document

Schelleckes, Kristina Kusche-Vihrog, Stefan-Martin Brand and Eva BrandBoris Schmitz, Johanna Nedele, Katrin Guske, Martina Maase, Malte Lenders, Michael

, and Mineralocorticoid Receptorβ/α, Na+/K+-ATPase-αSodium Channel-Soluble Adenylyl Cyclase in Vascular Endothelium: Gene Expression Control of Epithelial

Print ISSN: 0194-911X. Online ISSN: 1524-4563 Copyright © 2014 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Hypertension doi: 10.1161/HYPERTENSIONAHA.113.020612014;63:753-761; originally published online January 13, 2014;Hypertension.

http://hyper.ahajournals.org/content/63/4/753World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://hyper.ahajournals.org/content/suppl/2014/01/13/HYPERTENSIONAHA.113.02061.DC1.htmlData Supplement (unedited) at:

http://hyper.ahajournals.org//subscriptions/

is online at: Hypertension Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer this process is available in the

click Request Permissions in the middle column of the Web page under Services. Further information aboutOffice. Once the online version of the published article for which permission is being requested is located,

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialHypertensionin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from

http://hyper.ahajournals.org/content/63/4/753

http://hyper.ahajournals.org/content/63/4/753

http://hyper.ahajournals.org/content/suppl/2014/01/13/HYPERTENSIONAHA.113.02061.DC1.html

http://hyper.ahajournals.org/content/suppl/2014/01/13/HYPERTENSIONAHA.113.02061.DC1.html

http://www.ahajournals.org/site/rights/

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://www.lww.com/reprints



http://hyper.ahajournals.org/
























753

Arterial stiffening is associated with cardiovascular mor-bidity, such as myocardial infarction, heart failure, and

stroke, but also with dementia and renal failure.1 Central aor-tic elasticity can be measured by pulse wave velocity,2 and increased pulse wave velocity is a strong and independent pre-dictor of cardiovascular morbidity and all-cause mortality in patients with essential hypertension,3 end-stage renal disease,4 as well as the general population.5 The overall vascular elastic-ity reflects the mechanical property of the large arteries and is the result of individual genetic predisposition,6 lifestyle, other environmental factors, and their interaction.7

Vascular elasticity and compliance of the vascular wall depend to a great extent on the relative contribution of the scaf-folding proteins elastin and collagen.8 Dysregulation of their expression, degradation, and protein cross-links may lead to alterations in the elastin/collagen ratio with subsequent arte-rial stiffening.9 The mineralocorticoid hormone aldosterone is a potent and blood pressure–independent inducer of both, elastin and collagen expression,10 pointing to the direct impli-cation of aldosterone in vascular elasticity. Most recently, the

involvement of the vascular endothelium has been discussed extensively as an important regulator of vascular elasticity.11 Endothelial cells (ECs) contribute to the vascular tone and are sensitive to aldosterone and elevated sodium concentrations.12 Regulation of endothelial stiffness involves the multi-subunit epithelial sodium channel (ENaC) and potentially the Na+/K+-ATPase.11,13 Gene expression of ENaC-α (SCNN1A), Na+/K+-ATPase-α/-β (ATP1A1, ATP1B1), and the mineralocorti-coid receptor (MR; NR3C2) has been suggested to depend on the second messenger cAMP.14–17 The human adenylyl cyclase 10 (ADCY10), also termed soluble adenylyl cyclase (sAC), generates cAMP in the cellular nucleus18,19 with subsequent protein kinase A (PKA) activation and cAMP response ele-ment–binding protein (CREB) phosphorylation. In the kidney, sAC has been reported to be involved in blood pressure homeo-stasis, whereas specific inhibition of sAC by its inhibitor KH7 resulted in abrogation of basic and agonist-stimulated Na+ reabsorption.20 ENaC, Na+/K+-ATPase, and MR expression may involve binding of phosphorylated CREB (CREB-p) to cAMP response elements (CRE) at the promoter level.21–23 In

Abstract—The Ca2+- and bicarbonate-activated soluble adenylyl cyclase (sAC) has been identified recently as an important mediator of aldosterone signaling in the kidney. Nuclear sAC has been reported to stimulate cAMP response element–binding protein 1 phosphorylation via protein kinase A, suggesting an alternative cAMP pathway in the nucleus. In this study, we analyzed the sAC as a potential modulator of endothelial stiffness in the vascular endothelium. We determined the contribution of sAC to cAMP response element–mediated transcriptional activation in vascular endothelial cells and kidney collecting duct cells. Inhibition of sAC by the specific inhibitor KH7 significantly reduced cAMP response element–mediated promoter activity and affected cAMP response element–binding protein 1 phosphorylation. Furthermore, KH7 and anti-sAC small interfering RNA significantly decreased mRNA and protein levels of epithelial sodium channel-α and Na+/K+-ATPase-α. Using atomic force microscopy, a nano-technique that measures stiffness and deformability of living cells, we detected significant endothelial cell softening after sAC inhibition. Our results suggest that the sAC is a regulator of gene expression involved in aldosterone signaling and an important regulator of endothelial stiffness. Additional studies are warranted to investigate the protective action of sAC inhibitors in humans for potential clinical use. (Hypertension. 2014;63:753-761.) • Online Data Supplement

Key Words: adenylyl cyclase ■ aldosterone ■ cyclic AMP response element–binding protein ■ vascular stiffness

Received July 18, 2013; first decision August 6, 2013; revision accepted December 16, 2013.From Internal Medicine D, Department of Nephrology, Hypertension, and Rheumatology (B.S., J.N., K.G., M.L., M.S., E.B.) and Institute of Sports

Medicine, Molecular Genetics of Cardiovascular Disease (B.S., S.-M.B.), University Hospital Muenster, Muenster, Germany; and Institute of Physiology II, University of Muenster, Muenster, Germany (M.M., K.K.-V.).

*These authors contributed equally to this work.The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.

113.02061/-/DC1.Correspondence to Eva Brand, University Hospital Muenster, Internal Medicine D, Department of Nephrology, Hypertension, and Rheumatology,

Albert-Schweitzer-Campus 1, D-48149 Muenster, Germany. E-mail [email protected]

Soluble Adenylyl Cyclase in Vascular EndotheliumGene Expression Control of Epithelial Sodium Channel-α,

Na+/K+-ATPase-α/β, and Mineralocorticoid Receptor

Boris Schmitz,* Johanna Nedele,* Katrin Guske, Martina Maase, Malte Lenders, Michael Schelleckes, Kristina Kusche-Vihrog, Stefan-Martin Brand, Eva Brand

© 2014 American Heart Association, Inc.

Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYPERTENSIONAHA.113.02061

Vessels

at USC Norris Medical Library on April 4, 2014http://hyper.ahajournals.org/Downloaded from

http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.113.02061/-/DC1



mailto:[email protected]



754 Hypertension April 2014

the current work, we analyzed sAC-dependent CRE-mediated transcriptional activation through CREB-p in kidney and ECs and determined the impact of sAC on endothelial stiffness.

