[CANCER RESEARCH 56. 2171-2177. May I. 19%]

A Specific Deletion in the Breakpoint Cluster Region of the ALL-1 Gene IsAssociated with Acute Lymphoblastic T-Cell Leukemias1

Klaus Löchner,Gabi Siegler, Monika Führer,Johann Greil, JörnD. Beck, George H. Fey, and Rolf Marschalek2

Depurimeli! i>f Genetics. University- of Erlangen-Niirnherg. Staudtslr. 5, 91058 Erlangen /K. L. G. S., G. H. F., R. M.j; Department of Pediatrics, University of Erlangen-Nürnberg.Ltischge.ftr. 15, 91054 Erlangen ¡J.G., J. D. B.j; anil Department of Pediatrics, Universìi\of München,Pelíenkoferslr. Ha, 80336 MünchenIM. F.], Germans'

ABSTRACT

A variety of chromosomal translocations to the ALL-I gene are regu

larly observed in acute leukemias and are thought to play a key role in theleukemogenic process. Chimeric proteins encoded by the breakpoint regions of the derivative chromosomes have been proposed to be the relevant oncogenic agents. In addition, internal duplications of the ALL-] gene

have been observed in patients with specific acute myeloid leukemias.Thus, it has been hypothesized that oncogenic variants of the ALL-1protein may be generated by both chimerization and self-fusion, but the

critical structural features endowing the altered proteins with their oncogenic potential are still unknown. Here a novel structural alteration of theALL-1 gene was observed in three patients presenting with acute T-cellleukemia (ALL) without chromosomal translocations or self-fusions of theALL-1 gene. These unrelated patients carried an internal deletion in oneof the two alíelesof the ALL-I gene that eliminated parts of introns 7 and

8, together with exon 8. The deletion was found in 3 of 74 ALL patients,but not in acute myeloid leukemias, follicular lymphomas, or peripheralblood leukocytes from healthy donors. One ALL patient showed thedeletion at diagnosis but no longer at remission or at 9 months afterremission. These findings support the hypothesis that the ALL-1 protein

may be converted to an oncogenic variant, not only by chimerization orself-fusion, but also by deletion of sequences coded by exon 8. They further

suggest that these three different types of structural alterations of theALL-1 protein may each cause a distinct disease phenotype. Alternatively

spliced mRNA species omitting exon 8 were observed in 14 of 24 ALLpatients without detectable macroscopic alterations of the ALL-I gene and

also in peripheral blood leukocytes from healthy donors.

INTRODUCTION

The ALL3 gene 1 (ALL-1), also called the MLL (mixed lineage

leukemia) or human trithorax (Htrxl or HRX) gene, participates in abroad array of chromosomal translocations associated with ALLs andAMLs (1-5). A subset of these leukemias. the high-risk infant leuke

mias, are characterized by their occurrence in very early childhoodand a very poor prognosis. The majority of these cases show either thet(4;l 1) or the t(l 1;19) translocation to the ALL-1 gene and a disease

phenotype characterized by mixed lineage properties of the leukemicblasts displaying both pro-B lymphoid and myeloid markers, very

high WBC counts, responsiveness to chemotherapy at diagnosis, andresistance after first relapse (6-14, 16-20). The t(9;l 1) translocationto the ALL-I locus has been regularly found in childhood AML (21),and other translocations to the ALL-I gene have been observed in

AML patients (reviewed in Ref. 22), particularly in adults with

Received 12/4/95; accepted 3/4/96.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1This study was supported by Research Grant DFG (Fl 91/10-4, TP 5) from the

Deutsche Forschungsgemeinschaft (DFG; to R. M. and G. H. F.I and Grant Mar/93 fromthe Johannes and Frieda Marohn Stiftung (to R. M. and J. G.). R. M. is supported by aCareer Development Award from the Ria Freifrau von Fritsch Stiftung.

2 To whom requests for reprints should be addressed, at Department of Genetics.

University of Erlangen-Nürnberg. Staudtstr. 5. D 91058 Erlangen, Germany. Phone:49-9131-858530; Fax: 49-9131-858526; E-mail: rmarschao'biologie.unierlangen.de.

1The abbreviations used are: ALL. acule lymphoblastic leukemia: AML. acute mye

loid leukemia: FL. follicular lymphoma: MNC, mononuclear cells: PBL. peripheral bloodleukocyte; RT-PCR. reverse transcription-PCR.

secondary AML occurring after chemotherapy of primary tumors withtopoisomerase inhibitors (23-26).

Cytogenetic studies thus far revealed 29 different chromosomaltranslocations to the q23 region of human chromosome 11, and afraction of these have been identified as translocations to the ALL-1gene (22). The ALL-I cDNA (3, 4) and cDNAs for a number of

translocation partner genes from different chromosomes have beencloned and characterized, including the genes AF-lp (27), AF-lq (28),AF-4 (3), AF-6 (29), AF-9 (17), AF-10 (30), AF-17 (31), ELL (32),

ENL (4,) and the AFX1 gene located on the X chromosome (33, 34).Due to this unusually broad range of translocation partners and thegeneration of chimeric breakpoint proteins in the majority of cases,the hypothesis was proposed that chimeric breakpoint proteins are theoncogenic agents responsible for the malignant transformation. Thehypothesis further specified that the NH,-terminal portion of theALL-1 protein, contained as the smallest common denominator in all

chimeric proteins encoded by the various derivative 11 (derl 1) chromosomes, was an essential part of the oncogenic principle (35-37). Itwas anticipated that these chimeric proteins may act as dominant-negative inhibitors of the intact ALL-1 protein contributed by the

unaltered chromosome 11, which was consistently expressed in theleukemic blasts, possibly by forming heterodimers interfering with thenormal ALL-I function.4

The wild-type ALL-1 protein sequence deduced from cDNA spec

ifies a polypeptide of close to 4000 amino acids with sequencehomology to the drosophila trithorax protein (drTRX), an importantregulator of early development in Drosophila (38). It contains anAT-hook DNA-binding motif and a potential cysteine-methyltrans-ferase domain in its NH2-terminal portion and a bipartite zinc-fingermotif in its COOH-terminal portion (2-4, 37, 39). The AT-hookDNA-binding motif and the methyltransferase domain are present in

all chimeric breakpoint proteins produced from the der 11 chromosomes of the various translocations. However, it is not obvious howthis part of the protein may generate the oncogenic potential or act asa dominant-negative inhibitor of the wild-type ALL-1 protein. Oneproposed explanation was that the simple separation of the NH2- andCOOH-terminal portions of the ALL-1 protein might suffice to generate the oncogenic function and that the COOH-terminal portions of

the chimeric proteins derived from the various translocation partnergenes may contribute little or nothing to their transforming potential(37).

