATCGCATCTGAAAATTGTCG, reverse –
CTTGGTCATCTTGTCAATCGC, p120 forward – CACCATCAACGAAGTTATCGC,
reverse - GCAGGTAGAGTGGCGCTAAA, Actin forward –
GAAGTGTGATGTGGATATCCGC, reverse – AGAAGCATTTGCGGTGGAC. Nested
PCR on the Cdh1/E-Cadherin RT-Product was carried out with the sequences: forward –
CAGACGATGACGTCAACAC, reverse – CCTCATTCTCAGGCACTTG.
Software: Statistical analysis was carried out using Graphpad Prism 4.0. Comparisons
between normalized GSC and cyst nuclei quantifications was carried out by unpaired t-
176
tests, comparisons between multiple groups carried out by ANOVA with Dunnett or post-
test as required.
Results
E-Cadherin is Present in the Adult and Embryonic Brain
and in Colonies Derived From These Cells
E-Cadherin transcript and protein was probed in the adult forebrain ventricular zones. We
found E-Cadherin RNA, and that of its binding partners β-Catenin, α-Catenin, and p120,
present by RT-PCR both in vivo – and in colonies in vitro derived from adult ventricle
tissues (Table 5.). As well, forebrain germinal zone cells taken from E9.5, and E13.5
embryos, as well as their respective colonies, were found to express these same
transcripts (Table 5.). N-Cadherin expression, which is known to be present in all neural
tissues, was similarly confirmed in adult ventricular tissue and adult-derived colonies
(Table 5.).
We next examined the adult ventricles by immunohistochemistry to confirm the presence
of E-Cadherin protein in the NSC niche. Unlike N-Cadherin, E-Cadherin was present in
patches and at a lower level in the ventricular and subventricular zones (Fig 4-1A. and
B.). Dissection of ventricular zones followed by antibody staining and flow cytometry
confirmed that 4.2 ± 0.8% of dissected adult forebrain cells expressed the E-Cadherin
protein (data not shown).
177
Table 5: E-Cadherin, N-Cadherin and their binding partners are expressed in the forebrain germinal zones. Table shows results from conventional RT-PCR transcript detection of samples indicated. All samples were replicated in triplicate at minimum. E-Cadherin bands from adult murine tissue and colonies were faint, and were therefore confirmed by nested PCR carried out on the RT-PCR product. Adult NSC individual colonies (n=10 colonies sampled) were also tested to confirm data shown. The term “ND” means a transcript band was not detected in that sample. Asterisks in N-Cadherin row indicate that this transcript has been detected in the E9.5 and E13.5 brain by other groups, and is known to be expressed therein.
Table 5. RT-PCR of Cadherin and binding partner products.
Tissue Type
NSC Colonies
E9.5 Neuro-epithelium
E13.5 Cortex and
Ganglionic Eminence
Adult Ventricle
E9.5 E13.5 Adult
E-Cad
+ + + + + +
N-Cad * * + ND ND +
β-Cat
+ + + + + +
α-Cat
+ + + + + +
p120
+ + + + + +
β-Actin
+ + + + + +
178
179
Antibody was next applied to the colonies grown from cells dissected from germinal
zones in the embryo or the adult. Immunocytochemistry showed the presence of E-Cad in
clonal adult neurosphere colonies (Fig 4-1C.), as well as E9.5 and E13.5 colonies (data
not shown). Because Cadherins have been proposed to mediate cell sorting, we examined
7 day NSC neurospheres to determine whether E-Cad positive cells demonstrated any
localization within these (Fig 4-1D.). Although E-Cadherin positive cells clustered
together in these colonies, no obvious localization or separation between E-Cadherin
positive and negative cells was observed in any of the colonies examined. This may be
due to the presence of N-Cadherin in these cells, which when examined, showed
expression throughout all cells in these colonies (Fig 4-1E.).
These data show that RNA transcripts of E-Cadherin and its associated binding partners
are found both in vivo, in regions of the brain where NSCs are thought to reside.
Moreover, these transcripts are expressed in the in vitro colonies derived from such cells.
The E-Cadherin protein is present in the adult brain and in colonies derived from cells
dissected at all of these developmental timepoints. However, such protein does not appear
to mediate known cell sorting behaviours (Steinberg and Takeichi, 1994) between E-
Cadherin positive and negative neural cells arising from NSCs in vitro.
Disruption of E-Cadherin In Vivo Reduces NSC Self-Renewal but Increases Neural
Progenitor Proliferation
Previous studies have shown neurogenesis is impaired in mutations of the adherens
junction protein α-E-Catenin (Lien et al., 2006), although neurogenesis appears normal in
180
Fig 4-1: E-Cadherin is expressed in the adult murine ventricles and by in vitro colonies. (A) Image shows E-Cadherin immunohistochemistry in the subependyma of the forebrain lateral ventricles (green in panels ii and iii). Nuclei are shown in merge in blue. (B) Image shows N-Cadherin immunohistochemistry in the forebrain lateral ventricles’ subependyma (green in panels ii and iii). N-Cadherin is more widely expressed than E-Cadherin. Nuclei are shown in merge in blue. (C) E-Cadherin is expressed at day 3 in vitro by colonies derived from NSCs dissected from adult forebrain ventricles. E-Cadherin immunocytochemistry is shown in panels ii and iii as green, DAPI counterstain is blue in merged image. (D) E-Cadherin is expressed at day 7 in vitro NSC colonies. Merged image shows section of large NSC colony with E-Cadherin shown in green in panels ii and iii. DAPI counterstain is blue. (E) N-Cadherin is expressed at day 7 in vitro NSC colonies. Merged image shows section of large NSC colony with N-Cadherin shown in green in panels ii and iii. DAPI counterstain is blue. Similar to the in vivo results, N-Cadherin staining is stronger than E-Cadherin in these colonies.
181
182
mutants of the aPKCλ protein which regulates adherens junctions (Imai et al., 2006).
These studies presumably affected adherens junctions throughout the nervous system. We
attempted to focus on mutations of E-Cadherin in areas where NSCs specifically reside,
as E-Cadherin expression seems localized to ventricular regions of the adult forebrain
(Kuo et al., 2006; Rasin et al., 2007). E-Cadherin null embryos are not viable (Larue et
al., 1994) and thus this protein cannot be examined using conventional mutants. E-
Cadherin conditional knock-outs were assayed by crossing mice carrying E-Cadherin
floxed genes (Boussadia et al., 2002) with mice expressing the Cre-recombinase enzyme
under the Nestin promoter (Tronche et al., 1999), resulting in deletion of E-Cadherin in
all central nervous system tissues.
Conditional E-Cadherin mutant mice (EcadΔ/Δ mice) obtained from these crosses seemed
normal in appearance and behaviour. Indeed, no phenotypes were readily observed in
adult EcadΔ/Δ brains, suggesting that any transient effects of E-Cadherin expression in the
mouse embryo and adult are negligible or compensated for during development.
However, because NSC division in the adult brain is slow, we sought to determine if an
age-dependant effect of E-Cadherin became apparent during neurogenesis at later
timepoints during adulthood. We examined cell proliferation in the mitotic cell of the
forebrain ventricles of 2 month old mice by BrdU uptake following one hour
administration (Fig 4-2A. and B.). EcadΔ/Δ mice were noted to have an increased number
of cells in S-Phase as compared to their littermate wildtype (EcadWt/Wt) controls (Fig 4-
2C.). This increased proliferation in progenitors or NSCs in this region might result in the
premature senescence of NSCs in older animals. However, because NSCs are a minority
183
of the cells in this region, it is most likely that this difference is attributable to the
progenitors residing in these tissues. Hence we next sought to examine the effects of E-
Cadherin ablation on NSC division directly. NSCs are thought to divide relatively slowly
and their presence can be distinguished from that of fast-dividing adjacent neural
progenitor cells by long-term BrdU retention (Morshead et al., 1998). Aged 9 month
EcadΔ/Δ mice examined using this method revealed a significant decrease in BrdU
retaining cells in the subependymal zone (Fig 4-2D.). Since NSCs produce neurons that
migrate into the olfactory bulb, this region was also examined in the aged mice and it was
similarly noted that a significant decrease in the BrdU(+) olfactory neuron population
occurred as a result of E-Cadherin loss (Fig 4-2E.) These results suggest that E-Cadherin
functions to restrict NSC divisions and progenitor divisions in the neurogenic adult
subependymal zone, and in its absence NSCs divide more frequently. Yet E-Cadherin
regulation affects NSCs and progenitors separately, with the former reducing its divisions
in the absence of E-Cadherin which subsequently contribute to a reduction in neurons of
the olfactory bulb, and the latter increasing its divisions in the absence of the protein.
While it is likely the loss of BrdU retaining cells caused by E-Cadherin disruption reflects
a reduction in NSC number, an alternative possibility is that NSCs adopt an increased
symmetric division rate which dilutes BrdU signal past detectability resulting in fewer
BrdU(+) cells observed one month after BrdU incorporation.
The clonal in vitro analysis of NSCs has been shown to provide a means to directly
examine these cells. In order to resolve whether NSCs divided more or less frequently in
the absence of E-Cadherin, we dissected and cultured neural cells obtained from 2 month
184
Fig 4-2: E-Cadherin conditional knock-out NSCs show self-renewal deficit in vivo. (A) BrdU uptake in wildtype control forebrain ventricles. Sections show BrdU positive neural precursors (arrow) following 1 hour BrdU exposure in vivo. BrdU is green in panels ii and iii. Nuclei are counterstained in red by a pan-histone antibody. (B) BrdU uptake is increased in E-Cadherin conditional knock-out forebrain ventricles. Sections show BrdU positive neural precursors (arrows) following 1 hour BrdU exposure in vivo. BrdU is green in panels ii and iii. Nuclei are counterstained in red by a pan-histone antibody. Note the obvious increase in EcadΔ/Δ cells entering S-Phase during short-term BrdU administration. (C) Graph shows increase in BrdU(+) progenitors in EcadΔ/Δ mice (n=4) as compared to their EcadWt/Wt littermate controls (n=5). Asterisk indicates difference is significant (t = 4.817, df = 7, p<0.05). (D) Graph shows decrease in BrdU(+) retaining progenitors in SVZ, one month after BrdU injection, in EcadΔ/Δ mice (n=5) compared to their EcadWt/Wt littermate controls (n=5). Asterisk indicates this reduction is significant (t = 2.902, df = 8, p<0.05). (E) Graph shows decrease in BrdU(+) labeled cells in olfactory bulb, one month after BrdU injection, in EcadΔ/Δ mice (n=3 animals, 15 sections sampled) compared to their EcadWt/Wt littermate controls (n=3 animals, 15 sections sampled). Asterisk indicates this reduction is significant (t = 2.204, df = 28, p<0.05).
185
186
old ventricles in EcadΔ/Δ and examined the growth of colonies using clonal conditions in
vitro. It was predicted that during culture in proliferation conditions, adult NSCs would
be induced to divide more frequently than they do in vivo, and an eventual reduction in
proliferation would occur. Initially EcadΔ/Δ and EcadWt/Wt animals produced similar
numbers of colonies (Fig 4-2F.). However upon two serial passages, EcadΔ/Δ produced
fewer colonies than either EcadΔ/Wt (data not shown), and EcadWt/Wt and this decrease was
maintained thereafter (Fig 4-2F.). Heterozygous EcadΔ/Wt NSCs produced equal numbers
of colonies as EcadWt/Wt NSCs (data not shown). The step function loss in clonal
neurosphere number suggests a halving, followed by maintenance of lower numbers, of
multipotent NSCs in these in vitro conditions.
To test whether neurospheres derived from EcadΔ/Δ animals were restricted progenitors or
multipotent NSCs, we examined EcadΔ/Δ versus EcadWt/Wt colonies arising from newly
dissected cells under differentiation conditions to ascertain if differences existed in their
output of neural progeny. There were no differences among these groups tested, with
both wildtype (colonies sampled from n=6 animals) and mutant colonies (sampled from
n=6 animals) giving rise to equivalent neurons, as assessed by the use of β-3-tubulin, and
astrocytes, as assessed by the use of GFAP (data not shown). Together with the long term
passaging results above, these data suggest that the neurospheres dissected from EcadΔ/Δ
animals are NSCs and not progenitors.
Under in vitro conditions, NSCs are the cells within colonies with the ability to subclone.
The number of subclone-competent cells at 7 days following passage is 1.3±0.5% of total
187
cells. However 2-3 days upon replating, such cells are present at a significantly higher
frequency of 3.9±0.8% of the total cell population (t = 19.26, df = 101, p<0.05). This
means NSCs may be more directly examined at day 3 immediately following passage
when they are somewhat enriched among the in vitro neural cell population. We took
advantage of this to test the effects on E-Cadherin in NSCs. It is possible that the
reduction in neurosphere number was an outcome of increased cell death in the EcadΔ/Δ
cells as E-Cadherin has been shown to mediate cell survival in other tissues (Boussadia et
al., 2002; Tinkle et al., 2004). Colonies were examined at the passage three timepoint
when a significant decrease between E-Cadherin wildtype and mutant cultures were first
observed. No appreciable differences in cell death were observed between EcadΔ/Δ and
EcadWt/Wt colonies at 3 days culture when these were examined by TUNEL labeling (Fig
4-2G.). Cell division rate might also be a means through which NSC colony number
decreases in passage NSCs. Hence these same third-passage colonies were next pulsed
for 4 hours in vitro with BrdU and subsequently examined. A significant decrease in
overall cell proliferation was observed in EcadΔ/Δ derived clones (Fig 4-2H.).
Interestingly, when such colonies were examined for BrdU uptake at the passage two
timepoint, before a reduction in clone number was seen, there were no significant
differences between EcadΔ/Δ and EcadWt/Wt groups (data not shown). This data suggests
that over extended periods of time in vitro symmetric NSC divisions are reduced.
Because there are more rapidly dividing cells in vivo in the EcadΔ/Δ animals (Fig 4-2A-
C.), the progenitor population is likely to be higher, but because the progenitor population
fails to self-renew they obscure the dearth of stem cells for at time, until it becomes
apparent after long term passage that fewer colonies are produced.