MethodsCell CultureThe human vascular EC line EA.hy92624 was maintained in DMEM (Sigma-Aldrich, Munich, Germany) with 10% fetal calf serum (PAA, Cölbe, Germany), penicillin (100 U/mL), streptomycin (100 ng/mL), and l-glutamine (2 mmol/mL; all Sigma-Aldrich). The human kidney epithelial cell line IHKE25–27 was maintained in DMEM/Ham’s-F12, 1% fetal calf serum, penicillin (100 U/mL), streptomycin (100 ng/mL), and l-glutamine (2 mmol/mL), insulin-transferrin-sodium selenite media supplement (10 μL/mL), NaHCO

3 (1.25 μg/mL),

sodium pyruvate (55 μg/mL), epidermal growth factor (10 μg/L; all Sigma-Aldrich,) and HEPES (15 μmol/mL, Merck, Darmstadt, Germany). Human primary aortic ECs (PromoCell, Heidelberg, Germany) were maintained in endothelial cell growth medium MV with 10% fetal calf serum, epidermal growth factor (10 ng/mL), and hydrocortisone (1 μg/mL; all PromoCell). Cells were incubated with 500 μmol/L lipophilic 8-Br-cAMP (Biolog, Bremen, Germany) or 200 pmol/L aldosterone (Sigma-Aldrich) as indicated. The specific sAC inhibitor KH7 (Sigma-Aldrich) was administered at a concentra-tion of 25 μmol/L, the MR antagonist spironolactone (Sigma-Aldrich) at 1 μmol/L.

Preparation of Mice AortaeAll animal experiments were approved by an institutional review committee. Mice aortae (n=4) for atomic force microscopy (AFM)–based cell stiffness measurements were dissected, freed from sur-rounding tissue, opened and fixed on glass coverslips coated with Cell-Tak (Becton Dickinson, Heidelberg, Germany) as described pre-viously.28 Aortae were incubated for 24 hours in medium with KH7 (25 μmol/L) and aldosterone (1 nmol/L) or aldosterone alone.

AFM-Based Cell Stiffness MeasurementsThe stiffness (defined as Newton per meter) of EA.hy926 cells and in situ ECs of ex vivo mice aorta was measured at 37°C using a Multimode AFM (Bruker, Mannheim, Germany) equipped with a soft cantilever (MLCT-contact microlever, spring constant: 0.018 N/m for ECs, 0.011 or 0.012 N/m for aortae; Bruker) and a spherical tip with a diameter of 1 μm for ECs and 10 μm for aortae (Novascan, Ames, IA) as described previously.12 Cantilever deflection from the cell surface (indentation depth, ≈50–100 nm) was measured by laser beam and transformed into single-cell force/distance curves. For each experi-mental condition, 20 single-cell measurements with 8 force/distance curves per cell were recorded. During AFM measurements, cells were kept in HEPES-buffered solution (140 mmol/L NaCl, 5 mmol/L KCl, 1 mmol/L MgCl

2, 1 mmol/L CaCl

2, 10 mmol/L HEPES, 5 mmol/L

glucose, pH 7.4). AFM data were collected with the NanoScope V8.10 software (Bruker) and stiffness values were calculated using the Protein Unfolding and Nano-Indentation Analysis Software (http://punias.voila.net/).

Transient Transfections and siRNA ExperimentsFor details please see online-only Data Supplement.

Real-Time Polymerase Chain ReactionFor details please see online-only Data Supplement.

Preparation of Nuclear Protein ExtractsNuclear protein extracts were generated using a modified protocol.29 For details please see online-only Data Supplement.

Western BlotFor details please see online-only Data Supplement.

Chromatin Immunoprecipitation AssayChromatin immunoprecipitation (ChIP) was performed as described previously.30 DNA/protein complexes were fixed using formalde-hyde (1%, 30 minutes). DNA was sonicated using a Bioruptor (≈45 minutes, 0.5-second interval, 200 W; Diagenode, Liège, Belgium). Chromatin had an average size of 300 to 500 bp. Four microgram of anti–CREB-p or anti-specificity protein 1 (SP1; Millipore, Bedford, MA) or IgG (negative control; Millipore) were used. Oligonucleotide sequences are given in Table S1 in the online-only Data Supplement.

Statistical AnalysisP values were calculated using Graph Pad Prism 4.0 or OriginPro 8.5 (for AFM measurements) and unpaired Student t test or Mann–Whitney test for continuous variables. Significance was declared at P<0.05.

ResultsCellular sAC LocalizationWe initially determined expression levels of the cAMP-generating enzyme sAC in the vascular EC line EA.hy926 and the kidney proximal tubule epithelial cell line IHKE. EA.hy926 cells have been used commonly to investi-gate changes in endothelial function,11–13 whereas IHKE cells have been introduced to study the function of renal Ca2+-, Na+-, and K+-channels.25–27 We identified sAC protein in whole cell extract and, particularly, in the nucleus of EA.hy926 and IHKE cells (Figure 1), with 3 protein isoforms designated A (≈55 kDa), B (≈65 kDa), and C (≈80 kDa). The nuclear accu-mulation of all 3 detected isoforms in ECs was increased by cAMP stimulation. Isoform B was detected hardly in crude cellular extracts of kidney cells but was significantly enriched in nuclear extracts. Interestingly, we observed a significant increase in sAC transcript upon 24-hour cAMP stimulation, whereas stimulation with protein kinase C–activating PMA remained ineffective (data not shown), suggesting PKA sig-naling rather than protein kinase C signaling to be involved in sAC expression regulation.

CRE-Mediated Transcriptional Activity Is Affected by sACBecause sAC has been reported to stimulate CREB phosphor-ylation,31 we investigated the impact of sAC on CRE-mediated

Figure 1. Soluble adenylyl cyclase (sAC) protein isoforms are expressed differentially in endothelial EA.hy926 and renal IHKE cells. Three sAC isoforms were detected in nuclear extracts of EA.hy926 and IHKE cells: ≈55 kDa (A), ≈65 kDa (B), and ≈80 kDa (C). The nuclear accumulation of all 3 detected isoforms in endothelial cells was increased by cAMP stimulation. Isoform B was detected hardly in crude cellular extracts of kidney cells but was significantly enriched in nuclear extracts. Western blot is representative for 3 independent experiments.


http://punias.voila.net/



Schmitz et al Soluble Adenylyl Cyclase in Endothelium 755

transcriptional activity. A CRE reporter gene vector was used to detect changes in cellular CRE-mediated transcriptional activity (Figure 2). We observed strong CRE-mediated tran-scriptional activity in ECs under basic conditions (Figure 2A), which was less prominent in IHKE cells (Figure 2B). In both cell lines, PKA stimulation via cAMP led to significant acti-vation of CRE-mediated transcriptional activity (Figure 2A and 2B; P<0.001). Treatment with the specific sAC inhibi-tor KH7 significantly reduced CRE promoter activity in ECs (P=0.0006; Figure 2A) and CRE-mediated transcriptional activity was abrogated completely in kidney cells (P=0.0139; Figure 2B) and could not be restored by cAMP.

Our investigation of the impact of sAC inhibition on CREB phosphorylation (Ser

133-CREB-p) and total cellular CREB by

Western blot analyses showed that application of KH7 signifi-cantly reduced CREB-p in endothelial (P<0.05; Figure 2C) and kidney cells (P<0.05; Figure 2D) compared with mock control. The effects of KH7 on CREB phosphorylation were

prevented by cAMP. The level of unphosphorylated CREB remained unaffected by KH7 and cAMP in either cell line (Figure 2E and 2F). Notably, long-term treatment with KH7 (24 hours) resulted in an increase of Ser

133-CREB-p in both cell

lines (Figure S1), suggesting a potential feedback mechanism.