Recently, internal duplications of exons 2 to 6 or 2 to 8 of the ALL-1

gene have been reported in AML patients with trisomy 11 (40, 41).This observation suggests that oncogenic variants of the ALL-1 protein may also be generated by self-fusions causing duplication of partsof the ALL-1 protein. However, an actual transforming function of theself-fused proteins has not yet been demonstrated directly, and the

portions of the protein generating the oncogenic potential have notbeen defined with precision. Here we describe a third structuralalteration of the ALL-1 protein, a deletion of sequences coded by exon

8, that may generate transforming potential. The omission of theseprotein sequences can be caused either by a genomic deletion encom-

4 C. M. Croce, personal communication.

2171

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIHC DELETION OF ALL-I SEQUENCES IN ALL PATIENTS

passing exon 8 or by unidentified mechanisms leading to the omissionof exon 8 in an alternatively spliced mRNA without a concomitantgenomic deletion. Alternatively spliced breakpoint mRNAs generatedby omission of one or several exons from each translocation partnergene have been reponed previously by other authors for varioustranslocations to the ALL-I gene (3. 4. 6. 17. 35. 39. 42). In addition,

a number of cDNAs corresponding to alternatively spliced variants ofthe intact ALL-I mRNA have been reported (2-4, 43. 44). including

a cDNA lacking the coding sequences for exon 8 (43). However, todate a simple deletion of coding sequences of the ALL-1 protein had

not been proposed as a potential oncogenic mechanism. If confirmed,the present report of a correlation between the occurrence of agenomic deletion of exon 8 and the incidence of T-ALL may help todefine the potentially oncogenic features of variant ALL-1 proteins

with greater precision.

MATERIALS AND METHODS

PCR Primers and Oligonucleotide Probes. Primers 5-3 (5'-CCCAAAACCACTCCTAGTGAG-3'). 7-3 <5'-CAGCAGATGGAGTCCA-CAG-3'), and 10-5 <5'-CAGGGTGATAGCTGTTTCGG-3') bind to exons 5,7, and 10. respectively. Primers 8-51 (5'-GGACTATTAAAAGGCTCACC-3')and 9-54 (5'-ATCTTTAGGACTTCATATTTGCC-3') bind to introns 7 and 8

of the ALL-I gene. Oligonucleotide delta8-3 (.V-GTTCAGTGATCTC-GAGAGGCT-3') contained sequences from both introns 7 and 8 and formed

stable hybrids in Southern blot experiments selectively with amplimers fromthe deletion alíelebut not from the intact alíele.

Patient Materials and Cell Lines. Leukemic cells used in this study werecollected from children and adolescents enrolled in treatment protocols of theGerman BFM study group, which had been approved by institutional reviewboards. All patients and their parents or guardians gave informed consent fortreatment and tor collection of material for biological studies. Our panelcomprised 74 pediatrie patients with variant types of ALL including pro-B-.pre-B-. common, and T-ALL. Material from 50 patients was available as

cryopreserved leukemic bone marrow samples, and leukemic cells from 24patients were isolated freshly from bone marrow biopsies at diagnosis. PatientsAl. A8. and A15 were diagnosed as T-ALL. and relevant patient data are listed

in Table 1. Genomic DNA obtained from fresh bone marrow samples of 10adult AML patients was provided by Drs. M. Gramatzki and G. Eger (MedicalDepartment III. University of Erlangen-NUrnberg). Genomic DNA obtained

from lymph node biopsy material from 10 FLs was kindly donated by Dr. A.Polack (Gesellschaft fürStrahlen- und Uniweitforschung. Munich. Germany).

PBLs were obtained from healthy volunteer donors after informed consentaccording io approved standard protocols for vena puncture. The Namalwa cellline, a well described B-lymphoblastoid cell line, was obtained from the

American Type Culture Collection (Rockville. MD).Isolation of Genomic DNA and Southern Blot Hybridizations. MNCs

(5 X IO7) from peripheral blood or bone marrow aspirates from ALL patients

were collected by Ficoll gradient centrifugation and resuspended in ice-cold

PBS. The cells were lysed. and genomic DNA was isolated as described (15).The genomic DNA was either digesled with restriction enzymes or used

directly for PCRs. Southern blot hybridizations were performed using standardprocedures (45).

PCR Assays with Genomic DNA. Genomic DNA (50 to 100 ng) fromPBLs of healthy donors or biopsy samples from ALL. AML. and FL patientswas amplified for 35 cycles in a PCR reaction with denaturation for 30 s at94°C,annealing for 30 s at 58°C.and extension for 90 s at 72°Cin each cycle.

PCR products were electrophoresed in a 1.3% Seakem agarose gel next to aDNA size marker (pBR322 x Hinil). Amplified DNA fragments were isolatedfrom the gel and cloned into pBluescript plasmids (Stratagene) for furtheranalysis. Comparison of several independently generated cDNA sequencesfrom the same region indicated that the error rate in our experiments wassmaller than 1:1()4 nucleotides. Rearrangements of the ALL-I gene in genomic

DNA from leukemic cells were studied in a PCR assay using the primers 7-3.

8-51. and 9-54. This assay allowed the simultaneous detection of intact ALL-1

alíelesand alíelescarrying a deletion of exon 8 in one reaction tube. Fragmentslonger than 1000 bp were amplified poorly in this PCR assay. Human placentaDNA was used as a negative control.

Assessment of the Sensitivity of the Deletion-specific PCR Assay. Toevaluate the sensitivity of the deletion-specific PCR assay. 500 ng of placenta

DNA were mixed with genomic DNA from patient Al in various dilutions(500 ng to 0.5 pg. with 5 pg taken as the DNA content of a single cell). Thedeletion-specific PCR assay with primers 7-3. 8-51. and 9-54 was performed,

and resulting amplimers were separated by gel electrophoresis and blotted to anylon membrane. After transfer, nucleic acids were immobilized by UVcross-linking and hybridized with the radiolabeled Oligonucleotide delta8-3,

which recognized exclusively the amplimers from (he deleted alíele.RT-PCR Reactions with mRNA from Biopsy Material. MNCs (2 X IO7)

from ALL patients and PBL from healthy donors were collected, and mRNAwas isolated using the QuickPrep Micro mRNA purification kit (Pharmacia).Hexamer-primed cDNA was synthesized in 20-/nl reactions containing 0.1 /ngmRNA. 200 pmol random hexamer primer. 4 ju.1of 5X first-strand synthesis

buffer (Life Technologies. Inc.). 2 /nl of UK) niM DTT. 4 /xl of 2.5 mM stocksolutions of each of the fourdeoxynucleotide triphosphates. 200 units Moloneymurine leukemia virus reverse transcriptase (Life Technologies. Inc.) and 2units of the RNase inhibitor RNasin (Servai. Reactions were incubated for 60min at 42°Cand diluted to 120 fil. Five /il were used as template and wereamplified through 40 cycles using a "touch down" PCR program (initial cycle:

denaturation for 30 s at 94°C,annealing for 30 s at 65°C.and extension for 60s at 72°C:the annealing temperature was then lowered by 0.5°Cin everysubsequent cycle until 54°Cwas reached in cycle 26; the last 14 cycles wereperformed with an annealing temperature of 54°C).PCR products were elec

trophoresed in a 1.3% Seakem agarose gel next to a DNA size marker(pBR322 x Hinf\). Amplified DNA fragments were isolated and cloned intopBluescript plasmids (Stratagene).

