An Aptamer-Based Protein Biosensor by Detecting the Amplified Impedance Signal

Full Paper

An Aptamer-Based Protein Biosensor by Detecting the AmplifiedImpedance SignalYing Xu, Lin Yang, Xiaoyan Ye, Pingang He,* Yuzhi Fang*

Department of Chemistry, East China Normal University, Shanghai, 200062, P. R. China*e-mail: [email protected]; [email protected]

Received: May 1, 2006Accepted: May 25, 2006

AbstractA label-free electrochemical impedance based protein biosensor was introduced by using aptamer as recognition tool.Our sensing protocol utilizes the affinity interaction between the thrombin and the self-assembled DNA aptamer ongold electrode. This specific interaction increases the electrode interfacial electronic transfer resistance. The resistancesignal is then “amplified” by using guanidine hydrochloride to denature the captured thrombin for increasing thehydrated radius of the thrombin, consequently blocking the electron transfer from solution to electrode. The sensorsensitivity is improved using this strategy and as low as 1.0� 10�14 mol L�1 thrombin (enzymatic activity 10 U/mg) canbe detected out.

Keywords: Aptamer, Impedance, Protein biosensor, Thrombin

DOI: 10.1002/elan.200603566

1. Introduction

DNA aptamer, a novel class of short single-stranded nucleicacid, has become a new powerful tool in wide-scalemolecular recognition based on its specifically bindingwith the target molecules, including nucleic acids, proteins,peptides, small molecules, and even whole cells [1]. Addi-tionally, aptamer is replacing antibody in protein recogni-tion. For it can be “artificially” synthesized and thus labeledwith different marker molecules; it has strong bindingspecificity [2, 3]; it is relatively heat-stable and has a longshelf life. Several kinds of DNA aptamer-based proteinbiosensors have been developed, such as using quartz crystalmicrobalance (QCM) [4, 5], surface plasmon resonance(SPR) [6], optical [7], and fluorescence [3, 8 – 10] detectionstrategies. Electrochemical methods were also used totransduce the aptamer-protein recognition event on elec-trode by investigating the electrochemical response of thecaptured protein [11], labeled electroactive marker [12, 13],labeled enzyme [1], or by investigating the impedancechanges as the recognition signal [14 – 16].

In this work, we reported an impedance-based electro-chemical protein biosensor for directly detecting thrombinmolecules without using electroactive labels. The presenceof thrombin was detected by measuring the electrodeinterfacial electronic transfer resistance (Ret) change dueto the binding between the target protein thrombin and theaptamer immobilized on the sensor electrode (as shown inScheme 1). Firstly, the protein recognition layer on Auelectrode surface was fabricated by the self-assembly ofthiol group-ended thrombin aptamer, Aptamer I onto Auelectrode. This 15-mer aptamer is a well-known selective

product of SELEX (Systematic Evolution of ligands byexponential enrichment technique) to recognize thrombin[17, 18] with the dissociation constant (Kd) 10 – 150 nmol L�1

[19 – 21]. In a proper buffer solution, it folds into a chair-likestructure with two G-tetrad stacks by two TT loops and asingle TGT loop [22 – 26], and binds thrombin at thefibrinogen binding site [19, 24, 27]. Subsequently, 6-mer-capto-1-hexanol (MCH) was self-assembled onto the Ap-tamer I/Au electrode as blocking molecule to eliminate theunspecific adsorption between protein and electrode. Afterthe specific recognition of Aptamer I electrode andthrombin, the captured thrombin was unfolded into adenatured conformation by using guanidine hydrochloridetreatment. Such reaction did amplify the electrode Ret,showing an efficient and simple approach to improve thedetection sensitivity. In the experiments, the Ret differencefrom Aptamer I-MCH/Au electrode to guanidine hydro-chloride denatured thrombin/Aptamer I-MCH/Au elec-trode was recorded as the detection signal. The changesof impedance arcs reflected the sample protein concentra-tion.

