2014 - Infectious Hypodermal and Hematopoietic Necrosis Virus From BrazilSequencing, Comparative Analysis and PCR Detection

8/9/2019 2014 - Infectious Hypodermal and Hematopoietic Necrosis Virus From BrazilSequencing, Comparative Analysis and …

1/11

Virus Research 189 (2014) 136–146

Contents lists available at ScienceDirect

Virus Research

journa l homepage: www.elsevier .com/ locate /v i rusres

Infectious hypodermal and hematopoietic necrosis virus from Brazil:Sequencing, comparative analysis and PCR detection

Douglas C.D. Silvaa, Allan R.D. Nunesa, Dárlio I.A. Teixeirac, João Paulo M.S. Lima b,d,Daniel C.F. Lanzaa,∗

a Laboratório de Biologia Molecular Aplicada – LAPLIC, Departamento de Bioquímica, Universidade Federal do Rio Grande do Norte, Natal, RN, Brazilb Laboratório de Glicobiologia Molecular, Departamento de Bioquímica, Universidade Federal do RioGrandedo Norte,Natal, Brazilc EscolaAgrícola de Jundiaí, Universidade Federal do RioGrande do Norte, Brazild Programa de Pós-Graduação em Bioquímica, Universidade Federal do RioGrande do Norte, Natal, RN, Brazil

a r t i c l e i n f o

Article history:

Received 15 January 2014Received in revised form 7 May2014Accepted 11May2014Available online 24May2014

Keywords:

Shrimp nanismWhite Spot SyndromePenaeus stitlirostris densovirusBrevidensovirus

a b s t r a c t

A 3739 nucleotide fragment of Infectious hypodermal and hematopoietic necrosis virus (IHHNV) fromBrazil was amplified and sequenced. This fragment contains the entire coding sequences of viral pro-teins, the full 3 untranslated region (3UTR) and a partial sequence of 5 untranslated region (5UTR). Thegenome organization of IHHNV revealed the three typical major coding domains: a left ORF1 of 2001bpthat codes NS1, a left ORF2 (NS2) of 1091bp that codes NS2 and a right ORF3 of 990bp that codes VP.Nucleotide and amino acid sequences of the three viral proteins were compared with putative aminoacid sequences of viruses reported from different regions. Comparisons among genomes from differ-ent geographic locations reveal 31 nucleotide regions that are 100% similar, distributed throughout thegenome. An analysis of secondary structure of UTR regions, revealed regions with high probability toform hairpins, that may be involved in mechanisms of viral replication. Additionally, a maximum likeli-hood analysis indicates that Brazilian IHHNV belongs to lineage III, in the infectious IHHNV group, and isclustered with IHHNV isolates from Hawaii, China, Taiwan, Vietnam and South Korea. A new nested PCR targeting conserved nucleotide regions is proposed to detect IHHNV.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Infectious hypodermal and hematopoietic necrosis virus(IHHNV) is one of the viral pathogens of penaeid shrimps mostrecurrent in the world (Lightner, 2011;Vega-Heredia et al., 2012).The disease IHHN and its causative agent, IHHNV, were firstdescribed in the early 1980s, as the cause of acute epizootics andmass mortality in blue shrimp (Litopenaeus stylirostris) farmed insuper intensive raceway systems in Hawaii, causing acute epi-zootics and mass mortalities (Brock et al., 1983; Lightner, 1983,1988). After its discovery, IHHNV was found to be widely dis-tributed in cultured shrimp in North, South, and Central America,CaribbeanandtheIndo-Pacific( Lightner,2011;Vega-Heredia et al.,

∗ Corresponding author at: Laboratório de Biologia Molecular Aplicada – LAPLIC,Departamento de Bioquímica, Centro de Biociências, Universidade Federal do RioGrandedo Norte, CEP: 59072-970Natal, RN, Brazil. Tel.: +5584 3215 3416;fax: +55 84 32153415.

E-mail addresses:[email protected],[email protected] (D.C.F. Lanza).

2012). In Brazil, the first official report of IHHN occurrence was in2009, at the Bahia state and subsequent studies have confirmedtheIHHNVpresenceinother statesfromBrazilianNortheast region(Trindade et al., 2009; Braz et al., 2009;Teixeira-Lopes et al., 2011).Theprevalence of IHHNVhasbeen also reported inother regions of theworld, such as China, India andAustralia. PhylogeneticanalysissuggeststhatAmericanIHHNVwasintroducedfromthePhilippines(Tang et al., 2003; Krabsetsve et al., 2004;Tang andLightner, 2006)andthat IndianIHHNVis originated fromSouth-EastAsia (Raietal.,2009).The typical manifestation of IHHNV-induced disease in Litope-

naeus vannamei includes growth retardation and runt deformitysyndrome,which is characterized by cuticular deformities as bentrostrum, blistered cuticle, abdominal anomalies and curly anten-nae (Kalagayan et al., 1991; Browdy et al., 1993). IHHNV causedhighmortality rates in L. stylirostris some years after itsemergency,but this species has acquired tolerance to infection (Morales-Covarrubias et al., 1999; Tang and Lightner, 2002). Although L.vannamei and Penaeus monodon do not show significant mortal-ity rates caused by IHHNV infection, the economic and productionlosses are noteworthy, mainly due to the reduced and irregular

http://dx.doi.org/10.1016/j.virusres.2014.05.0080168-1702/©2014 Elsevier B.V.All rights reserved.

http://localhost/var/www/apps/conversion/tmp/scratch_3/dx.doi.org/10.1016/j.virusres.2014.05.008http://www.sciencedirect.com/science/journal/01681702http://www.elsevier.com/locate/virusresmailto:[email protected]:[email protected]://localhost/var/www/apps/conversion/tmp/scratch_3/dx.doi.org/10.1016/j.virusres.2014.05.008http://localhost/var/www/apps/conversion/tmp/scratch_3/dx.doi.org/10.1016/j.virusres.2014.05.008mailto:[email protected]:[email protected]://crossmark.crossref.org/dialog/?doi=10.1016/j.virusres.2014.05.008&domain=pdfhttp://www.elsevier.com/locate/virusreshttp://www.sciencedirect.com/science/journal/01681702http://localhost/var/www/apps/conversion/tmp/scratch_3/dx.doi.org/10.1016/j.virusres.2014.05.008