RESULTS

Exon 8 of the ALL-1 Gene Is Deleted in Three Independent

ALL Patients. Southern blot experiments with DNA from MNCs ofchildhood ALL patients were performed routinely to search for trans-locations to the ALL-I gene. Patient Al showed an intense 3-kb EcoRlrestriction fragment in addition to the 5.2-, 4.7-, and 4.2-kb fragments

Table 1 Patient ílalii

Age in years. WBC. while blood cell count in number of cells per microliler at diagnosis. Bone marrow cellularity (^ blasts in BM) was determined by microscopic evaluationof marrow smears. Immunophenoiypes were determined by flow cytometry using commercially available antibodies. TCR. status of the T-cell receptor. The status of the gene wasdetermined by Southern blot analysis with DNA from patient Al in the laboratory of Dr. C. R. Banram. using standard procedures. The status of ihe cell-surface protein for patientAS was determined by flow cytometry using commercially available antibodies. ND. not determined. Induction of remission was attempted for all three patients according to protocolI, 1995 version, of the German ALL-BFM study group. Therapy response, response to prednisone.

AgeSexWBC%

blast.s inBMImmunophenotypeTC'R

Therapy responsePatient

Al1

F743.00099CDla*.

CD2*. CDS*.CD7*. HLA-DR~ß

germlinePoorPatient

A81

M386.00090CDla*,

CD2*. CD3*. CDS*.CD7 *, CDS*. HLA-DR~a/ß

proteinPoorPatient

A1513M164.00099CDla*.

CD2*. CD3*. CD4*. CDS*.CD8*.CDIO+,HLA-DR"ND

Good

2172

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIFIC DELETION OF ALL-I SEQUENCES IN ALL PATIENTS

resulting from the intact ALL-l gene (Fig. 1). Further analysis of this

fragment revealed a genomic deletion of 1634 bp eliminating exon 8plus flanking sequences on either side. A specific PCR assay for exon8 was designed (Fig. 14), and DNA was prepared from cryopreservedbiopsy material of 74 ALL, 10 AML, and 10 FL patients and fromMNCs of 20 healthy donors. An indistinguishable deletion was detected in the DNA of ALL patients Al, A8, and A15 (Fig. 2ß),butnone of the AML and FL patients and healthy donors in our panelshowed this deletion. Subsequent review of the case histories showedthat all three patients had presented with T-ALL. Sequence analysis of

the PCR amplimers from patients Al. A8, and A15 showed anidentical deletion in all three of these unrelated patients (Fig. 2A). Inall three cases, the deletion occurred in only one of the two alíelesatpalindromic sequences located in introns 7 (5'-TGATCA-3') and 8(S'-CTCGAG-.V). respectively (Fig. 1C}. As a result ofthe deletion,sequences from introns 7 and 8 were fused (5'-TGATCTCGAG-3').

and large parts of introns 7 and 8 were deleted together with exon 8.An Xho\ restriction site (5'-CTCGAG-3') located adjacent to the point

of fusion in intron 8 remained intact and was used for diagnosticpurposes. The regions from introns 7 and 8 engaged in the recombination showed no extensive sequence similarities, suggesting that thedeletion was generated by illegitimate recombination through anunknown mechanism.

The Deletion Is Associated with the Leukemic Blasts. Biopsymaterial from patient A1, taken both at diagnosis and during therapy,was available. After 33 days of induction therapy, the patient achieveda first remission, and the deleted alíelewas no longer detectable in thePCR assay (Fig. 3A). To evaluate the sensitivity of the assay, serial10-fold dilutions of genomic DNA from patient Al were mixed with

EcoR1

6.5 —¿�

4.2—

3.2 —¿�

2.5 —¿�

5.24.74.2

<3.0

patient A1Fig. I. A genomic deletion in Ihe breakpoint cluster region of the ALL-l gene. Southern

blot analysis of genomic DNA from patient Al. Open arrowheads. Ec«R\fragments (5.2.4.7. and 4.2 kb) from the intact ALL-l alíelethat contain the breakpoint cluster. Therearranged 3.0-kb fragment (dosed arrnwlu'tid*} results from the 4.7-kb EcoR] fragmentby an internal deletion of —¿�1.7kb encompassing exon 8 and flanking intron sequenceson

either side. The blot was hybridi/ed with a cDNA probe spanning the breakpoint clusterregion (exons 4 to 13) of the ALL-l gene.

constant amounts of placenta DNA and analyzed (Fig. 3ß).Althoughthe PCR reactions were performed under semicompetitive conditions,the deleted alíelewas still detectable after a 10,000-fold dilution of the

patient DNA (Fig. 3ß).Thus, the deleted alíeledisappeared for patientAl together with the leukemic blasts at remission. Patient AI was stillin remission after 9 months of initial therapy, and another biopsysample was obtained at this time. The deletion-specific PCR product

was not detected, whereas the product from the intact alíelewasobtained as an internal positive control (Fig. 3/4). The hematopoieticsystem of the patient had largely recovered at this time: therefore, itis considered unlikely that the concordant disappearance of the leukemic blasts and the deletion-specific PCR product was a simple

coincidence and was due to the simultaneous disappearance of apopulation of cells different from the leukemic blasts that carried thedeletion. Such a population should have recovered from therapytogether with the majority of hematopoietic cells, and the deletion-

specific PCR product should have reappeared.An Alternative RNA Species Lacking Exon 8 Sequences Is

Present in Healthy Donors and ALL Patients in the Absence ofDetectable Genomic Alterations. mRNA was isolated from MNCsof 24 ALL patients lacking alterations of the ALL-l locus and from 20

healthy donors. cDNA was synthesized from each mRNA sample andused in RT-PCR experiments with a pair of primers complementary toexon sequences flanking the breakpoint cluster region of the ALL-Ì

gene (Fig. 4C). A PCR product corresponding to a variant, shortermRNA species was observed in 14 of 24 ALL samples. This productrepresented a variant mRNA species lacking exon 8 (A8: Fig. 4,4). asshown by cloning and sequence analysis. All other bands differingfrom the mobility of the germline and A8 bands were not related insequence to the ALL-l-derived mRNAs as shown by Southern blot

hybridization (data not shown). None ofthe patients analyzed in Fig.4A carried a translocation to the ALL-l gene or a macroscopic alteration of the ALL-l gene, as far as being detectable by Southern blotexperiments (data not shown). Similar RT-PCR assays were also

performed with mRNA from MNCs of healthy donors, and variantPCR products identical in size with the A8 product from ALL patientswere obtained in all cases (Fig. 4B).