2. Experimental

2.1. Reagents

All oligonucleotide sequences were customer-designed andsynthesized by Shanghai Shenergy Biocolor BiologicalScience & Technology Company (Shanghai, China). Thesequences of the thrombin aptamers were 15mer 5’-SH�(CH2)6�GGTTGGTGTGGTTGG (hereinafter, it

1449

Electroanalysis 18, 2006, No. 15, 1449 – 1456 © 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

was referred as Aptamer I) and 29mer 5’-NH2-ctatc�AGTCCGTGGTAGGGCAGGTTGGGGTGACT (here-inafter, it was referred to as Aptamer II). The sequence ofan unstructured linear single-stranded DNA used in con-trolled experiment was 5’�SH�(CH2)6�GAGCGGCG-CAACATTTCAGGTCGA. a-thrombin (enzymatic activityof 10 U mg�1, lyophilized power) and bovine serum albumin(BSA, lyophilized power) were purchased from Bei JingDing Guo Biotechnology Co., Ltd. (Beijing, China), and keptat �20 8C for use. 6-mercapto-1-hexanol (SH�(CH2)6�OH,>97.0%, Aldrich, hereinafter, it was referred as MCH) andmercaptoacetic acid (SHCH2COOH, >98%, Sigma) werepurchased from Sigma-Aldrich, Inc. Guanidine hydrochlor-ide (CH6ClN3, >99.0%) was purchased from ShanghaiYuanju Biology Technology Co. Ltd. (Shanghai, China).Rhodamine B (C28H31ClN2O3, >90%) was purchased fromChina National Medicine Group Shanghai Chemical Re-agent Company. The binding buffer solution used foraptamer capturing protein was 100 mmol L�1 phosphatebuffer solution (6.084 g NaH2PO4 ·2H2O and 21.848 g Na2

HPO4 ·12H2O were dissolved into 1.0 L solution using H2O,pH 7.0) containing 10 mmol L�1 KCl and 2 mmol L�1 MgCl2.Kþ ion is necessary in binding buffer solution for it stimulatesthe G-quartet assembly of aptamer [28].

2.2. Au Electrode Functionalization

Before modification, Aptamer I solution was heated at 908Cfor 3 min and cooled in ice bath to obtain a proper folding

structure [12]. Then 5 mL of binding buffer solution containing5.0�10�6 mol L�1 heat-treated Aptamer I was dropped onto afreshly prepared Au electrode surface and incubated overnightfor 12 h at room temperature (208C) in a humid chamber.After washing the Au electrode in binding buffer solution for30 min to remove the nonself-assembled Aptamer I, 5 mL ofbinding buffer solutioncontaining 1.0�10�3 mol L�1 MCH wasdropped onto electrode surface and incubated for 2 h at roomtemperature in a humid chamber. Finally, the Au electrode waswashed throughout in binding buffer solution for 30 min toremove the nonself-assembled MCH, and kept in a humidchamber for the following use. The Au electrodes used in theexperiments were prepared by standard photolithographic andwet chemical etching processes to pattern 250 nm Au layeronto glass surface. The active sensing area of such preparedbare Au electrode was 1.5569 mm2 determined by cyclicvoltammetry according to the Randles –Sevick equation [29].

2.3. Thrombin Binding and Denaturation Reactions

After the functionalization of Aptamer I and MCH onto Auelectrode, 5 mL of binding buffer solution containingthrombin was dropped onto electrode surface, and incubat-ed for 20 min at room temperature in a humid chamber. Foramplifying the recognition signal, 5 mL of binding buffersolution containing 6 mol L�1 guanidine hydrochloride wasdropped onto the thrombin/Aptamer I-MCH/Au electrodesurface for 1 h at room temperature in a humid chamber tounfold the captured thrombin.

Scheme 1. The aptamer-based protein biosensor by detecting the amplified impedance signal. Step 1: Aptamer I and 6-mercapto-1-hexanol (MCH) were self-assembled onto Au electrode successively. Step 2: Thrombin was captured onto the Aptamer I-MCH/Auelectrode. Step 3: Guanidine hydrochloride denatured the thrombin molecules on the Au electrode surface.