2/11

D.C.D.Silva et al./ Virus Research 189 (2014) 136–146 137

growth which results in small sized shrimps at harvest (Bell andLightner, 1984; Kalagayan et al., 1991; Primavera and Quinitio,2000).IHHNVwasclassifiedas Penaeusstylirostrisdensovirus (PstDNV)

in the family Parvoviridae, sub-family Densovirinae (Fauquet et al.,2005). It is the smallest penaeid shrimp virus, with nonenvelopedand icosaedral virions averaging 22–23nm in diameter and con-taining linear single stranded DNA of ∼3.9kb in length (Shikeet al., 2000; Rai et al., 2011; Kim et al., 2012). IHHNV genomeis comprised of 3 large open reading frames, the left ORFs 1 and2 that codifies non structural proteins and the right OFR 3 thatcodifies the viral capsid protein (Mari et al., 1993; Shike et al.,2000). To date, eight complete genome sequences of IHHNV areavailable in GenBank. Two sequences correspond to isolates fromAmerican continent, one complete genome from Hawaii (Acces-sion No. AF218266; 3909bp), and a complete coding sequence(CDS) of a Mexican isolate (GenBank Accession No. AF273215;3873bp). Genomes and complete coding sequences from otherparts of the globe such as China, India, Korea, Vietnam, Taiwan,Thailand, Philippines and Indonesia are also available. Two non-infectious related IHHNVsequencesdesignedas Type A andType Bweredetectedin P.monodon.TheTypeAwasfoundinsamplesfromMadagascar andAustralia andtheType Bwasdetected in Tanzania(Tang et al., 2003;Krabsetsveet al., 2004;TangandLightner, 2006).Both virus-related A and B types contain the three ORFs and typi-cal regulatory elements of IHHNV and show significant divergencewhen comparedwith theinfectious species (Tang et al., 2003; Tang& Lightner, 2006).IHHNV related sequencesmaybe integrated into thegenomeof

P. monodon as previously reported in shrimp samples from Africa,Australia and India (Tang and Lightner, 2006; Rai et al., 2009). Dueto thesefindings newtargets forPCRdetection hasbeen selected inIHHNV genome, to avoid the viral regions integrated into the hostgenome,orinordertodetectanintegratedpartofthevirusgenomeinto the host genome (Tang et al., 2007; Rai et al., 2009).In the present study we sequenced a 3739 nucleotide frag-

ment of a Brazilian IHHNV detected in L. vannamei samples, and

compared this sequencewith genomes andCDSs available in Gen-Bank. Thereafter, conserved nucleotide sequences and putativeDNA secondary structures in IHHNV genome were observed andphylogenetic relationships between IHHNV isolates fromdifferentgeographic regions were inferred. In addition, a newnestedPCRtoIHHNVdetection is proposed.

2. Materials and methods

2.1. Sample isolation and DNA extraction

Sub-adult shrimps L. vannamei (Boone, 1931) presenting viraldisease symptomswere sampled from one shrimp farm located inthe state of Rio GrandedoNorte, Brazil. The samples were cleanedto avoid anyexternal contaminations andkept under refrigeration(−20 ◦C), until DNA extraction.DNA was extracted from 50mg of muscular tissue extracted

from the third abdominal segment of frozen shrimp. Tissues sam-ples were cut and immediately transferred to a buffer containingproteinase K, according to specifications ofNucleoSpin® Tissuekit.After purification, DNA was eluted using EBbuffer (5mM Tris/HCl,pH 8.5) and quantified using a NanoDrop 2000 Spectrophotometer(Thermo Fisher Scientific).

2.2. Detection and sequencing of Brazilian IHHNV

First, IHHNV was detected using primers PF3 and PR3 specif-

ically designed for the present study. All sequences of primers

Table 1

Primers designed in this study to IHHNV genomeamplification.

Primername Primersequence(5–3) Amplicon size Tm (◦C)

PF1 ATGTCAACGGACAGTGTCAACACTG 662pb 63.63PR1 AATAAAGTCGGGTTGTGTTCCGCTA 62.76PF2 GAAATAAAAGAACCAGAAACTCCA 606pb 55.55PR2 TCATATATGGACATGGTCCGTCTA 58.42PF3 ATATCAAGAGATGGATACTCTATCT 588pb 53.95PR3 TAAGAGATTTTCCTGTTCCTGT 54.73

PF4 CCAACAACGACATCCGTGTACCAG 638pb 63.88PR4 TCGTCTTCATTATGTGCATCCCTCC 62.70PF5 ATCACCAGCGACGACTTCCTAGG 663pb 63.90PR5 CCAAATTGTTGGATTGGGTCTTCAT 60.28PF6 AAGGATACTACTGGACTACATAATC 415pb 55.23PR6 GGAAGAAGTCGGCTTGTACTCT 59.77PUTF1 GACGAGTGAAGAGGCTATTCCAAGT 594pb 62.35PUTR1 CTTGGAGAAATTCCCTGGCTGGAGT 64.56PUTF2 TTGGAAACCTAGTCTACCCAGC 574pb 59.43PUTR2 CAGAAACCGTTAACTTAATATGTGA 55.68

designedforthisstudyaredescribedinTable1. ThePCRwascarriedout in a 20L reaction, containing ∼1g of total extracted DNA,5pmolofeachprimer,4mMMgCl2,0.5UofTthDNApol(Biotools),

and 200M of each dNTP. Amplification was performed using aLife Touch Thermal Cycler TC-96 (BIOER) and the followingcyclingparameters: initial denaturation at 94 ◦C for 3min, followed by 40cycles of 94◦C for 1min, 55 ◦C for 1min, and 72 ◦C for 2min, anda final extension at 72◦C for 5min. After amplification, aliquots of thePCRproductswereanalyzedina1.0or1.5%agarosegelsstainedwith ethidiumbromide and then photographed.The genome sequencing was performed from the amplicons

generated using primers described in Table 1 and the follow-ing cycle parameters: at 94 ◦C for 3min, followed by 40 cyclesof 94 ◦C for 1min, 59 ◦C for 1min, and 72 ◦C for 2min, and afinal extension at 72 ◦C for 5min. The amplicons of coding andnoncoding regions were purified and submitted to sequencingusing the Applied Biosystems® 3500 Genetic Analyzer plat-

form, according to manufacturers specifications. All ampliconswere sequenced at least twice (forward and reverse), assem-bled using basecall quality values and validated using pre-definedparameters of Geneious software (Geneious version 7.0 Biomat-ters. Available from http://www.geneious.com/) and careful visualinspection.