DISCUSSION

A Novel Type of Structural Alteration of the ALL-l GeneAssociated with T-ALL. A specific deletion in the breakpoint clusterregion of the ALL-l gene is reported here that represents a third type

of genomic alteration associated with hematological neoplasias apartfrom the extensively described chromosomal translocations (reviewedin Ref. 22) and internal duplications of the ALL-l gene (40, 41).Interestingly, different structural alterations of the ALL-l gene and

protein appear to be associated with different disease phenotypes. Thecharacteristic high-risk infant. pro-B cell leukemias are predominantly

associated with translocations t(4;ll) and t( 11:19). whereas translocation t(9;ll) is associated mainly with childhood AML and theinternal duplications of the ALL-l gene without translocations are

associated with adult AML (40. 41 ). Thus, a correspondence betweenthe disease phenotype and the type of structural alteration of theALL-l protein is likely to exist but has not yet been proven. Atpresent, it is still a conjecture that the altered ALL-I proteins are the

responsible etiological agents for these leukemias. One possibility isthat simple genomic deletions of exon 8 as described here may beassociated with various ALLs but not necessarily with the characteristic high-risk pro-B ALLs. Patients Al, A8, and A15 support this

argument. They are the only patients in our panel showing thisdeletion, and all three presented with T-ALL but not with pro-B ALLor AML. The self-fused ALL-1 protein variants may then preferably

2173

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIFIC DELETION OF ALL-I SEQUENCES IN ALL PATIENTS

Fig. 2. Exon 8 is lost on one alíeleonly, and the loss isassociated with ALL. A. schematic illustration of the deletion-

specific PCR assay. The numbering of the exons was according to Gu et al. (3). Primer 8'51 binds only to the intact(germline) alíeleof the ALL-I gene. Primers 7-3 X 9-54produce a short 221-bp amplimer from alíelescarrying thedeletion (A8), whereas primers 7-3 x 8'51 produce a long421 -bp amplimer only from intact (germline) alíeles.The long1855-bp amplimer produced by primer combination7-3 X 9-54 from intact alíeleswas not detected under our PCR

conditions. B, a representative subset of the analyses performed with biopsy material from ALL, AML, and FL patients and PBLs from healthy donors. Open arrowhead, thespecific 221-bp amplimer from the alíelecarrying the deletion; closed arrowhead, the germline alíele.The negativecontrol (neg.}, containing all ingredients of the assay exceptgenomic DNA, demonstrates that the amplimers were specifically produced from added human template DNA. Agarosegel was stained with ethidium bromide. C. sequences of theregions from introns 7 (upper) and 8 (lower) participating inthe deletion. The cross-over site is underlined. Palindromicsequences <5'TGATCA-3' and 5'-CTCGAG-3:) are shaded in

gray. The fusion point of introns 7 and 8 was identical in allthree patients (Al. A8, and A15), as verified by sequenceanalysis. The degree of overall sequence identity (11 of 47nucleotides, 23% identity) of both regions is too low for ahomologous recombination event explained by the propertiesof known recombinases and recombination mechanisms.

9«54

5 67;..•••'deleted alíele a

B

19*54

•¿�S CM in oo d) -HT3uji-cot<or«-coi-T-T- «2«(/)<<<<<<<<< c to

ALL

TTAAGGTAAAGGTGTTCAGTGAT£ATAAAGTATATTGAGTGTCAAAG

GCGGGCGCCTGTAGTCCCAGCTA£TCGAGAGGCTGAGGCAGGAGAAC

generate AML, and to produce a high-risk pro-B-ALL with the

characteristic phenotype outlined above, the additional chimeric proteins generated from the breakpoint regions of the reciprocal derivative chromosomes (der4 and der 19), which are always present in theleukemic blasts, may be required. The panel of patients analyzed hereis still too small to produce a definitive statistical correlation, and itcontained patients with other subtypes of T-ALL that did not show

this deletion, but the absence of the deletion in AML and FL samplesis conspicuous. A larger number of cases need to be investigated fora critical test of the hypothesis that the deletion of exon 8 defines anew disease entity, i.e., a new subtype of T-ALLs different from thecharacteristic high-risk, infant pro-B ALLs.

Rare cases of childhood T-ALL associated with t(ll;19) transloca

tions have been reported (14, 46). However, in these cases, thetranslocation was only mapped at a cytogenetic level, and no directevidence for a structural alteration of the ALL-1 gene was provided. Inone additional case of childhood T-ALL, a complex rearrangementbetween the ALL-l and ENL genes was reported (47). An ALL-l/ENL

fusion mRNA species was expressed in these cells. This interestingobservation suggests a possible extension of our hypothesis; apartfrom the exon 8 deletion, other structural alterations of the ALL-I genemay also generate novel T-cell oncogenes.

Mechanism of Deletion of Exon 8. The area around exon 7 isone of the most frequently used sites for de novo translocations tothe ALL-I gene (39, 48), apart from the triple Alu element in intron

6, where about 40% of all reciprocal translocations have beenmapped (40, 41, 48). The specific genomic deletion of exon 8reported here occurred between a palindromic sequence 19 bp

downstream of exon 7 (TGATCA, a Bell restriction site) andanother palindrome located in the first Alu element of intron 8(CTCGAG, an Xhol restriction site). The palindromic CTCGAGsequence was not found in the seven other Alu repeats contained inthe breakpoint cluster region (39, 48). Illegitimate recombinationbetween both palindromic sequences probably occurred at a C-

nucleotide by a yet unknown mechanism, resulting in the specificdeletion of a 1634-bp DNA fragment, including exon 8 and sur

rounding intron sequences on either side. Interestingly, the deletioneliminated precisely the same sequence in all three unrelatedpatients. It occurred in the narrow break-point cluster region of theALL-I gene (10, 49) and, therefore, may have been produced by a

mechanism similar or identical to that generating the characteristictranslocations. By contrast, the self-fusions of the ALL-I gene in

AML patients have been proposed to be generated by homologousAlu-Alu recombination (40, 41), which if confirmed would be a

mechanism different from the one causing the genomic deletions ofexon 8.

A Potential Role for Exon 8-derived Amino Acid Sequences inthe ALL-l Protein and Possible Oncogenic Functions of ALL-l

Variant Proteins. Exon 8 specifies part of a predicted zinc fingerdomain of the ALL-l protein (3, 4, 39) encoded by exons 8 to 13. The

amino acid sequence allows the formation of seven zinc fingers, andDNA binding activity has been anticipated for this domain (3, 39).However, the amino acid sequence of this region may also be foldedalternatively to form a set of so-called "PHD-fingers" (50). Six of the

seven zinc fingers can be folded into three PHD-fingers, which wouldconfer a potential for protein-protein interactions to this domain.