1450 Ying Xu et al.

Electroanalysis 18, 2006, No. 15, 1449 – 1456 www.electroanalysis.wiley-vch.de © 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electroanalysis.wiley-vch.de

2.4. Signal Detection

The specific binding reaction between Aptamer I-MCHmodified Au electrode and thrombin was investigated byelectrochemical impedance measurements using CHI 660Ainstrument (CHI instrument Inc., USA). A three-electrodesystem consisted of an Au electrode as working electrode tocapture thrombin, an Ag/AgCl electrode with KCl saturatedas reference electrode and a platinum wire as counterelectrode. Impedance measurements were performed in5 mL of 0.01 mol L�1 phosphate buffer solution containing0.01 mol L�1 K3[Fe(CN)6]/K3[Fe(CN)6] (1 : 1) from 105 downto 1.0 Hz with a sampling rate of 12 points per decade (ACamplitude: 5 mV, bias potential: 0.19 V, vs. Ag/AgCl).

In the experiments, Rhodamine B labeled Aptamer II wasreacted with thrombin/Aptamer I-MCH/Au electrode forfluorescence detection confirming the thrombin capture onAptamer I modified electrode. Briefly, Rhodamine B wascovalently bound to Aptamer II through forming amidebond in the presence of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride for 7 h. Then, the solution wasdialyzed until the dialyzing solution had no Rhodamine Babsorption at 480 nm measured by ultraviolet spectrum(CARY 50 Probe, USA). The concentration of Aptamer II –Rhodamine B complex was determined by the absorption ofoligonucleotide at 260 nm using CARY 50 Probe. 5 mL ofbinding buffer solution containing 5.0� 10�6 mol L�1

Aptamer II – Rhodamine B complex was dropped ontothe thrombin/Aptamer I-MCH/Au electrode surface for20 min at room temperature in a humid chamber. Then thefluorescence molecule, Rhodamine B, was dissolved fromthe sandwich system by using HCl solution (pH 2.0) todestroy the amide bond [30, 31]. The fluorescence signal ofRhodamine B was detected using a Fluoromax 4 (Spex)spectrofluorimeter in a 1 cm� 1 cm quartz cuvette withexcitation and emission bandwidth 5 nm. Excitation wave-length was set at 540 nm and emission spectra were recordedfrom 560 nm to 700 nm, the emission maximum is at 575 nm.

The thrombin denaturation was also investigated by aJEOL JSM-6700F field emission scanning electron micro-scope (SEM). That is an Au substance modified thrombin/Aptamer I-MCH was scanned by SEM before and afterguanidine hydrochloride treatment with the same aptamerimmobilization, protein capture and denaturation condi-tions as in the sensor fabrication.

3. Results and Discussion

Considering a simple redox reaction, Oxþ ne�>Red,

without forming an adsorbed layer onto electrode surface,the equivalent circuit of the detection system called Randlesequivalent circuit. The semicircle’s diameter in its Nyquistplot (the imaginary portion of impedance vs. the real portionof impedance) equals to the interfacial electronic trans-ference (Ret) value of the working electrode [32]. In thisstudy, Nyquist plot was used to investigate the Ret change ofthe modified Au electrode. The high hydrophobic layer of

protein on Au electrode was expected to efficiently perturbthe interfacial electron transfer between the Au electrodeand the electroactive K3Fe(CN)6/K4Fe(CN)6 in the impe-dance measurement solution.

3.1. Construction of Thrombin Biosensor UsingElectrochemical Impedance Technique

To fabricate the recognition layer on Au electrode surface,the thrombin aptamer chain was chemically modified withthiol group at its 5’-end, allowing it to form Au�S bond withAu electrode. As shown in Figure 1, the Ret of a bare Auelectrode was estimated to be 1384.8 W (curve a). Theattachment of Aptamer I onto Au electrode increased thesemicircle’s diameter in the Nyquist plot and the Ret was5809.2 W (curve b). It was explained that because Aptamer Iwas a single strand nucleic acid with negative charges on itsphosphate backbone, [Fe(CN)6]

3�/4� was suffered electro-static repulsive force from the Aptamer I modified elec-trode, and the resistance of [Fe(CN)6]

