Alkaline Lysis, SDS Alkaline Lysis, SDS Page, Sequencing, Page, Sequencing, Chromatography, Chromatography, Agarose Gel Agarose Gel Electrophrosis, ProbesElectrophrosis, Probes

Alkaline LysisAlkaline Lysis

It is method of choice for isolating It is method of choice for isolating circular plasmid DNA or even RNA circular plasmid DNA or even RNA from cells.from cells.

It is probably one of the most It is probably one of the most generally useful techniques as it generally useful techniques as it is fast, reliable and relatively is fast, reliable and relatively clean way to obtain DNA from clean way to obtain DNA from cells.cells.

Alkaline lysis depends on a Alkaline lysis depends on a unique property of plasmid DNA. unique property of plasmid DNA. It is able to rapidly anneal It is able to rapidly anneal following denaturation.following denaturation.

This is what allows the plasmid This is what allows the plasmid DNA to be separated from the DNA to be separated from the chromosome.chromosome.

The cell debris is precipited using The cell debris is precipited using SDS and potassium acetate. This is SDS and potassium acetate. This is spun down, and the pellet is spun down, and the pellet is removed.removed.

Isopropanol is then used to Isopropanol is then used to precipitate the DNA from the precipitate the DNA from the supernatant, the supernatant supernatant, the supernatant removed, and the DNA is removed, and the DNA is resuspended in buffer.resuspended in buffer.

ProcedureProcedure

1.Spin down cells : DNA is in the cells, so 1.Spin down cells : DNA is in the cells, so it is in the pellet.it is in the pellet.

2. Discard the supernatant : pieces of 2. Discard the supernatant : pieces of cell wall released are floating around cell wall released are floating around in the supernatant. These cell wall in the supernatant. These cell wall pieces can inhibit enzyme action on pieces can inhibit enzyme action on the final DNA, so it is impt to get rid of the final DNA, so it is impt to get rid of all the supernatant and to even invert all the supernatant and to even invert the tube and wipe the lip with a Q-tip.the tube and wipe the lip with a Q-tip.

3. Resuspend the cells: in the buffer i.e. 3. Resuspend the cells: in the buffer i.e. EDTA. EDTA chelates divalent metals EDTA. EDTA chelates divalent metals (primarily magnesium and calcium ). (primarily magnesium and calcium ).

Removal of these cations destabilizes Removal of these cations destabilizes the cell membrane. It also inhibits the cell membrane. It also inhibits DNases. Glucose should also be added DNases. Glucose should also be added to maintain osmolarity and prevent the to maintain osmolarity and prevent the buffer from bursting the cells.buffer from bursting the cells.

4 . Lyse the cells :4 . Lyse the cells :

This is done with sodium This is done with sodium hydroxide and SDS. This highly hydroxide and SDS. This highly alkaline solution gave rise to the alkaline solution gave rise to the name to the technique. Mix this name to the technique. Mix this by gentle inversion and incubate by gentle inversion and incubate on ice for five mints ( but no on ice for five mints ( but no longer, or DNA will be irreversibly longer, or DNA will be irreversibly denaturized ) denaturized )

Three things happen during this stageThree things happen during this stagea.a. SDS pops holes in the cell membranes. SDS pops holes in the cell membranes. b.b. NaoH loosens the cell walls and NaoH loosens the cell walls and

releases the plasmid DNA and sheared releases the plasmid DNA and sheared cellular DNA.cellular DNA.

c.c. NaoH denatures the DNA. Cellular DNA NaoH denatures the DNA. Cellular DNA becomes lineraized and the strands are becomes lineraized and the strands are separated. Plasmid DNA is circular and separated. Plasmid DNA is circular and remains topologically constrained. remains topologically constrained.

5.Renature the 5.Renature the plasmid and get rid of plasmid and get rid of the garbagethe garbage Add potassium acetate (KAc), which Add potassium acetate (KAc), which

does three thingsdoes three things1.1. Circular DNA is allowed to renature. Circular DNA is allowed to renature.

Sheared cellular DNA remains denatured Sheared cellular DNA remains denatured as single stranded DNA (ssDNA).as single stranded DNA (ssDNA).

2.2. The ssDNA is precipitated, since large The ssDNA is precipitated, since large ssDNA molecules are insoluble in high ssDNA molecules are insoluble in high salt.salt.

