201008.164.ProNet

PCR Tools2nd edition

Novagen®

Thermostable DNA Polymerases ......... 4Overview and Enzyme Selection Guide ................................. 4KOD Hot Start DNA Polymerase ............................................. 6KOD Hot Start Master Mix ....................................................... 8KOD Xtreme™ Hot Start DNA Polymerase .............................. 9KOD XL DNA Polymerase .......................................................11KOD DNA Polymerase ............................................................ 12NovaTaq™ Hot Start DNA Polymerase ................................. 13NovaTaq Hot Start Master Mix Kit ........................................ 13NovaTaq DNA Polymerase .................................................... 14NovaTaq PCR Master Mix ..................................................... 14Taq Antibody ........................................................................... 1510 mM dNTP Mix ................................................................... 15

Direct PCR from Blood ........................16BloodDirect™ PCR Buffer Kits ............................................... 16

RT-PCR ....................................................18One Step RT-PCR Master Mix Kit ........................................ 18First Strand cDNA Synthesis Kit .......................................... 19

Prices and availability are subject to change. Copyright © 2009 EMD Chemicals Inc., an affiliate of Merck KGaA, Darmstadt, Germany. All rights reserved. Each product is sold with a limited warranty which is provided with each purchase. Each product is intended to be used for research purposes only. It is not to be used for drug or diagnostic purposes nor is it intended for human use. EMD Chemicals products may not be resold, modified for resale, or used to manufacture commercial products without written approval of EMD Chemicals. BacVector®, His•Tag®, HSV•Tag®, Novagen®, Pellet Paint®, Perfectly Blunt®, and T7Select® are registered trademarks of EMD Chemicals Inc. in the United States and in certain other jurisdictions. AccepTor™, BloodDirect™, Clonables™, CytoBuster™, D-Tube™, GelMelt™, GigaSingles, HT96™, KOD Xtreme™, NovaTaq™, Perfect DNA™, pETBlue™, S•Tag™, Singles™, SpinPrep™, Straight A’s™, Tuner™, Veggie™, and Zappers™ are trade-marks of EMD Chemicals Inc. ABI PRISM®, Big Dye®, and MicroAmp® are registered trade-marks of Applera Corporation. Cy5® is a registered trademark of GE Healthcare. Ex Taq™, LA Taq™, and PrimeSTAR® are trademarks of Takara Bio Inc. Herculase®, PfuTurbo®, and PfuUltra® are registered trademarks of Stratagene. Platinum®, Pfx50™, and Quant-iT™ are trademarks of Invitrogen Corp. Norit® is a registered trademark of Norit N.V. Phusion™ is a trademark of Finnzymes Oy. PicoGreen® and SYBR® are registered trademarks of Molecular Probes, Inc.

Patent & LicensingAccepTor™ Vectors are covered under U.S. Patent 5,856,144 issued to EMD Chemicals Inc. for a vector, method, and kit for direct cloning of PCR products.

D-Tube™ Dialyzers are covered under U.S. Patent 7,074,313, European Patent 1,285,257, Australian Patent 2001,262,612, Canadian Patent 2,410,322, Indian Patent 201,731, and Israeli Patent 152,986 assigned to Gene Bio-Application Ltd.

KOD DNA Polymerase, KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Xtreme™ Hot Start DNA Polymerase, KOD Hot Start Master Mix, One Step RT-PCR Master

Mix Kit, and Taq Antibody. These products are manufactured by Toyobo and distributed by EMD Chemicals, Inc. Patents related to these products include U.S. Patents 4,965,188, 4,889,818, 5,079,352,5,075,216, 5,407,800, 5,322,770, 5,310,652, 5,436,149, 5,338,671, USSN 07/873, 897,USSN 08/384,490, and European Patent 592,035.

KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Xtreme™ Hot Start DNA Polymerase, NovaTaq™ DNA Polymerase, NovaTaq Hot Start DNA Polymerase, One Step RT-PCR Master Mix Kit. Use of these products is covered by one of more of the following U.S. Patents and corresponding patent claims outside the U.S.: 5,079,352, 5,618,711, 5,789,224, 6,127,155 and claims outside the U.S. corresponding to U.S. Patent 4,889,818. The purchase of these products includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser’s own internal research. No right under any other patent claim (such as the patented 5’ Nuclease Process claims in U.S. Patents 5,210,015 and 5,487,972), no right to perform any patented method, and no right to perform commercial services of any kind, including without limi-tation reporting the results of purchaser’s activities for a fee or other commercial consid-eration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California, 94404.

Pellet Paint® Co-Precipitant is covered under U.S. Patent 7,144,713 and European Patent 0,853,680 issued to EMD Chemicals Inc. for a method for precipitating nucleic acid with a visible carrier.

pETBlue™ Perfectly Blunt® Cloning Kits are licensed under U.S. Patent 5,693,489. For aca-demic or non-profit laboratories, a nondistribution agreement accompanies the products. Commercial laboratories must obtain a research-use license from Brookhaven Science Associates prior to purchase of the products.

Cover and Inside Photography: Chris Bucher Photography, Dale Chihuly Sculpture located at Indiana University, Medical Sciences Building, Indiana, United States.

PCR Tools2nd edition | 2009

3

Novagen • PCR Tools

I N

C L U D E D

d N T P s

LIC

E N S E D FO

R

P C R

ON THE WEB

www.novagen.com

20 FAQ

22 Protocol Comparison

23 Comparing the Speed and Product Yield of 7 High Fidelity DNA Polymerases

27 Reliable and Efficient PCR from Whole Blood and Crude Tissue Lysates Using the KOD Xtreme™ Hot Start DNA Polymerase System

30 Reliable and Robust Real-time Amplification Using NovaTaq™ Hot Start Master Mix

32 One Step Real-Time Amplification of mRNA Using the One Step RT-PCR Master Mix Kit

35 Detection of Shiga toxin-producing E. coli using multiplex colony-direct PCR with KOD XL DNA Polymerase

Resource Guide

RESOURCE GUIDE ........................20

PCR Clean Up and Nucleic Acid Preparation ...................36

SpinPrep™ PCR Clean-Up Kit ................................................ 36SpinPrep Gel DNA Kit ............................................................ 37Pellet Paint® Co-Precipitant .................................................. 38Pellet Paint NF Co-Precipitant .............................................. 39

Molecular Size Markers ......................40Perfect DNA™ Markers ........................................................... 40Perfect DNA Ladders .............................................................. 41PCR Markers ............................................................................ 41

PCR Cloning ...........................................42Cloning Kits Overview ............................................................ 42AccepTor™ Vector Kits ............................................................. 44Perfectly Blunt® Cloning Kits ................................................ 46Clonables™ Ligation/Transformation Kit .............................. 49

Clonables 2X Ligation Premix ............................................... 49NovaBlue Competent Cell Formats ....................................... 50NovaBlue GigaSingles™ Competent Cells ............................ 50NovaBlue Singles™ Competent Cells .................................... 51NovaBlue T1R Singles Competent Cells ............................... 51Veggie™ NovaBlue Singles Competent Cells ....................... 52Zappers™ Electrocompetent Cells ......................................... 52HT96™ NovaBlue Competent Cells ....................................... 53HT96 Isothermal Block .......................................................... 53

Molecular Biology Essentials ............54Molecular Biology Reagents ................................................... 54Molecular Biology Grade Buffers .......................................... 55Molecular Biology Enzymes ................................................... 56D-Tube™ Dialyzers ................................................................... 58D-Tube Electroelution Accessory Kit ..................................... 59

Look for these icons on the product pages:

Indicates that the enzyme is licensed for PCR.

Indicates that dNTPs are included.

Find more information on our website.

[email protected]@merckbio.comVisit our website www.merckbio.com

4

Thermostable DN

A Polymerases


PCR • Thermostable DNA Polymerases

4

In the 25 years following the invention of PCR by Dr. Kary Mullis, PCR has evolved to become an integral laboratory tool. High quality thermostable polymerases are critical for consistent performance. We offer a complete selection of high-quality Novagen enzymes and kits for a variety of PCR applications.

Because low error rate is crucial, we feature ultra high-fidelity KOD DNA Polymerase. This unique proofreading enzyme, isolated from the extreme thermophile Thermococcus kodakaraensis KOD1, possesses superior processivity and fidelity. This enables faster, more accurate PCR amplification than can be achieved with conventional enzymes, including Pfu DNA Polymerase (Tagaki, 1997). KOD DNA Polymerase is also available in a hot start version for high specificity and increased read length (Mizuguchi, 1999). KOD Hot Start DNA Polymerase has been acknowledged in many peer-reviewed publications as the ultra high-fidelity enzyme of choice. KOD XL DNA Polymerase, a blend of KOD DNA Polymerase and a mutant form of KOD that is deficient in 3´→5´ exonuclease activity (Nishioka, 2002), is designed for reliable amplification of crude samples, multiplex PCR, and incorporation of derivatized dNTPs. New to the KOD family is KOD Xtreme™ Hot Start DNA Polymerase, a high-fidelity “enzyme of last resort” for the most challenging targets. KOD Xtreme Hot Start DNA Polymerase is optimized for the amplification of the most difficult targets, including GC-rich and long targets.

KOD Xtreme polymerase provides high accuracy, specificity, and robust yield.

Not all applications require high-fidelity, high-performance enzymes, but quality is still important. NovaTaq™ DNA Polymerase is a high-purity, recombinant enzyme suitable for any application requiring premium quality Taq DNA Polymerase. For increased specificity and convenience with standard PCR, we offer NovaTaq Hot Start DNA Polymerase and the Taq Antibody. NovaTaq Hot Start DNA Polymerase is a chemically modified form of the enzyme that activates when heated at 95°C for 10 minutes. The proprietary chemical modification utilized for NovaTaq Hot Start results in improved low-copy target amplification, higher specificity, and higher yield. Taq Antibody is available as an alternative means of providing hot start capability to NovaTaq DNA Polymerase as well as any other Taq DNA polymerase. Please refer to the table on the following page as a guide to select the appropriate enzyme for your application.

Our commitment to moving your research forward includes providing products that respect intellectual property law. All Novagen polymerases are licensed for PCR for research use.

References: Takagi, M., et al. 1997 Appl. Environ. Microbiol. 63,4504. Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762. Nishioka., et al. 2001 J. Biotechnol. 88, 141.

Overview and Enzyme Selection Guide A complete selection of enzymes and kits for PCR

Enzyme KOD DNA Polymerase Pfu DNA Polymerase Taq DNA Polymerase

Species Thermococcus kodakaraensis Pyrococcus furiosusThermus aquaticus

YT-1

Fidelity†

(mutation frequency) 0.0035 0.0039 0.013

Elongation rate(bases/second) 106-138 25 61

Processivity(nucleotide bases) >300 <20 not determined

† Fidelity was measured by the authors as mutation frequency in PCR products using a sensitive blue/white phenotypic assay with a 5.2-kb lacZ plasmid as template (Takagi 1997).