3�/4� to exchangeelectrons with Au electrode was increased as a result.Similar Ret change was often observed in impedance-basedDNA biosensors [33, 34]. Then, MCH was employed tooccupy the left bare sites on Aptamer I/Au electrode foreliminating the unspecific adsorption between the Auelectrode and protein molecules in the following thrombinrecognition experiment. As shown in the figure, the MCHmodification onto Aptamer I/Au electrode resulted in adecreasedRet (curve c), which can be contributed to that thespacer mercapto regent removed the unspecifically adsor-bed Aptamer I lying on Au surface [35, 36]. Savran et al.have showed that although surface-bound aptamer did notretain its all solution-phase activities, linking aptamer ontosubstrate surface did not significantly influence its specificability to recognize target protein [5]. Therefore, after theAptamer I-MCH/Au electrode was treated with thrombinsolution, thrombin was captured onto Aptamer I/Auelectrode surface. Due to the poor electronic transferability of protein, the electrode Ret was increased to10258.4 W (curve d). In order to amplify the Ret value,guanidine hydrochloride [37] was used to unfold thecaptured thrombin (curve e). Naturally, protein moleculeis in its three-dimensional structure by folding the poly-peptide chain into a curved, rigid conformation, burying itsnonpolar amino acids in the hydrophobic interior awayfrom the surrounding aqueous, hydrophilic medium. Themaintaining energy is from hydrophobic interaction, elec-trostatic forces, as well as hydrogen binding. However,guanidine hydrochloride would bind with the amino acidresidues of protein by forming hydrogen bond in themanner as shown in Figure 2, destroying the self-hydrogenbonds of polypeptide chain. As a consequence, thrombinwas unfolded into a loose linear primary structure with alarger radius, and the hydrophobic side-chains whichformerly buried in the interior were turned outside. SEMimages showed that the denatured thrombin formed acontinuous layer over the substrate with a larger hydrated

1451Aptamer-Based Protein Biosensor



radius ((Fig. 2 right SEM) when compared with theundenatured one (left SEM).

The electrode modification was also investigated by thecyclic voltammetry of Fe(CN)6

3�/4� and the results were

listed in Table 1. According to the data calculated based onequations Ret ¼RT(n1

2F2AKet[S])�1 [32] and ip ¼ 0.4463n2FAC(n2FvD/RT)1/2 [29], where R is the gas constant, Tthe absolute temperature, n1 the number of transferred

Fig. 1. Nyquist plots measured at bare Au electrode (a), Aptamer I/Au electrode (b), Aptamer I-MCH/Au electrode (c), thrombin/Aptamer I-MCH/Au electrode (d) and thrombin/Aptamer I-MCH/Au electrode after the guanidine hydrochloride treatment (e). Thethrombin was 1.0� 10�13 mol L�1.

Fig. 2. SEM images of thrombin molecules before (left) and after (right) the guanidine hydrochloride treatment. The inset is the imageof thrombin in low-density captured onto Au electrode before and after denaturation. The upper is the schematic representation ofprotein-guanidine hydrochloride complex.

1452 Ying Xu et al.



electrons per molecule of the redox probe, F Faraday’sconstant, A the electrode area, Ket the heterogeneouselectron-transfer rate constant, [S] and C the concentrationof the redox marker, ip the peak height, n2 the number ofelectrons appearing in half-reaction for the redox couple, vthe sweeping rate, and D the analyte’s diffusion coefficient,it can be concluded that under controlledT, [S](C) and v, thevalue of (AKet) and (AD1/2) of Au electrode were bothsuccessively decreased by the modification of Aptamer I-MCH and thrombin, and treatment of guanidine hydro-chloride. The ration is 1 : 0.304 :0.135 : 0.0673 and1 :0.740 : 0.716 :0.518, respectively (Table 1), showing thatFe(CN)6

3�/4� suffered a continuous increased resistancefrom the modified Au electrode.