188
Fig 4-2: E-Cadherin conditional knock-out NSCs show self-renewal deficit in vitro. (F) Graph shows the inability of EcadΔ/Δ NSCs to maintain over long term passage, in contrast to EcadWt/Wt littermate controls. Data shown is an average of two separate assays (F15,109=1.946, p<0.05). Primary timepoint is an average of cells dissected n=10 EcadΔ/Δ and n=11 EcadWt/Wt, remaining timepoints contain n=7 groups per passage EcadΔ/Δ and n=6-4 groups per passage EcadWt/Wt. (G) Cell death is equivalent between wildtype and E-Cadherin conditional knock-outs. Images show merge of 3 day EcadΔ/Δ and EcadWt/Wt colonies at passage 3, the timepoint at which differences in colony number arise between these groups. TUNEL assay (arrow) reveals cell nuclei undergoing apoptosis (green), nuclei are counterstained by DAPI (blue). Graph shows there are no significant differences (p>0.05) between total percentages of TUNEL(+) cells (n=3 animals per group), nor by proportion of TUNEL(+) cells per colony (n=30 colonies per group). (H) Proliferation is decreased in E-Cadherin conditional knock-outs at passage 3. Images show merge of 3 day EcadΔ/Δ and EcadWt/Wt colonies at passage 3, the timepoint at which differences in colony number arise between these groups. BrdU uptake (arrow) reveals nuclei which have entered S-phase (yellow in merged image). Cells are counterstained using pan-histone (red). Graph shows there are significant differences (indicated by asterisks) between the total percentages of BrdU(+) cells (t = 4.043, df = 4, p<0.05, n=3 animals per group), and in the proportion of BrdU(+) cells per colony (t = 3.417, df = 58, p<0.05, n=30 colonies per group). (I) Aged E-Cadherin conditional knock-outs produce fewer NSC colonies. Graph shows decrease in primary neurosphere colony formation in EcadΔ/Δ relative to EcadWt/Wt littermate controls. Asterisk indicates significance (t = 2.867, df = 19, p<0.05, n=11 EcadWt/Wt and n=10 EcadΔ/Δ).
189
190
These data therefore predict the premature depletion of the NSC pool in EcadΔ/Δ mice.
We re-examined the production of neural stem cells colonies to verify if such a decrease
was apparent over time. Because progenitors do not self-renew, dissections were carried
out on older 9 month EcadΔ/Δ mice to verify if the numbers of NSCs is lowered at later
timepoints. Indeed, the number of E-Cadherin mutant colonies was significantly
decreased compared to the number obtained from wildtypes (Fig 4-2I.), although colonies
in both groups were of equivalent size (data not shown).
Taken together, our results suggest that the number of NSCs is initially normal in young
EcadΔ/Δ animals but is lowered over time. Either an impaired NSC self-renewal in
EcadΔ/Δ mice only becomes evident over many symmetric NSC divisions, or the NSC
population is simply smaller and, in response, a progenitor population is recruited to
substitute for NSCs in the absence of E-Cadherin. However over 9 months is too long for
progenitors to last, and this limited self-renewal capability of progenitors results in an
overall decrease in colony formation and in BrdU-retaining cells over time.
Disruption of E-Cadherin Adhesion Reduces NSC Self-Renewal In Vitro
Thus far, our data hint that the effects of E-Cadherin on the NSC niche in vivo may take
place in vitro as well. However it is possible that compensatory mechanisms, such as N-
Cadherin upregulation, might occur in conditional E-Cadherin knockouts which could
mask effects mediated by E-Cadherin. The functional role of E-Cadherin in vitro was
directly investigated in wildtype mice, using adhesion-blocking antibodies that
specifically target cadherin extracellular adhesive domains. Homophilic E-Cadherin
191
binding between adjacent cells has been shown to elicit signal transduction simply by
engaging extracellular domains (Liu et al., 2006; Perrais et al., 2007). As with the EcadΔ/Δ
mutants, blocking of Cadherin binding also decreases cell to cell contact allowing the
interactions between NSC colony cells to be tested simultaneously.
Adult CD1 wildtype cells dissected from the adult forebrain ventricles were raised in the
presence of such antibodies for 7 days. Clonal adult neurosphere number decreased in the
presence of E-Cadherin and N-Cadherin antibodies in a dosage-dependant manner in
contrast to P-Cadherin antibody which had no effect on clonal colony formation (Fig 4-
3A.). The colonies observed in these adhesion blocking conditions appeared equal in size
as their untreated counterparts. Notably, both E-Cadherin blocking antibodies
demonstrated negative effects on colony number at high concentrations. This suggests
that specifically blocking either E-Cadherin or N-Cadherin adhesion itself in neurosphere
cells reduces NSC symmetric expansionary divisions or causes the premature
differentiation and thus disappearance of NSCs.
NSC cultures were grown in the presence of cadherin blocking antibodies at 1.0 μg/mL
(Fig 4-3B.), a concentration at which a reduction in colony number is observed using the
ECCD1 α-E-Cadherin antibody (see Fig 4-3A.). Though a reduction in colony number
was observed for both ECCD1 and α-N-Cadherin, the colonies successfully raised in the
presence of these antibodies appeared normal. These were passaged a second time to see
if any effects of α-E-Cad or α-N-Cadherin were apparent in the cells in these colonies. In
the absence of E-Cadherin antibody, the number of colonies arising from ones grown in
192
E-Cadherin and N-Cadherin blocking antibodies were also reduced (Fig 4-3C.) showing
that E- and N-Cadherin engagement reduced NSC symmetric division. However, colony
numbers had recovered somewhat from those grown in the antibodies and by the third
passage, colonies derived from E-Cadherin exposed cells produced normal numbers of
NSC progeny (Fig 4-3D.). These data show that the decrease in NSC self-renewal under
conditions of E- or N-Cadherin binding and/or lessened E- and N-Cadherin adhesion
between colony cells is reversible. Moreover, such data demonstrates that the death or
disappearance of NSCs can thus be ruled out.
Neural cells begin to divide 1-2 days upon passage under clonal proliferation conditions
(P. Karpowicz and D. van der Kooy, unpublished observations). From each colony, a
small subset of the progeny (of approximately 3000 total cells (Karpowicz et al., 2005))
have the competence to subclone. We applied Cadherin antibodies to colonies at day 3, a
timepoint where <10 cells are present in each clonal colony. Intriguingly, no reduction in
colony number is observed when antibodies are applied at this point (Fig 4-3E.)
suggesting that these antibodies take effect during the initial divisions of the in vitro
NSCs, at timepoints when NSCs are present at higher frequency than when colonies are
fully formed. Cell death was next examined in cells initially exposed to antibody to see if
this might explain our reduction before cells begin to divide. Trypan blue exclusion
showed that in the first 24 hours single cells that were exposed to antibody – no
differences in cell death were apparent between cells (Fig 4-3F.). These data show that
the effects of adhesion blocking antibodies are not due to toxicity before cells begin to
divide, but that whatever reduction effect the loss of E-Cadherin causes, happens during
193
Fig 4-3: E-Cadherin and N-Cadherin antibodies reduce NSC colony formation in vitro. (A) Graph shows decrease in number of colonies as adhesion blocking α-Cadherin antibody concentration increases. Colony formation in α-P-Cadherin antibody does not vary at any concentration (p>0.05). At 1.0 μg/mL concentration, ECCD-1 and α-NCad antibody significantly decrease colony formation (F3,57=15.75, p<0.05). At 2.0 μg/mL concentration, ECCD-1, ECCD-2 and α-NCad antibodies significantly decrease colony formation (F3,23=23.39, p<0.05). (B) Primary NSC colony formation is affected by ECad and NCad but not P-Cadherin adhesion block. Graph shows decrease in primary colony formation (asterisks) observed at 1.0 μg/mL ECCD-1 and α-NCad antibody exposure (F3,44=16.14, p<0.05) but not α-P-Cadherin (p>0.05). (C) Graph shows decrease in secondary colony number (asterisk) observed in colonies subcloned from cells exposed to 1.0 μg/mL ECCD-1 antibody (F3,84=17.14, p<0.05) but not α-NCad or α-P-Cadherin (p>0.05) during primary colony formation. Secondary colonies were grown in the absence of antibody. (D) Graph shows recovery in colony formation observed in tertiary spheres grown for two passages, in the absence of antibody, following exposure during primary colony formation. There are no significant differences between any of the groups tested (p>0.05). (E) Graph shows that unlike the decreases observed when plating cells directly into α-Cadherin antibodies (see Fig. 3A. & 3B.), there are no differences when antibodies are applied at day 3 in vitro (p>0.05). These results suggest colony decreases are due to antibody effects during the first 3 days. (F) Graph shows that exposure to antibodies at 1.0 μg/mL does not influence cell death. In no case did antibodies increase cell death over controls plated in the absence of antibody (p>0.05).
194
195
the first few divisions of these cells in vitro. Such a scenario is consistent with the notion
that an NSC divides to produce support cells that facilitate its symmetric expansion or
that maintain it in an undifferentiated state and when this adhesion is blocked, a
deficiency in NSC number ensues. The engagement of E- or N-Cadherin extracellular
domains is not sufficient to lower NSC number at day 3, suggesting that the most
parsimonious explanation is that a decrease in cell to cell contact inhibits a parallel
signalling pathway that is necessary for NSC self-renewal.
The effects of blocking E-Cadherin adhesion on differentiation were next assayed.
Although we previously noted no effects on the differentiation between EcadΔ/Δ and
EcadWt/Wt NSCs, the possibility that E-Cadherin binding would affect NSC differentiation
was examined in wildype cells which carry a functional E-Cadherin gene. First, colonies
raised in the presence of antibody and differentiated in the presence of antibody were
examined. In these conditions, curious phenotypes were observed in neuronal and glial
cells exposed to E-Cadherin blocking antibodies – in particular ECCD-1 (Fig 4-3G: i.) as
compared to P-Cadherin blocking antibodies (Fig 4-3G: ii.) which demonstrated no
altered phenotype. Not only did E-Cadherin antibody abolish neuronal production (Fig 4-
3H: i.), but in these conditions GFAP(+) astrocytes were reduced in number (Fig 4-3H:
ii.) and the diameter of the processes of those that remained was decreased, when either
E- and N-Cadherin were blocked. The most significant effects were observed with the
ECCD-1 and α-N-Cadherin antibodies. The reduced loss of neuronal cells, and no
differences in glial cell production, from NSCs grown in ECCD-2 rather than ECCD-1,
196
Fig 4-3: E-Cadherin and N-Cadherin antibodies reduce NSC colony formation in vitro. (G) α-ECad affects the differentiated progeny of NSCs. Images show colonies of NSCs grown and differentiated in the presence of: i) ECCD-1 or ii) α-P-Cadherin antibodies. Proteins of interest are shown in red, DAPI counterstain in blue. Note obvious altered morphology and number of neurons (β-III Tubulin+) and astrocytes (GFAP+) types grown in ECCD-1 as opposed to α-P-Cadherin control antibody. (H) Graphs show reduction in: (i) neuronal production (n=4 colonies sampled, F3,13=9.831, p<0.05), and (ii) astrocyte production (n=4 colonies sampled, F3,15=15.89, p<0.05) by NSC colonies. Asterisks indicate groups which are significantly different from α-P-Cadherin control.
197
198
are likely a result of the concentrations of this antibody which is only observed to
produce proliferation deficits at higher concentrations (see Fig 4-3A.).
These data show that blocking of endogenous E-Cadherin abolishes neuronal
differentiation in vitro, which is consistent with our observations of reduced BrdU(+)
cells in the olfactory bulb of EcadΔ/Δ mice. A reduction in E- and N-Cadherin adherence
reduces astrocyte production but this is not seen in the EcadΔ/Δ mutant (data not shown),
suggesting that a compensatory mechanism overcomes this deficiency in the mutant and
that this effect does not take place upon the NSC but on a differentiating E-Cadherin
wildtype astrocyte precursor. Taken together these experiments indicate that lessening E-
Cadherin adhesion reduces NSC number as well as the frequency of neuronal and glial
precursor proliferation in vitro. Such phenomena only take place during the first divisions
of NSC and/or neural progenitors in vitro, are reversible, and do not take effect through
the death of NSCs.
Increased E-Cadherin Adhesion Increases NSC Number In Vitro
We sought to determine what effect, if any, the overabundance of E-Cadherin would have
on NSCs in vitro. Adult CD1 NSCs were infected with retroviruses carrying human E-
Cadherin, N-Cadherin, or the E-Cadherin sequence with the β-Catenin binding domain
removed (ΔE-Cadherin). This last construct would allow the specific effects of only the
extracellular E-Cadherin adhesive domain to be tested sans an intracellular domains
which is known to affect Wnt signalling by binding β-Catenin (Gottardi et al., 2001). One
week following infection, E-Cadherin as well as ΔE-Cadherin overexpressing cells
199
produced increased numbers of neurosphere clones compared to cells expressing a
control retrovirus or those expressing the N-Cadherin transgene (Fig 4-4A.). Because
there is a possibility of transgene suppression in these cells, we confirmed that at this
timepoint 69.2 ± 5.1% of neurosphere cells were still positive for a GFP reporter that
indicated successful transduction and of these, 78.1 ± 2.3% reacted positively for E-
Cadherin antibodies as assessed by flow cytometry. Although not all cells were positive
at this timepoint, the increased incidence of Cadherin expression was sufficient to alter
the numbers of clones arising from E-Cadherin but not N-Cadherin retrovirus treated
cells (Fig 4-4A.). This suggested increased E-Cadherin adhesion increases the number of
NSCs capable of forming neurosphere colonies, perhaps by improving cellular contact
during the first few divisions of NSCs. Moreover, these increases in colony number were
not a general increase in proliferation, as colony size was not altered in the E-Cadherin or
ΔE-Cadherin overexpressing NSCs (data not shown).
We passaged the clones arising from this experiment to see if the overexpression of E-
Cadherin would exert itself over time. Similarly to our previous results, E-Cadherin and
ΔE-Cadherin increases lead to more colonies than control retrovirus, although it was
noted that N-Cadherin overexpression (which did not increase primary clone number)
now lead to greater numbers of secondary clones as well (Fig 4-4B.). Single GFP(+)
colonies (indicating successful transgene induction) from either E-Cadherin, N-Cadherin,
or ΔE-Cadherin were passaged at clonal density to confirm that the overexpression of
cadherins in these founder cells lead to increased numbers of colonies (data not shown).
These results suggest that increased adhesion supports greater NSC numbers over
200
Fig 4-4: E-Cadherin and N-Cadherin increase NSC colony formation. (A) Graph shows increase in neurosphere production when NSCs are induced to overexpress ECad. Asterisks indicate pMXIE: E-Cad and pMXIE: ΔE-Cad significantly increase primary colony number (F3,207=29.93, p<0.05). (B) Graph shows increase in number of colonies upon passage, following E- or NCad overexpression. Asterisks indicate pMXIE: E-Cad, pMXIE: N-Cad, and pMXIE: ΔE-Cad significantly increase secondary colony number (F3,177=31.03, p<0.05). This suggests N-Cadherin overexpression shows a reduced effect relative to E-Cadherin (compare Fig 4A and 4B).