2.3. Sequence analysis and alignment

The characterization of Brazilian IHHNV and the first com-parative analysis with other sequences available in GenBankwas performed using Basic Local Alignment Search Tool (BLAST)(Altschul et al., 1997) of the National Center for Biotechnol-

ogy Information (NCBI). The open reading frames (ORF) weredetermined using the ORF finder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Amino acid sequence prediction andcom-parative analysis between nucleotide and aminoacid sequenceswere performed using Geneious software (ver. 7.0, Biomat-ters). Multiple sequence alignment of coding IHHNV sequenceswas carried out using Muscle algorithm (Edgar, 2004) withdefault parameters in the Jalview software package Version 2.8(Waterhouse et al., 2009). The nucleotide regions conserved in allsequences were identified using the MEGA5 program Version 5.2(Tamura et al., 2011) and confirmed visually.Thenucleotide secondary structurewas predictedand theMin-

imum Free Energy models (MFE) were generated by RNAfold(Gruber et al., 2008), using DNA parameters and rescaling the

energy parameters to a temperature of 28◦

C.

http://www.geneious.com/http://www.ncbi.nlm.nih.gov/gorf/gorf.htmlhttp://www.ncbi.nlm.nih.gov/gorf/gorf.htmlhttp://www.ncbi.nlm.nih.gov/gorf/gorf.htmlhttp://www.ncbi.nlm.nih.gov/gorf/gorf.htmlhttp://www.geneious.com/


3/11

138 D.C.D. Silva et al. / Virus Research 189 (2014) 136–146

2.4. Phylogenetic analysis

A phylogenetic tree was constructed from alignment of partialIHHNVsequencescomprisingORF1,ORF2andORF3codingregions,using Molecular Evolutionary Genetics Analysis MEGA5 programVersion 5.2 (Tamura et al., 2011). The phylogenetic reconstructionwas performed using the maximum likelihood discrete method.The model HKY (Hasegawa et al., 1985) was selected after a best-fit nucleotidesubstitutionmodel analysis, usingestimatedgammaparameter(+G).Bothmodeltestsandphylogenetictreereconstruc-tion were carried out using complete deletion for gaps and verystrong branch swap filter. The horizontal branch lengths are pro-portional to nucleotide substitution rates, and numbers shown atbranchpointindicate1000bootstrapvalues,whichdeterminedtheconfidence indices within the tree.

2.5. Nested PCR and serial dilution test

Total DNA extracted from a shrimp sample positive for IHHNVwas subjected to a serial dilution by a factor of 5. The first PCR reactionwas performed using the PF3 and PR3 primers and 125ngof total DNA. After the first reaction, each of seven reaction prod-

ucts were used as templates in the nested PCR, in which wereused primers PF3 and PR2. The following cycle parameters wereused in the two steps: 94 ◦C for 3min, followed by 40 cycles of 94 ◦C for 1min, 59 ◦C for 1min, and 72 ◦C for 2min, and a finalextension at 72 ◦C for 5min. The amplification productswere ana-lyzed on agarose gels ordered from lowest to highest dilution. Apositive control containing total DNA from a shrimp positive toIHHNV and a negative control containing total DNA from a noninfectedshrimpwere insertedin thefirstandsecondsteps.An addi-tional positive control using decapods specific primers preconizedby OIE, (143F 5-TGCCTTATCAGCTNTCGATTGTAG-3 and 145R 5-TTCAGNTTTGCAACCATACTTCCC-3) yielding an 848bp ampliconwas used to verify the quality of the extracted DNA.

3. Results and discussion

3.1. Viral genome amplification

Initially, 21 sequences available in GenBank (Table 2) corre-sponding to the complete genomes or coding sequences of IHHNVwerealigned. A set of primers that anneal in regions with low vari-ability interspaced in IHHNV genome were designed to amplifyBrazilianIHHNV. Each primerused andits respective ampliconsizeand melting temperature are detailed in Table 1. After amplifica-tion, the eight generated amplicons were sequenced and entiresequences were assembled from the overlapping regions in eachamplicon.

3.2. Nucleic acid analysis and genomic organization of BrazilianIHHNV

The sequence of Brazilian IHHNV is composed of 3739nt andcomprise all coding regions, the major part of 5 UTR (lack-ing ∼160 nucleotides at 5 end that were not sequenced in thisstudy), and the entire 3 UTR region. The sequence are shownin Fig. 1 and had a base composition of 36.7% A, 23.9% C, 18.8%G and 20.6% T and the G+C and A+T content was calculated tobe 42.7% and 57.3%, respectively. The Brazilian IHHNV sequenceshared 99.7% similarity with the genome from Hawaii (Gen-Bank Accession No. AF218266.2) and 99.6% similarity with IHHNVgenomes from Taiwan and Ecuador (GenBank Accession num-bersAY355306and AY362548, respectively). The lowest similarity,

(85.7%)wasobserved to theAustralian isolate (GenBank Accession

EU675312). Additional nucleic acid similarity values of Brazil-ian IHHNV sequence with other partial and complete genomesequences reported so far are detailed in Table 2. The sequenceof Brazilian IHHNV is highly similar (>99.2%) to sequences thatwerereportedasmembersofaninfectiousgroup,includingisolatesfrom Taiwan (AY355306), Ecuador AY362548, China (EF633688and JX258653), México (AF273215) and South Korea (JN377975)(Lightner,2011;Kimet al., 2011). A comparison ofBrazilianIHHNVisolate with non-infectious IHHNV gave 86.0% similarity withType A sequence (GenBank Accession No. DQ228358) and 91.3%with Type B sequence from East Africa (GenBank Accession No.AY124937).Theprediction of coding regions of Brazilian IHHNV reveals the

three typical major coding domains identified in other IHHNV iso-lates:themiddleORF1thatcodesthenonstructuralprotein1(NS1)of 2001nt, a leftORF2 that codes the nonstructural protein 2 (NS2)of 1092nt and a right ORF3 that codes de capsid protein of IHHNV(VP) of 990nt. ORFs and its predicted amino acid sequences arerepresented in Fig. 1. The ORF2 and ORF3 are in the same readingframe and theORF1starts57 ntafter the firstnucleotideof ORF2, ina different reading frame. The organization of theBrazilian IHHNVgenome is schematized in Fig. 2, which shows the 5 and 3 UTR regions andthe codingregions composedbythethreetypicalORFs.The 162nt fragment belonging to5 UTRwhichwas not sequencedin this study is represented by a squarewith dotted line.A searchofnucleotide conservedregions in IHHNVgenomewas

performed in order to identify possible sites of genomic stability,which areoften associatedwith viral infectionandreplicationpro-cesses in different viruses (Wang et al., 2009; Kraft et al., 2013;Pollom et al., 2013). These regions are also ideal to PCR target-ing especially in cases such as IHHNV which has a large numberof variants. An alignment of the distinct IHHNV sequences avail-able in GenBank (Table 2), including Brazilian isolate, reveals 31regions of at least 14nt in length, that are 100% conserved in allviruses (Fig. 1). The first conserved region fromthe 5end of IHHNVgenome was named as conserved region 1 (CR1) and the subse-quent regions identifiedwere numbered accordingly (Fig. 1). Only

3 of the31 identifiedconservedregions areoutside codingregions.It is interesting to note that some conserved regions correspond toconserved domains of viral proteins and regulatory regions in thegenome, while others are in regions that do not encode structuredproteindomains.Thesepoints arediscussedin thefollowingtopics.