3.3. Adding potassium acetate to the SDS Adding potassium acetate to the SDS forms KDS, which is insoluble. This will forms KDS, which is insoluble. This will allow for the easy removal of the SDS allow for the easy removal of the SDS from plasmid DNA.from plasmid DNA.

Now that the contaminants can Now that the contaminants can be easily separated and be easily separated and centrifuge to remove the cell centrifuge to remove the cell debris, KDS and cellular ssDNA. debris, KDS and cellular ssDNA.

The plasmid DNA is in the The plasmid DNA is in the supernatant, while all of the supernatant, while all of the garbage is in the pellet.garbage is in the pellet.

6. Precipitate the 6. Precipitate the Plasmid DNA by Alcohol Plasmid DNA by Alcohol PrecipitationPrecipitation Ethanol or isopropanol and a salt Ethanol or isopropanol and a salt

such as ammonium acetate, lithium such as ammonium acetate, lithium chloride, sodium chloride or sodium chloride, sodium chloride or sodium acetate and spin this down. DNA is acetate and spin this down. DNA is negatively charged, so adding a negatively charged, so adding a salt masks the charges and allows salt masks the charges and allows DNA to precipitate. This will place DNA to precipitate. This will place DNA in the pellet.DNA in the pellet.

Rinse the pellet – plasmid DNA – Rinse the pellet – plasmid DNA – in ice cold 70% EtOH and air dry in ice cold 70% EtOH and air dry for about 10 mints to allow the for about 10 mints to allow the EtOH to evaporate.EtOH to evaporate.

Resuspend the clean DNA- pellet Resuspend the clean DNA- pellet in buffer EDTA plus RNases to in buffer EDTA plus RNases to cleave any remaining RNA. The cleave any remaining RNA. The DNA is back in solution. DNA is back in solution.

Uses Uses

DNA of this purity is use for the DNA of this purity is use for the following.following.

1. In vitro transcripiton or 1. In vitro transcripiton or translation with some enzymes.translation with some enzymes.

SDS PageSDS Page

Sodium Dodecyl Sulfate Polyacrylamide Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis.Gel Electrophoresis.

It is a technique used in biochemistry, It is a technique used in biochemistry, genetics and molecular biology to genetics and molecular biology to separate proteins according to their separate proteins according to their functional length of polypeptide chain in functional length of polypeptide chain in or molecular weight as well as higher or molecular weight as well as higher order protein folding ( in other words order protein folding ( in other words according to their electrophoretic according to their electrophoretic mobility ) mobility )

The SDS portion is a detergent used in The SDS portion is a detergent used in shampoo, soap, or toothpaste.shampoo, soap, or toothpaste.

The purpose of SDS is to take the The purpose of SDS is to take the protein from the native shape, which is protein from the native shape, which is a big glob, and open it up into linear a big glob, and open it up into linear piece. This will allow it to run more piece. This will allow it to run more efficiently down the gel and will be efficiently down the gel and will be easier to compare.easier to compare.

SDS is an anionic detergent that binds SDS is an anionic detergent that binds quantitatively to proteins, giving them quantitatively to proteins, giving them linearity and uniform charge, so that linearity and uniform charge, so that they can be separated solely on the they can be separated solely on the basis of their size.basis of their size.

Procedure Procedure

The solution of proteins to be analyzed is first The solution of proteins to be analyzed is first mixed with SDS, which denatures secondary mixed with SDS, which denatures secondary and non-disulfide-linked tertiary structures, and non-disulfide-linked tertiary structures, and applies a negative charge to the proteins and applies a negative charge to the proteins in proportion to its mass.in proportion to its mass.

Adding SDS linearizes the proteins so that they Adding SDS linearizes the proteins so that they may be separated strictly by molecular wt.may be separated strictly by molecular wt.

The SDS binds to the proteins in a ratio of app The SDS binds to the proteins in a ratio of app 1.1 – 2.2 g SDS/g protein.1.1 – 2.2 g SDS/g protein.

This gives a uniform mass: charge ration for This gives a uniform mass: charge ration for most the proteins, so that the distance of most the proteins, so that the distance of migration through the gel is related to the size migration through the gel is related to the size of the protein.of the protein.

Electrophoresis and Electrophoresis and StainingStaining The denatured proteins are applied to The denatured proteins are applied to

one end of a layer of polyacrylamide gel one end of a layer of polyacrylamide gel submerged in a suitable buffer.submerged in a suitable buffer.