For more information or to place an order, contact your local office (see back cover).

Thermostable DN

A Polymerases



5

PCR Enzyme Selection GuideA complete selection of enzymes and kits for PCR

Elongation RatePolymerase elongation rate affects not only the total experiment time but also product yield and success rate. Generally, a faster enzyme can generate higher yield of full-length products in fewer amplification cycles.

SpecificityInactivating the polymerase at room temperature and restoring activity after initial denaturation can increase amplification specificity. The two most common strategies used to create heat-activatable forms of DNA polymerase are chemical modification (NovaTaq™ Hot Start DNA Polymerase) or antibody-mediated methods (KOD Hot Start DNA Polymerase, KOD Xtreme™ Hot Start DNA Polymerase, and NovaTaq DNA Polymerase plus Taq Antibody).

FidelityFidelity is critical when the amplification product will be used for applications such as direct sequencing or cloning. KOD

enzymes offer the highest accuracy of commercially available proofreading DNA polymerases.

Difficult TargetsWhile many targets can be amplified with little optimization, certain target sequences (such as GC-rich sequences or long, complex targets) remain challenging. These targets may require a high-performance enzyme optimized for difficult amplifications.

PCR CloningWe offer PCR cloning kits for amplicons that have 3´-dA ends (AccepTor™ Vector Kits) and amplicons with blunt ends (Perfectly Blunt® Kits). Please refer to the PCR Cloning section of this brochure (page 40) for more information.

PCR Enzyme Selection Guide

Enzyme

PCR Product Size (kb)

Elongation Rate

(bases/s) Specificity FidelityGC-rich

Templates Yield

PCR Product

Ends

Success With Difficult Targets Applications

Available as Master Mix Page

KOD DNA Polymerase

<6 120 blunt Cloning, cDNA amplification

12

KOD Hot Start DNA Polymerase

<21 120 blunt Cloning, cDNA amplification

Y 6

KOD XL DNA Polymerase

<30 120 Mixed (blunt and 3’-dA)

Crude samples, multiplex,

incorporation of derivatized dNTPs

11

KOD Xtreme™ Hot Start DNA Polymerase

<40 120 blunt Crude samples,

Long targets, difficult and GC-rich targets

9

NovaTaq™ DNA Polymerase

<5 kb 60 3’-dA Routine PCR Y 14

NovaTaq Hot Start DNA Polymerase

<5 kb 60 3’-dA Hot start routine PCR Y 13

NovaTaq DNA Polymerase plus Taq Antibody

<5 kb 60 3’-dA Hot start routine PCR 14

Satisfactory Good Excellent Best

Our PCR Enzymes are

Priced Competitively for

your Diverse Research needs


6

Thermostable DN

A Polymerases



6

KOD Hot Start DNA Polymerase* is a premixed complex of high-fidelity KOD DNA Polymerase and two monoclonal antibodies that inhibit the DNA polymerase and 3’→5’ exonuclease activities at ambient temperatures (Mizuguchi 1999). KOD Hot Start combines the high fidelity, fast extension speed, and outstanding processivity of KOD with the high specificity of an antibody-mediated hot start. Non-specific amplification is reduced because mispriming events during setup and initial temperature increase are avoided. In addition, primer degradation due to exonuclease activity during setup at ambient temperature is effectively inhibited. KOD Hot Start DNA Polymerase generates blunt-ended DNA products suitable for cloning with the Novagen® Perfectly Blunt® and LIC Vector Kits. The enzyme is compatible with site-directed mutagenesis protocols. Unit definition: One unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol dNTP into acid-insoluble form in 30 min at 75°C, in a reaction containing 20 mM Tris-HCl (pH 7.5 at 25°C), 8 mM MgCl2, 7.5 mM DTT, 50 mg/ml BSA,150 µM each of dATP, dCTP, dGTP, dTTP (a mix of unlabeled and [3H]dTTP), and 150 µg/ml activated calf thymus DNA.

References: Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762.Kitabayashi, M., et al. 2002. Biosci. Biotechnol. Biochem. 66, 2194. Fujii, S., et al. 1999. J. Mol. Biol. 289, 835.


Source Recombinant Thermococcus kodakara-ensis KOD1 DNA polymerase expressed in E. coli

Concentration 1.0 U/ml

Nicking activity None detected

Amplification efficiency Functional PCR; inhibition of activity at 21˚C verified

Features• More accurate PCR in a shorter time• Highest accuracy, yield, and processivity of commercially

available proofreading DNA polymerases• Amplifies genomic DNA templates up to 12 kb• Amplifies plasmid and lambda DNA templates up to 21 kb• Eliminates mispriming and primer-dimer formation• Convenient ambient-temperature setup compatible with

automation• Optimal KOD Hot Start Buffer for robust PCR performance

with a wide range of targets

Heat-activatable form of KOD DNA Polymerase for increased specificity and convenient PCR setup

Components200 U or 5 × 200 U KOD Hot Start DNA Polymerase (1.0 U/ml)

1.2 ml or 5 × 1.2 ml 10X PCR Buffer for KOD Hot Start DNA Polymerase

1 ml or 5 × 1 ml 25 mM MgSO4

1 ml or 5 × 1 ml dNTP Mix (2 mM each)

Additional Information AvailableKOD Hot Start DNA Polymerase User Protocol TB341inNovations Nos. 17, 21, 25

Product Size Cat. No. PriceKOD Hot Start DNA Polymerase o

20 U200 U

1000 U

71086-571086-371086-4

I N

C L U D E D

d N T P s

LIC

E N S E D FO

R

P C R

ON THE WEB

www.novagen.com /KOD

Page 20

* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.


Thermostable DN

A Polymerases



7


M 8.4 12.3 kb

Genomic DNA amplification

The human myosin heavy chain gene (8.4 kb) and human β-globin gene (12.3 kb) were amplified using KOD Hot Start DNA Polymerase. M: markers.

M 1 2 4 6 8 10 12 15 21 M

Lambda DNA amplification

The indicated size fragments of lambda DNA were amplified using appropriate primers and KOD Hot Start DNA Polymerase. M: markers.

Product Size (kb)

DNAPolymerase Total

Number ofColonies Percentage of Mutants

Mutation frequency

Mutant Mutation Frequency (%)

KOD Hot Start

PfuUltra

PfuTurbo

Taq

51200

49900

65900

7000

51

53

164

354

Mutation Frequency: (Number of mutantcolonies/Number of total colonies) × 100%

0.0 1.0 2.0 3.0 4.0 5.0 6.0

Mutation frequency comparison: KOD Hot Start, PfuTurbo®, PfuUltra®, and Taq

The fidelity of replication was measured as the mutation frequency in PCR products using a modified rpsL+ fidelity assay (Kitabayashi 2002, Fujii 1999).

KOD Hot Start

PfuUltra

PfuTurbo

Taq

0.10

0.11

0.25

5.1

Continued

Lane SampleM PCR Markers1 KOD Hot Start DNA Pol.2 KOD DNA Pol.3 Platinum® Pfx DNA Pol.4 Pfx50™ DNA Pol.5 Phusion™ Hot Start DNA Pol.6 PfuUltra® II Fusion HS DNA Pol.7 PrimeSTAR® HS DNA Pol.

23 cycles 25 cycles

27 cycles 29 cycles(plus final extension)

M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7

M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7

Cycle Profile A Cycle Profile B Cycle Profile C Cycle Profile D

Initial denaturation 98°C 30 s 94°C 2 min 95°C 2 min 95°C 2 min

29 cycles98°C 10 s55°C 20 s72°C 30 s

94°C 15 s52°C 20 s68°C 60 s

95°C 20 s55°C 20 s72°C 30 s

95°C 20 s55°C 10 s70°C 15 s

Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A

KOD yields more product in fewer cycles compared to other PCR enzymesA 919-bp fragment of human glycogen synthase kinase 3α (GSK 3α) was amplified by one of 7 enzymes in 4 different cycling protocols (only Cycle Profile A is shown here), which encompass the manufacturers’ recommended cycling conditions. PCR samples (5 μl) were taken after 23, 25, 27, and 29 cycles and analyzed on 1.4% agarose/TAE gels. Lanes indicate the enzyme used for the reaction. Cycling profiles are defined in the table above. (Note: PicoGreen® assay results indicate a yield increase with PrimeSTAR® HS DNA Polymerase from cycle 27 to cycle 29; the reduced band intensity is a gel artifact.)

For the full article please see the Technical Note on page 23.


8

Thermostable DN

A Polymerases



8

Product Size Cat. No. PriceKOD Hot Start Master Mix

100 rxn500 rxn

71842-371842-4

KOD Hot Start Master MixPremixed 2X KOD Hot Start PCR components for convenience and reproducibility

KOD Hot Start Master Mix* is a ready-to-use 2X mixture optimized for convenient high-fidelity PCR. The mix contains KOD Hot Start DNA Polymerase, two monoclonal antibodies, ultrapure deoxynucleotides, and reaction buffer with MgSO4. The Master Mix simplifies PCR set-up, offering time savings, consistency, and minimal risk of contamination. The mix is ideal for use in high-throughput applications. This master mix quickly and accurately amplifies genomic and phage/plasmid DNA targets to 12 kb and 21 kb respectively. Simply add KOD Hot Start Master Mix to an equal volume of sample containing DNA template and primers. The final diluted reaction contains 1 U KOD Hot Start DNA Polymerase per 50 µl reaction. The smaller size is sufficient for 100 x 50 µl reactions or 250 x 20 µl reactions. The larger size is adequate for 500 x 50 µl reactions or 1250 x 20 µl reactions.

1 2 3 4 5 6 7 8 9 10

Lane Template – Target - Size 1 PCR Markers 2 DNA – att region - 595 bp 3 DNA – att region - 595 bp 4 PCR Markers 5 cDNA plasmid – GSK 3 CD ORF – 919 bp 6 cDNA plasmid – GSK 3 CD ORF – 919 bp 7 PCR Markers 8 Uncut BacVector® 3000 DNA – Chitinase deletion region – 1.9 kb 9 Uncut BacVector 3000 DNA – Chitinase deletion region – 1.9 kb 10 Perfect DNA™ Markers, 0.5-12 kb

PCR products amplified using KOD Hot Start Master MixThe indicated DNA fragments were amplified using KOD Hot Start Master Mix in separate 50-μl or 20-μl reactions using cycling conditions indicated in the user protocol. Samples (5 μl) were analyzed by agarose gel electrophoresis (1.0% TAE) and stained with ethidium bromide.