3.3. ORF1 and non structural protein 1 (NS1)

TheORF1 starts at nucleotide 488and terminates at nucleotide2488at a TAA codon. It encodes NS1 that contains 666 amino acidsand a molecular weight of 75,765kDa. The nucleotide sequencesimilarity of ORF1 of IHHNV from Brazil comparing it with ORF1sequences available in the GenBank are given in Table 2. As pre-viously observed in virus from other geographic locations, the

Brazilian IHHNV NS1 contains the replication initiatormotif com-mon to all parvoviruses located between aa 258 and 315, and astretch of conservedaa sequence characteristic of theNTP-bindingand helicase domains, shared by all parvoviruses located betweenaa 480 and 579 (Afanasiev et al., 1991; Boublik et al., 1994; Shikeet al.,2000;Rai et al., 2011). Thereplication initiatormotifsandtheNTP-binding/helicase domains in Brazilian IHHNVNS1 show 100%identitywith all IHHNV isolates.The estimated NS1 amino acid sequence was compared with

putative amino acid sequences predicted from sequences avail-able in Genbank and the similarities are listed in Table 2. The NS1amino acid sequence of the Brazilian IHHNV shows high similar-itywithHawaii (AF218266.2)andTaiwan (AY355306) isolates. ThepredictedaminoacidsequenceofORF1 showedonlytwosubstitut-

ions in comparisonwith Hawaii isolate: a change from aspartateto


4/11


Fig. 1. Nucleotide sequence of partial Brazilian IHHNV genome. Putative aminoacid sequences of ORF1, ORF2 andORF3 are shown above the sequence. The putative startand stop codonscorrespondent to each ORFare in gray. Theputative transcription initiation signals (CA) andpolyadenilation signals (ATAAA) areunderlined. The regionof P61 promoter is in bold. Conserved regions (CRs) are highlighted in black. CR3 and CR26 include the start codons of ORF1 andORF3 respectively, andCR30 includes ORF3stop codon. Conserved domains of proteins coded by ORF1 andORF3 arehighlighted in gray, in their respective aminoacid sequences.


5/11


Fig. 1. (Continued )

asparagine atpositions168and 461. Thecomparison to theTaiwanisolate reveals one substitution at the site 160, from asparagine tothreonine, and a substitution from aspartate to asparagine at site168.The nucleotide sequence of the ORF1 presents 24 conserved

regions (CR3–CR26) and some of these regions comprise sites of known importance in viral replication (Fig. 1). It is interesting,though expected, to note that some conserved regions correspondto segments where ORFs overlapping occurs, particularly the onesnext to start codons. The CR3 is located at the intersection point

between ORFs 1 and 2, covering the initiation codon of NS1 and

the CR26 begins at the start codon of capsid protein. The CR16 andCR18 are inside the coding region of the rolling-circle replicationmotifs I and II and CR23 and CR24 corresponds to a part of codingsequence ofNTP-biding andhelicasedomains. TheCR25 comprisespart ofoneIHHNVpromoterregion,describedby Dharetal.(2001).

3.4. ORF2 and non-structural protein 2 (NS2)

TheORF2 starts at nucleotide 432and terminates at nucleotide1523 at a TAG codon, thus, only the 56 first nucleotides of ORF2

does not overlap with ORF1. ORF2 encodes a protein containing


6/11


Fig. 1. (Continued )

363 amino acid residues, and a molecular weight of 42,076kDa. Acomparison of nucleotide and predicted amino acid sequence of Brazilian IHHNV NS2 with all other predicted sequences of NS2

available in GenBank are shown in Table 2. The predicted aminoacid sequence of NS2 from Brazilian IHHNV had only one substi-tution, from arginine to lysine at site 240, when compared to the

Hawaii isolate. The same substitution at site 240 and other fromthreonine to proline is observed when Brazilian IHHNV ORF2 iscomparedwithNS2 of Taiwan isolate. ORFs 1 and 2 share eighteen

conserved regions (CR3–CR20). Until now, there is no informationabout theNS2 function and about thepossible functional domainsof this protein.

Table 2

Comparison of nucleotide andpredictedaminoacidsequences of Brazilian IHHNV andother IHHNV sequences available in GenBank.

Country/isolate GenBank no Genome identity (%) Nucleotide identity (%) Amino acid identity (%)

ORF1 ORF2 ORF3 ORF1 ORF2 ORF3

Hawaiia AF218266 99.7 99.7 99.7 99.7 99.6 99.5 99.4Taiwan A AY355306 99.6 99.8 99.6 99.7 99.4 99.2 99.7Taiwan C AY355308 99.6 99.8 99.6 99.6 99.4 99.2 99.4Ecuador AY362548 99.6 99.8 99.7 99.4 99.4 99.5 98.8

Chinaa

EF633688 99.5 99.6 99.5 99.7 99.3 99.2 99.7México AF273215 99.4 99.6 99.6 99.3 99.1 99.5 98.5Chinaa JX258653 99.1 99.5 99.5 99.5 99.1 98.9 99.1South Koreaa JN377975 99.3 99.4 99.4 99.3 99 98.9 98.5Chinaa KF214742 99.3 99.3 99.1 99.1 98.4 97.8 98.5Vietnama JX840067 98.6 99.4 99.1 99.2 98.4 98.6 98.2Vietnam KC513422 95.8 96.7 97.3 95.5 96.3 95.9 96.7Thailand AY362547 95.6 97 97.6 94.9 96.7 97 96.7Taiwan B AY355307 95.6 96.7 97.4 95.2 96.6 96.4 97Thailand AY102034 95.7 96.6 97.3 95.3 96.3 95.9 97Vietnam JN616415 95.6 94.6 96.8 97.2 84.2 88.6 98.8Vietnama KF031144 95.6 96.3 96.8 95.2 95.7 95.3 96.7Austrália GQ475529 95.3 95.1 97.5 95.5 97 96.2 97.3Índiaa GQ411199 93.5 96.2 97 93.5 87.6 95.3 95.8East Africa AY124937 91.3 92.5 – 91.1 91.8 – 96.7Madagascar DQ228358 86.0 87.0 – 87.3 84.3 – 93.3Austrália EU675312 85.7 87.5 89.3 87.2 69.5 86 93

a

Complete genomes.