An electric current is applied across the An electric current is applied across the gel, causing the ‘-’vely charged proteins gel, causing the ‘-’vely charged proteins to migrate across the gel.to migrate across the gel.

Depending on their size, each protein Depending on their size, each protein will move differently through the gel will move differently through the gel matrix, short proteins will more easily fit matrix, short proteins will more easily fit through the pores in the gel, while the through the pores in the gel, while the larger ones will have more difficulty.larger ones will have more difficulty.

After a set amount of time the proteins will After a set amount of time the proteins will have differentially migrated based on their have differentially migrated based on their size, smaller proteins will have traveled size, smaller proteins will have traveled further down, while the larger ones will have further down, while the larger ones will have remained closer to the point of origin.remained closer to the point of origin.

Once this is done the gel is fixed so that the Once this is done the gel is fixed so that the proteins in the gel don’t come out when the proteins in the gel don’t come out when the gel is stained.gel is stained.

The fixative used is acetic acid 25 % in The fixative used is acetic acid 25 % in water. The gel is stained with coomasie blue water. The gel is stained with coomasie blue dye R250 or silver stain, allowing dye R250 or silver stain, allowing visualization of the proteins . visualization of the proteins .

After staining, different proteins will After staining, different proteins will appear as distinct bands within the appear as distinct bands within the gel.gel.

It is common to run ‘marker proteins’ It is common to run ‘marker proteins’ of known molecular wt in a separate of known molecular wt in a separate lane in the gel, in order to calibrate the lane in the gel, in order to calibrate the gel and determine the wt of unknown gel and determine the wt of unknown proteins by comparing the distance proteins by comparing the distance traveled relative to the marker.traveled relative to the marker.

Reducing SDS-PAGEReducing SDS-PAGE

Besides the addition of SDS, proteins Besides the addition of SDS, proteins may optionally be briefly heated to near may optionally be briefly heated to near boiling in the presence of a reducing boiling in the presence of a reducing agent, such as dithiothreitol or 2-agent, such as dithiothreitol or 2-mercaptoethanol, which further mercaptoethanol, which further denatures the proteins by reducing denatures the proteins by reducing disulfide linkages, thus overcoming disulfide linkages, thus overcoming forms of tertiary protein folding, and forms of tertiary protein folding, and breaking up quaternary protein breaking up quaternary protein structure.structure.

UsesUses

Establishing protein sizeEstablishing protein size Protein identificationProtein identification Determining sample purityDetermining sample purity Identifying disulfide bondsIdentifying disulfide bonds Quantifying proteinsQuantifying proteins Blotting applicationsBlotting applications

Sequencing Sequencing

DNA sequencing is the process of DNA sequencing is the process of determining the nucleotide order determining the nucleotide order of a given DNA fragment.of a given DNA fragment.

The most frequently used The most frequently used methods is the one developed by methods is the one developed by Frederick Sanger using Chain Frederick Sanger using Chain termination.termination.

Dideoxynucleotides (ddNTPs) are Dideoxynucleotides (ddNTPs) are missing a hyroxyl (OH) group at the 3 missing a hyroxyl (OH) group at the 3 position. This position is normally where position. This position is normally where one nucleotide attaches to form a chain.one nucleotide attaches to form a chain.

p-p-p-OCHp-p-p-OCH22 oo BasBaseeHH

HHHHHH

HH HH

Dideoxynucleotide (ddNTP)Dideoxynucleotide (ddNTP) Deoxynucleotide (dNTP)Deoxynucleotide (dNTP)

oop-p-p-OCHp-p-p-OCH22

HHHH HH

HHHHOHOH

BaseBase

Manual SequencingManual Sequencing

To begin the process firstly To begin the process firstly synthesizing a chain that is synthesizing a chain that is complimentary to the template to complimentary to the template to be analyzed should be done.be analyzed should be done.

Add a primer that will anneal. Add a primer that will anneal. Usually a oligonucleotide primer Usually a oligonucleotide primer which is complementary to the which is complementary to the template at that region is used. template at that region is used.

Divide the sample among four test Divide the sample among four test tubes. One test tube will be used for tubes. One test tube will be used for each specific nucleotide each specific nucleotide (dGTP,dATP,dCTP,and dTTP).(dGTP,dATP,dCTP,and dTTP).

Add DNA polymerase to each tube and Add DNA polymerase to each tube and one specific nucleotide per tube.one specific nucleotide per tube.