3.2. The Sensitivity and Selectivity of Thrombin Detection

The sensitivity of this impedance-based protein analysisprotocol was investigated by incubating the Aptamer I-MCH/Au electrode with varied concentration of thrombinunder the same binding and denaturing experiment con-ditions. As summarized in Figures 3A, B, the semicircle ofNyquist plot continued enlarging with the thrombin con-centration increasing. Until the thrombin concentration wasover 1.0� 10�9 mol L�1, the Aptamer I modified electrodereached its saturation to capture thrombin. The resultinglinear regression for the signal from 1.0� 10�14 mol L�1 to1.0� 10�13 mol L�1 (Fig. 3C, curve b) is Y¼1254.764þ1410.825 X (Y is the increment of Ret from Aptamer I-MCH/Au electrode to thrombin/Aptamer I-MCH/Au elec-trode after denaturation treatment in W; X is the thrombinconcentration� 1014 in mol L�1), regression coefficient (R)is 0.9918. Because the enzymatic activity of the thrombinused in the experiments was 10 U/mg, which was lower thanthe usually analyzed thrombin from 100 to 1000 U/mg, andKd depends on enzymatic activity of protein not on totalprotein concentration [28], this impedance-based proteinbiosensor is easy-to-use for detecting low concentrationof target protein. This sensor can be thought to go inreal samples by capturing the target protein out from thesample onto sensor electrode, and detecting the impedance

change of the electrode in the impedance measurementsolution.

We also investigated the relationship of theRet increase vs.the thrombin concentration in this sensor without carryingout denaturation treatment (Fig. 3C, curve a). The resultinglinear regression is Y¼982.482þ 290.326 X (Y is the incre-ment of Ret from Aptamer I-MCH/Au electrode to throm-bin/Aptamer I-MCH/Au electrode in W; X is the thrombinconcentration� 1014 in mol L�1), R is 0.9492. As comparingcurve a and b in Figure 3C, it can be concluded that thedenaturation of protein into its primary structure with alarger hydrated radius did efficiently block the Fe(CN)6

3�/4�

accessing Au electrode, and consequently amplify theelectrode Ret and improve the detection sensitive.

In the controlled experiments, the specificity of thisbiosensor was investigated by changing the target protein orthe single-stranded DNA immobilized on Au electrode.Briefly, BSA (1.0� 10�5 mol L�1) was used to react withAptamer I-MCH/Au electrode for 20 min, then the elec-trode was treated with guanidine hydrochloride for 1 h. Theadsorption of the BSA onto Aptamer I-MCH/Au electrodecan be neglectable as the Ret change was only 81 W (Fig. 4A,curve a to curve b). However, after the electrode was treatedby guanidine hydrochloride subsequently, the electrode Ret

increased (curve c), which might attributed to the specialreaction of BSA and guanidine hydrochloride. The totalincreasedRet was 2285.2W, which was about 1/7 of the signalof Aptamer I-MCH/Au electrode capturing 1.0� 10�13 molL�1 thrombin (Fig. 1). In another controlled experiment, Auelectrode was modified with 24-mer unstructured linearssDNA and MCH, and treated with thrombin solution(1.0� 10�13 mol L�1) and guanidine hydrochloride subse-quently. As shown in Figure 4B, a little of thrombin wasadsorbed to the linear ssDNA-MCH/Au electrode (curve ato curve b), and consequently denatured by guanidinehydrochloride (curve c). The total increased Ret was1230.5 W, which was 1/13 of that of Aptamer I-MCH/Auelectrode capturing thrombin (Fig. 1). Therefore, it can beconcluded that in this sensor the specific aptamer-proteininteraction, maybe with a little neglectable adsorptionfactor, resulted in an obvious increment ofRet when comparedwith the “noncomplementary” DNA and protein reaction.

Table 1. The experimental data calculated based on the Nyquist plots and cyclic voltammograms in Figure 1.

Electrode Au (a) Aptamer I/Au (b)

Aptamer I/MCH/Au (c)

Thrombin/Aptamer I/MCH/Au (d)

Guanidine HCltreated Au (e)

Rs (W) 200.2 228.4 218 241.8 287.1Ret (W) 1384.8 5809.2 4552 10258.4 20549ip of oxidation peak (mA) 41.94 31.03 30.03 21.71Ep of oxidation peak (V) 0.296 0.336 0.355 0.428Ep of reduction peak (V) 0.159 0.102 0.0725 �0.0285DEp (V) 0.137 0.234 0.282 0.457