2174

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIFIC DELETION OF ALL-1 SEQUENCES IN ALL PATIENTS

B

*I.2 oc §•¿�oo g

1— ^ 1— O)

< < < C

i0)o

1630 —¿�

520 —¿�396 —¿�

220 —¿�

520 —¿�396 —¿�

220 —¿�

<|germline

^germline

Fig. 3. The genomic deletion of exon 8 is lost in biopsy material from patient Al obtained at remission. A, PCR products from patient Al at diagnosis, during first remission atday 33. and 9 months after induction chemotherapy. Positions of the amplimers characteristic for the intact and deleted alíeles(germline and A8| are marked. Agarose gel was stainedwith ethidium bromide. B, calibration of the sensitivity of the PCR assay. Sid., molecular weight standards; placenta, human placenta DNA; neg.. negative control containing allingredients of the PCR assay except template DNA. Lanes 0-6 contained constant amounts of human DNA (500 ng) consisting of compensating quantities of placenta DNA and serial10-fold dilutions of patient DNA (Lane 0, 500 ng patient DNA; Lane I, 50 ng patient DNA; Lane 2. 5 ng patient DNA; Lane 3. 500 pg patient DNA, etc.). Amplimers were blottedfrom the gel (top panel) to a nylon membrane and hybridized with radiolabeled oligonucleotide delta8-3. The autoradiograph (Fig. 4B. bottom) demonstrates that the assay wassufficiently sensitive to detect the deletion-specific alíele(A8) at a 10,000-fold dilution in placenta DNA.

Consensus PHD-fingers have the amino acid sequence [N'-Cys-(2)- the open reading frame. This variant mRNA was absent in mRNACys-(n)-Cys-(2)-Cys-(4)-His-(2)-Cys-(n)-Cys-(2)-Cys-C'], where the

numbers in parentheses specify the numbers of intervening amino acidresidues and can bind two zinc atoms (50). The first putative zinc- orPHD-finger will be missing in the translation products from mRNAs

lacking exon 8. Conceivably, this alteration might endow the deletionvariant with the ability to bind to the intact ALL-1 protein andinterfere with its function in a dominant-negative fashion. A similar

mechanism may be applicable to the internal duplication variant of theALL-1 protein. To provide direct proof for any hypothesis about thefunctions of wild-type and mutant ALL-1 proteins, it is necessary to

introduce the coding sequences for these proteins with expressionconstructs into hematopoietic progenitor cells and to monitor theeffects in a biological assay system, either a cell culture or a trans-

genie animal system. The reciprocal experiments would also providepartial proof, i.e., elimination of the coding sequences for theseprotein variants from leukemic cells and demonstration of a partial orcomplete reversion to the nontransformed phenotype. Such experiments require the introduction of antisense constructs or targetingconstructs for homologous recombination and the use of cell cultureand animal models. They are technically demanding, and to ourknowledge, no experimental results providing direct proof for thefunctions of ALL-1 proteins and their oncogenic variants have been

published to date.ALL-1 mRNA Variants Lacking Exon 8 Are Present in PBL

from Healthy Donors and Biopsy Material from ALL Patients.An alternative ALL-1 mRNA species lacking exon 8 was observed in

biopsy material from 14 of 24 ALL patients without any alterations inthe ALL-1 breakpoint cluster region, which were detectable by South

ern blot hybridization, and in PBLs from 20 healthy donors. In thisvariant mRNA, exon 7 was spliced in phase to exon 9, thus preserving

samples from established lymphoblastoid cell lines, such as the Na-malwa line (Fig. 4). Other authors have also detected variant ALL-1

mRNA species lacking exon 8 in U937 cells, but not in a variety ofpre-B or B-cell lines (43). Therefore, we suspect that alternativesplicing of exon 8 is uncommon in the B-cell compartment and that

the omission of exon 8 may be restricted to a different subpopulationof peripheral blood MNCs, probably including myeloid cells and Tcells. This could explain the presence of the variant ALL-1 A8 mRNA

species in healthy donors. Another explanation needs to be considered. The corresponding protein variants lacking exon 8-derived se

quences have not yet been detected and quantitated on the proteinlevel due to the lack of specific reagents. Therefore, the concentrations of the variant mRNA seen in peripheral blood cells may not beproportional to the concentration of the variant protein in progenitorcells. If a critical threshold concentration of this protein were requiredto achieve transformation in progenitor cells, then these concentrations may only be reached in progenitor cells carrying the genomicdeletion, but not in PBLs carrying the alternatively spliced mRNAvariant. The specific genomic deletion identified here in biopsy material of three unrelated T-ALL patients may result in the continuousexpression of the ALL-ÃŒA8 mRNA variant in early progenitor cells,where it is not normally present. Thus, if the corresponding ALL-1

protein variant had a transforming effect specific for early progenitorcells, then the set of data presented here would be free of inconsistencies.

Specific Functions of the Exon 8 Deletion Variant of the ALL-1Protein in T Cells. The observation that chimeric variants of theALL-1 protein correlated with pro-B ALL, self-fused variants withAML, and exon 8 deletion variants with T-ALL makes the conclusionalmost unavoidable, that the variant ALL-1 proteins are the oncogenic

2175

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIFIC DELETION OF ALL-1 SEQUENCES IN ALL PATIENTS

O CO CO CM in

1630-

520-396-220-

-_• = - ---=-*-- intact—¿�A8

B(0

o rag </>CLCLu.a.a.a.a.Q.O-a! cz a.

220

_ intact

been demonstrated thus far: therefore, alternative splicing of exon 8 inthe human ALL-1 inRNA has no direct counterpart in the Drosophilu

trx system.Practical Value. The genomic deletion of exon 8 provides inves

tigators with a useful marker for diagnostic purposes and for monitoring the success of therapy and the progress of minimal residualdisease in ALL patients that carried this deletion.

ACKNOWLEDGMENTS

We thank Ihe following Pediatrie Departments. Hospitals, and their staff (allfrom Germany) tor providing fresh biopsy material: DRK Klinikum. Siegen:Universitätskinderklinik. Ulm: Cnopf sehe Kinderklinik. Nürnberg;Kinderklinik des Reinhard-Nieter Krankenhauses. Wilhelmshaven; Universitätskinderklinik. Wür/burg; Klinikum Chemnit/ GmbH Kinderklinik. Chemnitz: Carl-Thiem Klinikum. Kinderklinik. Coltbus: Stadt. Krankenhaus Dresden-Neustadt. Kinderklinik. Dresden-Neustadt; Klinikum Bayreuth. Kinderklinik.Bayreuth: Kinderklinik. Coburg: Stadt. Krankenhaus. Kinderklinik. München-Schwabing: and Johanniter Klinik. Sankt Augustin. We thank Drs. M. Gra-

mat/.ki. G. Eger. and A. Polack for genomic DNA samples from AML and FLpatients. We also thank Drs. M. Kasbohm and W. Behnisch for providingpatient material and the relevant clinicopathological data from patients AX andA15, Dr. C. R. Bartram for analyzing Ihe T-cell receptor gene rearrangements

in patient Al. and I. Zweckbronner for critical comments on Ihe manuscript.