Add ddNTPs to all four tubes. Once this Add ddNTPs to all four tubes. Once this is added the chain will not elongate is added the chain will not elongate and there is chain termination. and there is chain termination.

Run this on a polyacrylamide gel Run this on a polyacrylamide gel using one lane per reaction tube using one lane per reaction tube (dGTP,dATP,dCTP and dTTP ).(dGTP,dATP,dCTP and dTTP ).

To sequence, read the order of To sequence, read the order of bases from the smallest to the bases from the smallest to the largest.largest.

Add ddGTP, ddATP, Add ddGTP, ddATP, ddCTP,ddTTP, one to each ddCTP,ddTTP, one to each of four tubes containing of four tubes containing target DNA. Load each target DNA. Load each onto a separate lane on a onto a separate lane on a gel.gel.

LargestLargestTo sequence, read To sequence, read

the the order of bases order of bases from the from the smallest smallest to the largest.to the largest.

TCGAAGACGTATCTCGAAGACGTATC

SmallestSmallest

ddGTPddGTP ddATPddATP ddCTPddCTP ddTTddTTPP

Automated SequencingAutomated Sequencing

An automated sequencer runs on the same An automated sequencer runs on the same principle as the Sanger method.principle as the Sanger method.

A laser constantly scans the bottom of the A laser constantly scans the bottom of the gel, detecting bands as they move down the gel, detecting bands as they move down the gel. gel.

Where the manual method uses a radioactive Where the manual method uses a radioactive labeling, automated sequencing uses labeling, automated sequencing uses fluorescent tags on the ddNTPs ( a different fluorescent tags on the ddNTPs ( a different dye used for each nucleotide ).dye used for each nucleotide ).

This makes it possible for all four reactions to This makes it possible for all four reactions to be run in one lane, so that huge numbers of be run in one lane, so that huge numbers of reactions are on the gel. reactions are on the gel.

Dye Terminator Dye Terminator SequencingSequencing An alternative to the labeling of An alternative to the labeling of

the primer is to label the the primer is to label the terminators instead.terminators instead.

The major advantage is that The major advantage is that complete sequencing set can be complete sequencing set can be performed in a single reaction, performed in a single reaction, rather than the four needed with rather than the four needed with the labeled-primer approach. the labeled-primer approach.

454 Sequencing 454 Sequencing

This sequencing was developed in early 2000s.This sequencing was developed in early 2000s. In this method single stranded DNA is In this method single stranded DNA is

annealed to beads and amplified via PCR.annealed to beads and amplified via PCR. These DNA-bound beads are then placed into These DNA-bound beads are then placed into

wells on a fiber-optic chip along with enzymes wells on a fiber-optic chip along with enzymes which produce light in the presence of ATP.which produce light in the presence of ATP.

When free nucleotides are washed over the When free nucleotides are washed over the chip, light is produced as ATP is generated chip, light is produced as ATP is generated when nucleotides are washed over the chip when nucleotides are washed over the chip join with their complementary base pairs. join with their complementary base pairs. Addition of one nucleotide results in a reaction Addition of one nucleotide results in a reaction that generates a light signal that is recorded that generates a light signal that is recorded by the CCD camera.by the CCD camera.

The signal strength is proportional to the The signal strength is proportional to the number of the nucleotides. number of the nucleotides.

RNA SequencingRNA Sequencing

RNA is less stable in the cell, and also more RNA is less stable in the cell, and also more prone to nuclease attack. As RNA is generated prone to nuclease attack. As RNA is generated by transcription from DNA, the information is by transcription from DNA, the information is already present in the cell’s DNA.already present in the cell’s DNA.

RNA molecules are not necessarily co-linear RNA molecules are not necessarily co-linear with their DNA template as introns are excised.with their DNA template as introns are excised.

To sequence RNA, the usual method is first to To sequence RNA, the usual method is first to reverse transcribe the sample to generate DNA reverse transcribe the sample to generate DNA fragments.fragments.

This is then sequenced the above described This is then sequenced the above described manner.manner.

Agarose Gel Agarose Gel ElectrophoresisElectrophoresis This is a method used in biochemistry This is a method used in biochemistry

and molecular biology to separate and molecular biology to separate DNA, RNA or protein molecules by size.DNA, RNA or protein molecules by size.