201
202
controls, with a stronger effect seen through E-Cadherin and ΔE-Cadherin than N-
Cadherin overexpression, which is only revealed during passaging (compare Fig 4-4A. to
B.). In these passaged cells, either increased adhesiveness improves cellular contact
during the initial divisions (as it does with primary neurospheres) or NSCs possess a
cellular memory due to increased adhesion present during primary colony formation. If
the second of these is true, more NSCs are present in the Cadherin overexpressing
primary colonies.
Importantly, the increase in NSC colony number via Cadherin overexpression shows that,
if anything, Cadherins cause increased rather than decreased symmetric NSC division.
This excludes the possibility that under conditions where E-Cadherin is abolished in the
EcadΔ/Δ animals, symmetric NSC division was increased which spent the NSC population
prematurely. Thus these results more likely suggest that by increasing the closeness of
colony cells, NSCs are themselves increased – either through more symmetric divisions
or by the maintenance or survival of NSCs in an undifferentiated state.
Discussion
We find the adhesion protein, E-Cadherin, to display specific regulatory effects on the
division of NSCs isolated from the subependyma of the adult forebrain ventricles. The
conditional knock-out of E-Cadherin decreases the numbers of NSCs over time in aged
animals, or when NSCs from younger animals are passaged in vitro. Strikingly these
203
losses are coincident with greater cellular proliferation in neurogenic subedendymal
regions in vivo but this is a proliferation milieu which cannot be sustained for long
periods of time. Subsequently, this same lowered E-Cadherin binding also reduce non-
NSC progeny which migrate to the olfactory bulb.
Importantly, the perturbation of E-Cadherin adhesion by antibody also reduces NSC
number upon secondary passage in vitro. The specific blocking of E-Cadherin by
antibody in wildtype cells, engages the extracellular domains of the protein and
simultaneously disrupts E-Cadherin cell to cell contact between colony cells. The loss of
colony number by E-Cadherin but not P-Cadherin antibody-exposed NSCs, suggests that
E-Cadherin is specifically needed by adult NSCs. However, no decrease is evident in
NSC numbers if antibody is applied at day 3 of culture. Unless there is a penetrance issue
with antibody administered at timepoints when colony size is <15 cells (the approximate
size of colonies at this stage), it seems unlikely that the simple engagement of E-Cadherin
elicits the decrease in NSC number in vitro. This means that E-Cadherin is not likely to
participate in a direct signalling process that impedes NSC maintenance but to perturb an
unrelated pathway that is affected by adhesion.
The differences observed between mutants and wildtypes, antibody raised NSCs and
controls and Cadherin overexpressing NSCs and controls are all moderate effects. In the
EcadΔ/Δ this is perhaps due to compensatory adhesion carried out by N-Cadherin which is
known to be co-expressed with E-Cadherin in the ventricular zones (Rasin et al., 2007).
In recent studies, both proteins are observed to polarize radial glia in this region, which
204
means that the conditional ablation of one might be compensated for by the other. This
accounts for our observation that N-Cadherin retrovirus and blocking antibody
phenocopy the same E-Cadherin perturbations. Differences in adhesion block by
antibodies are most likely lessened due to insufficient concentrations of α-E-Cadherin
and α-N-Cadherin, which produce more pronounced effects at higher doses. These data
further support the notion that it is adhesiveness in general which affects the number of
NSCs.
It is unclear if the increase in progenitor proliferation is a separate E-Cadherin mediated
effect from that occurring in NSCs. The simplest explanation is that E-Cadherin only
affects NSCs and these non-NSC phenomena are a downstream outcome. For instance, E-
Cadherin displays effects on the output of neurons but the ultimate cause of these losses
may be the loss of multipotent NSCs. Similarly, the increase in progenitor proliferation in
vivo may occur as a result of differentiating NSCs adding to the progenitor pool, or
alterations in the proportion of asymmetric versus symmetric NSC divisions, without
actually altering the rate of progenitor division.
Yet it is unfair to completely disregard non-NSC mediated effects. In particular, the
differentiation of astrocytes from wildtype precursors seems to be impeded under
antibody block, and this is difficult to explain using an NSC mechanism as it would
suggest E-Cadherin increases rather than decreases differentiated cell types. We note that
because astrocyte differentiation is not altered in the EcadΔ/Δ animals, the differentiation
205
of astrocytes is likelier to be the result of E-Cadherin engagement in these cells rather
than an outcome of altered NSC behaviour.
Our data show that NSC number is altered in contexts where E-Cadherin adhesiveness is
altered. There are three straightforward interpretations: 1) That E-Cadherin negatively
regulates the frequency of NSC division, and in its absence NSCs divide rapidly until
they prematurely reach senescence; 2) That E-Cadherin regulates the symmetry of
divisions to favour asymmetric NSC divisions; or 3) That NSCs depend on a signalling
process, such as Notch-Delta signalling, that is indirectly affected by cellular association
via E-Cadherin. If the first of the proposed interpretations is correct we hypothesize that
EcadΔ/Δ embryos should contain more NSCs than EcadWt/Wt. However, this does not seem
to be the trend as younger EcadΔ/Δ adults have an equal number of neurosphere spawning
NSCs as EcadWt/Wt. Moreover, because the application of function blocking antibody does
not increase NSC symmetric divisions (no increase in secondary colony formation), it is
unlikely that E-Cadherin suppresses these divisions and thus we suggest that the effects
seen are not due to premature NSC senescence.
The second of these interpretations predicts that either symmetric or asymmetric
divisions would be either increased or decreased via E-Cadherin. However, it is difficult
to reconcile the increase in neurosphere number with E-Cadherin overexpression in one
experiment with another showing an increase in cell proliferation in EcadΔ/Δ conditional
knock-out mice. Such data seem to defy a direct role for E-Cadherin in either supporting
or reducing asymmetric division in a straightforward fashion. A separate influence of E-
206
Cadherin, in regulating progenitor cell proliferation might resolve this issue, but as such
would require the use of a two-factor explanation.
We thus favour the third interpretation that E-Cadherin is indirectly affecting other
juxtacrine signalling processes between NSCs and adjacent cells. This is the simplest
explanation of our study. E-Cadherin positive NSCs need close contact with E-Cadherin
expressing support cells (or other NSCs) that regulate NSC number by allowing these to
resist an intrinsic differentiation programme or by increasing symmetric NSC divisions.
Without this association, the NSC pool is lower in animals that do not contain neural E-
Cadherin and this decrease becomes apparent over time. The stepwise loss of EcadΔ/Δ
NSCs upon passage, suggests a halving of a signal such as Notch which maintains NSCs.
Similar losses were observed through the functional block of N-Cadherin but its specific
role for in NSCs needs to be tested explicitly using a conditional N-Cadherin knock-out.
If this third interpretation is indeed correct, our in vitro results suggest NSCs are the
founders of niche cells in this system (because in vitro NSCs are clonally producing their
own niche cells), a role which is not the case in classic stem cell tissues such as the
Drosophila gonad. The identity of these support cells is unclear, these may be any neural
cell types including NSCs themselves.
The second and third interpretations are not mutually exclusive and may even be
complementary. E-Cadherin regulation of NSC division symmetry might act directly
though a parallel signalling pathway that is affected by adhesion. In conditions of
increased Cadherin presence, the number of SCs contacting support cells would affect the
207
signals SCs received. Contacting cells and might thus determine the functional symmetry
of NSC division by physical closeness; those NSCs which do not contact support cells
would become progenitors (Lin, 1997). A related idea is that contact to a locus actually
polarizes cells, allowing them to divide asymmetrically (Betschinger and Knoblich,
2004). Studies that have demonstrated a polarization of cadherins in precursors in a
variety of systems (Song et al., 2002b; Rasin et al., 2007). Our interpretations are
consistent with these conclusions.
Such processes are suggestive of a niche-dependant mechanism of sensing physiological
change. The upregulation of a particular Cadherin within precursors, could increase SC
binding to support cell groups which increases the number of SCs through the
dedifferentiation of progenitors into SCs (Yamashita et al., 2003; Brawley and Matunis,
2004; Kai and Spradling, 2004) or simply a facilitated survival of SCs. This would indeed
account for the effects observed when either E- or N-Cadherin are overexpressed in
NSCs in vitro. It is tempting to speculate that both NSCs and support cells have the
ability to regulate NSC number. The former by intrinsically regulating its own expansion
or favouring NSC exit and differentiation, and the latter by limiting NSC expansion
concomitantly with a reduction in E-Cadherin expression. In line with this reasoning,
there is some evidence to suggest both Notch signalling dependant niche cells and Dpp
signalling dependant SCs share the redundant abilities of negatively regulating the SC
pool (Ward et al., 2006; Song et al., 2007). The adherence of these cell types to one
another represents a parallel pathway that determines SC number.
208
The E-Cadherin protein has been the subject of numerous studies focusing on its role in
metastasis. Remarkably SCs and cancer cells possess similarities that are suggestive of a
direct ontogeny between these cell types (Reya et al., 2001). The SC niche has been
proposed to play a role in tumour formation by acting on cancer SCs (Gilbertson and
Rich, 2007). Yet E-Cadherin is lost in nearly all forms of epithelial cancers which are
formed by overproliferating cells (Christofori and Semb, 1999). Indeed the loss of E-
Cadherin adhesion generally increases rather than decrease cell proliferation in a number
of systems (Tinkle et al., 2004; Liu et al., 2006; Perrais et al., 2007). This shows a
contrast between cancer cells and NSCs, where adhesion increases causes an increase in
NSC number. These differences shed light on the precise characteristics of cancer cells
that are of fundamental importance in understanding tumorigenesis.
209
Chapter VI.
General Discussion
210
Four studies are presented in this thesis: the first two demonstrating the intrinsic
asymmetric partitioning of genomic DNA in stem cells, the third demonstrating the
limitations of stem cell output when such cells are introduced into alternative niches, and
the fourth demonstrating the regulatory consequences of stem cell compartmentalization
in stem cell niches by adherence. Prima facie one might think there is both inconsistency
and tension between intrinsic and extrinsic pathways occurring in the same stem cell,
potentially at the same time.
It is important to note that the asymmetric partitioning of chromosomes is dependant on
the germ stem cell niche in vivo. The overexpression of a ligand which maintains
Drosophila germ stem cells resistant to differentiation delocalizes the niche and fails to
polarize cells so that asymmetric partitioning cannot occur. This manipulation provides
evidence that intrinsic processes occur subsequent to extrinsic processes, and suggests
that external cues drive the intrinsic apparatus in stem cells. For instance, murine neural
stem cells also demonstrated asymmetric DNA partitioning in vitro, two divisions upon
the separation of cells. One might think these data suggest that the niche is therefore
irrelevant for neural stem cell types, however, it is not possible to exclude extrinsic
processes for two reasons. First, because it is conceivable that such cells were polarized
prior to dissociation which pre-established asymmetric partitioning of chromosomes to
take place. Studies on the centrosome in Drosophila have suggested the mother
centrosome is localized due to extensive tubulin attachment at the same side of the cortex
as the location where cells adhere to niche cells (Siegrist and Doe, 2006; Yamashita et al.,
2007). A similar structural fixation of the cytoskeleton may have taken place, prior to cell
211
dissociation, priming the neural cells to divide asymmetrically. Notably only a minority
of cells demonstrate this asymmetry following dissociation, with the larger proportion
dividing symmetrically. In this sense, only a subset of immediately dissociated cells seem
to possess a ‘memory’ of their previous environment. Second, it is possible that in culture
neural stem cells participate in the formation of their own niche – dividing to produce the
support cells that signal to stem cells and polarize them to enable asymmetric divisions to
occur. Experiments undertaken here, showing the dependence of neural stem cells on E-
Cadherin in vitro, support the presence of a niche in this system as do studies showing the
effects of Notch (Hitoshi et al., 2002a).
It is therefore suggested that while intrinsic and extrinsic processes each play a role
during stem cell divisions, extrinsic mechanisms trump intrinsic ones if a cell is
competent to respond to them. Indeed the intrinsic asymmetry of division is seemingly
dependant on extrinsic environment to polarize asymmetrically dividing parent cells in all
organisms excepting C. elegans (Betschinger and Knoblich, 2004). Similarly, the
generation of differentiated progeny from stem cells may depend on maintenance of such
polarization by local cues in the stem cell niche (Fig 5.).
A similar interplay between extrinsic and intrinsic mechanisms operates in both adult and
developing tissues. The Drosophila germarium bears an intriguing resemblance to the
asymmetric division of blastomeres in Ciona embryos (Picco et al., 2007). In this
protochordate, a blastomere divides to produce both neural and mesodermal precursors
by virtue of the fact that one side contacts a cell presenting the Ephrin ligand which
212
Fig 5: Model of niche-dependant SC polarization and subsequent asymmetric division. Diagram shows a hypothetical niche cell (red) which is responsible for the formation of a stem cell niche either by paracrine or juxtacrine factors. The introduction of a hypothetical stem cell (yellow), competent to respond to these factors – polarizes the stem cells by virtue of how factors are physically localized closer to the niche cell. This results in an asymmetric division, whereby daughter cells are no longer present in the stem cell’s niche position and thus lose stemness (white). As indicated here, such hypothetical scenarios may be caused by niche cells which are distinct from the stem cells. However, it is equally feasible that stem cell themselves could act as niche cells in a similar situation.
213
214
inhibits mesodermal commitment. The cell participating in Eph/Ephrin signaling does not
differentiate into mesoderm and goes on to produce neural progeny. Thus the division is
asymmetric because of cell contact with a localized contact dependant niche that
polarizes the dividing precursor and primes the daughters to assume disparate fates, even
though the ultimate causes of differentiation are extrinsic. Along a similar vein,
experiments have shown that association of murine T-cells and their antigen presenting
cells, results in polarization of T-cells and their subsequent asymmetric division into
effector and memory T-cell daughters (Chang et al., 2007). Again it is the association of
the mitotic T-cell with the antigen presenting cell that polarizes it and drives different
fates in its daughter cells. A model in which a contact dependant niche polarizes a cell to
drive asymmetric division can be formulated from all of these instances. Because these
phenomena take place in diverse organisms, this niche-dependant polarization likely
represents an evolutionarily conserved mechanism. It is possible asymmetric division and
the generation of discrete cell types makes use of a niche-related polarity in many
biological situations, and that this process has been co-opted in diverse situations during
the evolution of these animals from a common ancestor.
Although much of the stem cell field has made use of information gleaned from the study
of hematopoietic stem cells, I hypothesize that these represent an exception to the
phenomena observed in this thesis. One reason for this is that there is no direct evidence
blood stem cells remain localized to a niche (Wilson and Trumpp, 2006; Kiel et al.,
2007b; Hooper et al., 2007), and it is known that these cells leave the bone marrow to
circulate throughout the adult vasculature. This means that hematopoietic stem cells
215
possess distinct properties from stem cells in other tissues – certainly different from the
obligately adhering germline and neural stem cells described here (Lin, 1997; Alvarez-
Buylla and Lim, 2004). In line with this reasoning, there is no evidence supporting the
asymmetric divisions of hematopoietic stem cells and asymmetric segregation of
chromatids according to the Immortal Strand Hypothesis has not been observed (Kiel et
al., 2007a). It is formally possible that like T-cells, asymmetric divisions might occur in
the bloodstream (Chang et al., 2007). If such divisions do not occur at all, the emergence
of multilineage progeny from hematopoietic stem cells must be accounted for by the
differentiation of one or both daughters following rather than concomitant to actual
division events.