7/11


|

432

|

488

ORF2

ORF1

ORF3

|

3.739|

1|

2.488

|

1.523

|

2.430|

3.419

5’UTR 3’UTR

Fig. 2. Genomic organizationof Brazilian IHHNVgenome. ThePlus strandof the3739nt sequencethat wassequenced in this study is represented by therectangle. Regions

of ORF1, ORF2 andORF3 are represented by keys andfirst andlast nucleotides of each ORFarerepresentedby numbers.Untranslated regions (UTRs)are shown in gray. Thedottedsquare corresponds to the5 UTR fragment that possibly existsin Brazilian IHHNV genome butwas not sequenced in this study.

3.5. ORF3 and viral capsid protein (VP)

The ORF3 is in the same reading frame as the ORF2: startsat nucletoide 2430 and terminates at nucleotide 3419 at a TAAcodon, and have a region of 59 nucleotides overlapping ORF1 end.It encodes a viral capsidprotein of 329 amino acids, correspondingtoamolecularweight of37,429kDa.The similarity degreebetweennucleotide and predicted amino acid sequence of Brazilian IHHNVVP and all other IHHNV correspondent sequences available in theGenBank are shown in Table 2. The amino acid sequence of Brazil-ian IHHNV VP is identical to VP fromChina isolate and differs from

VPs from Hawaii and Taiwan isolates only by a substitution fromasparagine to glutamate at position 44.Probably, VP is the unique protein composing the IHHNV cap-

sid, and this feature is not observed in other parvoviruses. Thestructure of VP protein was resolved by X-ray crystallography andshows eight parvoviral conserved secondary elements that forma “jelly roll” barrel motif, similar to that found in many icosahed-ral viruses, including other parvoviruses (Kaufmann et al., 2010).These conserved secondary elements are highlighted in the aminoacid sequence showninFig.1. ItiscurioustonotethatonlyCR27,of the5 CRs identified inORF3, corresponds to a conservedsecondary

Fig. 3. Sequences of UTR regions, secondary structure bracket representation andminimum free energy(MFE)models of 5 UTRhairpin. 5 and 3 UTR sequencesof HawaiiIHHNVisolate (GenBankAccessionNo.AF218266.2)wereanalyzedusing thesoftwareRNAfold.(A) Theparenthesesbelowthe nucleotide sequencesindicatebasepairing anddots indicate unpairedregions in DNA secondarystructure.Hairpinswith thehighestprobabilityof occurrenceare highlighted in grayand conserved regionsarehighlightedin black.The 77nt sequence that is repeated in the5 and3 endsare underlined. (B)MFEmodel calculatedusing thefirst154 nucleotides that correspond to5end oftheplusstrand of Hawaii isolate. (C)MFEmodel calculated usingthe correspondent 154nucleotide sequence fromminus strandof Hawaii isolate. Thestructures B andC arecoloredaccording to base-pairing probabilities. Redcolor denotes thehigh probability andpurple denotes lowprobability of a given base is pairedor not. For unpaired regions the

color denotes theprobability of being unpaired.(For interpretation of thereferences to color in this figurelegend, thereader is referred to theweb version of thearticle.)


8/11


Brazilian_IHHNV

JX258653.1_China

KF214742.1_China

JN377975.1_South Corea

AY362548.1_Ecuador

JX840067.1_Vietnam

AF218266.2_Hawaii

AY355308.1_Taiwan

EF633688.1_China

AF273215.1_Mexico

GQ411199.1_India

AY362547.1_Thailand

JN616415.1_Vietnam

KC513422.1_Vietnam

AY102034.1_Thailand

AY355307.1_Taiwan B

KF031144.1_Vietnam

GQ475529.1_Australia

AY124937.1_East Africa

EU675312.1_Australia

DQ228358.1_Madagascar 100

100

80

77

48

85

99

100

76

100

56

55

39

35

59

0.02

LineageIII

LineageII

LineageI

Fig. 4. Pylogenetic tree of IHHNV strains based on partial genomes comprising the ORF1, ORF2 and ORF3 coding regions. The phylogenetic relationship was estimated bymaximum likelihood methodusingMEGA program. The infectious IHHNV strains were divided into three lineages,and theBrazilian IHHNV is clusteredin lineage III(blackarrow). Numbers indicate the percentages of bootstrap support from1000 replicates.

structure in VP, considering the crystal structure elucidated byKaufmann et al., 2010. Amore careful analysis shows that themostpart of CRs regions are inside the VP loops that are in most casesunstructured or dynamic regions. These regions do not encode astructured region of the protein, but are submitted to a selectionpressure equal to or greater than structured regions. Maybe, theabsence of a rigid protein structure promoting the conservation of the nucleotide sequence in some manner.

3.6. UTR regions

The 5 UTR nucleotide sequence of Brazilian IHHNV, contains431 nucleotides, 162 nucleotides less when compared to 5 UTR from Hawaii isolate. The 3 UTR from Brazilian isolate shows 320nucleotides,eight nucleotides absent in the3 endwhen comparedwith 3 UTR of Hawaii isolate. Disregarding the regions that areabsent in Brazilian IHHNV, the differences between UTR regionsfromBrazilandHawaiivirusesareatransitionfromguaninetoade-nineat site 151in 5 UTR and a transition fromadenine to guanineatsite27inthe3 UTR. The 5UTR and 3UTR from Brazilian IHHNVisolate presented here possibly are incomplete, since typical ele-ments previously reported such as TATA box, a palindromic regionandother regulatory elements, observed in thefirst nucleotides of 5 UTR were not detected (Shike et al., 2000; Rai et al., 2011).