Expression of Genes Regulating Endothelial Stiffness Depends on sAC ActivityTo determine the regulatory effect of sAC on aldosterone-regulated genes, we analyzed the gene expression of Na+/K+-ATPase-α (ATP1A1), Na+/K+-ATPase-β (ATP1B1), MR (NR3C2), ENaC-α (SCNN1A), and sAC (ADCY10) via real-time polymerase chain reaction (Figure 3) in ECs expressing the MR (Figure S5). Compared with mock control, inhibition of sAC by KH7 resulted in significantly decreased expression of all genes tested (P<0.05), with the exception of NR3C2 (Figure 3A). Comparable results were obtained in human primary aortic ECs, in which treatment with KH7

Figure 2. A and B, cAMP response element (CRE)–mediated transcriptional activity is reduced significantly by selective soluble adenylyl cyclase (sAC) inhibition. Basic CRE-mediated transcriptional activity in EA.hy926 cells was reduced by application of sAC inhibitor KH7. Treatment with cAMP enhanced basic CRE promoter activity (positive control). Application of KH7 decreased the activating effect of cAMP. Comparable but more prominent effects of sAC inhibition were observed in IHKE cells. C and D, sAC inhibition leads to reduced CRE binding protein 1 (CREB) phosphorylation. Inhibition of sAC by KH7 for 1 hour resulted in reduced CREB phosphorylation (CREB-p) in EA.hy926 and IHKE cells. Addition of cAMP did not result in stimulation of CREB phosphorylation in both cell lines, whereas simultaneous application of cAMP and KH7 prevented the reduction of CREB phosphorylation. E and F, Total amount of CREB remained constant under all conditions. Cell lines were treated with KH7 and cAMP (alone or in combination) or DMSO (control) 3 hours after CRE reporter vector transfection for 24 hours. KH7 was administrated 15 minutes before cAMP. Transfections and Western blots are representative for 3 independent experiments. Relative band intensities are shown as mean±SEM of densitometric measurements compared with β-actin loading control of 3 independent blots. Transcriptional activity was assessed as relative light units (RLU). ***P<0.001, **P<0.01, and *P<0.05.





resulted in a significant downregulation of ATP1A1 and SCNN1A (Figure 3E). To validate the results obtained by sAC inhibition via KH7, we performed sAC-specific small inter-fering RNA (siRNA) transfection experiments (Figure 3B). Consistently, the siRNA approach resulted in a significant downregulation of the expression of all genes (P<0.001), again with the exception of NR3C2 (Figure 3B).

Furthermore, we assessed the regulative effect of sAC inhi-bition in ECs under stimulatory conditions including aldo-sterone and cAMP (Figure 3C and 3D). Application of 200 pmol/L aldosterone exerted a strong activating effect on the expression of ADCY10, ATP1A1, ATP1B1, and SCNN1A, whereas expression of NR3C2 was increased slightly (Figure 3C). The observed gene expression activation was

spironolactone-sensitive and was prevented effectively by KH7. Validation experiments were performed in human pri-mary aortic ECs, in which aldosterone stimulation resulted in a comparable increase of ATP1A1, ATP1B1, and SCNN1A expression (Figure 3F). This finding is consistent with data from a comparative gene expression analysis of human umbil-ical vein ECs and EA.hy926, which concluded that EA.hy926 cells have retained the gene expression profile of primary ECs.32 Short-term stimulation (2 and 4 hours) with cAMP significantly upregulated the expression of both genes coding for Na+/K+-ATPase subunits (ATP1A1, ATP1B1) and NR3C2 (P<0.05), whereas ADCY10 expression was not affected (Figure 3D). Notably, cAMP stimulation for 2 hours resulted in repression of NR3C2 and SCNN1A expression (P<0.01).

Figure 3. Aldosterone-sensitive genes are repressed by soluble adenylyl cyclase (sAC) inhibition. A and B, Treatment of endothelial cells (ECs) with KH7 and knockdown of sAC by small interfering RNA (siRNA) resulted in reduction of adenylyl cyclase 10 (ADCY10), Na+/K+-ATPase-α/-β (ATP1A1, ATP1B1), and epithelial sodium channel-α (SCNN1A) mRNA, determined by real-time polymerase chain reaction (PCR). C, Treatment of ECs with aldosterone (200 pmol/L) resulted in an upregulation of ADCY10, ATP1A1, ATP1B1, and SCNN1A after 2 hours. Expression of mineralocorticoid receptor (NR3C2) was increased slightly after 4 hours. Upregulation was prevented by application of KH7 and the MR antagonist spironolactone. D, Treatment of ECs with cAMP increased expression of ATP1A1, ATP1B1, and NR3C2, which was prevented by KH7 with the exception of NR3C2. E and F, Comparable results were observed in human primary aortic ECs (HAoECs). Cells were treated with KH7/spironolactone or ethanol/DMSO (control). Cells were transfected with sAC siRNA or scrambled siRNA (5 μmol/L, 48 hours). Real-time PCR results include data of 3 independent experiments shown as mean±SEM. ***P<0.001, **P<0.01, and *P<0.05.





The activating effect of cAMP was prevented by sAC inhibi-tion with the exception of NR3C2. The inhibitory effects of KH7 in the presence of aldosterone were also observed on isolated glucocorticoid response element- and CRE-mediated gene expression (Figure S2).

Because sAC inhibition led to a significant downregulation of ENaC-α and Na+/K+-ATPase-α gene expression (Figure 3) as well as a reduction in CREB-p and CRE-mediated promoter activity (Figure 2), we analyzed potential sAC-dependent changes of CREB-p binding at SCNN1A33 and ATP1A134 promoter regions in ChIP experiments. Because no reports existed that proved the binding of CREB-p to SCNN1A, we performed in silico analyses using PROMO 3.0.2.35 The analysis revealed a conserved CRE motive located at position −784 of SCNN1A. For the ATP1A1 promoter, we analyzed the well-characterized PUC-1 region, including the known CRE motive.34 Our ATP1A1 in silico analysis additionally sug-gested a SP1 binding site within the PUC-1 region. Our ChIP experiments in ECs revealed that CREB-p was bound to both promoters under basic conditions and binding of CREB-p was prevented by sAC inhibition (Figure 4). Notably, SP1 binding at the ATP1A1 CRE motive was also prevented by sAC inhibition.

With respect to the significant effects of sAC inhibition on EC gene expression, we investigated the consequences of sAC knockdown in ECs and renal cells on the protein level (Figure 5). Initially, we used an anti-sAC siRNA approach to confirm the identity of the detected sAC protein bands (Figure 5A and 5B). Expression of all 3 identified sAC iso-forms was significantly reduced by application of anti-sAC siRNA in both cell lines compared with scrambled siRNA (P<0.05). sAC inhibition by siRNA also affected ENaC-α and Na+/K+-ATPase-α levels. We observed a significant reduction of active ENaC-α as well as lower levels for glycosylated and ubiquitinylated ENaC-α36 compared with mock con-trol (P<0.05; Figure 5C and 5D). The protein level of Na+/K+-ATPase-α was reduced significantly in ECs (P<0.05; Figure 5E), whereas no significant downregulation was observed in renal IHKE cells (Figure 5F). Comparable results were observed after 24-hour sAC inhibition by KH7, in that protein levels of active ENaC-α and Na+/K+-ATPase-α were

reduced significantly in both cell lines compared with control (P<0.05; Figure S3).