Neural stem cells have been shown to alter their intrinsic gene expression in response to
extrinsic cues when displaced from their niche (Hitoshi et al., 2002b). Here the
limitations of neural stem cells to participate in alternative niches was tested by the
forcible association of such cells with the inner cell mass of the blastocyst. Needless to
say, this is a niche very different from that found in the lateral ventricles of the E9.5 and
adult forebrain where such cells are competent to contribute. Although the adherence of
these cells to this early environment was somewhat successful, it was noted that in no
case did these cells participate in normal processes occurring in that environment. This
suggests the neural cells are either insensitive to the extrinsic processes in the inner cell
mass region, or that they are incapable of transducing extrinsic signals from that locale.
These data demonstrate (the somewhat obvious point) that participation in the stem cell
niche is not induced by adhesion alone. Cells must possess other means of responding
216
and interpreting other environmental signals to enable their functioning in that
environment (Kai and Spradling, 2003). Conversely, data obtained by studying E-
Cadherin itself in neural stem cells shows that it exerts an effect on the differentiation of
such cells. This suggests that adhesion alone can regulate stem cell number by recruiting
and associating stem cells in locales where, because such cells are competent, they are
maintained in a dividing and self-renewing state (Song et al., 2002b; Tanentzapf et al.,
2007). These same cadherins and integrins that associate cells to a niche, have been
shown to further polarize such cells during development (Rasin et al., 2007), homeostasis
(Kuo et al., 2006), and division (Thery et al., 2007) raising important question regarding
the interplay between subcellular structure and the niche (Fig 5.).
Indeed, an intriguing idea arising from these studies is the inheritance of structure itself.
What I mean by this is the inheritance of protein form (in conjunction with protein code)
from parent cell to offspring. The phenomenon was first described by Sonneborn, who
named the process of structural inheritance, cytotaxis, to describe the movement of
cytosol and cellular components from mother to daughter cell (Sonneborn, 1964).
Sonneborn’s initial studies were on the organization of flagellar proteins which, when
reoriented or duplicated, preserved their abnormal structure throughout numerous
generations without reversion into wild phenotype. Genetic code alone was insufficient to
produce the normally observed shape. Nearly fifty years after its inception, studies now
support this notion. Both investigations into the inheritance of cortical (Chen et al., 2000)
and centrosomal (Feldman et al., 2007) structures show that parental structures organize
physical characteristics of the nascent daughter cell, respectively affecting the site of
217
future division and the position of other organelles. Prion based diseases show a similar
inheritance, at least in principle, with an analog method of inheritance that changes the
shape of existing proteins into an alternative tertiary structure that can be then inherited in
catalytic fashion (Alberts et al., 2002). The inheritance of form thus represents additional
information which is not necessarily inherited by means of code itself, but which is
evoked as an additional dimension of information carried by sequence. These examples
illustrate that in some cases the inheritance of molecular information is dependant on the
non-genetic pre-existing form of molecular templates.
Strikingly, Drosophila germline stem cells seem to undergo a variation of cytotaxis as
well. In the germline stem cells of the Drosophila testes, it has been noted that extensive
microtubules project from the maternal centrosome so as to anchor it at the cortex
apposed to the hub cells (Yamashita et al., 2007). The precise protein interactions
mediating these phenomena are currently not well understood, however, it is proposed
that Adenomatous Polypsis Coli protein (APC) binds to both microtubules emanating
from the centrosome and β-Catenin (Yamashita et al., 2003). By such means APC tethers
the DE-Cadherin complex that associates stem cells with support cells and the
centrosome complex itself. In contrast to the GSC daughter, the gonioblast daughter
possesses the same genes, yet does not seem to exhibit the GSC subcellular polarity.
Proteins which are encoded by genomic DNA and which are dependant on classic code
based inheritance, therefore display alternative tertiary or quaternary structures which
provide an additional non-encoded source of spatial information for the next generation
of GSCs. For instance, daughter centrioles are thought to be spawned from mother
218
centrioles, meaning that the assortment of proteins in the mother centriole serves as a
template for its progeny (Alberts et al., 2002; Pederson, 2006). In the absence of a
maternal centrosome, centrosomes can be formed de novo – but these randomly spawned
centrosomes now exhibit random spatial and temporal properties as well as a
randomization in centrosome number. This shows that in the absence of pre-existing
form, the daughter form would be altered. Strangely, in the female ovary it is doubtful if
maternal centrosome anchoring takes place (Stevens et al., 2007). In the absence of a
centrosome-mediated polarity it is possible that cellular polarity and spindle orientation
could be mediated by Cadherins themselves (Song et al., 2002a; Thery et al., 2007).
Though I show no direct evidence of this, the maintenance of neural stem cells by E-
Cadherin might occur through such an intrinsic mechanism rather than extrinsic signaling
mediated by cellular association. Future work needs to address whether the polarization
of the cytoskeleton and extracellular adhesive molecules is preset in stem cells and their
polarized shape maintained throughout successive stem cell divisions, similarly as
Sonneborn observed in the dividing protozoan. One important caveat to this idea is that,
unlike the protozoan, it has been shown (at least in Drosophila) that it is only one
daughter that retains the stem cell form while the other goes on to assume a novel one.
How has such polarity evolved? The protein which is thought to tether the maternal
centrosome in Drosophila, APC, is also known to participate in chromosome segregation
(Cleveland et al., 2003; Green and Kaplan, 2003), adhesion and cytoskeletal regulation in
mice (Fodde, 2003) including the central nervous system (Senda et al., 1998). Yet most
striking is the observation that the yeast orthologue of APC, Kar9, participates in
219
orienting the plane of mitosis by polarization (Gundersen and Bretscher, 2003). During
mitosis in budding yeast, Kar9 binds to only the daughter spindle pole body of the parent
cell, migrates to the plus end of microtubules, and then moves down actin filaments to the
site of the budding cortex of the new cell. This orients the spindle by asymmetric
localization of a protein in the direction of the nascent daughter. It is tempting to
speculate that its functional and sequential orthologue, APC, has been co-opted during
evolution to participate in a similar process occurring in metazoan stem cells.
It may be useful to extend this concept beyond the crystalline structure of cytoskeletal
and flagellar proteins. Because the leading and lagging strands should contain roughly the
same sequences, the non-random distribution of chromosomes represents primarily a
structural rather than genetic asymmetry between daughter cells. Replicated DNA within
daughter cells is not significantly different by sequence, but might permit a significant
epigenetic structural difference to arise. If histones or other DNA packaging proteins
remain bound to either the leading or lagging strand an epigenetic structure would thus be
committed to the one daughter but not the other.
Nucleosomes which physically package DNA are known to contain octamers of the core
histones: Histone-2A, Histone-2B, Histone-3 and Histone 4 (Alberts et al., 2002). It is
known that the packaging of DNA affects the transcription of sequences packaged, and
that the acetylation and methylation of core histone residues affects the transcription of
the genes bound to these (Patterton and Wolffe, 1996; Alberts et al., 2002). These
acetylation and methylation state of histones and their concomitant active or inactive
220
transcription states can be inherited from parent to daughter cell (Smith et al., 2002). In
addition transcription factors and Polycomb and Trithorax complexes provide an
additional dimension of packaging by affecting DNA accessibility (Alberts et al., 2002).
Certain DNA sequences, such as the Fab-7 Polycomb Responsive Element can be
inherited both mitotically and meiotically in active or inactive configurations (Cavalli and
Paro, 1998). Others such as the chromatin remodeling factor, Bmi-1, have been shown to
have strong effects on maintaining the proliferative state of neural stem cells (Molofsky
et al., 2003).
Asymmetric inheritance of these structural components bound to one daughter strand –
would mean that the structure of the genome and its subsequent transcription expression
profile will be committed to one daughter exactly as in the parent, but not the other
whose structure will be assembled de novo (Jablonka and Jablonka, 1982b). Although
there is some controversy surrounding the distribution of the histone proteins which
package DNA (Leffak et al., 1977; Leffak, 1984; Leffak, 1988; Gruss et al., 1993), it has
been largely ignored because it is known that histones bind to DNA extremely efficiently
and the repackaging of duplicated DNA seems overall more or less even between
daughter cells (Jackson, 1988; Alberts et al., 2002; Gruss and Sogo, 1992). These have
been quantified in a general sense, rather than by investigating specific functional
regions. Nonetheless, studies on the deposition of histones have produced some puzzling
results, including suggestions that histones remain attached during DNA replication and
thus one strand retains parental histones while the other does not (Randall and Kelly,
1992). Though it is known nucleosomes on both chromatids contain histones newly
221
synthesized during DNA replication (Alberts et al., 2002), the possibility that subsets of
nucleosomes are laid down only on one strand or that parental nucleosomes are inherited
intact on this one strand but not the other, mean that a fundamental epigenetic asymmetry
might exist between sister chromatids at the moment of their inception. One might call
this idea the Ancestral Histone Hypothesis.
At present the mechanism underlying asymmetric chromosome segregation is not known.
However the studies presented in this thesis, as well as those cited within, hint that stem
cell division asymmetry is linked to an extrinsic, niche-dependant polarization of the
dividing stem cell that, in addition to DNA, separates cytoplasmic components such as
adhesion-related proteins (Song et al., 2002b; Yamashita et al., 2003), organelles (Deng
and Lin, 1997) including centrosomes (Yamashita et al., 2007) asymmetrically. These
observations suggest a network of interactions leading to the general localization of
biochemicals, including chromosomes. In principle there are two steps necessary to carry
out the localization of chromosomes themselves: 1) a means of identifying particular
chromosomes uniquely so that these may be identified; and 2) a method of associating all
targeted chromosomes with the stem cell pole apposed to the support cells of the niche.
Research on the organization of the mitotic spindle sheds some light on this problem.
A search and capture mechanism has been proposed to underlie the binding of
kinetichores to microtubules emanating from the spindle (Nedelec et al., 2003). In this
model, the minus ends microtubules reaching from the aster elongate and shrink
randomly into the cytosol until they attach to kinetichore regions. There they stabilize to
222
prepare for chromatid segregation. Can this process segregate chromatids non-randomly?
Theoretical models have been proposed involving sense versus anti-sense sequences on
the leading and lagging strands that might be used to differentiate chromosomes
replicated from one or the other (Jablonka and Jablonka, 1982a). If the sequence “T-A-R-
G-E-T” is present in a sense direction on the leading strand but not the lagging strand, a
protein bound to this sequence would in effect mask TARGET on the leading strand, but
as the sequence is replicated from the lagging strand – TARGET would be now
unmasked on the newly synthesized leading strand. This provides a means to differentiate
chromatids as they are replicated by means of sequence. A slight variation of this theme
could be that a slight temporal lag in the binding of a protein to TARGET on the newly
synthesized leading strand, enables the formation of a complex marking TARGET
preferentially on the older leading strand. In either case, the sense versus anti-sense
sequences present on leading versus lagging strands which result in asymmetric DNA
replication mechanisms might also allow for asymmetric chromatid identification.
TARGET regions would not necessarily have to be present on the highly conserved
centromeric regions as other regions of DNA can bind to microtubules during spindle
formation via microtubule motors (Heald et al., 1996; Nedelec et al., 2003; Basto et al.,
2006), or through other proteins (Chikashige et al., 2006). Indeed, in some cases normal
bipolar spindles function to segregate chromosomes even when centromeric regions have
been silenced (Cleveland et al., 2003). Mitosis could be paused until all microtubules
from ancestral strands were tethered to the same pole. The protein Aurora-B participates
in a complex that halts mitosis until a amphitelic orientation between microtubules from
both spindle poles and separate kinetichores is obtained (Watrin and Legagneux, 2003).
223
Normally an orientation between any of two chromatid kinetichores and any of the poles
is sufficient, but if chromatids must relocate to a specific pole it may be that a protein like
Aurora-B delays mitosis until the correct pole is targeted. Using targeted protein
chaperones in combination with mitotic delay, it is plausible that microtubules from one
spindle pole could bind to one half of the chromatids specifically during search and
capture.
Alternative mechanisms have also been proposed to underlie the formation of the spindle
pole apparatus that flanks the dividing nucleus. These have emerged from studies
showing the self-organization of bipolar spindles upon DNA in the absence of
centrosomes (Basto et al., 2006), in the absence of centromere or kinetichore regions
(Heald et al., 1996), and the nucleation of microtubules induced at a distance by enzymes
localized on and around chromatin itself (Hyman and Karsenti, 1996; Nedelec et al.,
2003; Kalab et al., 2002). Such studies suggest DNA itself induces the formation of
microtubules rather than waiting for microtubules to approach it. This rephrases the
spindle to DNA attachment problem. If DNA can drive the formation of bipolar spindles,
a biased microtubule polymerization from one set of chromatids might result in the
preferential association of certain chromatids with one spindle pole rather than the other.
Such effects would depend less on a microtubule affinity to different sequences on the
sister chromatids, as in the TARGET account given above. The DNA driven mechanism
of spindle formation shows that chromatids themselves are not merely passive players in
nuclear division, dependant on the spindle for movement. Rather chromatids themselves
function to initiate and orchestrate their own segregation. While such ideas seem at odds
224
with the search and capture mechanism, there are clear examples of biopolar spindle
nucleation in the absence of centrosomes (Nedelec et al., 2003). Perhaps asymmetric
chromatid segregation would depend on asymmetric microtubule localization rather than
chromatid recognition. Curiously, it has been proposed that the asymmetric segregation
of chromatids during the mesodermal differentiation of embryonic stem cells is Left-
Right-Dynein (LRD) dependant (Armakolas and Klar, 2007). While there is no LRD in
the fruit fly, where asymmetric chromosome segregation appears to occur, cytoplasmic
Dynein is a known kinetichore minus end motor that participates in mitosis (Cleveland et
al., 2003). Surprisingly, it does not seem that Dynein functions in chromosomal
movement during mitosis in Drosophila, but rather is involved in the tethering and
positioning of centrosomes to opposite poles of the cell (Robinson et al., 1999). Dynein
functions to orient germ cell divisions to ensure normal oocyte differentiation (McGrail
and Hays, 1997), and displays asymmetric localization in the nascent oocyte (Li et al.,
1994). This is a second mechanism that might allow non-random chromatid movement.