1011 REFERENCES

1.

Fig. 4. A variant ALL-1 mRNA species lacking exon 8 is presenl in biopsy materialfrom ALL patients and PBI.s from healthy donors. A. RT-PCR products from mRNAprepared from biopsy material of ALL patients. Siti., si/e markers. Left, fragment sizes inbp. Ltinrs 2-/.Õ, amplification products obtained with primer pair 5-3 X 10-5 thatrecogni/cd both the intact and Ihe exon 8-deficient (A8) mRNAs {rifinì.All other bandsdiffering from the mobility of the germline and .18 bands were not related in sequence tothe ALL-/-derived mRNAs as shown by Southern blot hybridization (data not shown).Lanes are marked with identification codes of the ALL patients. Agarose gel was stainedwith ethidium bromide, fl. similar analysis as in A performed with mRNA from PBLs ofhealthy donors, neg.. no mRNA added: pus., cloned cDNA from A8 mRNA variant; NAM.cDNA derived from Namalwa cell mRNA. C schematic structure of the breakpointcluster region. Open boxes, exons; siutttetl hnrs. introns. numbering of exons as in Fig. 2.;zig-zag lines, structures of intact mRNA and A8 splice-variant. Hltu'k symbols witharrows, PCR primers 5-3 and I(K*>.The open reading frame is preserved in the splice

variant, thus generating a translation product shortened by 38 amino acids.

agents causing these diseases. The evidence is still circumstantial andnot direct, hut the degree of confidence that can be placed in thisconclusion has now reached virtual certainty. Direct proof of thishypothesis still requires the gene transfer experiments describedabove. The observations reported here do not address the interestingquestion, how a deletion of exon 8 sequences confers T-lineagespecificity and self-fusion myeloid lineage- and chimerizution B-lineage specificity. Two other cases of T-ALL associated with analteration of the ALL-1 gene have been reported, both translocationst(X;l 1) of the AF-X1 gene to the ALL-1 gene (33. 34). It would be

interesting to determine whether, in these cases, exon 8 sequenceswere also lacking in the chimeric proteins derived from the derl 1chromosomes or whether the T-lineage specificity was due to a

contribution from the chimeric protein derived from the derX chromosomes, or a combination of both.

Drosophila irx mRNA is also alternatively spliced in a cell type-and stage-specific manner during development (51). However, the

alternative splicing pattern documented in this report affects only thefirst four exons of the Drosophila trx gene, for which there is nohighly conserved sequence in the ALL-i mRNA. Alternative splicing

within the trx zinc finger region (amino acids 1269 to 1841) has not

10.

Djabali. M.. Seilen. L.. Parry. P.. Bower. M.. Young. B. D., and Evans. G. A. Atrithorax-like gene is interrupted by chromosome I tq23 translocations in acuteleukaemias. Nat. Genet.. 2: 113-118. 1992.Domer. P. H., Fakharzadeh. S. S.. Chen. C. S.. Jockei. J.. Johansen. L., Silverman.G. A.. Kersey, J. H.. and Korsmeyer. S. J. Acute mixed-lineage leukemia t(4;l 1)(q2l :q23) generates a MLL-AF4 fusion produci. Proc. Nati. Acad. Sci. USA, 90: 7884-

7888. 1993.Ciu. Y.. Nakamura. T.. Alder, H.. Prasad, R.. Canaani. O., Cimino. G.. Croce, C. M.,and Canaani. E. The t(4;l I) chromosome translocation of human acute leukemiasfuses Ihe ALL-1 gene, related to Drosophilu lrithora.\. to the AF-4 gene. Cell, 71:701-708. 1992.Tkachuk. D. C.. Kohler. S., and Cleary. M. L. Involvement of a homolog ofDrosofthilti lritluirn\ by I Iq23 chromosomal translocations in acute leukemias. Cell,71: 691-700. 1992.X.icmin van der Poel. S.. McCabe. N. R.. Gill. H. J.. Espinosa. R.. Ill, Palei. Y..Harden. A.. Rubinelli. P.. Smith. S. D.. I.eBeau. M. M.. Rowley. J. D.. and Diaz.M. (). Identification of a gene. MLL. that spans the breakpoint in I Iq23 translocationsassociated with human leukemias. Proc. Nati. Acad. Sci. USA. 88: 10735-10739.

1991.Chen. C. S., Hilden. J. M.. Presiedi. J.. Domer. P. H.. Moore. R.. Korsmeyer. S. J.. andKersey. J. H. The chromosome-4q2l gene iAF-4/FELìis widely expressed in normaltissues and shows breakpoint diversity in 1(4:11Mq21;q23 ) acule leukemia. Blood. 82:1080-1085. 1993.Cimino. G.. LoCoco. F.. Biondi. A.. Elia. L.. Luciano. A„Croce. C. M.. Masera. G..Mandelli. F.. and Canaani. E. The ALL-1 gene al chromosome I Iq23 is consistentlyaltered in acute leukemia of early infancy. Blood, 82: 544-546, 1993.Cohen. A.. Grunberger, T.. Vanek. W.. Dube, I. D.. Doherty, P. J., Letarte. M..Roifman. C.. and Freedman. M. H. Constitutive expression and role in growthregulation of interleukin- 1 and multiple cytokine receptors in a hiphenolypic leukemiccell line. Blood, 78: 94-102. 1991.

Greil. J.. Gramatzki. M.. Burger. R.. Marschalek. R.. Peltner. M.. Trautmann. U..Hansen-Hagge. T. E.. Banram, C. R.. Fey. G. H.. Stehr. K.. and Beck. J. The acuteIvmphohlaslic leukemia cell line SI-M wilh l(4;ll) chromosomal rearrangemenl isbiphenoiypic and responsive lo inlerleukin-7. Br. J. Haemalol.. 86: 275-283. 1994.

Hunger. S. P.. Tkachuk. D. C.. Amylon. M. D.. Link. M. P.. Carroll. A. J.. Welborn.J. L., Willman. C. L.. and Cleary, M. L. Hrx involvement in tie tun-ti and secondaryleukemias wilh diverse chromosome I Iq23 abnormalities. Blood. 81: 3197-3203.1993.lida. S.. Saito. M.. Okazaki. T., Scio. M., Yamamoto. K.. Akao. Y.. Ogura. M..Suzuki. H.. Ariyoshi, Y., Koike, K.. Nitta. M.. Takahashi. T.. Ueda. R.. and Naka-zawa. S. Phenotypic and genotypic characterization of 14 leukemia and lymphomacell lines with Ilq23 translocations. l.euk Res., 16: 1155-1163. 1992.