ECs Are Softened by Inhibition of sACBased on the identified effect of sAC inhibition on the expres-sion of genes known to be involved in the regulation of EC stiffness, we conducted AFM nano-indentation measurements of EA.hy926 ECs and mouse aorta ECs to determine the phys-iological effect of sAC inhibition. AFM is a nano-technique that measures stiffness, a mechanical property reflecting the physiological state of living cells.12 The AFM tip was used as a mechanical sensor to quantify these properties in a mul-titude of individual ECs (20 cells per setting). The treatment of ECs with KH7 for 24 hours resulted in a significant endo-thelial softening compared with control conditions (P<0.05; Figure S4). Furthermore, the significant aldosterone-induced stiffening of mouse aorta ECs was prevented by sAC inhibi-tion (P<0.05) and KH7-treated mouse aorta ECs were sig-nificantly softer than untreated cells in this setting (P<0.05; Figure 6). These results indicate that the observed effects on gene expression regulation via sAC inhibition in the presence of aldosterone translate into an overall endothelial softening.

DiscussionTo the best of our knowledge, our study is the first to inves-tigate the role of sAC in vascular ECs and the involvement of sAC in regulation of genes affecting endothelial stiffness. We were able to demonstrate the following: (1) inhibition of sAC impairs CRE-mediated promoter activity; (2) inhibition of sAC affects CREB phosphorylation; (3) sAC regulates the expression of genes involved in endothelial stiffness; and (4) inhibition of sAC leads to endothelial softening.

Nuclear sAC as a Regulator of Active CRE PromotersWe detected sAC transcript and protein in vascular ECs and in the kidney cell line IHKE. Two sAC isoforms (≈55 and ≈80 kDa), identified by Hallows et al20 in cell lysates of mpkCCDc14 kidney cells, were confirmed in IHKE cells, whereas we detected an additional isoform of ≈65 kDa predominantly in ECs. We confirmed the identity of all 3 detected protein bands by an anti-sAC siRNA approach. sAC has been reported to be involved in transmembrane adenylyl cyclases–independent cAMP signaling inside the mammalian cell nucleus, affecting CREB phosphorylation via PKA.37,38 Our experiments, including a CRE reporter vector and the sAC-specific inhibitor KH7, revealed potent inhibition of CRE-dependent promoter activation on sAC depletion. Previous studies have demonstrated that KH7 effectively inhibits sAC enzyme activity at con-centrations of 10 to 30 μmol/L, whereas transmembrane adenylyl cyclases and soluble guanylyl cyclases remained unaffected.39 The small molecule KH7 has been identi-fied originally to display an IC

50 between 3 and 10 μmol/L

toward the recombinant human ≈55 kDa sAC isoform.40 Until today, the exact molecular mechanisms underlying the inhibitory effects of KH7 are unknown. Notably, application of cAMP in our CRE reporter vector experiments in kidney cells could not overcome sAC inhibition by KH7, which

Figure 4. Inhibition of soluble adenylyl cyclase (sAC) prevents phosphorylated cAMP response element–binding protein 1 (CREB-p) binding to the epithelial sodium channel-α (ENaC-α) and Na+/K+-ATPase-α promoter. Chromatin immunoprecipitation revealed binding of phosphorylated CREB (CREB-p) at ENaC-α (SCNN1A) and Na+/K+-ATPase-α (ATP1A1) CRE sites in EA.hy926 cells. Binding of specificity protein 1 (SP1) was detected for the ATP1A1 CRE site. Transcription factor binding was prevented by KH7. DNA was precipitated with antibodies for CREB-p and SP1 and amplified using polymerase chain reaction (PCR). Input indicates sonicated chromatin, positive PCR control; control, IgG-treated chromatin, negative control; and Ø, unstimulated. PCR is representative for 3 independent experiments.





caused total abrogation of CRE-mediated transcriptional activity. The above-mentioned effects may be explained, at least in part, by the inhibition of enzymatic sAC cAMP production by KH7, but also by the alteration of a putative sAC/PKA complex with subsequent inhibition of respective promoter activities.

Inhibition of sAC Affects CREB PhosphorylationIn CRE reporter vector experiments, we observed that inhi-bition of sAC in ECs resulted in a less prominent effect on CRE-mediated transcription compared with that in IHKE cells. Furthermore, CRE-mediated transcriptional activity could only be restored by cAMP in ECs but not in renal cells. Because sAC has been suggested to act predominantly via cAMP-dependent PKA, which phosphorylates CREB exclu-sively at Ser

133,41 CRE-mediated transcriptional activation

through CREB phosphorylation at Ser133

may be the major pathway in renal cells. Our analysis of cellular CREB revealed that the level of total CREB was unaffected by short-term appli-cation of KH7 (1 hour), whereas Ser

133-phosphorylated CREB

was significantly reduced. Long-term KH7 treatment (24 hours) resulted in an increase of cellular Ser

133-phosphorylated

CREB in both cell lines, indicating the initiation of an alter-native back-up mechanism for CREB phosphorylation under long-term sAC inhibition. In ECs, additional kinases involved in CREB phosphorylation at alternative residues different from Ser

133 might also be active.42 Because cGMP-generating

soluble guanylyl cyclases are unaffected by KH7, and sAC has been reported to be the only AC in the mammalian cell nucleus,31 the endothelial soluble cGMP-dependent protein kinase I is a likely effector of alternative CRE-mediated tran-scription in ECs.43,44

An important function of cGMP in the vascular system has been stressed recently by the implication of phospho-diesterase 5 inhibitors, which increase intracellular cGMP concentration in disorders such as pulmonary and potentially essential hypertension.45 Taking our findings into account, it is conceivable that sAC inhibition may as well affect positively the cellular balance between cAMP and cGMP, resulting in a potential reduction of blood pressure.

Figure 5. Epithelial sodium channel-α (ENaC-α) and Na+/K+-ATPase-α protein is reduced by soluble adenylyl cyclase (sAC) knockdown. A and B, All 3 identified sAC protein isoforms (A, B, C) were reduced after transfection of anti-sAC small interfering RNA (siRNA) in EA.hy926 and IHKE cells compared with control. C and D, Knockdown of sAC resulted in reduced cellular levels of ENaC-α protein. The reduction was observed for active ENaC-α (a), glycosylated ENaC-α (g), as well as ubiquitinylated ENaC-α (u). E and F, Na+/K+-ATPase-α protein levels were reduced in endothelial EA.hy926 cells. No significant reduction was observed in renal IHKE cells. Cells were transfected with sAC siRNA (125 or 250 nmol/L) or scrambled siRNA (250 nmol/L) for 72 hours. Western blot is representative for 3 independent experiments. Relative band intensities are shown as mean±SEM of densitometric measurements compared with β-actin loading control of 3 independent blots. **P<0.01 and *P<0.05.