This is achieved by moving ‘-’vely This is achieved by moving ‘-’vely charged nucleic acid molecules charged nucleic acid molecules through an agarose matrix with an through an agarose matrix with an electric field. Shorter molecules move electric field. Shorter molecules move faster and migrate further than larger faster and migrate further than larger ones.ones.

Materials Materials

For AGE several items are neededFor AGE several items are needed1.1. DNA fragments to separateDNA fragments to separate2.2. DNA size markersDNA size markers3.3. Buffer solutionBuffer solution4.4. AgaroseAgarose5.5. Ethidium bromideEthidium bromide6.6. Nitrile rubber glovesNitrile rubber gloves7.7. A color marker dye ( bromophenol blue ) and A color marker dye ( bromophenol blue ) and

glycerolglycerol8.8. A gel rackA gel rack9.9. A combA comb10.10. Power supplyPower supply11.11. UV lamp or UV light box UV lamp or UV light box

Preparation Preparation

Make a 1% agarose solution in Make a 1% agarose solution in 0.5xTBE.0.5xTBE.

Bring the solution to boil to Bring the solution to boil to dissolve the agarose in a dissolve the agarose in a microwave.microwave.

Cool the solution to about 60Cool the solution to about 600 0 c at c at room temperature. Stir the room temperature. Stir the solution while cooling.solution while cooling.

Add 1ul ethidium bromide stock per 10 ml Add 1ul ethidium bromide stock per 10 ml gel solution.gel solution.

Stir the solution to disperse the ethidium Stir the solution to disperse the ethidium bromide, then pour it into the gel rack.bromide, then pour it into the gel rack.

Insert the comb at one side of the gel about Insert the comb at one side of the gel about 5-10mm from end of the gel.5-10mm from end of the gel.

When the gel has cooled down and become When the gel has cooled down and become solid remove the comb. The holes that solid remove the comb. The holes that remain in the gel are the wells or slots.remain in the gel are the wells or slots.

Put the gel, together with the rack, into a Put the gel, together with the rack, into a tank with 0.5xTBE. Ethidium bromide of the tank with 0.5xTBE. Ethidium bromide of the same conc can be added to be buffer.same conc can be added to be buffer.

Make sure the gel is completely covered with Make sure the gel is completely covered with TBE, and that the slots are at the end TBE, and that the slots are at the end electrode that will have the negative current.electrode that will have the negative current.

ProcedureProcedure

1.1. The agarose gel with three slots The agarose gel with three slots 2.2. Injection of DNA ladder into first slotInjection of DNA ladder into first slot3.3. DNA ladder injected. Injection samples into DNA ladder injected. Injection samples into

second and third slot.second and third slot.4.4. A current is applied. The DNA moves towards A current is applied. The DNA moves towards

the positive anode due to the negative the positive anode due to the negative charges on its phosphate back bone.charges on its phosphate back bone.

5.5. Small DNA strands move fast, large DNA Small DNA strands move fast, large DNA strands move slowly through gel. The DNA is strands move slowly through gel. The DNA is not normally visible during this process, so not normally visible during this process, so the marker dye is added to the DNA to avoid the marker dye is added to the DNA to avoid the DNA being run entirely off the gel. The the DNA being run entirely off the gel. The marker dye has a low molecular wt and marker dye has a low molecular wt and migrates faster than the DNA, so as long as migrates faster than the DNA, so as long as the marker has not run past the end of the the marker has not run past the end of the gel, the DNA will still be in the gel.gel, the DNA will still be in the gel.

6.6. Add the color marker dye to the DNA ladder.Add the color marker dye to the DNA ladder.

11 22 33

44 55 66

__

++

__

++ ++

DNA bands under UV DNA bands under UV lightlight

Factors Affecting Factors Affecting MigrationMigration The most impt factor is the length of the The most impt factor is the length of the

DNA molecule, smaller molecules travel DNA molecule, smaller molecules travel further. further.

Increase the agarose conc of a gel Increase the agarose conc of a gel reduces the migration speed and reduces the migration speed and enables separation of smaller DNA enables separation of smaller DNA molecules.molecules.

The higher voltage, the faster the DNA The higher voltage, the faster the DNA migrates. But voltage is limited by the migrates. But voltage is limited by the fact that it heats and ultimately causes fact that it heats and ultimately causes the gel to melt. High voltages also the gel to melt. High voltages also decrease the resolution . decrease the resolution .