The synthesis of the mitotic apparatus is redundant, self-organizing and combines search
and capture mechanisms with an secondary active role for DNA. A mechanism
accounting for non-random chromosome segregation may combine elements of both
ideas outlined above. Moreover, recent findings have shown that telomeres bind directly
to spindle poles during meiosis in Schizosaccharomyces pombe (Chikashige et al., 2006),
and appear needed to orchestrate successful meiotic spindle pole formation (Tomita and
Cooper, 2007). These events precede centromeric to microtubule binding, and by their
225
regulative nature, suggest it is feasible the interplay between chromosomes and the
spindle could direct asymmetric chromosome segregation.
A final model to explain non-random chromatid segregation is recombination and
crossing-over itself. Induction of FLP-driven recombination has demonstrated the
separation of recombinants in Drosophila (Beumer et al., 1998). It is thought that
segregation events occurring in the G2 phase, following DNA replication, result in X-
segregation patterns – where recombinant chromatids/chromosomes invariably migrate to
opposite poles. If the correct pattern of recombination events were to occur, either
between both chromatids and/or between duplicated chromosomes, this in theory could
mobilize any chromosomes to a particular pole. Certainly such a scenario is difficult to
envision occurring for all duplicated chromatids of the 40 chromosomes in a mouse cell,
but it is formally possible. The primary difficulty in accepting this simple hypothesis is
that it undermines the biological relevance of asymmetric chromatid segregation prima
facie. Both the reduction in mutation load and epigenetic causes would be obviated were
sister chromatids to exchange any gene-rich regions. However, recombination without
crossover, or recombination in gene-poor regions might not affect the overall purpose of
asymmetric genetic and structural inheritance.
The fundamental structure of DNA and its semi-conservative replication mode, elegantly
demonstrated in bacteria by Meselson and Stahl (Meselson and Stahl, 1958b), have led to
the assumption that the inheritance of genomic sequence by DNA is equivalent between
daughter cells. Clearly the non-random cosegregation of chromatids, or the unequal
226
inheritance of DNA strands carries important physiological and evolutionary
implications. How could non-random chromatid segregation evolve? The fission yeast, S.
pombe segregates one strand of parental chromosomes as a differentiating mechanism
(Klar, 1990; Dalgaard and Klar, 2001). Such a mechanism might have been co-opted in
metazoans as either a differentiating process (Jablonka and Jablonka, 1982a; Armakolas
and Klar, 2006; Jablonka and Jablonka, 1982b; Lansdorp, 2007) or as one that reduces
mutation load in critical cells (Cairns, 1975; Cairns, 2006). A third (I admit equally
speculative) possibility is that a conservation of particular strand might lead to selective
advantage of particular cells over others during development and during evolution. This
is simply because uneven inheritance of code or epigenetically modified code, by
definition, creates a selection process.
For instance, germ cell selection among genetic mosaics has been shown to bias the
population of cells that give rise to the germ line (Extavour and Garcia-Bellido, 2001).
Similarly, inferences have been drawn suggesting that the default fate of primordial germ
cells, whose number is much greater than that of the germline stem cells, is actually to
differentiate (Bhat and Schedl, 1997). Only a subset of these become germline stem cells
(Asaoka and Lin, 2004). Yet it is the cells which remain undifferentiated that persist to
produce the gametes of the adult animal and, in turn, the gametes of future generations. In
most of Metazoa germ cell specification is not immediate (Extavour and Akam, 2003),
meaning that a window of opportunity exists during development whereby genetic or
epigenetic discrepancies between embryonic precursors might affect the which cells
become the founders of the next generation. The nascence of a self-renewing germline
227
stem cells may thus be the outcome of a cellular selection process that is a direct result of
uneven genomic inheritance between daughter primordial germ cells. This would present
a strong evolutionary pressure for such a mechanism to arise, and the differentiation and
anti-mutation effects of the process were later additions. One can imagine that similar
occurrences might take place in any tissue and with similar outcomes. It is worth testing
such speculative hypotheses, because if they are true – cell selection, stem cell ontogeny,
asymmetric divisions, and stem cell multipotency might be accounted for with far fewer
reasons than are invoked today.
228
Reference List
1. Ackermann,M., Stearns,S.C., and Jenal,U. (2003). Senescence in a bacterium with asymmetric division. Science 300, 1920.
2. Aguilaniu,H., Gustafsson,L., Rigoulet,M., and Nystrom,T. (2003). Asymmetric inheritance of oxidatively damaged proteins during cytokinesis. Science 299, 1751-1753.
3. Alberts,B., Johnson,A., Lewis,J., Raff,M., Roberts,K., and Walter,P. (2002). Molecular Biology of the Cell. (New York: Garland Science).
4. Alvarez-Buylla,A., Garcia-Verdugo,J.M., and Tramontin,A.D. (2001b). A unified hypothesis on the lineage of neural stem cells. Nat. Rev. Neurosci. 2, 287-293.
5. Alvarez-Buylla,A., Garcia-Verdugo,J.M., and Tramontin,A.D. (2001a). A unified hypothesis on the lineage of neural stem cells. Nat. Rev. Neurosci. 2, 287-293.
6. Alvarez-Buylla,A. and Lim,D.A. (2004). For the long run: maintaining germinal niches in the adult brain. Neuron 41, 683-686.
7. Alvarez-Dolado,M., Pardal,R., Garcia-Verdugo,J.M., Fike,J.R., Lee,H.O., Pfeffer,K., Lois,C., Morrison,S.J., and Alvarez-Buylla,A. (2003). Fusion of bone-marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature 425, 968-973.
8. Armakolas,A. and Klar,A.J. (2006). Cell type regulates selective segregation of mouse chromosome 7 DNA strands in mitosis. Science 311, 1146-1149.
9. Armakolas,A. and Klar,A.J. (2007). Left-right dynein motor implicated in selective chromatid segregation in mouse cells. Science 315, 100-101.
10. Asaoka,M. and Lin,H. (2004). Germline stem cells in the Drosophila ovary descend from pole cells in the anterior region of the embryonic gonad. Development 131, 5079-5089.
11. Basto,R., Lau,J., Vinogradova,T., Gardiol,A., Woods,C.G., Khodjakov,A., and Raff,J.W. (2006). Flies without centrioles. Cell 125, 1375-1386.
12. Betschinger,J. and Knoblich,J.A. (2004). Dare to be different: asymmetric cell division in Drosophila, C. elegans and vertebrates. Curr. Biol. 14, R674-R685.
13. Betschinger,J., Mechtler,K., and Knoblich,J.A. (2006). Asymmetric segregation of the tumor suppressor brat regulates self-renewal in Drosophila neural stem cells. Cell 124, 1241-1253.
229
14. Beumer,K.J., Pimpinelli,S., and Golic,K.G. (1998). Induced chromosomal exchange directs the segregation of recombinant chromatids in mitosis of Drosophila. Genetics 150, 173-188.
15. Bhat,K.M. and Apsel,N. (2004). Upregulation of Mitimere and Nubbin acts through cyclin E to confer self-renewing asymmetric division potential to neural precursor cells. Development 131, 1123-1134.
16. Bhat,K.M. and Schedl,P. (1997). Establishment of stem cell identity in the Drosophila germline. Dev. Dyn. 210, 371-382.
17. Bjornson,C.R., Rietze,R.L., Reynolds,B.A., Magli,M.C., and Vescovi,A.L. (1999). Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283, 534-537.
18. Blanpain,C., Lowry,W.E., Geoghegan,A., Polak,L., and Fuchs,E. (2004). Self-renewal, multipotency, and the existence of two cell populations within an epithelial stem cell niche. Cell 118, 635-648.
19. Bogard,N., Lan,L., Xu,J., and Cohen,R.S. (2007). Rab11 maintains connections between germline stem cells and niche cells in the Drosophila ovary. Development.
20. Boussadia,O., Kutsch,S., Hierholzer,A., Delmas,V., and Kemler,R. (2002). E-cadherin is a survival factor for the lactating mouse mammary gland. Mech. Dev. 115, 53-62.
21. Braga,V.M., Del Maschio,A., Machesky,L., and Dejana,E. (1999). Regulation of cadherin function by Rho and Rac: modulation by junction maturation and cellular context. Mol. Biol. Cell 10, 9-22.
22. Brawley,C. and Matunis,E. (2004). Regeneration of male germline stem cells by spermatogonial dedifferentiation in vivo. Science 304, 1331-1334.
23. Brazelton,T.R., Rossi,F.M., Keshet,G.I., and Blau,H.M. (2000). From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290, 1775-1779.
24. Brown,M.D. and Sacks,D.B. (2006). IQGAP1 in cellular signaling: bridging the GAP. Trends Cell Biol. 16, 242-249.
25. Burdsal,C.A., Damsky,C.H., and Pedersen,R.A. (1993). The role of E-cadherin and integrins in mesoderm differentiation and migration at the mammalian primitive streak. Development 118, 829-844.
26. Cairns,J. (1975). Mutation selection and the natural history of cancer. Nature 255, 197-200.
230
27. Cairns,J. (2002). Somatic stem cells and the kinetics of mutagenesis and carcinogenesis. Proc. Natl. Acad. Sci. U. S. A 99, 10567-10570.
28. Cairns,J. (2006). Cancer and the immortal strand hypothesis. Genetics 174, 1069-1072.
29. Campos,L.S., Decker,L., Taylor,V., and Skarnes,W. (2006). Notch, epidermal growth factor receptor, and beta1-integrin pathways are coordinated in neural stem cells. J. Biol. Chem. 281, 5300-5309.
30. Campos,L.S., Leone,D.P., Relvas,J.B., Brakebusch,C., Fassler,R., Suter,U., and Ffrench-Constant,C. (2004). Beta1 integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance. Development 131, 3433-3444.
31. Casper,A. and Van Doren,M. (2006). The control of sexual identity in the Drosophila germline. Development 133, 2783-2791.
32. Cavalli,G. and Paro,R. (1998). The Drosophila Fab-7 chromosomal element conveys epigenetic inheritance during mitosis and meiosis. Cell 93, 505-518.
33. Cayouette,M., Barres,B.A., and Raff,M. (2003). Importance of intrinsic mechanisms in cell fate decisions in the developing rat retina. Neuron 40, 897-904.
34. Chang,J.T., Palanivel,V.R., Kinjyo,I., Schambach,F., Intlekofer,A.M., Banerjee,A., Longworth,S.A., Vinup,K.E., Mrass,P., Oliaro,J., Killeen,N., Orange,J.S., Russell,S.M., Weninger,W., and Reiner,S.L. (2007). Asymmetric T lymphocyte division in the initiation of adaptive immune responses. Science 315, 1687-1691.
35. Chappuis-Flament,S., Wong,E., Hicks,L.D., Kay,C.M., and Gumbiner,B.M. (2001). Multiple cadherin extracellular repeats mediate homophilic binding and adhesion. J. Cell Biol. 154, 231-243.
36. Chen,D. and McKearin,D. (2003). Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Curr. Biol. 13, 1786-1791.
37. Chen,T., Hiroko,T., Chaudhuri,A., Inose,F., Lord,M., Tanaka,S., Chant,J., and Fujita,A. (2000). Multigenerational cortical inheritance of the Rax2 protein in orienting polarity and division in yeast. Science 290, 1975-1978.
38. Cheng,A., Tang,H., Cai,J., Zhu,M., Zhang,X., Rao,M., and Mattson,M.P. (2004). Gap junctional communication is required to maintain mouse cortical neural progenitor cells in a proliferative state. Dev. Biol. 272, 203-216.
231
39. Chiasson,B.J., Tropepe,V., Morshead,C.M., and van der Kooy,D. (1999). Adult mammalian forebrain ependymal and subependymal cells demonstrate proliferative potential, but only subependymal cells have neural stem cell characteristics. J. Neurosci. 19, 4462-4471.
40. Chikashige,Y., Tsutsumi,C., Yamane,M., Okamasa,K., Haraguchi,T., and Hiraoka,Y. (2006). Meiotic proteins bqt1 and bqt2 tether telomeres to form the bouquet arrangement of chromosomes. Cell 125, 59-69.
41. Christofori,G. and Semb,H. (1999). The role of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene. Trends Biochem. Sci. 24, 73-76.
42. Clarke,D.L., Johansson,C.B., Wilbertz,J., Veress,B., Nilsson,E., Karlstrom,H., Lendahl,U., and Frisen,J. (2000). Generalized potential of adult neural stem cells. Science 288, 1660-1663.
43. Cleveland,D.W., Mao,Y., and Sullivan,K.F. (2003). Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 112, 407-421.
44. Conboy,M.J., Karasov,A.O., and Rando,T.A. (2007). High incidence of non-random template strand segregation and asymmetric fate determination in dividing stem cells and their progeny. PLoS. Biol. 5, e102.
45. Crittenden,S.L., Leonhard,K.A., Byrd,D.T., and Kimble,J. (2006). Cellular analyses of the mitotic region in the Caenorhabditis elegans adult germ line. Mol. Biol. Cell 17, 3051-3061.
46. D'Amour,K.A. and Gage,F.H. (2003). Genetic and functional differences between multipotent neural and pluripotent embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A 100 Suppl 1, 11866-11872.
47. Dalgaard,J.Z. and Klar,A.J. (2001). Does S. pombe exploit the intrinsic asymmetry of DNA synthesis to imprint daughter cells for mating-type switching? Trends Genet. 17, 153-157.
48. Dang,S.M., Kyba,M., Perlingeiro,R., Daley,G.Q., and Zandstra,P.W. (2002). Efficiency of embryoid body formation and hematopoietic development from embryonic stem cells in different culture systems. Biotechnol. Bioeng. 78, 442-453.
49. David,J., Gordon,J.S., and Rutter,W.J. (1974). Increased thermal stability of chromatin containing 5-bromodeoxyuridine-substituted DNA. Proc. Natl. Acad. Sci. U. S. A 71, 2808-2812.
50. de Cuevas,M. and Spradling,A.C. (1998). Morphogenesis of the Drosophila fusome and its implications for oocyte specification. Development 125, 2781-2789.
232
51. Deng,W. and Lin,H. (1997). Spectrosomes and fusomes anchor mitotic spindles during asymmetric germ cell divisions and facilitate the formation of a polarized microtubule array for oocyte specification in Drosophila. Dev. Biol. 189, 79-94.
52. Dewey,W.C., Sedita,B.A., and Humphrey,R.M. (1966). Radiosensitization of X chromosome of Chinese hamster cells related to incorporation of 5-bromodeoxyuridine. Science 152, 519-521.
53. Dick,J.E. (2003). Stem cells: Self-renewal writ in blood. Nature 423, 231-233.
54. Doetsch,F., Caille,I., Lim,D.A., Garcia-Verdugo,J.M., and Alvarez-Buylla,A. (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703-716.