Components2 × 1.25 ml or 10 × 1.25 ml KOD Hot Start Master Mix

Additional Information AvailableKOD Hot Start Master Mix User Protocol TB506


ON THE WEB


LIC

E N S E D FO

R

P C R

Page 20 I N

C L U D E D

d N T P s

Features• More accurate PCR in a shorter time• Highest accuracy, yield, and processivity of commercially

available proofreading DNA polymerases• Amplifies genomic DNA templates up to 12 kb• Amplifies plasmid and lambda DNA templates up to 21 kb• Eliminates mispriming and primer-dimer formation• Convenient ambient-temperature setup compatible with

automation• Optimal KOD Hot Start Buffer for robust PCR performance

with a wide range of targets


Thermostable DN

A Polymerases



9

RESO

URCE

GUIDE

KOD Xtreme™ Hot Start DNA PolymeraseKOD system optimized for difficult targets

Product Size Cat. No. PriceKOD Xtreme™ Hot Start DNA Polymerase

200 U 71975-3

Components1 × 200 U KOD Xtreme Hot Start DNA Polymerase3 × 1.7 ml 2X Xtreme Buffer2 × 1 ml dNTPs (2 mM each)

Additional Information AvailableKOD Xtreme Hot Start DNA Polymerase User Protocol TB507inNovations No. 28

d N T P s

Features:• Optimized for the highest PCR success rate, even with the

most difficult targets

• Efficiently amplifies up to 90% GC-content templates

• 10X higher fidelity than Taq blends

• Amplifies genomic targets up to 24 kb

• Amplifies phage/plasmid targets up to 40 kb• Efficiently amplifies DNA from crude samples

• Eliminates mispriming and primer-dimer formation• Convenient ambient-temperature setup compatible with

automation


The KOD Xtreme™ Hot Start DNA Polymerase* kit is an optimized PCR system for the amplification of long or GC-rich DNA templates. The system includes an ultra high fidelity KOD DNA polymerase complexed with two monoclonal antibodies to permit hot start thermocycling, along with specially formulated 2X buffer. KOD Xtreme Hot Start DNA Polymerase quickly and accurately amplifies genomic and phage/plasmid DNA targets up to 24 and 40 kb, respectively. It successfully amplifies challenging DNA templates with up to 90% GC content.

Each kit provides 200 U KOD Xtreme Hot Start DNA Polymerase, an optimized buffer, and dNTPs sufficient for 200 amplification reactions. The polymerase produces blunt-ended DNA products suitable for cloning with the Novagen® Perfectly Blunt® and LIC Vector Kits.

DNA Polymerase

Number of Bases Percentage of Mutants

Sequenced Mutated Mutation Frequency (%)

KOD Hot Start 145,753 5

KOD Xtreme 144,535 19

LA Taq‡ 167,343 218

Taq 102,708 145

‡ LA Taq is representative of polymerases mixes which are a blend of Taq DNA polymerase and a proofreading enzyme, such as AccuTaq™ LA DNA Polymerase, Advan-tage polymerases, Expand PCR systems, and TaKaRa LA Taq™ polymerase

00 30 60 90 120 150

Mutation Frequency (× 10-5)

3.4 - KOD Hot Start

13.1 - KOD Xtreme™ Hot Start DNA Polymerase

130.3 - LA Taq polymerase

141.2 - Taq polymerase

See Page 10 for additional data.

I N

C L U D E D

d N T P s

LIC

E N S E D FO

R

P C R

ON THE WEB


Page 20


10

Thermostable DN

A Polymerases



10

KOD Xtreme™ Hot Start DNA Polymerase Continued

1 2 3 4 5 6 M 2M 1Lane Samples M1 1 kb DNA ladder 1 Product of KOD Xtreme™ Hot Start DNA Polymerase 2 Product of Ex Taq™ polymerase 3 Product of LA Taq™ polymerase 4 Product of PrimeSTAR® polymerase with GC Buffer 5 Product of LA Taq polymerase with GC Buffer 1 6 Product of LA Taq polymerase with GC Buffer 2 M2 l/HindIII DNA Markers

GC-rich target AmplificationThe human IGF2R gene[NM_000876] contains a 5’ region that is ~90% GC. The reactions contained cDNA derived from 50 ng HeLa cell total RNA. PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 9 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used.

1 2 3 4 5 M 2M 1Lane Samples M1 1 kb DNA ladder 1 1.3 kb b-globin target 2 3.6 kb b-globin target 3 8.5 kb b-globin target 4 17.5 kb b-globin target 5 24 kb tissue plasminogen activator target M2 l /HindIII DNA Markers

Genomic DNA AmplificationThe indicated targets were amplified from 200 ng human genomic DNA. PCR cycling parameters for 1.3 to 8.5 kb targets: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kb. PCR cycling parameters for 17.5 and 25 kb targets: initial denaturation at 94°C for 2 min; 5 cycles at 98°C for 10 s, 74°C for 1 min/kb; 5 cycles at 98°C for 10 s, 72°C for 1 min/kb; 5 cycles at 98°C for 10 s, 70°C for 1 min/kb; 20 cycles at 98°C for 10 s, 68°C for 1 min/kb.

1 2 3 4 5 M 6 7

�

Lane(s) Samples M 1 kb ladder 1 Product of PfuTurbo® DNA Polymerase 2 Product of Advantage 2 polymerase 3 Product of LA Taq Polymerase 4 Product of Expand Long Template system 5 Product of Herculase® polymerase 6, 7 Products of KOD Xtreme Hot Start DNA Polymerase

1 2 3 4 5 M 6 7 Performance of KOD Xtreme Hot Start DNA Polymerase versus competitors' polymerases in amplification of genomic DNAA 6273 bp region of the GAD67 target was amplified from 100 ng chick kidney genomic DNA. PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 35 cycles at 98°C for 10 s, 68°C for 7 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used.

These data were provided by a member of the Faculty of Medicine, Kyoto

University.


Thermostable DN

A Polymerases



11

Features• Ideal for amplification of large DNA fragments from

purified DNA or crude samples• Amplifies DNA templates up to 30 kb• Successfully amplifies GC-rich sequences• Efficiently incorporates derivatized dNTPs

KOD XL DNA Polymerase High performance enzyme blend for long and accurate PCR

Components250 U or 5 × 250 U KOD XL DNA Polymerase (2.5 U/ml)

1.2 ml or 5 × 1.2 ml 10X PCR Buffer for KOD XL DNA Polymerase

1 ml or 5 × 1 ml dNTP Mix (2 mM each)

Additional Information AvailableKOD XL DNA Polymerase User Protocol TB342inNovations No. 17

Source Recombinant Thermococcus koda-karaensis KOD1 DNA polymerase expressed in E. coli (wild type and exonuclease-deficient forms)


Endonuclease None detected


Amplification efficiency Functional PCR

Product Size Cat. No. PriceKOD XL DNA Polymerase

250 U1250 U

71087-371087-4

d N T P s

Lane Sample1 1-kb PCR fragment2 2-kb PCR fragment3 4-kb PCR fragment4 6-kb PCR fragment5 8-kb PCR fragment6 10-kb PCR fragment7 12-kb PCR fragment 8 15-kb PCR fragment

Performance comparison

The indicated λ DNA fragments were amplified using 2.5 U Taq DNA Polymerase or 2.5 U KOD XL DNA Polymerase in a 50-µl reaction. M: markers.

1 2 3 4 5 6 7 8 M 1 2 3 4 5 6 7 8

Taq KOD XL

KOD XL DNA Polymerase* is an optimized blend of KOD DNA Polymerase and a mutant form of KOD that is deficient in 3´→5´ exonuclease activity (Nishioka 2002). This enzyme mixture is designed for reliable amplification of long, complex targets with robust yield and high accuracy. It can also be used for incorporation of derivatized dNTPs in PCR amplicons (Sawai 2002, Sawai 2001). KOD XL DNA Polymerase generates a mixture of PCR products with blunt and 3´-dA overhangs, suitable for cloning with the Novagen® Perfectly Blunt®, AccepTor™, and LIC Vector Kits. Unit definition: One unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol of dNTP into acid-insoluble form in 30 min at 75˚C, in a reaction containing 20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl2, 7.5 mM DTT, 50 mg/ml BSA, 150 µM each of dATP, dCTP, dGTP, dTTP (a mix of unlabeled and [3H]dTTP), and 150 µg/ml activated calf thymus DNA.

References:

Nishioka, M., et al. 2002. J. Biotechnol. 88, 141.Sawai, H., et al. 2002. Bioconjugate Chem. 13, 309.Sawai, H., et al. 2001. Chem. Commun. 24, 2604.

I N

C L U D E D

d N T P s

LIC

E N S E D FO

R

P C R

ON THE WEB


Page 20



12

Thermostable DN

A Polymerases



12

Features • More accurate PCR in a shorter time• Higher fidelity than Pfu DNA polymerase—excellent for

cloning• Greater yield—extension speed is 2X faster than Taq DNA

polymerase and 5X faster than Pfu DNA polymerase• Higher processivity—sequential nucleotide polymerization

is 10- to 15-fold greater than Pfu and Tli DNA polymerases

• Does not result in truncated amplification products

KOD DNA Polymerase Pure recombinant high fidelity DNA polymerase from Thermococcus kodakaraensis KOD1

Components250 U KOD DNA Polymerase (2.5 U/ml)

1 ml 10X Buffer #1 for KOD DNA Polymerase (pH 8.0)

1 ml 10X Buffer #2 for KOD DNA Polymerase (pH 8.8)

1 ml 25 mM MgCl21 ml dNTP Mix (2 mM each)

Additional Information AvailableKOD DNA Polymerase User Protocol TB320inNovations No. 25

Source Recombinant Thermococcus koda-karaensis KOD1 DNA polymerase expressed in E. coli


Purity > 90% homogeneous by SDS-PAGE

5' Exonuclease Less than 2% per unit of enzyme when incubated 1 h at 74˚C in a reaction with 5'-labeled l/ScaI digest



bp

12,000 – 10,000 –

8000 – 6000 – 4000 – 3000 –

2000 –

1500 –

1000 –

500 –

M 1 2 3

Lane SampleM Perfect DNA™ Markers, 0.5–12 kbp1 5.4-kb PCR product (lambda DNA)2 2.0-kb PCR product (plasmid DNA)3 1.6-kb PCR product (human genomic DNA)

PCR products amplified using KOD DNA Polymerase

DNA fragments from various templates were amplified using 2.5 U KOD DNA Polymerase in a 100-µl reaction. Samples were analyzed by agarose gel electrophoresis (1.2% TAE).