Visualisation : EtBr Visualisation : EtBr and Dyesand Dyes The most common dye used for AGE is The most common dye used for AGE is

ethidium bromide. ethidium bromide. It fluoresces under uv light when It fluoresces under uv light when

intercalated into DNA. By running DNA intercalated into DNA. By running DNA through EtBr-treated gel and through EtBr-treated gel and visualizing it with UV light , distant visualizing it with UV light , distant bands of DNA become visible .bands of DNA become visible .

Alternative dye such as SYBR Green Alternative dye such as SYBR Green may be used.may be used.

Loading buffers area added with Loading buffers area added with DNA in order to visualize it and DNA in order to visualize it and sediment it in the gel.sediment it in the gel.

Xylene cynaol and Bromophenol Xylene cynaol and Bromophenol blue are used.blue are used.

Other less frequently used Other less frequently used markers are Cresol red and markers are Cresol red and Orange G. Orange G.

UsesUses

In restriction mapping of cloned In restriction mapping of cloned DNADNA

Analysis of PCR products ,eg. In Analysis of PCR products ,eg. In molecular genetic diagnosis or molecular genetic diagnosis or genetic fingerprintinggenetic fingerprinting

Separation of restricted genomic Separation of restricted genomic DNA prior to southern transfer, or DNA prior to southern transfer, or RNA prior to northern transfer.RNA prior to northern transfer.

The advantages are that the gel is easily The advantages are that the gel is easily poured, does not denature the samples, poured, does not denature the samples, and is physically firmer than and is physically firmer than polyacrylamide. The samples can also polyacrylamide. The samples can also be recovered.be recovered.

The disadvantages are the gel can melt The disadvantages are the gel can melt during electrophoresis, the buffer can during electrophoresis, the buffer can become exhausted and different forms become exhausted and different forms of genetic material may run in of genetic material may run in unpredictable forms.unpredictable forms.

Chromatography Chromatography

It was the Russian botanist It was the Russian botanist Mikhail Semyonovich Tscet who Mikhail Semyonovich Tscet who invented the first invented the first chromatography technique in chromatography technique in 1900 during research on 1900 during research on chlorophyll.chlorophyll.

Column chromatograhy is one of Column chromatograhy is one of the most common methods of the most common methods of protein purification. protein purification.

In this method a protein is In this method a protein is passed through a column that is passed through a column that is designed to trap or slow up the designed to trap or slow up the passing of proteins based on a passing of proteins based on a particular property such as size, particular property such as size, charge or composition. charge or composition.

Some of the more common Some of the more common column arecolumn are

1.1. Ion exchange chromatographyIon exchange chromatography

2.2. Hydrophobic interaction columnHydrophobic interaction column

3.3. Affinity chromatography.Affinity chromatography.

4.4. Gel filtration ( size exclusion ) Gel filtration ( size exclusion ) chromatography. chromatography.

Ion Exchange Ion Exchange ChromatographyChromatography This method is based on the charge of the This method is based on the charge of the

protein. If the protein to be studied has a protein. If the protein to be studied has a positive charge, then it has to pass positive charge, then it has to pass through a column of negative charge.through a column of negative charge.

The negative charge on the column will The negative charge on the column will bind the positively charged protein, and bind the positively charged protein, and other protein will pass through the other protein will pass through the column.column.

Then salting out is done to release the Then salting out is done to release the positively charged protein from the positively charged protein from the negatively charged column. negatively charged column.

The column that does this is The column that does this is called cation exchange column called cation exchange column and often uses sulfonated and often uses sulfonated residues.residues.

Likewise negatively charged Likewise negatively charged protein can bind to a positively protein can bind to a positively charge column. The column that charge column. The column that does this is called an anion does this is called an anion exchange column and often uses exchange column and often uses quaternary ammonium residues.quaternary ammonium residues.

Salting Out Salting Out

This is a procedure which will release the This is a procedure which will release the protein from the column. This technique protein from the column. This technique uses a high salt concentration solution.uses a high salt concentration solution.

The column has a higher attraction for The column has a higher attraction for the charge of salts than for the charged the charge of salts than for the charged protein, and it will release the protein in protein, and it will release the protein in favor of binding the salts instead.favor of binding the salts instead.

Proteins with weaker ionic interactions Proteins with weaker ionic interactions will elute at a lower salt. Different will elute at a lower salt. Different proteins elute at different salt conc. proteins elute at different salt conc.