55. Dubreuil,V., Marzesco,A.M., Corbeil,D., Huttner,W.B., and Wilsch-Brauninger,M. (2007). Midbody and primary cilium of neural progenitors release extracellular membrane particles enriched in the stem cell marker prominin-1. J. Cell Biol. 176, 483-495.
56. Edelman,G.M. (1984). Cell adhesion and morphogenesis: the regulator hypothesis. Proc. Natl. Acad. Sci. U. S. A 81, 1460-1464.
57. Edlund,T. and Jessell,T.M. (1999). Progression from extrinsic to intrinsic signaling in cell fate specification: a view from the nervous system. Cell 96, 211-224.
58. Extavour,C. and Garcia-Bellido,A. (2001). Germ cell selection in genetic mosaics in Drosophila melanogaster. Proc. Natl. Acad. Sci. U. S. A 98, 11341-11346.
59. Extavour,C.G. and Akam,M. (2003). Mechanisms of germ cell specification across the metazoans: epigenesis and preformation. Development 130, 5869-5884.
60. Fedor-Chaiken,M., Hein,P.W., Stewart,J.C., Brackenbury,R., and Kinch,M.S. (2003). E-cadherin binding modulates EGF receptor activation. Cell Commun. Adhes. 10, 105-118.
61. Feldman,J.L., Geimer,S., and Marshall,W.F. (2007). The mother centriole plays an instructive role in defining cell geometry. PLoS. Biol. 5, e149.
62. Fodde,R. (2003). The multiple functions of tumour suppressors: it's all in APC. Nat. Cell Biol. 5, 190-192.
63. Foty,R.A. and Steinberg,M.S. (2005). The differential adhesion hypothesis: a direct evaluation. Dev. Biol. 278, 255-263.
233
64. Freeman,M.R. and Doe,C.Q. (2001). Asymmetric Prospero localization is required to generate mixed neuronal/glial lineages in the Drosophila CNS. Development 128, 4103-4112.
65. Fuchs,E., Tumbar,T., and Guasch,G. (2004). Socializing with the neighbors: stem cells and their niche. Cell 116, 769-778.
66. Fujita,Y., Krause,G., Scheffner,M., Zechner,D., Leddy,H.E., Behrens,J., Sommer,T., and Birchmeier,W. (2002). Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat. Cell Biol. 4, 222-231.
67. Fuller,M.T. and Spradling,A.C. (2007). Male and female Drosophila germline stem cells: two versions of immortality. Science 316, 402-404.
68. Gilbert,S.F. (2000). Developmental Biology. (Sunderland: Sinauer Associates, Inc.).
69. Gilbertson,R.J. and Rich,J.N. (2007). Making a tumour's bed: glioblastoma stem cells and the vascular niche. Nat. Rev. Cancer.
70. Gilboa,L. and Lehmann,R. (2004). Repression of primordial germ cell differentiation parallels germ line stem cell maintenance. Curr. Biol. 14, 981-986.
71. Gilboa,L. and Lehmann,R. (2006). Soma-germline interactions coordinate homeostasis and growth in the Drosophila gonad. Nature 443, 97-100.
72. Gottardi,C.J. and Gumbiner,B.M. (2004). Distinct molecular forms of beta-catenin are targeted to adhesive or transcriptional complexes. J. Cell Biol. 167, 339-349.
73. Gottardi,C.J., Wong,E., and Gumbiner,B.M. (2001). E-cadherin suppresses cellular transformation by inhibiting beta-catenin signaling in an adhesion-independent manner. J. Cell Biol. 153, 1049-1060.
74. Greco,B., Low,H.P., Johnson,E.C., Salmonsen,R.A., Gallant,J., Jones,S.N., Ross,A.H., and Recht,L.D. (2004). Differentiation prevents assessment of neural stem cell pluripotency after blastocyst injection. Stem Cells 22, 600-608.
75. Green,R.A. and Kaplan,K.B. (2003). Chromosome instability in colorectal tumor cells is associated with defects in microtubule plus-end attachments caused by a dominant mutation in APC. J. Cell Biol. 163, 949-961.
76. Griffiths,A., Miller,J.H., Suzuki,D., Lewontin,R.C., and Gelbart,W.M. (1996). An Introduction to Genetic Analysis. (New York: W.H. Freeman and Company).
77. Gruss,C. and Sogo,J.M. (1992). Chromatin replication. Bioessays 14, 1-8.
234
78. Gruss,C., Wu,J., Koller,T., and Sogo,J.M. (1993). Disruption of the nucleosomes at the replication fork. EMBO J. 12, 4533-4545.
79. Gundersen,G.G. and Bretscher,A. (2003). Cell biology. Microtubule asymmetry. Science 300, 2040-2041.
80. Haber,J.E. (2006). Comment on "Cell type regulates selective segregation of mouse chromosome 7 DNA strands in mitosis". Science 313, 1045.
81. Haeckel,E. (1877). Anthropogenie. (Leipzig: Wilhelm Engelmann).
82. Hazan,R.B. and Norton,L. (1998). The epidermal growth factor receptor modulates the interaction of E-cadherin with the actin cytoskeleton. J. Biol. Chem. 273, 9078-9084.
83. Heald,R., Tournebize,R., Blank,T., Sandaltzopoulos,R., Becker,P., Hyman,A., and Karsenti,E. (1996). Self-organization of microtubules into bipolar spindles around artificial chromosomes in Xenopus egg extracts. Nature 382, 420-425.
84. Helleday,T. (2003). Pathways for mitotic homologous recombination in mammalian cells. Mutat. Res. 532, 103-115.
85. Herrera,D.G., Garcia-Verdugo,J.M., and Alvarez-Buylla,A. (1999). Adult-derived neural precursors transplanted into multiple regions in the adult brain. Ann. Neurol. 46, 867-877.
86. Hitoshi,S., Alexson,T., Tropepe,V., Donoviel,D., Elia,A.J., Nye,J.S., Conlon,R.A., Mak,T.W., Bernstein,A., and van der Kooy,D. (2002a). Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev. 16, 846-858.
87. Hitoshi,S., Seaberg,R.M., Koscik,C., Alexson,T., Kusunoki,S., Kanazawa,I., Tsuji,S., and van der Kooy,D. (2004). Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes Dev. 18, 1806-1811.
88. Hitoshi,S., Tropepe,V., Ekker,M., and van der Kooy,D. (2002b). Neural stem cell lineages are regionally specified, but not committed, within distinct compartments of the developing brain. Development 129, 233-244.
89. hooper,A.T., Butler,J., Petit,I., and Rafii,S. (2007). Does N-Cadherin Regulate Interaction of Hematopoietic Stem Cells with Their Niches? Cell Stem Cell 1, 127-129.
90. Hu,Y., Lu,X., Barnes,E., Yan,M., Lou,H., and Luo,G. (2005). Recql5 and Blm RecQ DNA helicases have nonredundant roles in suppressing crossovers. Mol. Cell Biol. 25, 3431-3442.
235
91. Hulsken,J., Birchmeier,W., and Behrens,J. (1994). E-cadherin and APC compete for the interaction with beta-catenin and the cytoskeleton. J. Cell Biol. 127, 2061-2069.
92. Hwang,E., Kusch,J., Barral,Y., and Huffaker,T.C. (2003). Spindle orientation in Saccharomyces cerevisiae depends on the transport of microtubule ends along polarized actin cables. J. Cell Biol. 161, 483-488.
93. Hyman,A.A. and Karsenti,E. (1996). Morphogenetic properties of microtubules and mitotic spindle assembly. Cell 84, 401-410.
94. Imai,F., Hirai,S., Akimoto,K., Koyama,H., Miyata,T., Ogawa,M., Noguchi,S., Sasaoka,T., Noda,T., and Ohno,S. (2006). Inactivation of aPKClambda results in the loss of adherens junctions in neuroepithelial cells without affecting neurogenesis in mouse neocortex. Development 133, 1735-1744.
95. Imura,T., Kornblum,H.I., and Sofroniew,M.V. (2003). The predominant neural stem cell isolated from postnatal and adult forebrain but not early embryonic forebrain expresses GFAP. J. Neurosci. 23, 2824-2832.
96. Inoue,T., Tanaka,T., Takeichi,M., Chisaka,O., Nakamura,S., and Osumi,N. (2001). Role of cadherins in maintaining the compartment boundary between the cortex and striatum during development. Development 128, 561-569.
97. Ito,K. and McGhee,J.D. (1987). Parental DNA strands segregate randomly during embryonic development of Caenorhabditis elegans. Cell 49, 329-336.
98. Ito,K., McGhee,J.D., and Schultz,G.A. (1988). Paternal DNA strands segregate to both trophectoderm and inner cell mass of the developing mouse embryo. Genes Dev. 2, 929-936.
99. Jablonka,P. and Jablonka,E. (1982a). Non-random sister chromatid segregation by cell type. J. Theor. Biol. 99, 427-436.
100. Jablonka,P. and Jablonka,E. (1982b). On the control of hnRNA production. J. Theor. Biol. 99, 407-425.
101. Jackson,V. (1988). Deposition of newly synthesized histones: hybrid nucleosomes are not tandemly arranged on daughter DNA strands. Biochemistry 27, 2109-2120.
102. Jiang,Y., Jahagirdar,B.N., Reinhardt,R.L., Schwartz,R.E., Keene,C.D., Ortiz-Gonzalez,X.R., Reyes,M., Lenvik,T., Lund,T., Blackstad,M., Du,J., Aldrich,S., Lisberg,A., Low,W.C., Largaespada,D.A., and Verfaillie,C.M. (2002). Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41-49.
236
103. Johansson,C.B., Momma,S., Clarke,D.L., Risling,M., Lendahl,U., and Frisen,J. (1999). Identification of a neural stem cell in the adult mammalian central nervous system. Cell 96, 25-34.
104. Jou,T.S., Stewart,D.B., Stappert,J., Nelson,W.J., and Marrs,J.A. (1995). Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc. Natl. Acad. Sci. U. S. A 92, 5067-5071.
105. Kai,T. and Spradling,A. (2003). An empty Drosophila stem cell niche reactivates the proliferation of ectopic cells. Proc. Natl. Acad. Sci. U. S. A 100, 4633-4638.
106. Kai,T. and Spradling,A. (2004). Differentiating germ cells can revert into functional stem cells in Drosophila melanogaster ovaries. Nature 428, 564-569.
107. Kai,T., Williams,D., and Spradling,A.C. (2005). The expression profile of purified Drosophila germline stem cells. Dev. Biol. 283, 486-502.
108. Kalab,P., Weis,K., and Heald,R. (2002). Visualization of a Ran-GTP gradient in interphase and mitotic Xenopus egg extracts. Science 295, 2452-2456.
109. Kan,N.G., Stemmler,M.P., Junghans,D., Kanzler,B., de Vries,W.N., Dominis,M., and Kemler,R. (2007). Gene replacement reveals a specific role for E-cadherin in the formation of a functional trophectoderm. Development 134, 31-41.
110. Karpowicz,P., Morshead,C., Kam,A., Jervis,E., Ramunas,J., Cheng,V., and van der Kooy,D. (2005). Support for the immortal strand hypothesis: neural stem cells partition DNA asymmetrically in vitro. J. Cell Biol. 170, 721-732.
111. Kiel,M.J., He,S., Ashkenazi,R., Gentry,S.N., Teta,M., Kushner,J.A., Jackson,T.L., and Morrison,S.J. (2007a). Haematopoietic stem cells do not asymmetrically segregate chromosomes or retain BrdU. Nature.
112. Kiel,M.J., Radice,G.L., and Morrison,S.J. (2007b). Lack of Evidence that Hematopoietic Stem Cells Depend on N-Cadherin-Mediated Adhesion to Osteoblasts for Their Maintenance. Cell Stem Cell 1, 204-217.
113. Kiger,A.A., Jones,D.L., Schulz,C., Rogers,M.B., and Fuller,M.T. (2001). Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science 294, 2542-2545.
114. Kiger,A.A., White-Cooper,H., and Fuller,M.T. (2000). Somatic support cells restrict germline stem cell self-renewal and promote differentiation. Nature 407, 750-754.
115. Klar,A.J. (1990). The developmental fate of fission yeast cells is determined by the pattern of inheritance of parental and grandparental DNA strands. EMBO J. 9, 1407-1415.
237
116. Klar,A.J. (1999). Genetic models for handedness, brain lateralization, schizophrenia, and manic-depression. Schizophr. Res. 39, 207-218.
117. Klar,A.J. (2004). A genetic mechanism implicates chromosome 11 in schizophrenia and bipolar diseases. Genetics 167, 1833-1840.
118. Klar,A.J. and Armakolas,A. (2006). Response to Comment on "Cell Type Regulates Selective Segregation of Mouse Chromosome 7 DNA Strands in Mitosis". Science 313, 1045c.
119. Kostetskii,I., Moore,R., Kemler,R., and Radice,G.L. (2001). Differential adhesion leads to segregation and exclusion of N-cadherin-deficient cells in chimeric embryos. Dev. Biol. 234, 72-79.
120. Krause,D.S., Theise,N.D., Collector,M.I., Henegariu,O., Hwang,S., Gardner,R., Neutzel,S., and Sharkis,S.J. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105, 369-377.
121. Krushel,L.A. and van der Kooy D. (1993). Pattern formation in the developing mammalian forebrain: selective adhesion of early but not late postmitotic cortical and striatal neurons within forebrain reaggregate cultures. Dev. Biol. 158, 145-162.
122. Kubo,A., Shinozaki,K., Shannon,J.M., Kouskoff,V., Kennedy,M., Woo,S., Fehling,H.J., and Keller,G. (2004). Development of definitive endoderm from embryonic stem cells in culture. Development 131, 1651-1662.
123. Kuo,C.T., Mirzadeh,Z., Soriano-Navarro,M., Rasin,M., Wang,D., Shen,J., Sestan,N., Garcia-Verdugo,J., Alvarez-Buylla,A., Jan,L.Y., and Jan,Y.N. (2006). Postnatal deletion of Numb/Numblike reveals repair and remodeling capacity in the subventricular neurogenic niche. Cell 127, 1253-1264.
124. Kuroki,T. and Murakami,Y. (1989). Random segregation of DNA strands in epidermal basal cells. Jpn. J. Cancer Res. 80, 637-642.
125. Kusch,J., Liakopoulos,D., and Barral,Y. (2003). Spindle asymmetry: a compass for the cell. Trends Cell Biol. 13, 562-569.
126. Lambert,J.D. and Nagy,L.M. (2002). Asymmetric inheritance of centrosomally localized mRNAs during embryonic cleavages. Nature 420, 682-686.