Expression of Genes Regulating Endothelial Stiffness Depends on sACIndividual reports have proposed a role for cAMP in gene expression regulation of SCNN1A, ATP1A1/-B1, and NR3C2,15–17,21 which are targets of endothelial aldosterone sig-naling. These observations, together with our results, suggested that sAC is involved in the regulation of all 4 genes and could affect endothelial stiffness. Consistently, we detected decreased levels of ATP1A1 and ATP1B1, NR3C2, SCNN1A, and sAC mRNA after 24 hours of KH7 administration in EA.hy926 cells. The results obtained with the sAC-specific inhibitor KH7 were validated using an anti-sAC siRNA approach, which led to a comparable strong reduction of all transcripts tested. In con-trast to another report,46 we detected aldosterone stimulation (200 pmol/L) of ECs to increase the expression of ADCY10, ATP1A1/B1, and SCNN1A after 2 hours, whereas NR3C2 increased after 4 hours. The increased mRNA levels of sAC, ATP1A1/B1, and SCNN1A were not detected after 4 hours of aldosterone stimulation, suggesting a feedback inhibition including either short mRNA half-lives or active degradation. The activating effect of aldosterone was prevented completely by KH7 and spironolactone. ATP1A1/B1, SCNN1A, and NR3C2 expression was also increased by cAMP stimulation, which was counterbalanced by sAC inhibition. Notably, NR3C2 expression remained activated in the presence of KH7. Our data obtained from ECs treated with anti-sAC siRNA and subsequent Western blot analyses suggest that the observed inhibition of ATP1A1 and SCNN1A gene expression may translate into a reduction of ENaC-α and Na+/K+-ATPase-α protein levels.

Moreover, our ChIP experiments on CREB-p and SP1 bind-ing to CRE motives demonstrate that sAC inhibition alters the interaction between transcription factors and the ATP1A1 and SCNN1A promoter regions. These findings may explain the observed reduction in ATP1A1 and SCNN1A gene expression on sAC inhibition.

Endothelium Is Softened by sAC InhibitionExtending our molecular functional analyses on sAC in ECs, we hypothesized that sAC inhibition translates into relevant physiological effects through alteration of the mechanical properties of ECs. Using AFM measurements of an EC line as well as ECs of mice ex vivo aortae, we detected a significant softening of cells after inhibition of sAC. The observed effect of ≈8% difference in EC stiffness may be explained by the inhibitory effect on mRNA and protein levels of the analyzed genes, resulting in a mild but significant cell softening. This result is of clinical relevance because chronic endothelial stiff-ness is accompanied by endothelial dysfunction as one of the first measurable features of arteriosclerosis.1,3 Future in vivo studies will be required to demonstrate the importance of sAC in the modulation of EC stiffness.

PerspectiveIn conclusion, we propose that sAC is involved in cAMP-mediated regulation of aldosterone-sensitive genes in renal epithelial and vascular ECs. sAC contributes differently to the CRE-mediated transcriptional activation in both cell types, suggesting a cell type–specific function together with other CREB-phosphorylating kinases. Vascular sAC may be a key regulator of long-term arterial elasticity because the amount of functional cAMP-producing sAC determines cellular transcript and protein levels of ENaC-α and the α subunit of Na+/K+-ATPase. Further analysis of sAC transcript and protein levels combined with specific sAC-dependent cAMP measurements in patients with elevated pulse wave velocity are warranted to address the impact of sAC on arterial stiffening. Additional stud-ies are needed to investigate the potentially protective action of sAC inhibitors in humans with respect to possible clinical use.

AcknowledgmentsEA.hy926 cells were a kind gift of Cora-Jean S. Edgell, University of NC. IHKE cells were a kind gift of Eberhard Schlatter, University Hospital Muenster, Germany. pADneo2-C6-BGL was provided kindly by Elwyn Isaac, Leeds, United Kingdom, the TAT3-Luc plas-mid by María dM Vivanco, Derio, Spain. We thank Samira Schiwek, Birgit Orlowski, and Alois Rötrige for excellent technical assistance.

Sources of FundingE. Brand is supported by a Heisenberg professorship from the Deutsche Forschungsgemeinschaft (DFG, Br1589/8-2). This study was also sup-ported, in part, by a grant from the Else Kröner-Fresenius-Foundation (project-no. 2010_A116) to E. Brand and K. Kusche-Vihrog and an information and communications technology project in the FP7-ICT-2007-2, project-no. 224635, VPH2-Virtual Pathological Heart of the Virtual Physiological Human (supported Boris Schmitz), to Stefan-Martin Brand, formerly Stefan-Martin Brand-Herrmann/Stefan-Martin Herrmann. Kristina Kusche-Vihrog was supported by the DFG (KU1496/7-1).

DisclosuresNone.

References 1. Zieman SJ, Melenovsky V, Kass DA. Mechanisms, pathophysiol-

ogy, and therapy of arterial stiffness. Arterioscler Thromb Vasc Biol. 2005;25:932–943.

2. Weber T, Ammer M, Rammer M, Adji A, O’Rourke MF, Wassertheurer S, Rosenkranz S, Eber B. Noninvasive determination of carotid-fem-oral pulse wave velocity depends critically on assessment of travel

Figure 6. Aldosterone-induced stiffening of endothelial cells is prevented by soluble adenylyl cyclase (sAC) inhibition. Incubating of ex vivo mice aortae with aldosterone for 24 hours resulted in a significant endothelial stiffening compared with control conditions. The aldosterone-induced stiffening was prevented by application of the sAC inhibitor KH7 (control: 1.08±0.037 pN/nm, n=79; aldosterone: 1.12±0.045, n=74; KH7+aldosterone: 0.94±0.027, n=79; mean±SEM). Atomic force microscopy measurements were repeated with aortae prepared from 4 animals. *P<0.05.





distance: a comparison with invasive measurement. J Hypertens. 2009;27:1624–1630.

3. Laurent S, Boutouyrie P, Asmar R, Gautier I, Laloux B, Guize L, Ducimetiere P, Benetos A. Aortic stiffness is an independent predic-tor of all-cause and cardiovascular mortality in hypertensive patients. Hypertension. 2001;37:1236–1241.

4. Blacher J, Guerin AP, Pannier B, Marchais SJ, Safar ME, London GM. Impact of aortic stiffness on survival in end-stage renal disease. Circulation. 1999;99:2434–2439.

5. Willum-Hansen T, Staessen JA, Torp-Pedersen C, Rasmussen S, Thijs L, Ibsen H, Jeppesen J. Prognostic value of aortic pulse wave veloc-ity as index of arterial stiffness in the general population. Circulation. 2006;113:664–670.

6. Lacolley P, Challande P, Osborne-Pellegrin M, Regnault V. Genetics and pathophysiology of arterial stiffness. Cardiovasc Res. 2009;81: 637–648.

7. Mullins LJ, Bailey MA, Mullins JJ. Hypertension, kidney, and transgen-ics: a fresh perspective. Physiol Rev. 2006;86:709–746.

8. Izzo JL Jr, Mitchell GF. Aging and arterial structure-function relations. Adv Cardiol. 2007;44:19–34.

9. Brull DJ, Murray LJ, Boreham CA, Ralston SH, Montgomery HE, Gallagher AM, McGuigan FE, Davey Smith G, Savage M, Humphries SE, Young IS. Effect of a COL1A1 Sp1 binding site polymorphism on arterial pulse wave velocity: an index of compliance. Hypertension. 2001;38:444–448.