Basic steps in ionic Basic steps in ionic ExchangeExchange Prep the Column. Pour the buffer over Prep the Column. Pour the buffer over

the column to make sure is has the column to make sure is has equilibrated to the required pH.equilibrated to the required pH.

Load protein solution. Load protein solution. Salt out. Increase the salt conc to elute Salt out. Increase the salt conc to elute

the bound proteins. It is best to use a the bound proteins. It is best to use a salt gradient to gradually elute salt gradient to gradually elute proteins with different ionic strengths.proteins with different ionic strengths.

Remove salts. Use dialysis to remove Remove salts. Use dialysis to remove the salts from the protein solution. the salts from the protein solution.

Hydrophobic Hydrophobic interaction interaction chromatographychromatography HIC uses the hydrophobic HIC uses the hydrophobic

properties of some proteins. properties of some proteins. Hydrophobic groups on the Hydrophobic groups on the protein bind to hydrophilic groups protein bind to hydrophilic groups on the column. on the column.

The more hydrophobic a protein The more hydrophobic a protein is, the stronger it will bind to the is, the stronger it will bind to the column.column.

Load the proteins in the presence of a Load the proteins in the presence of a high conc of ammonium sulfate. high conc of ammonium sulfate. Ammonium sulfate is a chaotrophic Ammonium sulfate is a chaotrophic agent. It increases the chaos in water, agent. It increases the chaos in water, and thereby increases hydrophobic and thereby increases hydrophobic interactions.interactions.

Ammonium sulfate also stabilizes Ammonium sulfate also stabilizes proteins. So the result of using HIC proteins. So the result of using HIC column the protein is in its stable form. column the protein is in its stable form.

The hydrophobic column is The hydrophobic column is packed with a phenyl agarose packed with a phenyl agarose matrix. In the presence of high matrix. In the presence of high salt conc the phenyl groups on salt conc the phenyl groups on this matrix binds hydrophobic this matrix binds hydrophobic portions of proteins. portions of proteins.

Affinity Affinity ChromatographyChromatography This relies in the biological functions of This relies in the biological functions of

a protein to bind it to a column. The a protein to bind it to a column. The most common type involves a ligand , most common type involves a ligand , a specific small biomolecule.a specific small biomolecule.

This small molecule is immobilized and This small molecule is immobilized and attached to a column matrix, such as attached to a column matrix, such as cellulose or polyacrylamide.cellulose or polyacrylamide.

The target protein is then passed The target protein is then passed through the column and bound to by its through the column and bound to by its ligand, while other proteins elute out.ligand, while other proteins elute out.

Elution of the target protein is usually Elution of the target protein is usually done by passing through the column a done by passing through the column a solution that has in it a high conc of solution that has in it a high conc of free ligand.free ligand.

This is a very efficient purification This is a very efficient purification method since it relies on the biological method since it relies on the biological specificity of the target protein , such specificity of the target protein , such as the affinity of an enzyme for a as the affinity of an enzyme for a substrate. substrate.

Gel Filtration Gel Filtration ChromatographyChromatography Gel filtration, or size exclusion, Gel filtration, or size exclusion,

chromatography separates chromatography separates proteins on the basis of their size. proteins on the basis of their size. The column packed with a matrix The column packed with a matrix of fine porous beads.of fine porous beads.

It works somewhat like a sieve, but in It works somewhat like a sieve, but in reverse. The beads have in them very reverse. The beads have in them very small holes. small holes.

As the protein solution is poured on As the protein solution is poured on the column, small molecules enter the the column, small molecules enter the pores in the beads. pores in the beads.

Larger molecules are excluded from Larger molecules are excluded from the holes, and pass quickly between the holes, and pass quickly between the beads. the beads.

The larger molecules are eluted first. The larger molecules are eluted first. The smaller molecules have a longer The smaller molecules have a longer path to travel, as they get stuck over path to travel, as they get stuck over and over again in the maze of pores and over again in the maze of pores running from bead to bead.running from bead to bead.

These smaller molecules, therefore, These smaller molecules, therefore, take longer to make their way take longer to make their way through the column and eluted last through the column and eluted last

Load proteins Load proteins into columninto column

Smaller Smaller molecules molecules enter the enter the channels channels in the in the beads and beads and have to have to travel travel fartherfarther

Larger Larger molecules molecules travel travel between between beads and beads and elute firstelute first

Probes Probes

Probes are complimentary Probes are complimentary sequences of nucleotide bases to sequences of nucleotide bases to the specific mRNA sequence of the specific mRNA sequence of interest.interest.