Rc/Ra ¼ 3.287, Rd/Rc ¼ 2.254, Re/Rd¼ 2.003Ra :Rc :Rd :Re ¼ 1 : 3.287 : 7.409 : 14.840 (herein, R is the electrode Ret)(AKet)a : (AKet)c : (AKet)d : (AKet)e ¼ 1 : 0.304 : 0.135 : 0.0673ia/ic ¼ 1.352, ic/id ¼ 1.033, id/ie ¼ 1.383ia : ic : id : ie¼ 1 : 0.740 : 0.716 : 0.518(AD1/2)a : (AD1/2)c : (AD1/2)d : (AD1/2)e¼ 1 : 0.740 : 0.716 : 0.518




3.3. Fluorescence-Based Thrombin Detection in SandwichSystem

Thrombin can simultaneously bind with two differentfamilies of aptamers at its different positions [2] withoutseriously influencing each other’s intercalation with protein[38]. In the experiments, we employed another aptamer,Aptamer II to react with the thrombin/Aptamer I-MCH/Auforming a sandwich fluorescence assay system and confirm-ing the specific capture of thrombin onto the Aptamer Imodified electrode (Fig. 5 inset). Aptamer II (the sequencewas introduced in Materials Section) is another thrombinaptamer with Kd 0.5 nmol L�1 [24]. It forms two G-quartetswith an additional DNA duplex [28], and binds to theheparin binding site of thrombin [19, 24]. In this work,Aptamer II was labeled with Rhodamine B as a fluorescencesignal reporter. As shown in Figure 5, a visible emission ofthe resolved Rhodamine B from the Aptamer II/thrombin/Aptamer I-MCH/Au in HCl solution was obtained at

Fig. 3. A) Nyquist plots of Aptamer I-MCH/Au electrode afterreacting with different concentrations of thrombin and beingdenatured with guanidine hydrochloride. B) The Ret changecaused by capturing different concentrations of thrombin ontoAptamer I-MCH/Au electrode after denaturation treatment. C)The calibration plots of Ret increase from Aptamer I-MCH/Auelectrode to thrombin/Aptamer I-MCH/Au electrode (a) andafter denaturation treatment (b) vs. the thrombin from 1.0� 10�14

mol L�1 to 1.0� 10�13 mol L�1.

Fig. 4. A) Nyquist plots of Aptamer I-MCH modified Auelectrode (a) after being treated with BSA (1.0� 10�5 mol L�1)(b) and then being denatured by guanidine hydrochloride (c). B)Nyquist plots of unstructured SH-ssDNA-MCH modified Auelectrode (a) after being treated with thrombin (1.0� 10�13 molL�1) (b) and then being denatured by guanidine hydrochloride (c).

1454 Ying Xu et al.



576 nm, and the emission strength was 0.332. There was nofluorescence emission in the blank HCl solution, and BSAsolution resulted only 4% fluorescence signal when com-pared with thrombin. This means aptamer specificallybound to thrombin and the fluorescence intensity was onlydetermined by thrombin.

3.4. Other Optimized Conditions

Unspecific adsorption between target biomolecules (e.g.DNA, protein) and transducer surface is a disadvantage indeveloping biosensors, for it gives a background signal. Inorder to reduce the contact between biomolecules andsubstrate surface and eliminate the unspecific adsorption,several blocking molecules, such as BSA, Tween 20, T-blocketc. have been used to occupy the bare sites of transducersurface [3]. In this work, we compared two water-solublemercapto-reagents as blocking molecules on eliminating thethrombin’s unspecific adsorption on Au electrode. One ismercaptoacetic acid (SHCH2COOH) and the other is 6-mercapto-1-hexanol (SH(CH2)6OH). In the experiment, theAu electrode was successively modified by SH-Aptamer Iand mercapto-reagent for 12 h and 2 h. Then, binding buffersolution containing 1.0� 10�5 mol L�1 BSA was dropped onthe Aptamer I-RSH (ab. mercapto-reagent) modified Auelectrode and incubated for 20 min. The increased Ret

caused by BSA adsorption onto Aptamer I-RSH/Auelectrode was 1849.3 W, 800W and 81W for non-usingRSH modification, using SHCH2COOH2 and SH(CH2)6OHmodification, respectively. Therefore, we chose SH(CH2)6

OH, which has a longer chain, as the blocking molecule toreduce the unspecific adsorption between thrombin andelectrode.