10. Bunda S, Wang Y, Mitts TF, Liu P, Arab S, Arabkhari M, Hinek A. Aldosterone stimulates elastogenesis in cardiac fibroblasts via mineralo-corticoid receptor-independent action involving the consecutive activation of Galpha13, c-Src, the insulin-like growth factor-I receptor, and phospha-tidylinositol 3-kinase/Akt. J Biol Chem. 2009;284:16633–16647.

11. Kusche-Vihrog K, Callies C, Fels J, Oberleithner H. The epithelial sodium channel (ENaC): mediator of the aldosterone response in the vascular endothelium? Steroids. 2010;75:544–549.

12. Oberleithner H, Riethmüller C, Schillers H, MacGregor GA, de Wardener HE, Hausberg M. Plasma sodium stiffens vascular endo-thelium and reduces nitric oxide release. Proc Natl Acad Sci U S A. 2007;104:16281–16286.

13. Blaustein MP, Zhang J, Chen L, Song H, Raina H, Kinsey SP, Izuka M, Iwamoto T, Kotlikoff MI, Lingrel JB, Philipson KD, Wier WG, Hamlyn JM. The pump, the exchanger and endogenous quabain: signal-ing mechanisms that link salt retention to hypertension. Hypertension. 2009;53:291–298.

14. Mustafa SB, Castro R, Falck AJ, Petershack JA, Henson BM, Mendoza YM, Choudary A, Seidner SR. Protein kinase A and mitogen-activated protein kinase pathways mediate cAMP induction of alpha-epithelial Na+ channels (alpha-ENaC). J Cell Physiol. 2008;215:101–110.

15. Listwak SJ, Gold PW, Whitfield HJ Jr. The human mineralocorticoid receptor gene promoter: its structure and expression. J Steroid Biochem Mol Biol. 1996;58:495–506.

16. Dagenais A, Denis C, Vives MF, Girouard S, Massé C, Nguyen T, Yamagata T, Grygorczyk C, Kothary R, Berthiaume Y. Modulation of alpha-ENaC and alpha1-Na+-K+-ATPase by cAMP and dexametha-sone in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol. 2001;281:L217–L230.

17. Matlhagela K, Borsick M, Rajkhowa T, Taub M. Identification of a prostaglandin-responsive element in the Na,K-ATPase beta 1 promoter that is regulated by cAMP and Ca2+. Evidence for an interactive role of cAMP regulatory element-binding protein and Sp1. J Biol Chem. 2005;280:334–346.

18. Zippin JH, Chen Y, Nahirney P, Kamenetsky M, Wuttke MS, Fischman DA, Levin LR, Buck J. Compartmentalization of bicarbonate-sensitive adenylyl cyclase in distinct signaling microdomains. FASEB J. 2003; 17:82–84.

19. Feng Q, Zhang Y, Li Y, Liu Z, Zuo J, Fang F. Two domains are criti-cal for the nuclear localization of soluble adenylyl cyclase. Biochimie. 2006;88:319–328.

20. Hallows KR, Wang H, Edinger RS, Butterworth MB, Oyster NM, Li H, Buck J, Levin LR, Johnson JP, Pastor-Soler NM. Regulation of epithelial Na+ transport by soluble adenylyl cyclase in kidney collecting duct cells. J Biol Chem. 2009;284:5774–5783.

21. Ahmad M, Medford RM. Evidence for the regulation of Na+, K(+)-ATPase alpha 1 gene expression through the interaction of aldosterone and cAMP-inducible transcriptional factors. Steroids. 1995;60:147–152.

22. Wang G, Kawakami K, Gick G. Regulation of Na,K-ATPase alpha1 sub-unit gene transcription in response to low K(+): role of CRE/ATF- and GC box-binding proteins. J Cell Physiol. 2007;213:167–176.

23. Wang J, Li X, Ke Y, Lu Y, Wang F, Fan N, Sun H, Zhang H, Liu R, Yang J, Ye L, Liu M, Ning G. GPR48 increases mineralocorticoid receptor gene expression. J Am Soc Nephrol. 2012;23:281–293.

24. Edgell CJ, McDonald CC, Graham JB. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc Natl Acad Sci U S A. 1983;80:3734–3737.

25. Hohage H, Stachon A, Feidt C, Hirsch JR, Schlatter E. Regulation of organic cation transport in IHKE-1 and LLC-PK1 cells. Fluorometric stud-ies with 4-(4-dimethylaminostyryl)-N-methylpyridinium. J Pharmacol Exp Ther. 1998;286:305–310.

26. Jessen H, Røigaard H, Riahi-Esfahani S, Jacobsen C. A comparative study on the uptake of alpha-aminoisobutyric acid by normal and immortalized human embryonic kidney cells from proximal tubule. Biochim Biophys Acta. 1994;1190:279–288.

27. Tveito G, Hansteen IL, Dalen H, Haugen A. Immortalization of normal human kidney epithelial cells by nickel(II). Cancer Res. 1989;49:1829–1835.

28. Kusche-Vihrog K, Urbanova K, Blanqué A, Wilhelmi M, Schillers H, Kliche K, Pavenstädt H, Brand E, Oberleithner H. C-reactive protein makes human endothelium stiff and tight. Hypertension. 2011;57:231–237.

29. Schreiber E, Matthias P, Müller MM, Schaffner W. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. 1989;17:6419.

30. Schmitz B, Salomon A, Rötrige A, Ritter M, Ringelstein EB, Fischer JW, Paul M, Brand E, Brand SM. Interindividual transcriptional regulation of the human biglycan gene involves three common molecular haplotypes. Arterioscler Thromb Vasc Biol. 2013;33:871–880.

31. Zippin JH, Farrell J, Huron D, Kamenetsky M, Hess KC, Fischman DA, Levin LR, Buck J. Bicarbonate-responsive “soluble” adeny-lyl cyclase defines a nuclear cAMP microdomain. J Cell Biol. 2004;164:527–534.

32. Boerma M, Fu Q, Wang J, Loose DS, Bartolozzi A, Ellis JL, McGonigle S, Paradise E, Sweetnam P, Fink LM, Vozenin-Brotons MC, Hauer-Jensen M. Comparative gene expression profiling in three primary human cell lines after treatment with a novel inhibitor of Rho kinase or atorvastatin. Blood Coagul Fibrinolysis. 2008;19:709–718.

33. Mick VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, Thomas CP. The alpha-subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5’-flanking region of the gene. Mol Endocrinol. 2001;15:575–588.

34. Kobayashi M, Kawakami K. ATF-1CREB heterodimer is involved in con-stitutive expression of the housekeeping Na,K-ATPase alpha 1 subunit gene. Nucleic Acids Res. 1995;23:2848–2855.

35. Messeguer X, Escudero R, Farré D, Núñez O, Martínez J, Albà MM. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics. 2002;18:333–334.

36. Staub O, Gautschi I, Ishikawa T, Breitschopf K, Ciechanover A, Schild L, Rotin D. Regulation of stability and function of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J. 1997;16:6325–6336.

37. Zippin JH, Chadwick PA, Levin LR, Buck J, Magro CM. Soluble adenylyl cyclase defines a nuclear cAMP microdomain in keratinocyte hyperprolif-erative skin diseases. J Invest Dermatol. 2010;130:1279–1287.