These probes can be as small as These probes can be as small as 20 -40 base pairs or be up to 20 -40 base pairs or be up to 1000bp. 1000bp.

Types of ProbesTypes of Probes

There are essentially four types There are essentially four types of probes used.of probes used.

1.1. Oligonucleotide probeOligonucleotide probe

2.2. Single stranded DNA probeSingle stranded DNA probe

3.3. Double stranded DNA probeDouble stranded DNA probe

4.4. RNA probeRNA probe

1.1. Oligonucleotide probes. : these Oligonucleotide probes. : these are produced synthetically by a are produced synthetically by a automated chemical synthesis. automated chemical synthesis.

This method utilizes This method utilizes deoxynucleotides, which requires deoxynucleotides, which requires designing the sequence of the designing the sequence of the probe when using oligonucleotide probe when using oligonucleotide probes.probes.

These probes have the These probes have the advantage of being resistant to advantage of being resistant to RNases and are small, generally RNases and are small, generally around 40 – 50 base pairs. around 40 – 50 base pairs.

This is ideal for in situ hybridization This is ideal for in situ hybridization because their small size allows for because their small size allows for easy penetration into the cells or easy penetration into the cells or tissue of interest.tissue of interest.

In addition, because they are In addition, because they are synthetically designed, it is synthetically designed, it is possible to make a series of probes possible to make a series of probes that have the same GC content. that have the same GC content.

Single Stranded DNA Single Stranded DNA ProbesProbes These are much larger 200 -500 These are much larger 200 -500

bp size range. They can be bp size range. They can be produced by reverse transcription produced by reverse transcription of RNA or by amplified primer of RNA or by amplified primer extension of a PCR- generated extension of a PCR- generated fragment in the presence of a fragment in the presence of a single antisense primer.single antisense primer.

That is once amplified sequence of That is once amplified sequence of interest is identified a subsequent round interest is identified a subsequent round of PCR is carried out using the first PCR of PCR is carried out using the first PCR product template, but only using anti-product template, but only using anti-sense primers, thus producing single sense primers, thus producing single stranded DNA.stranded DNA.

They require time to prepare, expensive They require time to prepare, expensive reagents are used, and a good reagents are used, and a good repertoire of molecular skills are repertoire of molecular skills are required.required.

Double Stranded DNA Double Stranded DNA ProbeProbe These can be produced by the These can be produced by the

inclusion of the sequence of inclusion of the sequence of interest, which is replicated, interest, which is replicated, lysed. lysed.

And the DNA extracted, purified And the DNA extracted, purified and the sequence of interest is and the sequence of interest is excised with restriction enzymes.excised with restriction enzymes.

The advantage is that it is The advantage is that it is possible to obtain large quantities possible to obtain large quantities of the probe sequence.of the probe sequence.

These probes are generally less These probes are generally less sensitive because of the DNA sensitive because of the DNA strands to rehybridize to each strands to rehybridize to each other are not widely used.other are not widely used.

RNA ProbesRNA Probes

They have an advantage that They have an advantage that RNA-RNA hybrides are very RNA-RNA hybrides are very thermostable and are resistant to thermostable and are resistant to digestion by RNases. digestion by RNases.

There are 2 methods of preparing There are 2 methods of preparing RNA probes RNA probes

1.1. Complimentary RNA’s are prepared by Complimentary RNA’s are prepared by an RNA polymerase-catalysed an RNA polymerase-catalysed transcription of mRNA.transcription of mRNA.

2.2. Alternatively, in vitro transcription of Alternatively, in vitro transcription of linearized plasmid DNA with linearized plasmid DNA with polymerase can be used to produce polymerase can be used to produce the RNA probes. Here plasmid vectors the RNA probes. Here plasmid vectors containing polymerase from containing polymerase from bacteriophages T3, T7 or SP6 are used. bacteriophages T3, T7 or SP6 are used.

These probes are very sensitive These probes are very sensitive to RNases and so scrupulous to RNases and so scrupulous sterile technique is observed, or sterile technique is observed, or these probes can be destroyed these probes can be destroyed easily.easily.

They still widely used with in situ They still widely used with in situ hybridization.hybridization.