In the experiments, the recognition of low concentrationof thrombin depended on amplifying the Ret by denaturingthe captured protein into its loose structure. The relation-ship of the denaturing time vs. the Ret change wasinvestigated by using guanidine hydrochloride as thedenaturing reagent. As shown in Figure 6, Guanidine spentabout 1.5 h to denature the thrombin molecules to themaximumRet. Then, the longer denaturing time resulted in adowntrend of Ret. It might be explained that the Kd of theaptamer-protein was decreased as the result of the signifi-cant protein configuration change with a long denaturingtime. The aptamer, consequently, could not fasten thethrombin molecules tightly as before. Therefore, 1 h waschosen as the denaturing time to unfold the capturedthrombin in the experiments.

Fig. 5. Fluorescence emission spectra of Rhodamine B dissolved from Aptamer II/thrombin/Aptamer I-MCH/Au electrodes (totallynine electrodes) into 2 mL HCl solution (pH 2.0). Inset: The fluorescence detection scheme of protein in sandwich manner using twokinds of thrombin aptamers. The thrombin was 1.0� 10�9 mol L�1.

Fig. 6. The increment of Ret caused by the denaturation treat-ment of guanidine hydrochloride vs. denaturation time. Thethrombin was 4.0� 10�14 mol L�1.




4. Conclusions

In conclusion, an electrochemical impedance protein bio-sensor was fabricated by using aptamer as molecularrecognition tool. The captured thrombin molecules on Auelectrode surface were carried out denaturation treatmentto enlarge the interfacial electronic transfer resistance. Thisimpedance-based protein biosensor eliminates the aptamerand/or protein modification with electroactive or fluores-cence molecules, giving an acceptable detection sensitivityand selectivity. Further research works based on aptamerare being carried out in our lab to find more efficientamplification methods to enlarge impedance value fordetecting low concentration of target protein, employ thesensor to analyze protein in real sample, and fabricateprotein chip using impedance detection technique, etc.

5. Acknowledgements

We thank the National Nature Science Foundation of China(NSFC), which financially supported this work (No.29875008). We are grateful to Prof. Anbao Wang (ShanghaiInstitute of Ceramics Chinese Academy of Science, ChineseAcademy of Sciences Shanghai Branch) for SEM experi-ments, Prof. Hsing I-Ming (University of Science andTechnology, Hong Kong) providing Au electrodes andrevising this paper.

6. References

[1] M. Moreno, G. Fernandez, A. Domingo, A. Jimenez-Ruiz,M. Salinas, V. M. Gonzalez, Biochem. Biophys. Res. Com-mun. 2003, 308, 214.

[2] K. Ikebukuro, C. Kiyohara, K. Sode, Biosens. Bioelectron.2005, 20, 2168.

[3] K. Stadtherr, H. Wolf, P. Lindner, Anal. Chem. 2005, 77,3437.

[4] M. Liss, B. Petersen, H. Wolf, E. Prohaska, Anal. Chem.2002, 74, 4488.

[5] C. A. Savran, S. M. Knudsen, A. D. Ellington, S. R. Manalis,Anal. Chem. 2004, 76, 3194.

[6] S. Tombelli, M. Minunni, M., Mascini, Anal. Lett. 2002, 35,599.

[7] Y. Jiang, X. Fang, C. Bai, Anal. Chem. 2004, 76, 5230.[8] X. Fang, Z. Cao, T. Beck, W. Tan, Anal. Chem. 2001, 73, 5752.[9] N. Hamaguchi, A. Ellington, M. Stanton, Anal. Biochem.

2001, 294, 126.[10] M. Lee, D. R. Walt, Anal. Biochem. 2000, 282, 142.[11] A. N. Kawde, M. C. Rodriguez, T. M.H. Lee, J. Wang,

Electrochem. Commun. 2005, 7, 537.

[12] T. Hianik, V. Ostatna, Z. Zajacova, E. Stoikova, G. Evtugyn,Bioorg. Med. Chem. Lett. 2005, 15, 291.