38. Xu WM, Chen J, Chen H, Diao RY, Fok KL, Dong JD, Sun TT, Chen WY, Yu MK, Zhang, XH, Tsang LL, Lau A, Shi QX, Shi QH, Huang PB, Chan HC. Defective CFTR-dependent CREB activation results in impaired spermatogenesis and azoospermia. PLoS One. 2011;6:e19120.

39. Flacke JP, Flacke H, Appukuttan A, Palisaar RJ, Noldus J, Robinson BD, Reusch HP, Zippin JH, Ladilov Y. Type 10 soluble adenylyl cyclase is overexpressed in prostate carcinoma and controls proliferation of prostate cancer cells. J Biol Chem. 2013;288:3126–3135.

40. Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, Kamenetsky M, Miyamoto C, Zippin JH, Kopf GS, Suarez SS, Levin LR, Williams CJ, Buck J, Moss SB. The “soluble” adenylyl cyclase in sperm medi-ates multiple signaling events required for fertilization. Dev Cell. 2005;9:249–259.

41. Johannessen M, Moens U. Multisite phosphorylation of the cAMP response element-binding protein (CREB) by a diversity of protein kinases. Front Biosci. 2007;12:1814–1832.

42. Dash PK, Karl KA, Colicos MA, Prywes R, Kandel ER. cAMP response element-binding protein is activated by Ca2+/calmodulin- as





well as cAMP-dependent protein kinase. Proc Natl Acad Sci U S A. 1991;88:5061–5065.

43. Pilz RB, Casteel DE. Regulation of gene expression by cyclic GMP. Circ Res. 2003;93:1034–1046.

44. Sauzeau V, Rolli-Derkinderen M, Marionneau C, Loirand G, Pacaud P. RhoA expression is controlled by nitric oxide through cGMP-dependent protein kinase activation. J Biol Chem. 2003;278:9472–9480.

45. Taddei S, Ghiadoni L. Phosphodiesterase 5 inhibition to treat essen-tial hypertension: is this the beginning of the story? Hypertension. 2006;48:546–548.

46. Verhovez A, Williams TA, Morello F, Monticone S, Brizzi MF, Dentelli P, Fallo F, Fabris B, Amenta F, Gomez-Sanchez C, Veglio F, Mulatero P. Aldosterone does not modify gene expression in human ECs. Horm Metab Res. 2012;44:234–238.

What Is New?•Soluble adenylyl cyclase (sAC) regulates expression of genes involved in

endothelial stiffness.• sAC inhibition results in endothelial softening.

What Is Relevant?•Our findings identify a potential mechanism by which endothelial sAC

affects vascular elasticity.

SummaryWe illustrate a mechanism by which sAC affects endothelial stiffness. sAC is involved in expression regulation of aldosterone-sensitive genes SCNN1A, ATP1A1, ATP1B1, and NR3C2. Dysregulation of sAC seems to play a role in arterial stiffness.

Novelty and Significance




1

Soluble adenylyl cyclase in vascular endothelium: gene expression control of ENaC-α, Na+/K+-ATPase-α/β and

mineralocorticoid receptor

Boris Schmitz1,2*, Johanna Nedele1*, Katrin Guske1, Martina Maase3, Malte Lenders1, Michael Schelleckes1, Kristina Kusche-Vihrog3, Stefan-Martin Brand2

and Eva Brand1

*contributed equally

1Internal Medicine D, Department of Nephrology, Hypertension and Rheumatology, University Hospital Muenster, Muenster, Germany

2Institute of Sports Medicine, Molecular Genetics of Cardiovascular Disease, University Hospital Muenster, Muenster, Germany

3Institute of Physiology II, University of Muenster, Muenster, Germany

Running title: Soluble adenylyl cyclase in endothelium

Corresponding author: Univ.-Prof. Dr. Dr. med. Eva Brand, MD, PhD University Hospital Muenster Internal Medicine D Nephrology, Hypertension and Rheumatology Albert-Schweitzer-Campus 1 D-48149 Muenster phone: +49/251/ 83-48746 fax: +49/251/ 83-46979 email: [email protected]

2

Online Data Supplement Supplemental methods

Transient transfections and siRNA experiments

EA.hy926 and IHKE cells were transfected using Nanofectin (PAA) or jetPEI (PolyPlus-

Transfection, Illkirch Cedex, France). The CRE reporter plasmid (pADneo2-C6-BGL)

comprised six CRE promoter elements 5' to the firefly luciferase gene,1 the GRE reporter

plasmid (TAT3-Luc) three GRE promoter elements 5' to the firefly luciferase gene.2

Transfection experiments were repeated at least two times in triplicates. sAC knockdown was

performed by application of sAC-specific or scrambled siRNA (5 µM for 48h or 125 and 250

nM for 72h; Life Technologies, Darmstadt, Germany) using Oligofectamine (Invitrogen,

Karlsruhe, Germany) in EA.hy926 and jetPRIME (PolyPlus) in IHKE cells. Transfection

experiments were repeated at least three times in triplicates.

Real-time PCR

Total RNA was extracted using the NucleoSpin RNA II Extraction Kit (Macherey-Nagel,

Düren, Germany). cDNA, generated from 1 µg of total RNA by Mul-V (Fermentas, St. Leon-

Rot), was amplified in a 384-well format (standard real-time PCR conditions) in duplicates

using Power SYBR Green (Applied Biosystem, Carlsbad, USA) on an Applied Biosystems

7500 Fast real-time PCR system. Relative quantification was calculated using the ΔΔCt

method and GAPDH as endogenous control. The absence of non-specific amplification

products was confirmed by agarose gel electrophoresis and generation of melting curves using

the Applied Biosystems software. Oligonucleotides had an amplification efficiency of ≥90%

(supplemental table S1).

Preparation of nuclear protein extracts

In brief, cells were resuspended in a “low salt” buffer (10 mM HEPES pH 7.9, 10 mM KCl,

1 mM DTT, 1.5 mM MgCl2, ‘Complete’ protease inhibitor cocktail; Roche, Mannheim,

3

Germany), lysed by addition of 0.05% NP40 and centrifuged. Intact nuclei were incubated in

“high salt” buffer (20 mM HEPES pH 7.9, 0.2 mM EDTA, 1 mM DTT, 420 mM NaCl,

1.5 mM MgCl2, 0.5 mM PMSF, Roche ‘Complete’, 25% glycerol) and proteins were

harvested by centrifugation.

Western blot

For crude extracts, cells were lysed in RIPA buffer containing 1% NP40 and 0.1% SDS

supplemented with ‘PhosSTOP’ Phosphatase Inhibitor Cocktail (Roche). Immunodetection

was performed using an anti-sAC (Deciphergen Biosystems, Fremont, USA; 1:1000), anti-

CREB (Cell Signaling, Frankfurt, Germany; 1:1000), anti-phosphoCREB (Nanotools,

Teningen, Germany; 1:1000), anti-ENaC-α (Santa Cruz, Heidelberg, Germany; 1:500), anti-

Na+/K+-ATPase-α (Santa Cruz; 1:1000) and anti-mouse (GE Healthcare, Buckinghamshire,

UK; 1:1000 - 1:10000), or anti-rabbit (GE Healthcare; 1:5000), or anti-goat (GE Healthcare;

1:20000) antibody, respectively. Sample loading was confirmed by β-actin detection (Cell

Signaling; 1:5000; anti-rabbit secondary antibody; 1:10000).