127. Lansdorp,P.M. (2007). Immortal strands? Give me a break. Cell 129, 1244-1247.
128. Lark,K.G. (1967). Nonrandom segregation of sister chromatids in Vicia faba and Triticum boeoticum. Proc. Natl. Acad. Sci. U. S. A 58, 352-359.
129. Lark,K.G., Consigli,R.A., and Minocha,H.C. (1966). Segregation of sister chromatids in mammalian cells. Science 154, 1202-1205.
238
130. Larue,L., Antos,C., Butz,S., Huber,O., Delmas,V., Dominis,M., and Kemler,R. (1996). A role for cadherins in tissue formation. Development 122, 3185-3194.
131. Larue,L., Ohsugi,M., Hirchenhain,J., and Kemler,R. (1994). E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc. Natl. Acad. Sci. U. S. A 91, 8263-8267.
132. Lasko,P.F. and Ashburner,M. (1988). The product of the Drosophila gene vasa is very similar to eukaryotic initiation factor-4A. Nature 335, 611-617.
133. Le Borgne,R., Bellaiche,Y., and Schweisguth,F. (2002). Drosophila E-cadherin regulates the orientation of asymmetric cell division in the sensory organ lineage. Curr. Biol. 12, 95-104.
134. Lechler,T. and Fuchs,E. (2005). Asymmetric cell divisions promote stratification and differentiation of mammalian skin. Nature 437, 275-280.
135. Lee,C.Y., Robinson,K.J., and Doe,C.Q. (2006). Lgl, Pins and aPKC regulate neuroblast self-renewal versus differentiation. Nature 439, 594-598.
136. Leffak,I.M. (1984). Conservative segregation of nucleosome core histones. Nature 307, 82-85.
137. Leffak,I.M., Grainger,R., and Weintraub,H. (1977). Conservative assembly and segregation of nucleosomal histones. Cell 12, 837-845.
138. Leffak,M. (1988). Nonrandom assembly of chromatin during hydroxyurea inhibition of DNA synthesis. Biochemistry 27, 686-691.
139. Lendahl,U., Zimmerman,L.B., and McKay,R.D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60, 585-595.
140. Li,M., McGrail,M., Serr,M., and Hays,T.S. (1994). Drosophila cytoplasmic dynein, a microtubule motor that is asymmetrically localized in the oocyte. J. Cell Biol. 126, 1475-1494.
141. Liakopoulos,D., Kusch,J., Grava,S., Vogel,J., and Barral,Y. (2003). Asymmetric loading of Kar9 onto spindle poles and microtubules ensures proper spindle alignment. Cell 112, 561-574.
142. Lien,W.H., Klezovitch,O., Fernandez,T.E., Delrow,J., and Vasioukhin,V. (2006). alphaE-catenin controls cerebral cortical size by regulating the hedgehog signaling pathway. Science 311, 1609-1612.
143. Lin,H. (1997). The tao of stem cells in the germline. Annu. Rev. Genet. 31, 455-491.
239
144. Lin,H. and Spradling,A.C. (1993). Germline stem cell division and egg chamber development in transplanted Drosophila germaria. Dev. Biol. 159, 140-152.
145. Liu,W.F., Nelson,C.M., Pirone,D.M., and Chen,C.S. (2006). E-cadherin engagement stimulates proliferation via Rac1. J. Cell Biol. 173, 431-441.
146. Louvi,A. and Artavanis-Tsakonas,S. (2006). Notch signalling in vertebrate neural development. Nat. Rev. Neurosci. 7, 93-102.
147. Magie,C.R., Pinto-Santini,D., and Parkhurst,S.M. (2002). Rho1 interacts with p120ctn and alpha-catenin, and regulates cadherin-based adherens junction components in Drosophila. Development 129, 3771-3782.
148. Malatesta,P., Hartfuss,E., and Gotz,M. (2000). Isolation of radial glial cells by fluorescent-activated cell sorting reveals a neuronal lineage. Development 127, 5253-5263.
149. Maretzky,T., Reiss,K., Ludwig,A., Buchholz,J., Scholz,F., Proksch,E., de Strooper,B., Hartmann,D., and Saftig,P. (2005). ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation. Proc. Natl. Acad. Sci. U. S. A 102, 9182-9187.
150. Marrs,J.A., Andersson-Fisone,C., Jeong,M.C., Cohen-Gould,L., Zurzolo,C., Nabi,I.R., Rodriguez-Boulan,E., and Nelson,W.J. (1995). Plasticity in epithelial cell phenotype: modulation by expression of different cadherin cell adhesion molecules. J. Cell Biol. 129, 507-519.
151. Matsunami,H. and Takeichi,M. (1995). Fetal brain subdivisions defined by R- and E-cadherin expressions: evidence for the role of cadherin activity in region-specific, cell-cell adhesion. Dev. Biol. 172, 466-478.
152. McGrail,M. and Hays,T.S. (1997). The microtubule motor cytoplasmic dynein is required for spindle orientation during germline cell divisions and oocyte differentiation in Drosophila. Development 124, 2409-2419.
153. McKearin,D. and Ohlstein,B. (1995). A role for the Drosophila bag-of-marbles protein in the differentiation of cystoblasts from germline stem cells. Development 121, 2937-2947.
154. Merkle,F.T., Tramontin,A.D., Garcia-Verdugo,J.M., and Alvarez-Buylla,A. (2004). Radial glia give rise to adult neural stem cells in the subventricular zone. Proc. Natl. Acad. Sci. U. S. A 101, 17528-17532.
155. Merok,J.R., Lansita,J.A., Tunstead,J.R., and Sherley,J.L. (2002). Cosegregation of chromosomes containing immortal DNA strands in cells that cycle with asymmetric stem cell kinetics. Cancer Res. 62, 6791-6795.
240
156. Meselson,M. and Stahl,F.W. (1958a). The replication of DNA. Cold Spring Harb. Symp. Quant. Biol. 23, 9-12.
157. Meselson,M. and Stahl,F.W. (1958b). The replication of DNA in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A 44, 671-682.
158. Mezey,E., Chandross,K.J., Harta,G., Maki,R.A., and McKercher,S.R. (2000). Turning blood into brain: cells bearing neuronal antigens generated in vivo from bone marrow. Science 290, 1779-1782.
159. Mizutani,K.I., Yoon,K., Dang,L., Tokunaga,A., and Gaiano,N. (2007). Differential Notch signalling distinguishes neural stem cells from intermediate progenitors. Nature.
160. Mochizuki,K. and Gorovsky,M.A. (2004). Small RNAs in genome rearrangement in Tetrahymena. Curr. Opin. Genet. Dev. 14, 181-187.
161. Molofsky,A.V., Pardal,R., Iwashita,T., Park,I.K., Clarke,M.F., and Morrison,S.J. (2003). Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation. Nature 425, 962-967.
162. Morshead,C.M., Craig,C.G., and van der Kooy,D. (1998). In vivo clonal analyses reveal the properties of endogenous neural stem cell proliferation in the adult mammalian forebrain. Development 125, 2251-2261.
163. Morshead,C.M., Garcia,A.D., Sofroniew,M.V., and van der Kooy,D. (2003). The ablation of glial fibrillary acidic protein-positive cells from the adult central nervous system results in the loss of forebrain neural stem cells but not retinal stem cells. Eur. J. Neurosci. 18, 76-84.
164. Morshead,C.M., Reynolds,B.A., Craig,C.G., McBurney,M.W., Staines,W.A., Morassutti,D., Weiss,S., and van der Kooy,D. (1994). Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells. Neuron 13, 1071-1082.
165. Morshead,C.M. and van der Kooy,D. (2001). A new 'spin' on neural stem cells? Curr. Opin. Neurobiol. 11, 59-65.
166. Nagy,A., Rossant,J., Nagy,R., Abramow-Newerly,W., and Roder,J.C. (1993). Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A 90, 8424-8428.
167. Nagy,A., Gertsenstein,M., Vintersten,K., and Behringer,R. (2002). Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press).
168. Nedelec,F., Surrey,T., and Karsenti,E. (2003). Self-organisation and forces in the microtubule cytoskeleton. Curr. Opin. Cell Biol. 15, 118-124.
241
169. Neff,M.W. and Burke,D.J. (1991). Random segregation of chromatids at mitosis in Saccharomyces cerevisiae. Genetics 127, 463-473.
170. Neganova,I.E., Sekirina,G.G., and Eichenlaub-Ritter,U. (2000). Surface-expressed E-cadherin, and mitochondrial and microtubule distribution in rescue of mouse embryos from 2-cell block by aggregation. Mol. Hum. Reprod. 6, 454-464.
171. Niessen,C.M. and Gumbiner,B.M. (2002). Cadherin-mediated cell sorting not determined by binding or adhesion specificity. J. Cell Biol. 156, 389-399.
172. Niki,Y., Yamaguchi,T., and Mahowald,A.P. (2006). Establishment of stable cell lines of Drosophila germ-line stem cells. Proc. Natl. Acad. Sci. U. S. A 103, 16325-16330.
173. Nose,A., Nagafuchi,A., and Takeichi,M. (1988). Expressed recombinant cadherins mediate cell sorting in model systems. Cell 54, 993-1001.
174. Ohlstein,B., Kai,T., Decotto,E., and Spradling,A. (2004). The stem cell niche: theme and variations. Curr. Opin. Cell Biol. 16, 693-699.
175. Ohlstein,B., Lavoie,C.A., Vef,O., Gateff,E., and McKearin,D.M. (2000). The Drosophila cystoblast differentiation factor, benign gonial cell neoplasm, is related to DExH-box proteins and interacts genetically with bag-of-marbles. Genetics 155, 1809-1819.
176. Ohlstein,B. and McKearin,D. (1997). Ectopic expression of the Drosophila Bam protein eliminates oogenic germline stem cells. Development 124, 3651-3662.
177. Okamura,D., Kimura,T., Nakano,T., and Matsui,Y. (2003). Cadherin-mediated cell interaction regulates germ cell determination in mice. Development 130, 6423-6430.
178. Olsson,M., Bjerregaard,K., Winkler,C., Gates,M., Bjorklund,A., and Campbell,K. (1998). Incorporation of mouse neural progenitors transplanted into the rat embryonic forebrain is developmentally regulated and dependent on regional and adhesive properties. Eur. J. Neurosci. 10, 71-85.
179. Olsson,M., Campbell,K., and Turnbull,D.H. (1997). Specification of mouse telencephalic and mid-hindbrain progenitors following heterotopic ultrasound-guided embryonic transplantation. Neuron 19, 761-772.
180. Palmer,T.D., Willhoite,A.R., and Gage,F.H. (2000). Vascular niche for adult hippocampal neurogenesis. J. Comp Neurol. 425, 479-494.
181. Pasquale,E.B. (2005). Eph receptor signalling casts a wide net on cell behaviour. Nat. Rev. Mol. Cell Biol. 6, 462-475.
242
182. Patterton,D. and Wolffe,A.P. (1996). Developmental roles for chromatin and chromosomal structure. Dev. Biol. 173, 2-13.
183. Pederson,T. (2006). The centrosome: built on an mRNA? Nat. Cell Biol. 8, 652-654.
184. Perez-Moreno,M., Jamora,C., and Fuchs,E. (2003). Sticky business: orchestrating cellular signals at adherens junctions. Cell 112, 535-548.
185. Perrais,M., Chen,X., Perez-Moreno,M., and Gumbiner,B.M. (2007). E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions. Mol. Biol. Cell 18, 2013-2025.
186. Picco,V., Hudson,C., and Yasuo,H. (2007). Ephrin-Eph signalling drives the asymmetric division of notochord/neural precursors in Ciona embryos. Development 134, 1491-1497.
187. Placzek,M., Jessell,T.M., and Dodd,J. (1993). Induction of floor plate differentiation by contact-dependent, homeogenetic signals. Development 117, 205-218.
188. Potten,C.S. (1977). Extreme sensitivity of some intestinal crypt cells to X and gamma irradiation. Nature 269, 518-521.
189. Potten,C.S., Hume,W.J., Reid,P., and Cairns,J. (1978). The segregation of DNA in epithelial stem cells. Cell 15, 899-906.
190. Potten,C.S., Owen,G., and Booth,D. (2002). Intestinal stem cells protect their genome by selective segregation of template DNA strands. J. Cell Sci. 115, 2381-2388.
191. Prakasam,A.K., Maruthamuthu,V., and Leckband,D.E. (2006). Similarities between heterophilic and homophilic cadherin adhesion. Proc. Natl. Acad. Sci. U. S. A 103, 15434-15439.
192. Ramalho-Santos,M. and Willenbring,H. (2007). On the Origin of the Term "Stem Cell". Cell Stem Cell 1, 35-38.
193. Rambhatla,L., Ram-Mohan,S., Cheng,J.J., and Sherley,J.L. (2005). Immortal DNA strand cosegregation requires p53/IMPDH-dependent asymmetric self-renewal associated with adult stem cells. Cancer Res. 65, 3155-3161.
194. Randall,S.K. and Kelly,T.J. (1992). The fate of parental nucleosomes during SV40 DNA replication. J. Biol. Chem. 267, 14259-14265.
195. Rando,T.A. (2007). The immortal strand hypothesis: segregation and reconstruction. Cell 129, 1239-1243.
243
196. Rasin,M.R., Gazula,V.R., Breunig,J.J., Kwan,K.Y., Johnson,M.B., Liu-Chen,S., Li,H.S., Jan,L.Y., Jan,Y.N., Rakic,P., and Sestan,N. (2007). Numb and Numbl are required for maintenance of cadherin-based adhesion and polarity of neural progenitors. Nat. Neurosci. 10, 819-827.
197. Rebollo,E., Sampaio,P., Januschke,J., Llamazares,S., Varmark,H., and Gonzalez,C. (2007). Functionally unequal centrosomes drive spindle orientation in asymmetrically dividing Drosophila neural stem cells. Dev. Cell 12, 467-474.
198. Redies,C. (2000). Cadherins in the central nervous system. Prog. Neurobiol. 61, 611-648.
199. Rehen,S.K., McConnell,M.J., Kaushal,D., Kingsbury,M.A., Yang,A.H., and Chun,J. (2001). Chromosomal variation in neurons of the developing and adult mammalian nervous system. Proc. Natl. Acad. Sci. U. S. A 98, 13361-13366.
200. Reya,T., Morrison,S.J., Clarke,M.F., and Weissman,I.L. (2001). Stem cells, cancer, and cancer stem cells. Nature 414, 105-111.
201. Reynolds,B.A., Tetzlaff,W., and Weiss,S. (1992). A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J. Neurosci. 12, 4565-4574.
202. Reynolds,B.A. and Weiss,S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255, 1707-1710.
203. Rivolta,M.N. and Holley,M.C. (2002). Asymmetric segregation of mitochondria and mortalin correlates with the multi-lineage potential of inner ear sensory cell progenitors in vitro. Brain Res. Dev. Brain Res. 133, 49-56.