Due to its high similarity with Brazilian IHHNV sequence, thecomplete 5 UTR and 3 UTR sequences from Hawaii isolate wereused to prospect secondary structures, which are necessary torolling hairpin replication observed in parvoviruses (Tattersall andWard, 1976; Cotmore and Tattersall, 2006; Li et al., 2012). Analyz-ing the minimum free energy (MFE) models of plus strand, severalregions with potential to form hairpins in the UTR regions wereidentified, as showed in bracket representation in Fig. 3A. Thehighest base pair probability scores were observed to tree hair-pins inside the 5 UTR sequence, the first, from the 5 extremity,which comprises theregion fromnucleotide 62–96, thesecondtheregion from nucleotide 293–320, and the last comprises theregionfrom nucleotide 386–412 (Fig. 3A). A more detailed examinationrevealed a sequence that is repeated, located in the first 77nt of 5

UTR and in the last 77nt of 3

UTR region, in the same orientation

in both extremities (Fig. 3A underlined region). Interestingly, ana-lyzing this repeated sequence fused to the next 77 nucleotides of the 5 UTR region, it was possible to detect a hairpin with highprobability or occurrence that is represented in Fig. 3B. This hair-pin is more probable when the corresponding sequence of minusstrand is used to generate the MFE model (Fig. 3C). Parvovirusesthat present 5 UTR and 3 UTR different ends, likeminute virus of mice, selectively encapsidates strands that are minus sense withrespect to transcription (Tattersall and Ward, 1976; Cotmore andTattersall, 2006). This predicted hairpin can be the starting point

for better understanding themechanisms of IHHNV replication.ThreeCRswere identifiedwithin UTRs: CR1and CR2are located

in the 5 UTR region and CR31 are located in the 3 UTR, as shownin Figs. 1 and3A. CR31are inside the repeated sequence and is oneof the largest conserved regions identified, with 30nt.

3.7. Phylogenetic analysis

A phylogenetic tree was constructed based on the alignmentof nucleotide coding IHHNV sequences available in GenBank,including Brazilian IHHNV (Fig. 4). The maximum likelihood treesuggest that the IHHNVs can be divided into two major groups,one group corresponds to a group of isolates that produce theinfection and other non-virulent group of IHHNV, according to

previously described by (Kim et al., 2012). Likewise, our resultssupport thedivisionof IHHNVinfectious groupin threedistinct lin-eages. The lineage III comprising viruses JX258653.1, KF214742.1, JN377975.1, AY362548.1, JX840067.1, AY355308.1, EF633688.1,AF273215.1 and the Brazilian IHHNV isolate. The lineage IIis composed by strains GQ411199.1, AY362547.1, JN616415.1,KC513422.1, AY102034.1, AY355307.1, KF031144.1, and the lin-eage I is composed uniquely by strain GQ475529.1 from Australia.This subdivisionwassupportedby very high bootstrapvalues, andindicatepotentialgenetic differencesbetweenlineages. Thenonin-fectious groupis composedof isolates fromAustralia (EU675312.1)andMadagascar (DQ228358.1).The three identified lineages are not limited to defined geo-

graphical areas, and more than one lineage may occur in the

same area. This observation corroborateswith several studies that


9/11


Fig.5. Semi-nestedPCR toIHHNVdetection.PrimersPF3/PR3wereusedin thefirstPCRand PF3/PR2 inthe nestedPCR.(A) FirstPCR step,usingtheDNA templatessubmittedto a serial dilution by a factor of 5. Lane 1, reactionwith undiluted template; lanes 2–7, reactions using templates submitted to a progressive serial dilution by a factor of 5(lane 2= lowest dilution;lane 7=highest dilution). The expected amplicon of first step has588 bp. (B)Nested reactionsusingfirst step reaction products as templates. Lane1, nestedPCR using theproduct of reaction 1 of first step as template;lanes2–7, nestedPCRs using theproductsof reactions2–7 of first step as templates, respectively. The153bp fragment indicatesthe positive result.M, DNAladder;N, negativecontrol;P, positive control. (C)DNA quality control usingdecapodspecific primers.DP,DNA shrimpsample used as positive control; DN, DNAshrimp sampleused as negative control.

demonstrate that the trade of breeding animals is one of the main

ways of virus dispersion (Lightner, 1988, 2011). Strains from EastAfrica (AY124937.1) andAustralia (GQ475529.1) can still preservecharacteristics of the primitive IHHNV. As indicated by the smallvariation in thesizes of thebranches insideeach lineage, themajorevents of differentiation may have occurred before the spread of the virus across the globe.

3.8. Detection of IHHNV using nested PCR

A newsemi nested PCR protocol to IHHNV detection with highsensitivity and low cost has been developed, using primers cor-responding to regions with little genetic variability that encodesreplication initiator motif and NTP-binding and helicase domainsin NS1. These new protocol comprises a set of tree primers PF3,

PR3 and PR2 (also used to genome sequencing, shown in Table 1)

that are used in two subsequent PCR reactions. In the first reac-

tion the primers PF3 and PR3 are usedand anampliconof 588bp isgenerated. In the second reaction primer PF3 is used with primerPR2, which aligns to an internal region of the amplicon gener-ated in the first reaction. The nested reaction generates a 153bpamplicon. This strategy allowed a significant increase in test sen-sitivity, according to demonstrated by a serial dilution in Fig. 5.The nested PCR increased the sensitivity of the test at least 5 timesand allowed a clear visualization of the positive result in reac-tions that were performed using 5ng of total DNA as template(Fig. 5B).The development of molecular markers to detect IHHNV is

complex. The mean rate of nucleotide substitution for IHHNV ishigh and comparable to that reported for RNA viruses (Robles-Sikisaka et al., 2010). Moreover, as observed here and in previous

studies, IHHNV lineages are not restricted to specific areas (Tang


10/11


Table 3

Some primers used to IHHNV identification available so far.

Primername Primersequence 5- 3a References

IHHNV392F GGGCGAACCAGAATCACTTA Tang etal. (2000)IHHNV392R ATCCGGAGGAATCTGATGTG77012F ATCGGTGCACTACTCGGA OIE (2000)77353R TCGTACTGGCTGTTCATC389F CGGAACACAACCCGACTTTA OIE (2003)389R GGCCAAGACCAAAATACGAA

IHHNV309F TCCAACACTTAGTCAAAACCAA Tang etal. (2007)IHHNV309R TGTCTGCTACGATGATTATCCAIHHNV648F GAACGGCTTTCGTATTTTGG Rai et al. (2009)IHHNV648R AGCGTAGGACTTGCCGATTAIHHNVF ATGTGCGCCGATTCAACAAG Tang andLightner