4

Supplemental references

1. Isaac RE, Johnson EC, Audsley N, Shirras AD. Metabolic inactivation of the circadian

transmitter, pigment dispersing factor (PDF), by neprilysin-like peptidases in

Drosophila. J Exp Biol. 2007;210:4465-4470.

2. Vivanco MD, Johnson R, Galante PE, Hanahan D, Yamamoto KR. A transition in

transcriptional activation by the glucocorticoid and retinoic acid receptors at the tumor

stage of dermal fibrosarcoma development. EMBO J. 1995;14:2217-2228.

3. Klok MD, Alt SR, Irurzun Lafitte AJ, Turner JD, Lakke EA, Huitinga I, Muller CP,

Zitman FG, de Kloet ER, Derijk RH. Decreased expression of mineralocorticoid

receptor mRNA and its splice variants in postmortem brain regions of patients with

major depressive disorder. J Psychiatr Res. 2011;45:871-878.

4. Murphy KT, Snow RJ, Petersen AC, Murphy RM, Mollica J, Lee JS, Garnham AP,

Aughey RJ, Leppik JA, Medved I, Cameron-Smith D, McKenna MJ. Intense exercise

up-regulates Na+,K+-ATPase isoform mRNA, but not protein expression in human

skeletal muscle. J Physiol. 2004;556:507-519.

5. Schmid A, Sutto Z, Nlend MC, Horvath G, Schmid N, Buck J, Levin LR, Conner GE,

Fregien N, Salathe M. Soluble adenylyl cyclase is localized to cilia and contributes to

ciliary beat frequency regulation via production of cAMP. J Gen Physiol.

2007;130:99-109.

6. Bangel N, Dahlhoff C, Sobczak K, Weber WM, Kusche-Vihrog K. Upregulated

expression of ENaC in human CF nasal epithelium. J Cyst Fibros. 2008;7:197-205.

5

Table S1

Supplemental Table S1: Sequences and positions of oligonucleotides used in this study

Description Sequence 5'-3' Position Reference/Acc.#

Oligonucleotides used in real-time PCR

NR3C2 SS CAGGTAGACGGCGAGAGA +324 Klok et al.,3 NM_000901.4

NR3C2 AS CCTGAGAAACTTGACCCCAC +416 Klok et al., NM_000901.4

ATP1A1 SS TGTCCAGAATTGCAGGTCTTTG +1600 Murphy et al.,4 NM_000701.7

ATP1A1 AS TGCCCGCTTAAGAATAGGTAGGT +1654 Murphy et al., NM_000701.7

ATP1B1 SS ACCAATCTTACCATGGACACTGAA +910 Murphy et al., NM_001677

ATP1B1 AS CGGTCTTTCTCACTGTACCCAAT +967 Murphy et al., NM_001677

ADCY10 SS CTGAGCAGTTGGTGGAGATCCTC +500 Schmid et al.,5 NM_018417

ADCY10 AS CAGCCAGTCCTATCTTGACTCGG +720 Schmid et , al. NM_018417

SCNN1A SS CCTCTGTCACGATGGTCACCCTCC +1907 Bangel et al.,6 NM_001038.5

SCNN1A AS CAGCAGGTCAAAGACGAGCTCAG +1997 Bangel et al., NM_001038.5

GAPDH SS CTGCACCACCAACTGCTTAGCAC +554 NM_002046.4

GAPDH AS CACCACCATGGAGAAGGCTGGGG +621 NM_002046.4

Oligonucleotides used for ChIP

SCNN1A_CRE SS AAGGCTTCCTGAGTCTCCTG -888 NC_000012.11

SCNN1A_CRE AS TTTAAAACGGACTTCTAACAAAAGTG -777 NC_000012.11

ATP1A1_CRE SS GCCGGTGTCAGGTTGCTC -97 NC_000001.10

ATP1A1_CRE AS CGCCTCCTCCTCACTTCC -21 NC_000001.10

6

Figure S1

Supplemental Figure S1: CREB phosphorylation is increased after 24h of sAC

inhibition

Inhibition of sAC by KH7 for 24h resulted in increased CREB phosphorylation (CREB-p) in

(A) EA.hy926 and (B) IHKE cells compared to control. Western blots are representative for

three independent experiments. Band intensities were analyzed by densitometric

quantification. Relative signal intensities are shown as standard deviation of the mean of three

independent densitometric measurements compared to β-actin loading control. *** p<0.001, *

p<0.05.

7

Figure S2

Supplemental Figure S2: sAC inhibition abrogates CRE- and GRE-mediated

transcriptional activity in the presence of aldosterone

(A, B) CRE-mediated transcriptional activity was inhibited by KH7 in the presence of

aldosterone in EA.hy926 and IHKE cells. Spironolactone (1 µM) did not affect CRE promoter

activity. (C, D) GRE-mediated transcriptional activity was activated by application of

aldosterone and dexamethasone in both cell lines. Treatment with KH7 and spironolactone (1

µM) prevented GRE promoter activation by aldosterone. Cell lines were treated with

KH7/spironolactone and aldosterone (or dexamethasone, 50 µM) or DMSO/ethanol (control)

starting 4h after reporter vector transfection for 24h. In combination with aldosterone (or

dexamethasone, 50 µM), KH7/spironolactone was administered 15 min prior to aldosterone.

Transfections are representative for three independent experiments. Transcriptional activity

was assessed as relative light units (RLU). *** p<0.001, ** p<0.01, * p<0.05.

8

Figure S3

Supplemental Figure S3: ENaC-α and Na+/K+-ATPase-α protein levels are reduced by

sAC inhibition

(A) Inhibition of sAC by KH7 for 24h reduced cellular levels of active ENaC-α protein (band

a) in EA.hy926 cells significantly compared to control (DMSO). No difference was observed

for glycosylated ENaC-α (band g) or ubiquitinylated ENaC-α (band u). (B) In IHKE cells,

inhibition of sAC by KH7 for 24h resulted in a significant reduction of active ENaC-α (band

a) and glycosylated ENaC-α (band g), while ubiquitinylated ENaC-α (band u) was not

reduced. (C, D) Na+/K+-ATPase-α protein levels were significantly reduced in both cell lines

after inhibition of sAC by KH7 for 24h. Western blots are representative for three

independent experiments. Relative band intensities are shown as mean ± SEM of

densitometric measurements (24h KH7) compared to β-actin loading control of three

independent blots. *** p<0.001, * p<0.05.

9

Figure S4

control KH7

Cor

tical

stiff

ness

(pN

/nm

)

0.6

0.8

1.0

1.2

1.4

1.6 *

Supplemental Figure S4: Inhibition of sAC reduces endothelial stiffness

Treatment of ECs with KH7 for 24h resulted in a significant endothelial softening compared

to control conditions (control: 0.98 ± 0.012 pN/nm, n=148; KH7: 0.90 ± 0.011 pN/nm,

n=117). AFM measurements were repeated in three independent experimental settings. *

p<0.05.

10

Figure S5

nuclearcellular nuclear

MR

ß-actin

IHKE EA.hy926

Supplemental Figure S5: Nuclear localization of the mineralocorticoid receptor (MR) in

IHKE and EA.hy926 cells

The MR was detected by western blot analysis in nuclear extracts of IHKE and EA.hy926

cells under basic conditions. Western blots are representative for three independent

experiments. β-actin served as gel loading control.

Documents

document