204. Robinson,J.T., Wojcik,E.J., Sanders,M.A., McGrail,M., and Hays,T.S. (1999). Cytoplasmic dynein is required for the nuclear attachment and migration of centrosomes during mitosis in Drosophila. J. Cell Biol. 146, 597-608.
205. Rosenberger,R.F. and Kessel,M. (1968). Nonrandom sister chromatid segregation and nuclear migration in hyphae of Aspergillus nidulans. J. Bacteriol. 96, 1208-1213.
206. Rossant,J. (2001). Stem cells from the Mammalian blastocyst. Stem Cells 19, 477-482.
207. Rusan,N.M. and Peifer,M. (2007). A role for a novel centrosome cycle in asymmetric cell division. J. Cell Biol. 177, 13-20.
208. Seaberg,R.M. and van der Kooy,D. (2003). Stem and progenitor cells: the premature desertion of rigorous definitions. Trends Neurosci. 26, 125-131.
244
209. Senda,T., Iino,S., Matsushita,K., Matsumine,A., Kobayashi,S., and Akiyama,T. (1998). Localization of the adenomatous polyposis coli tumour suppressor protein in the mouse central nervous system. Neuroscience 83, 857-866.
210. Shao,C., Deng,L., Henegariu,O., Liang,L., Raikwar,N., Sahota,A., Stambrook,P.J., and Tischfield,J.A. (1999). Mitotic recombination produces the majority of recessive fibroblast variants in heterozygous mice. Proc. Natl. Acad. Sci. U. S. A 96, 9230-9235.
211. Shen,Q., Goderie,S.K., Jin,L., Karanth,N., Sun,Y., Abramova,N., Vincent,P., Pumiglia,K., and Temple,S. (2004). Endothelial cells stimulate self-renewal and expand neurogenesis of neural stem cells. Science 304, 1338-1340.
212. Shen,Q., Zhong,W., Jan,Y.N., and Temple,S. (2002). Asymmetric Numb distribution is critical for asymmetric cell division of mouse cerebral cortical stem cells and neuroblasts. Development 129, 4843-4853.
213. Shimamura,K. and Takeichi,M. (1992). Local and transient expression of E-cadherin involved in mouse embryonic brain morphogenesis. Development 116, 1011-1019.
214. Shingo,T., Gregg,C., Enwere,E., Fujikawa,H., Hassam,R., Geary,C., Cross,J.C., and Weiss,S. (2003). Pregnancy-stimulated neurogenesis in the adult female forebrain mediated by prolactin. Science 299, 117-120.
215. Shinin,V., Gayraud-Morel,B., Gomes,D., and Tajbakhsh,S. (2006). Asymmetric division and cosegregation of template DNA strands in adult muscle satellite cells. Nat. Cell Biol. 8, 677-682.
216. Siegrist,S.E. and Doe,C.Q. (2006). Extrinsic cues orient the cell division axis in Drosophila embryonic neuroblasts. Development 133, 529-536.
217. Slevin,J.C., Byers,L., Gertsenstein,M., Qu,D., Mu,J., Sunn,N., Kingdom,J.C., Rossant,J., and Adamson,S.L. (2006). High resolution ultrasound-guided microinjection for interventional studies of early embryonic and placental development in vivo in mice. BMC. Dev. Biol. 6, 10.
218. Smith,A.G. (2001). Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol. 17, 435-462.
219. Smith,C.M., Haimberger,Z.W., Johnson,C.O., Wolf,A.J., Gafken,P.R., Zhang,Z., Parthun,M.R., and Gottschling,D.E. (2002). Heritable chromatin structure: mapping "memory" in histones H3 and H4. Proc. Natl. Acad. Sci. U. S. A 99 Suppl 4, 16454-16461.
220. Smith,G.H. (2005). Label-retaining epithelial cells in mouse mammary gland divide asymmetrically and retain their template DNA strands. Development 132, 681-687.
245
221. Song,H., Stevens,C.F., and Gage,F.H. (2002a). Astroglia induce neurogenesis from adult neural stem cells. Nature 417, 39-44.
222. Song,X., Call,G.B., Kirilly,D., and Xie,T. (2007). Notch signaling controls germline stem cell niche formation in the Drosophila ovary. Development 134, 1071-1080.
223. Song,X., Zhu,C.H., Doan,C., and Xie,T. (2002b). Germline stem cells anchored by adherens junctions in the Drosophila ovary niches. Science 296, 1855-1857.
224. Sonneborn,T.M. (1964). THE DETERMINANTS AND EVOLUTION OF LIFE. THE DIFFERENTIATION OF CELLS. Proc. Natl. Acad. Sci. U. S. A 51, 915-929.
225. Staiber,W. (2006). Chromosome elimination in germ line-soma differentiation of Acricotopus lucidus (Diptera, Chironomidae). Genome 49, 269-274.
226. Staiber,W. (2007). Asymmetric distribution of mitochondria and of spindle microtubules in opposite directions in differential mitosis of germ line cells in Acricotopus. Cell Tissue Res. 329, 197-203.
227. Steinberg,M.S. and Takeichi,M. (1994). Experimental specification of cell sorting, tissue spreading, and specific spatial patterning by quantitative differences in cadherin expression. Proc. Natl. Acad. Sci. U. S. A 91, 206-209.
228. Stevens,N.R., Raposo,A.A., Basto,R., St Johnston,D., and Raff,J.W. (2007). From Stem Cell to Embryo without Centrioles. Curr. Biol.
229. Strachan,T. and Reid,A.P. (2000). Human Molecular Genetics. (New York: John Wiley and Sons Inc.).
230. Sun,Y., Goderie,S.K., and Temple,S. (2005). Asymmetric distribution of EGFR receptor during mitosis generates diverse CNS progenitor cells. Neuron 45, 873-886.
231. Taguchi,T. and Shiraishi,Y. (1989). Increased sister-chromatid exchanges (SCEs) and chromosomal fragilities by BrdU in a human mutant B-lymphoblastoid cell line. Mutat. Res. 211, 43-49.
232. Takeichi,M. (1995). Morphogenetic roles of classic cadherins. Curr. Opin. Cell Biol. 7, 619-627.
233. Tanentzapf,G., Devenport,D., Godt,D., and Brown,N.H. (2007). Integrin-dependent anchoring of a stem-cell niche. Nat. Cell Biol.
234. Tannenbaum,E., Sherley,J.L., and Shakhnovich,E.I. (2005). Evolutionary dynamics of adult stem cells: comparison of random and immortal-strand
246
segregation mechanisms. Phys. Rev. E. Stat. Nonlin. Soft. Matter Phys. 71, 041914.
235. Tannenbaum,E., Sherley,J.L., and Shakhnovich,E.I. (2006). Semiconservative quasispecies equations for polysomic genomes: the haploid case. J. Theor. Biol. 241, 791-805.
236. Temple,S. (2001). The development of neural stem cells. Nature 414, 112-117.
237. Terada,N., Hamazaki,T., Oka,M., Hoki,M., Mastalerz,D.M., Nakano,Y., Meyer,E.M., Morel,L., Petersen,B.E., and Scott,E.W. (2002). Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416, 542-545.
238. Thery,M., Jimenez-Dalmaroni,A., Racine,V., Bornens,M., and Julicher,F. (2007). Experimental and theoretical study of mitotic spindle orientation. Nature 447, 493-496.
239. Till,J.E. and McCulloch,E.A. (1961). A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat. Res. 14, 213-222.
240. Till,J.E. and McCulloch,E.A. (1980). Hemopoietic stem cell differentiation. Biochim. Biophys. Acta 605, 431-459.
241. Tinkle,C.L., Lechler,T., Pasolli,H.A., and Fuchs,E. (2004). Conditional targeting of E-cadherin in skin: insights into hyperproliferative and degenerative responses. Proc. Natl. Acad. Sci. U. S. A 101, 552-557.
242. Tischfield,J.A. and Shao,C. (2003). Somatic recombination redux. Nat. Genet. 33, 5-6.
243. Tomasovic,S.P. and Mix,M.C. (1974). Cell renewal in the gill of the freshwater mussel, Margaritifera margaritifera: an autoradiographic study using high specific activity tritiated thymidine. J. Cell Sci. 14, 561-569.
244. Tomita,K. and Cooper,J.P. (2007). The telomere bouquet controls the meiotic spindle. Cell 130, 113-126.
245. Tronche,F., Kellendonk,C., Kretz,O., Gass,P., Anlag,K., Orban,P.C., Bock,R., Klein,R., and Schutz,G. (1999). Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat. Genet. 23, 99-103.
246. Tropepe,V., Coles,B.L., Chiasson,B.J., Horsford,D.J., Elia,A.J., McInnes,R.R., and van der Kooy,D. (2000). Retinal stem cells in the adult mammalian eye. Science 287, 2032-2036.
247. Tropepe,V., Craig,C.G., Morshead,C.M., and van der Kooy,D. (1997). Transforming growth factor-alpha null and senescent mice show decreased neural
247
progenitor cell proliferation in the forebrain subependyma. J. Neurosci. 17, 7850-7859.
248. Tropepe,V., Hitoshi,S., Sirard,C., Mak,T.W., Rossant,J., and van der Kooy,D. (2001). Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired through a default mechanism. Neuron 30, 65-78.
249. Tropepe,V., Sibilia,M., Ciruna,B.G., Rossant,J., Wagner,E.F., and van der Kooy,D. (1999). Distinct neural stem cells proliferate in response to EGF and FGF in the developing mouse telencephalon. Dev. Biol. 208, 166-188.
250. Tsuji,H. (1982). Presence of a base line level of sister chromatid exchanges in somatic cells of Drosophila melanogaster in vivo and in vitro. Genetics 100, 259-278.
251. Tumbar,T., Guasch,G., Greco,V., Blanpain,C., Lowry,W.E., Rendl,M., and Fuchs,E. (2004). Defining the epithelial stem cell niche in skin. Science 303, 359-363.
252. van der Kooy,D. and Weiss,S. (2000). Why stem cells? Science 287, 1439-1441.
253. van der Kooy,D. and Weiss,S. (2000). Why stem cells? Science 287, 1439-1441.
254. Wagers,A.J., Sherwood,R.I., Christensen,J.L., and Weissman,I.L. (2002). Little evidence for developmental plasticity of adult hematopoietic stem cells. Science 297, 2256-2259.
255. Wang,X., Willenbring,H., Akkari,Y., Torimaru,Y., Foster,M., Al Dhalimy,M., Lagasse,E., Finegold,M., Olson,S., and Grompe,M. (2003). Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 422, 897-901.
256. Ward,E.J., Shcherbata,H.R., Reynolds,S.H., Fischer,K.A., Hatfield,S.D., and Ruohola-Baker,H. (2006). Stem cells signal to the niche through the Notch pathway in the Drosophila ovary. Curr. Biol. 16, 2352-2358.
257. Warrior,R. (1994). Primordial germ cell migration and the assembly of the Drosophila embryonic gonad. Dev. Biol. 166, 180-194.
258. Watrin,E. and Legagneux,V. (2003). Introduction to chromosome dynamics in mitosis. Biol. Cell 95, 507-513.
259. Watson,J.D. and Crick,F.H. (1974). Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid. J.D. Watson and F.H.C. Crick. Published in Nature, number 4356 April 25, 1953. Nature 248, 765.
260. Weissman,I.L. (2000). Stem cells: units of development, units of regeneration, and units in evolution. Cell 100, 157-168.
248
261. Wilson,A., Murphy,M.J., Oskarsson,T., Kaloulis,K., Bettess,M.D., Oser,G.M., Pasche,A.C., Knabenhans,C., Macdonald,H.R., and Trumpp,A. (2004). c-Myc controls the balance between hematopoietic stem cell self-renewal and differentiation. Genes Dev. 18, 2747-2763.
262. Wilson,A. and Trumpp,A. (2006). Bone-marrow haematopoietic-stem-cell niches. Nat. Rev. Immunol. 6, 93-106.
263. Wu,L. and Hickson,I.D. (2003). The Bloom's syndrome helicase suppresses crossing over during homologous recombination. Nature 426, 870-874.
264. Wurmser,A.E., Nakashima,K., Summers,R.G., Toni,N., D'Amour,K.A., Lie,D.C., and Gage,F.H. (2004). Cell fusion-independent differentiation of neural stem cells to the endothelial lineage. Nature 430, 350-356.
265. Xie,T. and Spradling,A.C. (1998). decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell 94, 251-260.
266. Xie,T. and Spradling,A.C. (2000). A niche maintaining germ line stem cells in the Drosophila ovary. Science 290, 328-330.
267. Yamada,S., Pokutta,S., Drees,F., Weis,W.I., and Nelson,W.J. (2005). Deconstructing the cadherin-catenin-actin complex. Cell 123, 889-901.
268. Yamashita,Y.M., Jones,D.L., and Fuller,M.T. (2003). Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science 301, 1547-1550.
269. Yamashita,Y.M., Mahowald,A.P., Perlin,J.R., and Fuller,M.T. (2007). Asymmetric inheritance of mother versus daughter centrosome in stem cell division. Science 315, 518-521.
270. Yang,A.H., Kaushal,D., Rehen,S.K., Kriedt,K., Kingsbury,M.A., McConnell,M.J., and Chun,J. (2003). Chromosome segregation defects contribute to aneuploidy in normal neural progenitor cells. J. Neurosci. 23, 10454-10462.
271. Yap,A.S., Niessen,C.M., and Gumbiner,B.M. (1998). The juxtamembrane region of the cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and interaction with p120ctn. J. Cell Biol. 141, 779-789.
272. Ying,Q.L., Nichols,J., Evans,E.P., and Smith,A.G. (2002). Changing potency by spontaneous fusion. Nature 416, 545-548.
273. Yue,L. and Spradling,A.C. (1992). hu-li tai shao, a gene required for ring canal formation during Drosophila oogenesis, encodes a homolog of adducin. Genes Dev. 6, 2443-2454.
249
274. Yusa,K., Horie,K., Kondoh,G., Kouno,M., Maeda,Y., Kinoshita,T., and Takeda,J. (2004). Genome-wide phenotype analysis in ES cells by regulated disruption of Bloom's syndrome gene. Nature 429, 896-899.
275. Zaccai,M. and Lipshitz,H.D. (1996). Role of Adducin-like (hu-li tai shao) mRNA and protein localization in regulating cytoskeletal structure and function during Drosophila Oogenesis and early embryogenesis. Dev. Genet. 19, 249-257.
276. Zhu,B., Chappuis-Flament,S., Wong,E., Jensen,I.E., Gumbiner,B.M., and Leckband,D. (2003). Functional analysis of the structural basis of homophilic cadherin adhesion. Biophys. J. 84, 4033-4042.