Kaneko. Y.. Maseki. N.. Takasaki. N.. Sakurai, M.. Hayashi. Y.. Nakazawa, S.. Mori.T.. Sakurai. M.. Takeda. T.. Shikano. T.. and Hiyoshi. Y. Clinical and hématologiecharacteristics in acute leukemia with I Iq23 translocations. Blood, 67: 484-491.1986.Katz. F.. Malcolm. S.. Gibbons. B.. Tilly. R.. Lam, G.. Robertson. M. E.. Cz-epulkowski. B.. and Chessels. J. Cellular and molecular studies of infant null acutelymphoblastic leukemia. Blood. 71: 1438-1447. 1988.

Knuulila S.. Rajantie. J.. Leskinen. R.. Rapóla,J.. and Chapelle. A. Ill l;I9)(q23;pl I)in a child with acute T-cell leukemia. Cancer Genet. Cytogenet.. IS: 181-186. 1985.

2176

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

SPECIFIC DELETION Or ALL'I SEQUENCES IN ALL PATIENTS

15. Laitinen. J.. Sumurut. J.. and Hölttä.E. A nontoxic and versatile protein salting-outmethod for isolation of DNA. Biotechnique.s, 17: 316-322, 1994.

16. Lange, B., Valtieri, M.. Santoli, D., Caracciolo, D.. Mavilio, F., Gemperlein. !..Griffin. C., Enianuel, B., Finan, J., Nowell. P.. and Rovera, G. Growth factor 34.requirements of childhood acute leukemia: establishment of GM-CSF-dependent celllines. Blood, 70: 192-198, 1987.

17. Nakamura, T., Alder. H., Gu, Y.. Prasad, R., Canaani. O., Kamada. N., Gale. R. P.. 35.Lange. B.. Crist, W. M., Nowell, P. C., Croce, C. M., and Canaani. E. Genes onchromosomes 4, 9. and 19 involved in I Iq23 abnormalities in acute leukemia sharesequence homology and/or common motifs. Proc. Nati. Acad. Sci. USA, 90: 4631-

4635. 1993. 36.18. Pui, C. H., Raimondi, S. C.. Murphy, S. B., Ribeiro, R. C., Kalwinsky, D. K., Dahl,

G. V., Crist. W. M-, and Williams, D. L. An analysis of leukemic cell chromosomalfeatures in infants. Blood. 69: 1289-1293, 1987. 37.

19. Pui. C. H., Crist, W. M.. and Look. A. T. Biology and clinical significance ofcytogenetic abnormalities in childhood acute lymphohlastic leukemia. Blood, 76:1449-1463, 1990.

20. Pui. C. H., Frankel, L. S., Carroll, A. J., Raimondi, S. C., Shuster, J. J.. Head. D. R.. 38.Crist. W. M., Land. V. J., Pullen, D. J.. Steuber, C. P., Behm, F. G.. and Borowitz,M. J. Clinical characteristics and treatment outcome of childhood acute lymphoblasticleukemia with t(4;l I)(q21;q23): a collaborative study of 40 cases. Blood. 77: 440- 39.

447, 1991.21. Sorensen. P. H.. Chen, C. S., Smith, F. O., Arthur, D. C., Domer. P. H.. Bernstein.

I. D., Korsmeyer. S. J., Hammond, G. D., and Kersey. J. H. Molecular rearrangementsof the MLL gene are present in most cases of infant acute myeloid leukemia and are 40.strongly correlated with monocytic or myelomonocytic phenotypes. J. Clin. Invest.,93: 429-37, 1994.

22. Bernard. O. A., and Berger, R. Molecular basis of I Iq23 rearrangements ¡nhema-topoietic malignant proliferations. Genes Chromosomes & Cancer, 13: 75-85, 1995. 41.

23. Felix, C. A.. Winick, N. J., Negrini, M., Bowman, W. P.. Croce. C. M., and Lange.B. J. Common region oíALL-1 gene disrupted in epipodophyllotoxin-related secondary acute myeloid leukemia. Cancer Res.. 53: 2954-2956, 1993. 42.

24. Gill-Super. H. J.. McCabe. N. R., Thirman. M. J., Larson, R. A., LeBeau, M. M..Pedersen-Bjergaard. J.. Philip. P.. Dia/. M. O., and Rowley, J. D. Rearrangements ofthe MLL gene in therapy-related acute myeloid leukemia in patients previously treatedwith agents targeting DNA-topoisomerase II. Blood, 82: 3705-3711, 1993.

25. Pedersen-Bjergaard. J. Acute lymphoid leukemia with t(4;l 1)(q21;q23) following 43.chemotherapy with cytostatic agents targeting at DNA-topoisomerase-II. Leuk. Res..16: 733-735, 1992.

26. Pui, C. H., Ribeiro, R. C.. Hamcock, M. L.. Rivera. G. K.. Evans. W. E.. Raimondi.S. C., Head. D. R.. Brehm. F. G.. Mahmound. M. H.. Sandlund. J. T., and Crist. W. M. 44.Acute myeloid leukemia in children treated with epipodophyllotoxins for acutelymphoblastic leukemia. N. Eng. J. Med., 325: 1682-1687, 1991.

27. Bernard. O. A., Mauchauffe, C., Van den Berghe. H., and Berger. R. A novel gene, 45.AF-lp. fused to HRX in t(l:l D(p32;q23), is not related to AF-4, AF-9 nor ENL.Oncogene, 9: 1039-1045, 1994.

28. Tse, W., Zhu, W., Chen, H. S., and Cohen, A. A novel gene, AFlq. fused to MLL in 46.t(l;ll) (q2l;q23), is specifically expressed in leukemic and immature hematopoieticcells. Blood, 85: 650-656. 1995.

29. Prasad. R.. Gu. Y., Alder. H.. Nakamura, T.. Canaani. O., Saito. H.. Huebner. K.,Gale, R. P.. Nowell, P. C., Kuriyama. K.. Miyazaki. Y.. Croce, C. M., and Canaani,E. Cloning of the ALL-1 fusion partner, the AF-6 gene, involved in acute myeloid 47.leukemias with the 1(6;11) chromosome translocation. Cancer Res.. 53: 5624-5628.

1993.30. Chaplin, T.. Ayton, P.. Bernard. O. A., Saha, V.. Della Valle, V., Hillion, J.. 48.

Gregorini, A.. Lillington. D.. Berger, R.. and Young. B. D. A novel class of zincfmger/leucine zipper genes identified from the molecular cloning of the t(IO;ll)translocation in acute leukemia. Blood. 85: 1435-1441, 1995. 49.

31. Prasad, R.. Leshkowitz, D.. Gu. Y.. Alder, H., Nakamura, T.. Saito. H.. Huebner, K..Berger, R., Croce. C., and Canaani. E. Leucine zipper dimerization motif encoded bythe/tF-/7gene fused loALL-J (MLL} in acute leukemia. Proc. Nati. Acad. Sci. USA,91: 8107-8111, 1994. 50.

32. Thirman. M. J., Levitan. D. A., Kobayashi. H.. Simon, M. C., and Rowley, J. D.Cloning of ELL, a gene that fuses to MLL in a t( 11;l9)(q23;pl3.1) in acute myeloid 51.leukemia. Proc. Nati. Acad. Sci. USA. 91: 12110-12114, 1994.