Product Size Cat. No. PriceKOD DNA Polymerase 250 U 71085-3

d N T P s

KOD DNA Polymerase* is a recombinant form of Thermococcus kodakaraensis KOD1 DNA polymerase (Nishioka 2001). KOD is a high-fidelity thermostable polymerase that amplifies target DNA up to 6 kb with superior accuracy and yield (Takagi 1997). The 3´→5´ exonuclease-dependent proofreading activity of the enzyme results in a lower mutation frequency than any other commercially available DNA polymerase. The elongation rate and processivity are 5 times and 10 to 15 times higher, respectively, than for Pfu DNA polymerase, resulting in highly accurate products and robust yield in a short reaction time. The enzyme generates blunt-ended PCR products suitable for cloning with the Novagen® Perfectly Blunt® and LIC Vector Kits. Unit definition: One unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol of dNTP into acid-insoluble form in 30 min at 75˚C, in a reaction containing 20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl2, 7.5 mM DTT, 50 mg/ml BSA, 150 µM each of dATP, dCTP, dGTP, dTTP (a mix of unlabeled and [3H]dTTP) and150 µg/ml activated calf thymus DNA.

References:

Nishioka, M., et al. 2001. J. Biotechnol. 88, 141. Takagi, M., et al. 1997. Appl. Environ. Microbiol. 63, 4504.

I N

C L U D E D

d N T P s

LIC

E N S E D FO

R

P C R

ON THE WEB


Page 20



Thermostable DN

A Polymerases



13

NovaTaq Hot Start Master Mix provides a ready-to-use 2X mixture of NovaTaq Hot Start DNA Polymerase, ultrapure deoxynucleotides, and reaction buffer with MgCl2. The Master Mix simplifies the set-up for PCR resulting in time savings, consistency, and minimal risk of contamination. In addition to the Master Mix, the kit includes PCR Grade Water and MgCl2 for optimizing Mg2+ concentration. Simply add the NovaTaq Hot Start Master Mix to an equal volume containing DNA template, primers, and, if desired, additional MgCl2. The final diluted reaction contains 1.25 U of NovaTaq Hot Start DNA Polymerase per 50 µl. The two NovaTaq Hot Start Master Mix Kit sizes provide sufficient components for 200 or 1000 standard 50-µl amplification reactions.

Features• Higher PCR specificity and yield• Improved low-copy target amplification• Ambient temperature setup compatible with automation• Target amplification of up to 5 kb• Ideal for quantitative and high-throughput PCR

applications

NovaTaq™ Hot Start DNA Polymerase Heat-activatable, chemically modified form of recombinant Taq DNA polymerase

NovaTaq™ Hot Start Master Mix KitPremixed 2X “hot start” PCR components for convenience and reproducibility

Source Recombinant Thermus aquaticus DNA poly-merase expressed in E. coli

Concentration 5 U/ml


Exonuclease None detected

Amplification efficiency

Functional PCR

Lane SampleM Markers1 2-kb fragment amplified using NovaTaq Hot Start DNA Polymerase2 2-kb fragment amplifed using Company A chemically modified Taq DNA polymerase

M 1 2

Hot Start PCR products

The indicated fragments were amplified under standard conditions for each enzyme and analyzed by agarose gel electrophoresis (1.2% TAE).

2500 –2000 –1500 –

1000 –800 –

400 –

200 –

600 –

bp

Components250 U or 5 × 250 U NovaTaq Hot Start DNA Polymerase

1.5 ml or 5 × 1.5 ml 10X NovaTaq Hot Start Buffer

1.5 ml or 5 × 1.5 ml 25 mM MgCl2

Components4 × 1.25 ml or 20 × 1.25 ml NovaTaq Hot Start Master Mix

1 × 1.5 ml or 3 × 1.5 ml 25 mM MgCl23 × 2 ml or 11 × 2 ml PCR Grade Water

Additional Information AvailableNovaTaq Hot Start DNA Polymerase and Kits User Protocol TB460

Product Size Cat. No. PriceNovaTaq™ Hot Start DNA Polymerase

250 U1,250 U

71091-371091-4

Product Size Cat. No. PriceNovaTaq™ Hot Start Master Mix Kit

200 rxn1000 rxn

71676-371676-4

S E

Additional Information AvailableNovaTaq Hot Start DNA Polymerase and Kits User Protocol

TB460

LIC

E N S E D FO

R

P C R

LIC

E N S E D FO

R

P C R

NovaTaq™ Hot Start DNA Polymerase is a chemically modified form of Taq DNA polymerase that is inactive at ambient temperature. The enzyme provides improved specificity when compared to standard Taq DNA polymerase and can minimize the generation of nonspecific amplification products, such as primer-dimers and misprimed products. The enzyme must be activated by heat treatment (10 min at 95˚C), after which thermal cycling can proceed. The enzyme generates PCR products with 3´-dA overhangs, suitable for cloning with the Novagen® Perfectly Blunt®, AccepTor™, and LIC Vector Kits. Unit definition: one unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol of dNTP into acid-insoluble form in 30 min at 72˚C, in a reaction containing 25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane-sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and dTTP, 0.1 µM [α-32P]dCTP, and 12.5 µg activated salmon sperm DNA in a volume of 50 µl.

Page 20

Page 20 I N

C L U D E Dd N T P s


14

Thermostable DN

A Polymerases



14

The NovaTaq PCR Master Mix is a ready-to-use 2X mixture of NovaTaq DNA Polymerase, ultrapure deoxynucleotides, and reaction buffer without MgCl2. The Master Mix simplifies the assembly of PCRs and offers advantages of time savings, consistency, and minimal risk of contamination. Simply add the NovaTaq PCR Master Mix to an equal volume containing the required amount of MgCl2, DNA template, and primers, and the reaction is ready for thermal cycling. The final diluted reaction contains 2.5 U of NovaTaq DNA Polymerase per 100 ml. Sufficient components are included for 200 standard 50-ml (or 100 × 100-ml) amplification reactions.

NovaTaq™ DNA Polymerase is a premium quality recombinant form of Thermus aquaticus DNA polymerase. This thermostable enzyme is suitable for a wide range of PCR applications. To ensure the highest purity and reproducible perfomance, each preparation is extensively tested in a variety of quality control assays. NovaTaq DNA Polymerase has 5´→3’ exonuclease activity and lacks 3’→5’ exonuclease activity. The enzyme generates PCR products with 3’-dA overhangs, suitable for cloning with the Novagen® Perfectly Blunt®, AccepTor™, and LIC Vector Kits. Each kit also includes optimized 10X NovaTaq Buffer with 15 mM MgCl2 for routine amplification conditions, plus separate vials of 10X NovaTaq Buffer without MgCl2 and 25 mM MgCl2 to enable convenient optimization of Mg2+ concentration. Unit definition: one unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol dNTP into acid-insoluble form in 30 min at 74˚C, in a reaction containing 25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane-sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and dTTP, 0.1 µM [α-32P]dCTP, and activated salmon sperm DNA.

NovaTaq™ DNA Polymerase Ultrapure recombinant enzyme for dependable PCR amplification

Components100 U, 500 U, or 5 × 500 U NovaTaq DNA Polymerase

1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 10X NovaTaq Buffer with MgCl21 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 m 10X NovaTaq Buffer without MgCl21 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 25 mM MgCl2

Additional Information AvailableNovaTaq DNA Polymerase and Kits User Protocol TB309

Source Recombinant Thermus aquaticus DNA polymerase expressed in E. coli

Concentration 5 U/ml

Purity >95% homogenous by SDS-PAGE


RNase None detected


bp

12,000 –8000 –6000 –4000 –3000 –

2000 –1500 –

1000 –

500 –

M 1 2 3 4 5 M

Lane SampleM Perfect DNA™ Markers, 0.5–12 kb1 0.5-kb PCR product2 1.0-kb PCR product3 2.0-kb PCR product4 4.8-kb PCR product5 7.35-kb PCR product

PCR products amplified using NovaTaq DNA Polymerase

DNA fragments 0.5 to 7.35 kb in size were amplified using 2.5 U NovaTaq DNA Polymerase in separate 100-ml reactions. Products were analyzed by agarose gel electrophoresis (1.2% TAE).

Components4 × 1.25 ml 2X NovaTaq PCR Master Mix

1.5 ml 25 mM MgCl2 Solution

3 × 2 ml PCR Grade Water

Additional Information AvailableNovaTaq DNA Polymerase and Kits Protocol TB309

Product Size Cat. No. PriceNovaTaq™ PCR Master Mix

200 rxn 71007-3

Product Size Cat. No. PriceNovaTaq™ DNA Polymerase 100 U

500 U2500 U

71003-371003-471003-5

LIC

E N S E D FO

R

P C R

LIC

E N S E D FO

R

P C RNovaTaq™ PCR Master Mix Premixed 2X PCR reaction components for convenience and reproducibility

I N

C L U D E D

d N T P s

Page 20

Page 20


Thermostable DN

A Polymerases



15

The Taq Antibody* is a mouse monoclonal antibody that inhibits Taq DNA polymerase activity at ambient temperatures. When mixed with Taq DNA Polymerase, it provides an antibody-mediated hot start that enhances the specificity, sensitivity, and convenience of PCR. Inhibition is effective during reaction assembly at ambient temperature, and is completely reversed when thermal cycling begins, with no other effect on PCR conditions. The antibody inhibits both native and recombinant Taq DNA polymerase activities, including NovaTaq™ DNA Polymerase.

One microgram (1 ml) of antibody inhibits > 95% of 5 U of Taq DNA polymerase at 40˚C. For convenience, simply mix 100 ml Taq Antibody with 500 U (100 ml) NovaTaq DNA Polymerase, incubate for 5 minutes at room temperature, and proceed with PCR. The polymerase:antibody complex can be freshly prepared for each experiment or stored at –20˚C for later use.

Taq Antibody Converts unmodified Taq DNA polymerase into a hot start enzyme

10 mM dNTP Mix Qualified for enzymatic DNA synthesis

The 10 mM dNTP Mix is a ready-to-use preparation of ultrapure dATP, dCTP, dGTP, and dTTP (monosodium salts) at a concentration of 10 mM each in sterile deionized water at pH 7.0. The dNTP Mix is free of RNase and DNase and is qualified for any application that requires pure deoxynucleotides, such as PCR, cDNA synthesis, and fill-in reactions.