(2002)IHHNVR1 CTAAGTGACGGCGGACAATAIHHNV721F CTACTGCCTCTGCAACGAG Tang andLightner

(2002)IHHNV2860R GTGGGTCTGGTCCACTTGATIHHN3065F GACGACGAAGAATGGACAGA Tang etal. (2003)IHHN3065R TGCCTGGGTAGCTGGTATGTATA77012F ATCGGTGCACTACTGGGA Nunan et al. (2000)2553R CGGACAATATCCCTGACTI2814F TAATGAAGACGAAGAACACGCCGAAGG Yang etal. (2007)I3516R TGGGTAGACTAGGTTTCCAAGGGATGGTT

a Underlined bases indicate the polymorphic sites.

and Lightner, 2002; Tang et al., 2003). Furthermore, fragments of IHHNV are inserted in P. monodon genomes collected in Australia,Africa and India (Krabsetsve et al., 2004; Tang andLightner, 2006).All these factors justify the need of continued development of specific primers, in order to avoid false positive and false neg-ative results. The primers recommended by the World AnimalHealth Organization can amplify the IHHNV-related sequencespresent in P.monodon, whichhasgottenintegrated into theshrimpgenome, thus showing false positive results (Tang et al., 2006).Several primers to IHHNV detection have been published, includ-ing primers that allow to detect the viral sequence integrated intoshrimpgenome (Table3).Many of theseprimesare effectiveto dis-tinguish IHHNV variants, but most of them are located in regions

comprising polymorphic sites in the genome, as shown in Table 3.Depending on its location (proximity to the 3 region), the mis-matches may decrease the PCR efficiency or causes the completeinhibition of amplification. Considering all these points the systempresented here offers two major advantages. The first is that theprimers were designed to align in regions that encoding conserveddomains of viral NS1protein, which increases the chance to detectthe largest number of variants of the virus. The second is that theuseof tree primers andthe incrementof theannealing temperatureof the primer used in the nested reaction turned the methodmoresensitivewithout loss the reaction specificity.In summary, the IHHNV Brazilian isolate is very similar to

Hawaii isolate, and is closely related to a lineage which comprisesinfectious variants of IHHNV. Some conserved nucleotide regions

identified in IHHNV genome correspond to putative regulatorygene sites or regions that codingconservedprotein domains. How-ever,in some cases,it wasnotpossibleto correlatetheconservationof certain regions of its biological function. TheUTR regions showssegmentswith potential to formhairpins, anda repeated sequenceof 77nt were observed in IHHNV genome extremities. Unexpect-edly, a putative hairpin in the 5 UTR region of the positive IHHNVstrandwas detected,andcanbea candidatesite of early viral repli-cation. In addition, a new nested PCR protocol using tree primerswas efficient to detect IHHNV with high sensitivity. These resultswill be important to direct further studies about genetic variabilityof IHHNV and to guide the design of new markers to its variantsdetection, as well as to the comprehensive understanding of thegene regulation and replication mechanisms present in this virus

family.

Acknowledgements

Wewould like to thankCAPESandFAPERN forfinancial supportand the company Camanor for providing shrimp samples used inthis study.

References

Afanasiev, B.N.,Galyov,E.E., Buchatsky, L.P.,Kozlov,Y.V., 1991.Nucleotide sequenceandgenomic organization of Aedes densonucleosis virus. Virology185, 323–336.

Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman,D.J., 1997. GappedBLAST andPSI-BLAST: a newgeneration of protein databasesearchprograms. Nucleic Acids Res. 25, 3389–3402.

Bell, T.A., Lightner, D.V., 1984. IHHN virus: infectivity and pathogenicity studies inPenaeus stylirostris and Penaeus vannamei. Aquaculture 38, 185–194.

Boublik, Y., Jousset, F.X., Bergoin, M., 1994. Complete nucleotide sequence andgenome organization of the Aedes albopictus parvovirus (AaPV) pathogenic for Aedes aegypti larvae. Virology 200, 752–763.

Braz,R.F.S.,Oliveira, C.P.R., Reis,L.G.,Martins,P.C.C.,Sales,M.P.,Meissner, R.V.,2009.Prevalence of infectious hypodermal andhematopoieticnecrosis virus (IHHNV)in Penaeus vannamei culturedin northeasternBrazil. Aquaculture 288,143–146.

Brock, J.A., Lightner,D.V., Bell,T.A., 1983. A reviewof four virus (BP, MBV, BMN, andIHHNV)diseases of penaeid shrimp with particular referenceto clinical signifi-cance, diagnosisand control in shrimpaquaculture. In:Proceedingsof the71stInternational. Council for the Exploration of the Sea, C.M. 1983/Gen:10/1–18.

Browdy,C.L., Holloway,J.D., King, C.O.,Stokes, A.D.,Hopkins, J.S.,Sandifer, P.A., 1993.

IHHNvirusandintensivecultureof Penaeusvannamei: effectsofstockingdensityandwater exchange rates.J. Crustacean Biol. 13, 87–94.Cotmore, S.F., Tattersall, P., 2006. Parvovirus DNA replication. In: DePamphilis, M.

(Ed.), DNAReplication andHumanDisease.Cold SpringHarbor LaboratoryPress,Cold SpringHarbor, NY, pp. 593–608.

Dhar,A.K.,Roux,M.M.,Klimpel,K.R.,2001. Detectionandquantificationof infectioushypodermal and hematopoietic necrosis virus and white spot virus in shrimpusing real-time quantitative PCR and SYBR green chemistry. J. Clin. Microbiol.39, 2835–2845.

Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy andhigh throughput. Nucleic Acids Res. 32, 1792–1797.

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus Tax-onomy. EighthReport of theInternational Committeeon Taxonomy of Viruses.Elsevier, Amsterdam.

Gruber, A.R., Lorenz, R., Bernhart, S.H., Neuböck, R., Hofacker, I.L., 2008. The ViennaRNAwebsuite. Nucleic Acids Res. 36 (Web Serverissue),W70–W74.

Hasegawa, M., Kishino, H., Yano, T., 1985. Dating of the human-ape splitting by amolecular clock ofmitochondrial DNA. J. Mol. Evol. 22, 160–174.

Kalagayan, G., Godin,D., Kanna, R., Hagino, G., Sweeny, J.,Wyban, J., Brock, J., 1991.

IHHN virus as an etiological factor in runt deformity syndrome of juvenilePenaeus vannamei cultured in Hawaii.J. World Aquacult. Soc. 22, 235–243.

Kaufmann,B., Bowman,V.D., Li,Y., Szelei, J.,Waddell,P.J.,Tijssen,P., Rossmann,M.G.,2010. Structureof Penaeus stylirostrisdensovirus, a shrimp pathogen.J. Virol. 84,11289–11296.