33. Corrali, J., Forster, A., Thompson, S., Lampert, F.. Kaneko. Y.. Slater. R., Kroes.W. G., van der School, C. E., Ludwig. W-D.. Karpas. A.. Pocock, C.. Colter. F.. and

Rabbitts. T. H. Acute leukemias of different lineages have similar MLL-gene fusions

encoding related chimeric proteins resulting from chromosomal translocations. Proc.Nati. Acad. Sci. USA, 90: 8538-8542, 1993.

Parry, P., Wei, Y.. and Evans, G. Cloning and characterization of the t(X;ll)breakpoint from a leukemic cell line identify a new member of the forkheati genefamily. Genes Chromosomes & Cancer, //: 79-84. 1994.Downing, J. R., Head, D. R., Raimondi, S. C., Carol!, A. J.. Curcio-Brint. A. M..Motroni. T. A.. Hulshof. M. G., Pullen. D. J.. and Domer, P. H. The der( 11(-encodedMLL/AF-4 fusion transcript is consistently detected in l(4;l 1Hq21;q23(-containingacute lymphoblastic leukemia. Blood, 83: 330-335, 1994.Rowley, J. D. The der( 11) chromosome contains the critical breakpoint junction in the4;ll. 9;11, and 11;I9 translocations in acute leukemia. Genes Chromosomes &Cancer. 5: 264-266, 1992.Zeleznik-Le, N. J.. Harden, A. M.. and Rowley, J. D. I Iq23 translocations split the"AT-hook" cruciform DNA-binding region and the transcriptional repression domain

from the activation domain of the mixed- lineage leukemia (MLL) gene. Proc. Nati.Acad. Sci. USA. 91: 10610-10614. 1994.Mazo, A. M.. Huang, D-H.. Mozer. B. A., and Dawid, I. B. The iriihima gene, a//wi.v-acting regulator of the bithorax complex in DntMtphHti. encodes a protein withzinc-binding domains. Proc. Nati. Acad. Sci. USA, 87: 2112-2116, 1990.

Marschalek. R.. Greil. J.. Löchner.K.. Nilson. !.. Siegler. G.. Zweckbronner. !.. Beck.J. D., and Fey. G. H. Molecular analysis of the chromosomal breakpoint and fusiontranscripts in the acute lymphoblastic SEM cell line with chromosomal translocationt(4; 11). Br. J. Haematol., 90: 308-320, 1995.

Schichman, S. A., Caligiuri. M. A., Strout, M. P., Carter, S. L., Gu, Y., Canaani, E.,Bloomfield, C. D., and Croce, C. M. ALL-1 tandem duplication in acule myeloidleukemia with a normal karyotype involves homologous recombination between Aluelements. Cancer Res.. 54: 4277-4280. 1994.

Schichman, S. A.. Caligiuri. M. A.. Gu. Y.. Strout. M. P.. Canaani. E.. Bloomfield,C. D.. and Croce, C. M. ALL-1 partial duplication in acute leukemia. Proc. Nail.Acad. Sci. USA. 91: 6236-6239, 1994.Griesinger. F.. Elfers. H.. Ludwig, W-D.. Falk, M.. Rieder. H.. Harbott. J.. Lampert.

F.. Heinze, B.. Hoelzer. D.. Thiel, E., Riehm, H.. Wörmann. B„Fonatsch, C., andHiddemann, W. Detection of Hrx-FEL fusion transcripts in pre-pre-B-ALL with andwithout cytogenetic demonstration of 1(4;11). Leukemia (Baltimore), 8: 542-548,

1994.Mbangkollo. D., Burnett. R., McCabe. N.. Thirman, M.. Gill, H.. Yu, H.. Rowley.J. D., and Diaz. M. O. The human MLL gene: nudeotide sequence, homology to theDrosophilti trx zinc-finger domain, and alternative splicing. DNA Cell Biol.. 14:475-483. 1995.Yamamoto, K.. Seto, M., Akao. Y., lida. S.. Nakazawa. S., Oshimura, M.. Takahashi.T.. und Ueda. R. Gene rearrangement and truncated mRNA in cell lines with 1Iq23translocation. Oncogene, 8: 479-485, 1993.

Sambrook. J.. Fritsch, E. F.. and Manialis, T. Molecular Cloning: A LaboratoryManual, pp. 9.31-9.57. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory,

1989.Huret. J. L., Brizard. A.. Slater. R.. Charrin, C., Bertheas. M. F., Guilhot, F., Hahlen,K., Kroes W.. van Leeuwen. E., School. E. V. D.. Beishuizen. A.. Tanzer, J., andHagemeijer. A. Cytogenetic heterogeneity in til 1:19) acute leukemias: clinical.hematological and cytogenetic analysis of 48 patients-updated published cases and16 new observations. Leukemia (Baltimore). 7: 152-160. 1993.

Chervinsky, D., Sail, S. N. Y., Nowak, N. J., Shows. D. B., and Apian. P. D. ComplexMLL rearrangement in a patient with T-cell acute lymphoblastic leukemia. GenesChromosomes & Cancer, 14: 76-84, 1995.Gu. Y.. Alder. H.. Nakamura. T.. Schichman, S. A.. Prasad, R., Canaani. O.. Saito. H..Croce. C. M., and Canaani. E. Sequence analysis of the breakpoint cluster region inthe ALL-1 gene involved in acute leukemia. Cancer Res., 54: 2327-2330, 1994.

Gu. Y.. Cimino. G.. Alder, H.. Nakamura. T.. Prasad. R.. Canaani. O.. Moir, D. T.,Jones, C.. Nowell, P. C., Croce, C. M., and Canaani, E. The (4;l I)(q2l:q23)chromosome translocations in acute leukemias involve (he VDJ recombinase. Proc.Nati. Acad. Sci. USA. 89: 10464-10468. 1992.Aasland. R.. Gibson. T. J.. and Stewart. A. F. The PHD finger: implications forchrornatin-mediated transcriptional regulation. Trends Biol. Sci., 20: 56-59, 1995.

Sedkov. Y.. Tillib. S., Mizrokhi. L.. and Mazo. A. The bithorax complex is regulatedby trithorax earlier during Drosophila embryogenesis than is the Antennapediacomplex, correlating with a bithorax-like expression pattern of distinct early trilhoraxtranscripts. Development (Camb.K 120: 1907-1917, 1994.

2177

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

1996;56:2171-2177. Cancer Res   Klaus Löchner, Gabi Siegler, Monika Führer, et al.   Leukemias

Gene Is Associated with Acute Lymphoblastic T-CellALL-1A Specific Deletion in the Breakpoint Cluster Region of the

  Updated version

  http://cancerres.aacrjournals.org/content/56/9/2171

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/9/2171To request permission to re-use all or part of this article, use this link

Research. on January 25, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from