Features• Higher PCR specificity and yield• Improved low-copy target amplification• Ambient temperature setup compatible

with automation

Components100 ml Taq Antibody (1 mg/ml)

1.3 ml 10X PCR Buffer

Additional Information AvailableTaq Antibody User Protocol TB322

Product Size Cat. No. PriceTaq Antibody 100 µl 71088-3

Product Size Cat. No. Price10mM dNTP Mix 0.2 ml 71004-3



16

Direct PCR from Blood


PCR • Direct PCR from Blood

16


ComponentsCat. No. 71342

200 ml or 1 ml 5X BloodDirect Buffer 1

200 ml or 1 ml 5X BloodDirect Buffer A, Human

Cat. No. 71343

200 ml or 1 ml 5X BloodDirect Buffer 1

200 ml or 1 ml 5X BloodDirect Buffer B, Mouse

Additional Information AvailableBloodDirect PCR Buffer Kit User Protocol TB404inNovations No. 18

Product Size Cat. No. PriceBloodDirect™ PCR Buffer Kit, Human

50 rxn250 rxn

71342-371342-4

BloodDirect™ PCR Buffer Kit, Mouse

50 rxn250 rxn

71343-371343-4

Features• Enables direct PCR amplification from

anticoagulant-treated blood• Ideal for genotyping and genetic screening experiments,

including routine transgenic mouse genotyping• No DNA extraction required• Compatible with fresh, stored, and dried blood samples• Minimizes risk of sample cross-contamination• Requires as little as 0.5 ml human or mouse blood

BloodDirect™ PCR Buffer Kits PCR amplification directly from human or mouse blood

BloodDirect™ PCR Buffer Kits are novel buffers that neutralize DNA polymerase inhibitors present in human or mouse blood. This eliminates all sample pretreatment steps and allows direct PCR amplification from as little as 0.5 µl of blood treated with any commonly used anticoagulant.

Blood samples and other biological fluids contain a variety of Taq DNA polymerase inhibitors such as polysaccharides, proteins, lipids and their conjugates, hemoglobin, and heparin. Sequestration of these substances from the DNA template is necessary prior to PCR amplification. BloodDirect PCR buffers neutralize charge-bearing inhibitory substances that might bind to DNA polymerase or template DNA. This ensures successful PCR amplification directly from blood.

Each BloodDirect PCR Buffer Kit includes two components: 5X BloodDirect Buffer 1 and either 5X BloodDirect Buffer A in the human kit or 5X BloodDirect Buffer B in the mouse kit. These buffers are added to the PCR mixture in place of 10X PCR buffer. Anticoagulant-treated blood sample (1 µl per 50-ml mixture, 0.5 ml per 20-ml mixture) is added as the final component.

BloodDirect Kits can be used in genotyping and genetic screening experiments with fresh blood samples, with samples stored at –20°C for up to four years, and with archived dried blood samples stored on filter paper or specimen collection cards. BloodDirect PCR Buffer Kit for mouse blood is ideal for routine transgenic mouse genotyping. The simple protocol dramatically reduces the risk of cross-contamination and sample mishandling.

BloodDirect Kits are compatible with commercially available Taq DNA polymerases, except for chemically-modified hot start DNA polymerases. To perform hot start PCR with BloodDirect PCR Buffer Kits, use any antibody-mediated hot start DNA polymerase, for example, NovaTaq™ DNA Polymerase plus Taq Antibody.




PCR • Direct PCR from Blood

17


Typical PCR setup and cycling conditions

Final Volume

Treatment 50 ml 20 ml

5X BloodDirect Buffer 1 10 ml 4 ml

5X BloodDirect Buffer A (or B)

10 ml 4 ml

dNTP mixture (2.5 mM each) 4 ml 1 ml

5’-primer† 0.5 mM 0.125 mM

3’-primer† 0.5 mM 0.125 mM

Taq DNA polymerase (5 U/ml) 0.25 ml 0.1 ml

PCR-grade water to 50 ml to 20 ml

Anticoagulant-treated blood 1 ml 0.5 ml

Cycling Conditions

94˚C, 4.5 min*

94˚C, 30 s

Annealing temperature, 1 min

40 cycles

72˚C, 1 min

72˚C, 7 min

* Preheating at 80˚ C for 15 min is recommended when fresh blood (collected on the same day as PCR amplification) is used.

† Final concentration

M 1 2 3 4 N M 1 2 3 4 N M 1 2 3 4 N M

β-globin protein S HLA DPB1

← 408 bp ← 280 bp ← 213 bp

Comparison of direct PCR using fresh, dried, and purified DNA samples from human blood

PCR amplifications (50 µl) were performed with BloodDirect buffers and NovaTaq™ DNA Polymerase using the cycling conditions listed in the table (PCR setup and cycling conditions) with annealing at 55°C. Targetsequences included β-globin, protein S, and HLA DPB1. PCR samples(5 µl) of the total reaction volume was analyzedby agarose gel electrophoresis (2.5% TAE) and ethidium bromide staining. Lane 1: 1 µl EDTA-treated human blood;Lane 2: blood dried in PCR tube; Lane 3: blood absorbed on filter paper (4-mm diameter); Lane 4: purified DNAequivalent to 1 µl blood; Lane N: negative control; Lane M: markers.

← 521 bp

A. Heparinized blood samples

B. Purified DNA samples

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 M

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 M

← 521 bp

Screening for transgenic mice by BloodDirect PCR analysis

PCR analysis to detect the lck promoter-human D4-GD1 transgene was performed using BloodDirect buffers andNovaTaq DNA Polymerase. For heparinized blood samples, the cycling conditions listed in the table above (Typical PCR setup and cycling conditions) were used with annealing at 55˚C; for purified DNA samples, theconditions were modified (30 cycles and a 30-s annealing at 55˚C). Panel A shows the results from 1-ml samplesof heparinized blood; Panel B shows the results from 200-800 ng of each DNA purified from the tails of the same19 mice. A total reaction volume of 5 ml was analyzed by agarose gel electrophoresis (2.5% TAE) andethidium bromide staining. Lane M: markers.

BloodDirect™ PCR Buffer Kits Continued


18

RT - PCR


PCR • RT - PCR

18

The One Step RT-PCR Master Mix Kit* allows rapid, sensitive analysis of gene expression from tissues and cells. One Step RT-PCR Master Mix Kit can replace methods for detecting and quantifying gene expression such as Northern blots, in situ hybridization, dot blots, S nuclease assays and conventional two step RT-PCR. The kit utilizes recombinant Thermus thermophilus (rTth) DNA Polymerase, which acts as both a thermostable RNA-dependent DNA polymerase and a DNA-dependent DNA polymerase. The rTth DNA Polymerase is provided in a 2X master mix with an antibody for antibody-mediated hot start, optimized buffer, and ultrapure deoxynucleotides. Antibody-mediated hot start enhances specificity of both reverse transcription and PCR. The kit enables cDNA synthesis from input RNA followed by PCR amplification of the cDNA in a single reaction, with no additional hands-on requirement for buffer changes or adding reagents. Typically, detection of a specific transcript requires only 2 hours.

We recommend using either two gene-specific primers or oligo (dT) and one gene-specific 5´-primer with the kit. Although rTth adds 3´ dA overhangs, it is generally not recommended for PCR product cloning because the rTth error rate is higher than standard Taq DNA Polymerase. This kit is ideal for the rapid screening of gene expression.

One Step RT-PCR Master Mix Kit Convenient one-enzyme, hot start master mix system for RT-PCR

Additional Information AvailableOne Step RT-PCR Master Mix Kit User Protocol TB508

Components2 × 625 ml 2X One Step RT-PCR Master Mix1 × 200 ml 50 mM Mn(OAc)2

1 × 1.1 ml RNase Free Water1 × 50 ml Primer F (10 pmol/ ml)1 × 50 ml Primer R (10 pmol/ ml)1 × 50 ml Positive Control RNA (5 × 108 copies/ml)

Product Size Cat. No. PriceOne Step RT-PCR Master Mix Kit

50 rxn 71978-3

Features and Benefits:• Robust one-step, one-enzyme master mix system for easy

reaction assembly• Eliminates the risk of cross contamination associated with

two-step RT-PCR protocols• High-temperature (60°C) for reverse transcription

enhances read-through of RNA secondary structure• Ideal for gene expression studies• Compatible with real-time RT-PCR• Optimized buffer conditions and antibody-mediated hot

start for increased sensitivity• Rapid enzyme activation step (30 s) avoids damage of

template RNA

Page 20



RT - PCR


PCR • RT - PCR

19

First Strand cDNA Synthesis Kit Reliable preparation of templates for RT-PCR

The First Strand cDNA Synthesis Kit is designed for the preparation of high-quality first strand cDNA from cellular RNA templates. The kit contains MMLV Reverse Transcriptase for superior yields of full-length cDNA. Both oligo(dT) and random hexamer primers are included for a choice of general priming strategies and as alternatives to user-supplied specific primers. A small volume (1-2 ml) of the first strand cDNA reaction can be used in PCR amplification with KOD DNA Polymerase. Use this kit in conjunction with the Straight A’s™ mRNA Isolation System and appropriate PCR reagents to amplify rare coding regions.

Components4000 U MMLV Reverse Transcriptase

200 ml 5X First Strand Buffer

100 ml 100 mM DTT

50 ml 10 mM dNTP Mix

20 mg Oligo(dT) Primer

10 mg Random Hexamer Primers

1.5 ml Nuclease-free Water

100 pmol Positive Control Primer, 3’ AS

100 pmol Positive Control Primer, 5’ S

M AS AS +

RH

dT AS +

dT

RH

PCR of first strand cDNA

The positive control RNA was subjected to first strand cDNA synthesis with various primer combinations followed by addition of the 5'-sense Control Primer (and antisense Control Primer, where appropriate) and amplification. First strand primersare indicated. AS: antisense Control Primer, RH: random hexamers, dT: oligo (dT).

Product Size Cat. No. PriceFirst Strand cDNA Synthesis Kit

40 rxn 69001-3

Oligo(dT) primer 20 µg 69896-3


20

Thermostable DN

A Polymerases Resource G

uide


PCR • Resource Guide

20

RESO

URCE

GUIDE

What is the difference between NovaTaq™ and KOD polymerases?NovaTaq DNA Polymerase is a premium quality recombinant form of Thermus aquaticus DNA polymerase. The enzyme possesses 5´ to 3´ DNA polymerase activity and lacks 3´ to 5´ exonuclease activity (proofreading). The preparation is >95% pure and lacks RNase and endonuclease activities. NovaTaq DNA Polymerase generates PCR products with 3´-dA overhangs.

KOD is a recombinant form of Thermococcus kodakaraensis KOD1 DNA Polymerase. The enzyme's 3´ to 5´ exonuclease- dependent proofreading activity results in an extremely low mutation frequency. The extension speed of KOD is 2X faster than Taq, enabling shorter reaction times. KOD DNA polymerase produces blunt-ended DNA products.