[13] J. A. Hansen, J. Wang, A. N. Kawde, Y. Xiang, K. V. Gothelf,G. Collins, J. Am. Chem. Soc. 2006, 128, 2228.

[14] H. Cai, T. M. H. Lee, I. M. Hsing, Sen. Actuators B 2006, 114,433.

[15] D. Xu, D. Xu, X. Yu, Z. Liu, W. He, Z. Ma, Anal. Chem.2005, 77, 5107.

[16] A. E.Radi, J. L. A. Sanchez, E. Baldrich, C. K. O’Sullivan,Anal. Chem. 2005, 77, 6320.

[17] E. DiCera, Q. D. Dang, Y. M. Ayala, Cell. Mol. Life Sci.1997, 53, 701.

[18] M. Tsiang, A. K. Jain, K. E. Dunn, M. E. Rojas, L. K. Leung,C. S. Gibbs, J. Biol. Chem. 1995, 270, 16854.

[19] L. C. Bock, L. C. Griffin, J. A. Latham, E. H. Vermaas, J. J.Toole, Nature 1992, 355, 564.

[20] R. F. Macaya, J. A. Waldron, B. A. Beutel, H. Gao, M. E.Joesten, M. Yang, R. Patel, A. H. Bertelsen, A. F. Cook,Biochemistry 1995, 34, 4478.

[21] R. A. Potyrailo, G. M. Hieftje, Anal. Chem. 1998, 70, 3407.[22] L. C. Griffin, J. J. Toole, L. L. Leung, Gene 1993, 137, 25.[23] G. He, J. P. Williams, M. J. Postich, S. Swaminathan, R. G.

Shea, T. Terhorst, V. S. Law, C. T. Mao, C. Sueoka, S. Coutre,N. Bischofberger, J. Med. Chem. 1998, 41, 4224.

[24] D. M. Tasset, M. F. Kubik, W. Steiner, J. Mol. Biol. 1997, 272,688.

[25] K. Y. Wang, S. H. Krawczyk, N. Bischofberger, S. Swamina-than, P. H. Bolton, Biochemistry 1993, 32, 11285.

[26] K. Y. Wang, S. McCurdy, R. G. Shea, S. Swaminathan, P. H.Bolton, Biochemistry 1993, 32, 1899.

[27] Q. Wu, M. Tsiang, J. E. Sadler, J. Biol. Chem. 1992, 267,24408.

[28] V. Spiridonova, T. Rassokhin, A. Golovin, E. Petrova, T.Rohzdestvensky, Y. Pakhomova, A. Kopylov, Bioelectro-chemistry 2002, 56, 95.

[29] A. J. Bard, L. R. Faulkner, Electrochemical Methods: Funda-mentals and Applications, Wiley, Chichester 1980.

[30] S. S. Ghosh, G. F. Musso, Nucl. Acids Res. 1987, 15, 5353.[31] S. H. Liu, C. L. Sun, P. G. He, Y. Z. Fang, Chin. J. Anal.

Chem. 1999, 27, 130.[32] Z. B. Stoynov, B. M. Grafov, B. S. Savova-Stoynov, V. V.

Elkin, Electrochemical impedance, Nauka, Moscow 1991.[33] L. Alfonta, A. Bardea, O. Khersonsky, E. Katz, I. Willer,

Biosens. Bioelectron. 2001, 16, 675.[34] H. Cai, Y. Xu, P. G. He, Y. Z. Fang, Electroanalysis 2003, 15,

1864.[35] X. Liu, W. Farmerie, S. Schuster, W. Tan, Anal. Biochem.

2000, 283, 56.[36] E. Southern, K. Mir, M. Shchepinov, Nat. Genet. Suppl. 1999,

21, 5.[37] T. Shen, J. Y. Wang, Biochemistry, 2nd ed., China High

Education Press & Springer, Beijing 1990.[38] H. Dougan, J. I. Weitz, A. R. Stafford, K. D. Gillespie, P.

Klement, J. B. Hobbs, Nucl. Med. Biol. 2003, 30, 61.

1456 Ying Xu et al.



Documents

An Aptamer-Based Protein Biosensor by Detecting the Amplified Impedance Signal