Kim, J.H., Choresca Jr., C.H., Shin, S.P., Han, J.E., Jun, J.W., Han, S.Y., Park, S.C., 2011.Detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV)in Litopenaeus vannamei shrimp cultured in South Korea. Aquaculture 313,161–164.

Kim, J.H., Kim, H.K., Nguyen, V.G., Park, B.K., Choresca, C.H., Shin, S.P., Han, J.E., Jun, J.W., Park, S.C., 2012. Genomic sequence of infectious hypodermal andhematopoietic necrosis virus (IHHNV) KLV-2010-01 originating from the firstKorean outbreak in cultured Litopenaeusvannamei. Arch. Virol. 157, 369–373.

Krabsetsve, K., Cullen, B.R., Owens, L., 2004. Rediscovery of the Australian strain of infectious hypodermal and haematopoietic necrosis virus. Dis. Aquat. Org. 61,153–158.

Kraft, J.J.,Treder, K.,Peterson,M.S.,Miller,W.A., 2013.Cation-dependent foldingof 3

cap-independent translation elements facilitatesinteraction of a 17-nucleotideconservedsequencewith eIF4G.Nucleic Acids Res. 41, 3398–3413.

Li, L.,Cotmore,S.F.,Tattersall,P., 2012. Parvoviral left-endhairpin earsare essentialduring infectionforestablishinga functional intranucleartranscriptiontemplateand forefficientprogeny genomeencapsidation. J. Virol. 87, 10501–10514.

Lightner, D.V., 1983. Diseases of cultured penaeid shrimp. In:McVey, J.P. (Ed.), CRCHandbookof Mariculture.CrustaceanAquaculture,vol. 1. CRCPress,Boca Raton,FL, USA, pp. 289–320.

Lightner, D.V., 1988. Diseases of cultured penaeid shrimp and prawns. In: Sinder-mann,C.J.,Lightner,D.V.(Eds.),DiseaseDiagnosisandControlinNorthAmericanMarine Aquaculture. Elsevier,Amsterdam, TheNetherlands, pp. 8–127.

Lightner, D.V., 2011. Virus diseases of farmed shrimp in theWestern Hemisphere(the Americas): a review. J. Invertebr. Pathol. 106, 110–130.

Mari, J., Bonami, J.R., Lightner, D.V., 1993. Partial cloning of the genome of infec-tious hypodermal and haematopoietic necrosis virus, an unusual parvoviruspathogenic forpenaeid shrimps; diagnosis of thediseaseusinga specific probe. J. Gen. Virol. 74, 2637–2643.

Morales-Covarrubias, M.S., Nunan, L.M., Lightner, D.V., Mota-Urbina, J.C., Garza-Aguirre, M.C., Chavez-Sanchez, M.C., 1999. Prevalence of IHHNV in wildbroodstock of Penaeus stylirostris from the upper Gulf of California, Mexico. J.

Aquat. Anim.Health 11, 296–301.

http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0140http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0135http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0130http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0125http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0120http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0115http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0110http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0105http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0100http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0095http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0090http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0085http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0080http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0075http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0070http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0065http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0060http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0055http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0040http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0035http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0030http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0025http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0015http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0010http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005http://refhub.elsevier.com/S0168-1702(14)00212-3/sbref0005


11/11


Nunan, L.M., Poulos, B.T., Lightner, D.V., 2000. Use of polymerase chain reactionfor thedetectionof infectious hypodermal andhematopoietic necrosisvirus inpenaeid shrimp. Mar. Biotechnol. 2, 319–328.

OIE, 2000. Diagnostic Manual forAquatic AnimalDiseases, 3rd edn. Office Interna-tional des Epizooties, Paris.

OIE, 2003. Manual of Diagnostic Tests forAquatic Animals, 4th edn. Office Interna-tional des Epizooties, Paris.

Pollom, E.,Dang,K.K., Potter, E.L.,Gorelick,R.J., Burch, C.L.,Weeks,K.M.,Swanstrom,R., 2013. Comparison of SIV andHIV-1 genomic RNA structures reveals impactof sequence evolutionon conservedandnon-conserved structural motifs. PLoSPathog..

Primavera,J.H.,Quinitio,E.T.,2000.Runt-DeformitySyndromein culturedgianttigerprawn Penaeus monodon. J. Crustac. Biol. 20, 796–802.Rai,P., Pradeep,B., Safeena,M.P., Karunasagar,I., Karunasagar,I., 2009.Simultaneous

presence of infectious hypodermal and hematopoietic necrosis virus (IHHNV)andTypeA virus-relatedsequencein Penaeus monodon fromIndia. Aquaculture295,168–174.

Rai, P., Safeena, M.P., Karunasagar, I., Karunasagar, I., 2011. Complete nucleic acidsequenceof Penaeus stylirostris densovirus (PstDNV) from India. Virus Res.158,37–45.

Robles-Sikisaka, R., Bohonak, A.J., McClenaghan Jr., L.R., Dhar, A.K., 2010. Geneticsignature of rapid IHHNV (infectious hypodermal and hematopoietic necrosisvirus)expansion inwild penaeus shrimppopulations.PLoS ONE5 (7), e11799.

Shike, H., Dhar, A.K., Burns, J.C., Shimizu, C., Jousset, F.X., Klimpel, K.R., Bergoin,M., 2000. Infectious hypodermal and hematopoietic necrosis virus of shrimpis related to mosquito brevidensoviruses. Virology277, 167–177.

Tamura, K., Peterson, D., Peterson,N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecularevolutionarygenetics analysisusingmaximumlikelihood, evolution-arydistance,andmaximumparsimonymethods.Mol.Biol. Evol. 28,2731–2739.

Tang, K.F.J.,Durand,S.V.,White,B.L.,Redman, R.M.,Pantoja,C.R.,Lightner,D.V., 2000.Postlarvae and juveniles of a selected line of Penaeus stylirostris are resistant toinfectioushypodermal andhematopoietic necrosis virus infection. Aquaculture190, 203–210.

Tang, K.F.J., Lightner,D.V.,2002. Lowsequence variationamongisolatesof infectioushypodermal andhematopoieticnecrosisvirus (IHHNV)originating fromHawaiiand theAmericas. Dis. Aquat. Organ.49, 93–97.

Tang, K.F.J., Poulos, B.T., Wang, J

Documents

2014 - Infectious Hypodermal and Hematopoietic Necrosis Virus From BrazilSequencing, Comparative Analysis and PCR Detection