Why should I use KOD DNA polymerases?KOD DNA Polymerase is an ultra high fidelity thermostable DNA polymerase and a number of independent studies have verified the extreme high fidelity of KOD DNA Polymerase compared to other thermophilic polymerases (Takagi 1997, Nishioka 2001, Rual 2004, Wu 2006). In addition to a low mutation frequency, the fast extension rate and high processivity of KOD result in higher yields of full-length product in fewer reaction cycles. Combined, these make KOD DNA polymerases the PCR enzyme of choice when speed and fidelity matter.

Nishioka, M. et al. 2001. J. Biotech. 88, 141.Rual, J-F. et al. 2004. Genome Res. 14, 2128.Takagi, M. et al. 997 Appl. Environ. Microbiol. 63, 4509.Wu, G. et al. 2006. J. Biotechnol. 124, 496.

Are the Novagen® polymerases “proofreading”? What type of proofreading mechanism do NovaTaq and KOD polymerases use?KOD, KOD Hot Start, and KOD Xtreme™ polymerases all possess 3´ to 5´ exonuclease proofreading activity, making them ideal for applications where fidelity is essential, such as PCR from reverse transcription reactions and cloning. KOD XL is a mixture of traditional KOD and its exonuclease-deficient mutant. NovaTaq polymerase does not have proofreading activity. a. KOD – 3´ to 5´ exonuclease proofreading activityb. KOD Hot Start – 3´ to 5´ exonuclease proofreading activityc. KOD XL – mixture of KOD (with exonuclease proofreading activity) and its exonuclease-deficient mutant.

d. KOD Xtreme – 3´ to 5´ exonuclease proofreading activitye. NovaTaq – lacks 3´ to 5´ exonuclease proofreading activityf. NovaTaq Hot Start – lacks 3´ to 5´ exonuclease proofreading activity

What types of ends do the various Novagen polymerases leave on PCR amplification products?Generally, proofreading polymerases that possess 3´ to 5´ exonuclease activity will remove the 3´-dA overhangs whereas non-proofreading polymerases will not.a. KOD – blunt endsb. KOD Hot Start – blunt endsc. KOD XL – mixture of blunt ends and 3´-dA overhangsd. KOD Xtreme – blunt endse. NovaTaq – 3´-dA overhangsf. NovaTaq Hot Start – 3´-dA overhangs

What does “hot start” mean and what are the advantages?While it is most convenient to set up PCR reactions at ambient temperature, this can lead to mispriming events that result in non-specific amplification products. In addition, the exonuclease activity possessed by proofreading enzymes, such as KOD, can lead to primer degradation. “Hot start” means that the polymerase is not active until cycling temperatures are increased to activate the polymerase. This eliminates the mispriming and primer degradation concerns described above, resulting in greater specificity and increased target yield. In addition, “hot start” enzymes offer convenience of the room-temperature reaction set-up.

How does the hot start work with Novagen polymerases?KOD Hot Start is a premixed complex of KOD DNA Polymerase and two monoclonal antibodies. The antibodies inhibit the 3´ to 5´ exonuclease and DNA polymerase activities at ambient temperatures, providing high template specificity by preventing primer degradation and mispriming during reation set-up.

NovaTaq Hot Start is a chemically modified form of Taq DNA Polymerase that is inactive at room temperature. The enzyme must be activated by heat treatment (10 minutes at 95˚C), after which thermal cycling can proceed.

FAQ


Thermostable DN


uide



21

RESO

URCE

GUIDE

What is the difference between KOD XL and KOD Xtreme™ Hot Start DNA Polymerases?KOD XL is designed for accurate and rapid amplification of complex, GC-rich, and long (up to 30 kb) target DNA. KOD XL is an optimized mixture of KOD DNA Polymerase and a mutant form of KOD that is deficient in 3´ to 5´ exonuclease activity, resulting in increased efficiency and better yield of long targets. KOD XL is the only variation of KOD polymerase known to work in reactions for incorporation of modified dNTPs.

KOD Xtreme™ Hot Start is an optimized PCR system for the amplification of long or GC-rich DNA templates. The system includes an ultra high fidelity KOD DNA Polymerase complexed with two monoclonal antibodies to permit hot start thermocycling, along with specially formulated 2X Xtreme buffer. KOD Xtreme quickly and accurately amplifies genomic and phage/plasmid DNA targets up to 24 and 40 kbp, respectively. KOD Xtreme successfully amplifies challenging DNA templates with up to 90% GC content. Relative fidelity is higher than that of KOD XL.

Can I use KOD DNA polymerases for site-directed mutagenesis?KOD DNA polymerases are an ideal choice for site-directed mutagenesis protocols. These polymerases possess ultra-high fidelity, providing a reduced chance of unintentional changes. This high fidelity combined with high processivity and fast extension rate, allow for efficient amplification of plasmids over 10 kb with only the desired mutation. Below are selected citations of KOD Hot Start used for site-directed mutagenesis.

Deigendesch, N. et al. 2006 Nucleic Acids Res. 34, 5007Konno, A. et al. 2007 Mol. Biol. Evol. 24, 2504.Liang, J. et al. 2007 Nucleic Acids Res. 35, 2944.

Are there any special recommendations for using KOD with GC-rich targets?KOD Xtreme Hot Start DNA Polymerases has been specifically formulated for difficult targets, including GC-rich targets. Additions, such as DMSO or other additives, are generally not needed.

With other KOD polymerases, the addition of DMSO to 2-10% final concentration may decrease template secondary structure and increase yield. Final DMSO concentrations of less than 5% v/v have no effect on fidelity. The effect of DMSO above 5% v/v on enzyme fidelity has not yet been determined.

Are there any special recommendations for using KOD with long targets?In addition to trying one of our polymerases specialized for long targets (KOD XL or KOD Xtreme), it is often beneficial to adjust the final Mg2+ concentration. Adjusting the final MgSO4 concentration from 1.5 to 2.25 mM in 0.25 mM increments should be tried when suboptimal results are obtained for targets over 3000 bp. Also, the addition of DMSO to 2-10% v/v final concentration may reduce secondary structure of the template DNA and increase yield. The 2X Xtreme Buffer supplied with KOD Xtreme polymerase has been optimized for long targets. The addition of DMSO or other additives is generally not needed when using KOD Xtreme polymerase.

I see smearing of my PCR products after cycling when using KOD. What is causing this and how can I get rid of it?Because KOD has higher processivity and faster reaction times, it is important to adjust extension times to 10-25 s/kb.

Smearing can be caused by too long or short extension times. If the smear is above the target size, extension time can be reduced by 5 s/kb and/or the Mg2+ concentration can be reduced in 0.25 mM increments. If the smearing is below the target size, we would recommend increasing the extension time by 5 s/kb and/or increasing the Mg2+ concentration in 0.25 mM increments. Smearing can also sometimes be reduced by reducing the amount of template DNA added to the reaction.

If not using a hot start enzyme, smearing can be caused by exonuclease activity during reaction set-up. Reactions should be set up on ice to avoid degredation.

FAQ


22

Thermostable DN


uide



22

RESO

URCE

GUIDE

Protocol Comparison

PfuTurbo® Hot Start

PfuUltra Hot Start

Herculase® Hot Start

Platinum® Pfx

Company Stratagene Stratagene Stratagene Invitrogen

Target Size genomic up to 19 kb phage up to 20 kb

genomic up to 6 kb (use 5 U/rxn for genomic > 6kbp) vector up to 17 kb

genomic up to 37 kb

vector up to 48 kb

up to 12 kb

Fidelity 6-fold higher than Taq 18-fold higher than Taq 3-fold higher than Taq 26-fold higher than Taq

Ends blunt blunt mixed blunt

Other target info For GC rich, long, and challenging targets

Enzyme/50 µl rxn 2.5-5 U/rxn 2.5-5 U/rxn 2.5-5 U/rxn 1-2.5 U/rxn

Activate 95˚C for 2 min 95˚C for 2 min 95˚C for 2 min 94˚C for 2 min

Denature 95˚C for 30 s 98˚C for 30 s 98˚C for 30 s 94˚C for 15 s

Anneal Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s 55˚C for 30 s

Extend 72˚C for 5 min 72˚C for 10 min 10 cycles: 72˚C for 5 min 20 cycles; 72˚C for 5 min + 10 s/cycle

68˚C for 5 min

Final Extension time 72˚C for 5 min 72˚C for 10 min 72˚C for 10 min n/a

# of cycles 30 30 30 30

Reaction time for a 5 kb target amplified from plasmid

3 h, 12 min 3 h, 12 min 3 h, 43 min 2 h, 53 min


KOD Hot Start KOD Xtreme™ Hot Start

Phusion™ Hot Start

PfuUltra® II Fusion HS

Company Merck Chemicals Merck Chemicals NEB/Finnzymes Stratagene

Target Size genomic up to 12 kb phage/plasmid up to 21 kb

genomic up to 24 kb

phage/plasmid

up to 40 kb

genomic up to 7.5 kb genomic up to 19 kb (use 5U/rxn for genomic > 6 kb) vector up to 20 kbp

Fidelity 50-fold higher than Taq 11-fold higher than Taq 52-fold higher than Taq 20-fold higher than Taq

Ends blunt blunt blunt blunt

Other target info For targets up to 90% GC

Enzyme/50 µl rxn 1 U/rxn 1 U/rxn 1 U/rxn 1 µl/rxn

Activate 95˚C for 2 min 94˚C for 2 min 98˚C for 30 s 95˚C for 2 min

Denature 95˚C for 20 s 98˚C for 10 s 98˚C for 30 s 95˚C for 20 s

Anneal Lowest Tm for 10 s Lowest Tm for 30 s Tm + 3 for 30 s Lowest Tm-5 for 20 s

Extend 70˚C for 2 min, 5 sec

68˚C for 5 min

72˚C for 1 min, 15 s

72˚C for 1 min, 15 s

Final Extension time n/a n/a 72˚C for 10 min 72˚C for 3 min

# of cycles 25 30 30 30

Reaction time for a 5 kb target amplified from plasmid

1 h, 10 min 2 h, 51 min 1 h, 8 min 1 h, 3 min

Thermostable DN


uide



23

RESO

URCE

GUIDE

Technical Notes

Continues on page 24

IntroductionThermococcus kodakaraensis (strain KOD1), previously thought to be a Pyrococcus sp., is a hyperthermophilic archaea isolated from a solfataric hot spring on Kodakara Island, Japan (Atomi 2004). In preliminary studies to characterize the KOD1 DNA polymerase, researchers found that the enzyme had fidelity comparable to Pfu DNA polymerase, but with an extension rate (referred to as speed) 5 times higher and processivity 10 to 15 times higher than the Pfu enzyme (Takagi 1997). When amplifying DNA for cloning, high fidelity DNA polymerases, such as KOD polymerase, are recommended. If the enzyme is also fast and can generate high yields of full-length product, fewer amplification cycles are required and the probability of obtaining error-free clones is greatly increased.

Since the preliminary KOD DNA Polymerase studies, significant work has been done to optimize the PCR buffer and cycling parameters. Another improvement is KOD Hot Start DNA Polymerase, which is a premixed complex of KOD DNA Polymerase

and two monoclonal antibodies. The antibodies inhibit the 3´→5´ exonuclease and DNA polymerase activities at ambient temperatures (Mizuguchi 1999), providing high template specificity by preventing primer degradation and mispriming events during reaction set-up. This report evaluates the speed and product yield of KOD Hot Start DNA Polymerase in an optimized reaction buffer and compares the enzyme to 6 other commercially available high fidelity thermophilic DNA polymerases.

Materials and MethodsThermocyclerDNA amplification was performed on MJ Research PTC-200 thermocyclers that had recently been calibrated by the manufacturer. Reactions were going to be done in tube strips, always using the same polymerase in the same location on each strip. To ensure no bias due to the location of the reaction in the strip or in the thermocycler, test reactions were performed using KOD Hot Start DNA Polymerase, and reaction yields measured. Yields were found to be comparable for all tube locations and wells tested (data not shown).

Reaction volumeReaction volumes of 50, 25, 20, and 10 ml were tested to determine an optimum volume for consistent PCR results (data not shown). Both 50- and 25-ml reactions gave consistent results, and the 25-ml volume was used for the remaining experiments.

TemplateA 919-bp fragment of human GSK3α (glycogen synthase kinase 3α) catalytic domain ORF, 54% GC-content, in an Open Biosystems cDNA plasmid (MHS1010-7507851, GeneBank BC027984) was selected as the DNA template.

Primers/reagentsPrimers used were HPLC purified: (35-mer sense) 5´-GACGACGACAAGA TTTCCCAAGAAGTGGCTTACAC-3´ and (41-mer antisense) 5´-GAGGAGAAGC CCGGTCTTAACATCGCAGTTCATCAAAGA AG-3´. Bases shown in bold are homologous to the ORF. Table 1 shows the ion components used for each polymerase.

Comparing the Speed and Product Yield of 7 High Fidelity DNA Polymerases Keith Yaeger and Keith Fourrier - EMD Chemicals - Novagen - Madison, WI

Table 1. Reaction components and cycling profile for each DNA polymerase based on manufacturers’ recommendations

DNA Polymerase Buffer

[Mg2+] in reaction (mM)

added in 1X buffer[dNTP]

(mM each)[Primer]

(mM each)

Template/ 25-ml reaction

(ng)Polymerase*/

25-ml reactionCycling profile†

KOD Hot Start 1X 1.5 0.2 0.3 5 0.5 U 4

KOD 1X 1.5 0.2 0.3 5 0.5 U 1

Platinum® Pfx 1X 1.0 0.3 0.3 5 0.5 U 2

Pfx50™ 1X in buffer 1.2 0.3 0.3 5 2.5 U 2

Phusion™ Hot Start 1X in buffer 1.5 0.2 0.5 5 0.5 U 1

PfuUltra® II Fusion Hot Start 1X in buffer 2.0 0.25 0.2 5 0.5 ml (U not given) 3

PrimeSTAR® HS 1X in buffer 1.0 0.2 0.3 5 0.625 U 3

*Manufacturer defined units, used as recommended by manufacturer. † See Table 2 for cycling parameters


24

Thermostable DN


uide



24

RESO

URCE

GUIDE

Technical Notes

23 cycles 25 cycles

Lane DNA PolymeraseM PCR Markers1 KOD Hot Start2 KOD3 Platinum® Pfx4 Pfx50™5 Phusion™ Hot Start6 PfuUltra® II Fusion HS7 PrimeSTAR® HS


M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7

M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7

23 cycles 25 cyclesM 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7


M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7



M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7



Figure 1. PCR results from 7 high fidelity thermophilic DNA polymerases using 4 different cycling profiles PCR samples were removed after 23, 25, 27, and 29 cycles and 5 ml were assayed on 1.4% agarose/TAE gels. Lanes indicate the enzyme used for the reaction. Cycling profiles are defined in Table 2. (A) cycling profile 1 (Note: PicoGreen results indicate a yield increase with PrimeStar HS DNA Pol. from cycle 27 to cycle 29; the reduced band intensity here is a gel loading artifact), (B) cycling profile 2, (C) cycling profile 3, (D) cycling profile 4.

A.

B. C .

D.

Cycling profilesAll 7 enzymes were tested in 4 different cycling protocols, which encompass the manufacturers’ recommended cycling conditions (Table 2).

Results and DiscussionDifferent Cycling ProfilesMultiple reaction strips were prepared using master mixes for each polymerase. After 19, 21, 23, 25, 27, and 29 cycles, reaction strips were removed and placed on ice. Samples (5 ml) from cycles 23, 25, 27, and 29 were assayed on 1.4% agarose/TAE gels containing ethidium bromide (Figure 1). Yield concentrations were determined on diluted samples from 19, 21, 23, 25, 27, and 29 cycles using a Quant-iT™ PicoGreen® ds DNA Assay Kit (Invitrogen) and a FLUOstar plate reader (BMG LABTECH).

New primers and enzyme kits were obtained and all experiments were repeated to verify initial results and trends. Results with the new reagents were comparable to the initial experiments (data not shown).Yields generated by each enzyme at 19, 21, 23, 25, 27, and 29 cycles were plotted for each protocol. Not all enzymes gave their best yield using the manufacturer’s recommended cycling conditions, so the best yields for each enzyme, from any cycling protocol, were compared (Figure 2). For cloning purposes, fewer reaction cycles increase the potential for error-free clones. Cycles 19-25 have been shaded green on the graph to emphasize the reaction yields

Table 2. Cycling profiles used

Cycle Profile 1 Cycle Profile 2 Cycle Profile 3 Cycle Profile 4

Initial denaturation 98°C 30 s 94°C 2 min 95°C 2 min 95°C 2 min

29 cycles

98°C 10 s 94°C 15 s 95°C 20 s 95°C 20 s

55°C 20 s 52°C 20 s 55°C 20 s 55°C 10 s

72°C 30 s 68°C 60 s 72°C 30 s 70°C 15 s

Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A


Thermostable DN


uide



25

RESO

URCE

GUIDE

Technical Notes


from these earlier cycles. KOD Hot Start DNA Polymerase consistently gave high yields in cycles 19-25 for all 4 profiles tested. (data not shown)

2-Step PCRLonger primers (generally ≥23 bases) can increase PCR specificity and, due to higher annealing temperatures, can be used in time-saving 2-step cycling profiles. KOD Hot Start DNA Polymerase and the other 6 high fidelity enzymes were tested in a 2-step protocol (initial denaturation at 95°C for 2 min, and 29 cycles of 95°C for 20 s, 68°C for 40 s). Figure 3 shows that not all enzymes functioned well with this 2-step protocol (lanes with little or not product). Other enzymes, including the 2 KOD enzymes, generated high yields comparable to the 3-step protocols shown in Figure 1.KOD application - screening plaquesTesting the ability of KOD Hot Start DNA Polymerase to amplify a variety of DNA templates, the enzyme was used in a 2-step cycling profile to screen random clones from the T7Select® Human Brain cDNA Library (Cat. No. 70637). Plaques were eluted in 100 ml TE (10 mM Tris-HCl, 0.1 mM EDTA) and 5 ml eluate was used for PCR. Primers were: sense primer 5´-ACT TCC AAG CGG ACC AGA TTA TCG C-3´ and antisense primer 5´-AAC CCC TCA AGA CCC GTT TAG AGG-3´. Reactions were cycled with an initial denaturation at 95°C for 2 min, and 25 cycles of 95°C for 20 s, 68°C for 25 s. Of the 50 clones screened, KOD successfully amplified 49 inserts (Figure 4). Amplicons ranged in size from ~250-1800 bp.

0.00

0.50

1.00

1.50

2.00

2.50

3.00

3.50

4.00

19 21 23 25 27 29

KOD Hot Start (1)

KOD (1)

Pfx50™ (2)

Phusion™ Hot Start (3)

PfuUltra® II Fusion HS (2)

PrimeSTAR® HS (1)

Cycle number

Ampl

icon

yie

ld(µ

g/25

-µl r

eact

ion)

Platinum® Pfx (2)

Figure 2. Best yield for each high fidelity thermophilic enzyme from any cycling profile Yields were determined by PicoGreen analysis after 19, 21, 23, 25, 27, and 29 cycles for all 4 cycling profiles (Table 2). The best yield data for each enzyme, from any cycling profile, was graphed. The cycling profile that gave the best yields is identified in parentheses. The green shaded area highlights yields in cycles 19-25, which would be preferable for cloning.

Lane DNA PolymeraseM PCR Markers1 KOD Hot Start2 KOD3 Platinum Pfx4 Pfx505 Phusion Hot Start6 PfuUltra II Fusion HS7 PrimeSTAR HS



Figure 3. PCR results from 7 high fidelity enzymes using a 2-step cycling profile PCR samples were removed after 23, 25, 27, and 29 cycles of a 2-step protocol and 5 ml were assayed on 1.4% agarose/TAE gels. Lanes indicate the enzyme used for the reaction.


26

Thermostable DN


uide



26

RESO

URCE

GUIDE

Technical NotesKOD DNA polymerase (pol) fidelity in PCR has been assayed by different methods. Initial studies by Takagi et al. (1997) measured the mutation frequency in amplicons after 30 PCR cycles using a plasmid template containing the lacZ gene. By comparing the number of white and light blue colonies (mutant) to the total number of colonies (including blue, intact lacZ colonies), they determined mutation rates of 2.8% for KOD DNA pol, 3.6% for Pfu DNA pol, and 48.0% for Taq DNA pol. Using the same blue/white assay method, but with 25 cycles, Nishioka et al. (2001) found mutation frequencies of 0.79% for KOD DNA pol and 28.1% for Taq DNA pol. Rual et al. (2004) directly sequenced ~70,000 bases and determined a misincorporation rate of 1 in 35,000 nucleotides for KOD DNA pol compared to 1 in 2,000 nucleotides for Platinum® Taq DNA Polymerase High Fidelity in amplicons generated after 20 cycles of PCR. Discrepancies in mutation rates can be due to the different assay methods, as well as to thermal degradation of DNA at high temperatures, which is not related to enzyme function (Tindall 1988, Pienaar 2006). What stands out in these

independent assays is the consistent high fidelity of KOD DNA pol.

ConclusionA number of independent studies have verified the extremely high fidelity of KOD DNA Polymerase. In addition to a low mutation frequency, the fast extension rate and high processivity of the KOD enzyme result in high yields of full-length product in fewer reaction cycles. Combined, these attributes have made KOD Hot Start DNA Polymerase the PCR enzyme of choice for many routine and high throughput cloning and structural proteomics studies. ■ReferencesAtomi, H. et al. 2004. Archaea 1, 263.

Mizuguchi, H. et al. 1999. J. Biochem. (Tokyo) 126, 762.

Nishioka, M. et al. 2001. J. Biotech. 88, 141.

Pienaar, E. et al. 2006. Comp. Biol. Chem. 30, 102.

Rual, J-F. et al. 2004. Genome Res. 14, 2128.

Takagi, M. et al. 1997. Appl. Environ. Microbiol. 63, 4509.

Tindall, K.R. and Kunkel, T.A. 1988. Biochemistry 27, 6008.

Lane SampleM1 Perfect DNA™ Markers, 0.5-12 kbpM2 PCR Markers

Figure 4. Results from KOD Hot Start amplification of T7Select Human cDNA Library clones PCR was performed as stated in the text; 5 ml of each 25-ml reaction were assayed on a 1.4% agarose/TAE gel. KOD Hot Start successfully amplified 49 of 50 clones with amplicons ranging from ~250-1800 bp.


Thermostable DN


uide



27

RESO

URCE

GUIDE

Technical Notes


IntroductionAmong the persistent challenges of existing PCR systems are sample scarcity, time and cost efficiency, and the reliable amplification of problematic targets such as GC-rich DNA. The latest addition to our PCR system offering, the KOD Xtreme™ Hot Start DNA Polymerase System, addresses these issues, while still maintaining high accuracy and fast reaction rate.

Currently, efficient and reliable PCR systems require the prior purification of target DNA templates from samples of interest. In addition to the burdens of cost and time invested in the DNA purification procedures, this approach necessitates a larger amount of sample material, which in many cases is scarce. Furthermore, the amplification of GC-rich DNA templates often requires extensive time consuming optimization. The KOD Xtreme Hot Start DNA Polymerase System exploits the inherent high fidelity, fast extension rate, and processivity of DNA polymerase from Thermococcus kodakaraensis (KOD DNA polymerase) in a combination that permits hot start PCR and the amplification of difficult DNA targets, and facilitates PCR from whole blood or crude tissue lysates. This is all achieved with minimal optimization. The system includes:

1. The ultra high fidelity KOD DNA polymerase in complex with two neutralizing monoclonal antibodies that inhibit the DNA polymerase and the 3’5’ exonuclease activities at ambient temperature. This complex allows for antibody-mediated hot start

thermocycling, thereby ensuring high priming specificity and inhibition of primer degradation during setup at ambient temperature.

2. A specifically formulated 2X buffer which in combination with optimized reaction conditions, facilitates the amplification of GC-rich, long, and otherwise problematic target DNA sequences (Yaeger, 2008), as well as amplification from difficult samples such as whole blood or crude tissue lysates.

ResultsAs illustrated in Figure 1A, KOD Xtreme polymerase successfully amplified a 1.3 kb fragment of the b-globin gene from different sample sizes (1, 2, or 4 ml) of whole blood, with superior yield and reliability compared with other commercial PCR systems. This reliability and high yield were maintained with DNA templates up to 8.5 kb under the same reaction and cycling conditions, from only 2 ml of whole blood (Figure 1B), thus eliminating the usual need for further optimization when targeting larger DNA sequences or different amounts of starting sample material.

Figure 2 features the amplification of a 1.3 kb fragment of the rbcL gene from crude lysates of different plant tissues. The KOD Xtreme Hot Start DNA Polymerase System facilitated the successful amplification of the target gene fragment from crude lysates of two different tissue types (leaf and grain) of different plants

(tomato, tobacco, and rice) under the same cycling and reaction conditions with excellent yield. In contrast, the two competitor high-efficiency Taq-proofreading enzyme blends failed to yield any detectable PCR product from the same tissue lysates, yielding PCR product only when purified genomic DNA was used as template. Hence, the KOD Xtreme Hot Start DNA Polymerase System is an efficient and reliable PCR system that obviates the need for the purification of target genomic DNA from plant tissues, or the optimization of reaction or cycling conditions for different types of tissue lysates, thereby saving time, sample, and cost of PCR reagents and DNA purification systems.

Figure 3 illustrates the superior performance of the KOD Xtreme Hot Start DNA Polymerase System in genotyping PCR using crude mouse tail tissue lysates compared to a competitor’s high-efficiency Taq-proofreading enzyme blends commonly used for this purpose. The competitor’s PCR systems did not amplify the larger transgenic target sequence, and amplified the wild-type sequence with mostly moderate to low efficiency. In contrast, the KOD Xtreme Hot Start DNA Polymerase system efficiently and reliably amplified homozygous wild-type, homozygous transgenic, as well as heterozygous target genomic DNA with excellent yield.

Reliable and Efficient PCR from Whole Blood and Crude Tissue Lysates Using the KOD Xtreme™ Hot Start DNA Polymerase System


28

Thermostable DN


uide



28

RESO

URCE

GUIDE

Technical NotesSummaryThe KOD Xtreme™ Hot Start DNA Polymerase System has been optimized to provide the highest success rate even with the most challenging DNA targets and sample types. It is superior for the amplification of target DNA from whole blood or crude lysates of different types of tissues. This is in addition to offering fast reaction rates, high fidelity, and high efficiency amplification of long targets

and templates that are up to 90% GC-rich, with much enhanced yields and blunt ended DNA products suitable for cloning. To the end user, such superior performance is achieved with minimal manipulation and significant cost, time, and sample savings.

Acknowledgements: We would like to thank Akio Sugiyama, Toyobo Co., Ltd and Yuji Arai, National Cardiovascular Center, Japan for their

technical assistance in providing data and/or samples. We would also like to acknowledge the EMD Chemicals technical service scientists and others for their assistance in preparing this note.

References

Yaeger, K., et al. 2008 inNovations 28, 15.

Figure 1: Performance of the KOD Xtreme Hot Start DNA Polymerase System in Amplification from Whole Blood Samples

KOD Xtreme PfuTurbo® Ex Taq™ HS LA Taq™ HS TaqM 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M

Figure 1A

KOD XtremeM1 1 2 3 M2

Figure 1B

A. Reactions (50 μl each) were set up to amplify a 1.3 kb region of the b-globin gene from 1, 2 or 4 µl of untreated whole blood (lanes numbered 1, 2, and 3, respectively). B. PCR reactions were set up to amplify a 1.3 kb region, a 3.6 kb region, or an 8.5 kb region of the b-globin gene (lanes 1, 2, and 3, respectively) from 2 μl of untreated whole blood. For both A and B, PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kbp. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used. M and M1: 1 kbp Ladder; M2: l/Hind III Marker.

Primers:

<b-globin 1.3 kb>

Primer F: 5’-TTAGGCCTTAGCGGGCTTAGAC-3’

Primer R: 5’-CCAGGATTTTTGATGGGACACG-3’

<b-globin 3.6 kb>

Primer F: 5’-GGTGTTCCCTTGATGTAGCACA-3’

Primer R: 5’-ACATGTATTTGCATGGAAAACAACTC-3’

<b-globin 8.5 kb>

Primer F: 5’-TGATAGGCACTGACTCTCTGTCCCTTGGGCTGTTT-3’

Primer R: 5’-ACATGATTAGCAAAAGGGCCTAGCTTGGACTCAGA-3


Thermostable DN


uide



29

RESO

URCE

GUIDE

Technical NotesFigure 2: Performance of the KOD Xtreme™ Hot Start DNA Polymerase System in Amplification from Crude Lysates of Different Plant Tissues

KOD Xtreme Ex Taq™ HS LA Taq™ HS1 2 3 4 5 M 1 2 3 4 5 M 1 2 3 4 5

Lane SamplesM 1 kbp Ladder1 Tomato leaf2 Tobacco leaf3 Rice leaf4 Rice grain5 Purified rice leaf DNA

Reactions (50 μl each) were set up to amplify a 1.3 kb region of the rbcL gene from each of the indicated crude plant tissue lysates. All tissues (~ 3 x 3 mm piece of leaf or one rice grain) were extracted for 10 minutes at 95°C in 100 mM Tris-HCl (pH 9.5), 1 M KCl, 10 mM EDTA, and 1 ul of each of the extracts was used in the corresponding amplification reaction. PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 1.5 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used.

Reactions (50 μl each) were set up to amplify a 1.5 kbp region or a 3.1 kbp region of the wild-type or transgenic gene, respectively, from the indicated mouse tail tissue lysates. Tissue fragments (~ 3 mm-long tail piece each) were extracted in 50 mM NaOH for 10 minutes at 95°C, neutralized with one-tenth volume of 1 M Tris-HCl, pH 8.0, spun at 12,000 rpm for 5 min, and 1 μl of each of the clarified extracts was used in the corresponding amplification reaction. PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 3 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used. Tg: transgenic; W: wild-type.

Primers:

F1: 5’-ATGTCACCACAAACAGAGACTAAAGC-3’ (Tomato & Tobacco)

R1: 5’-AAGCAGCAGCTAGTTCCGGGCTCCA-3’ (Tomato & Tobacco)）

F2: 5’-ATGTCACCACAAACAGAAACTAAAGC-3’ (Rice)

R2: 5’-AAGCTGCGGCTAGTTCAGGACTCCA-3’ (Rice)

Primers:

F: 5’-TGGACGTGAGCTTCAGCAC-3’

R: 5’-AGGCCTGACAGTAGCTCAG-3’

* The mouse tail samples were provided by Dr. Yugi Arai, National Cardiovascular Center, Japan.

Figure 3*: Genotyping of Transgenic Mice by PCR from Mouse Tail Tissue Lysates Using KOD Xtreme Hot Start DNA Polymerase System

KOD Xtreme Ex Taq™ HS LA Taq™ HS1 2 3 M 1 2 3 M 1 2 3

Lane SamplesM 1 kbp Ladder1 Tg/Tg2 Tg/W3 W/W


30

Thermostable DN


uide



30

RESO

URCE

GUIDE

Technical Notes

Real-time PCR methods are used to determine the level of specific mRNA or DNA sequences. These real-time methods may be used in a number of different application areas including analyzing gene expression, genotyping studies, and pathogen detection. We have demonstrated that NovaTaq™ Hot Start Master Mix can be used in real-time PCR amplification of various templates to obtain reproducible results and robust amplification of low copy number genes. In this article, a comparison of competitors’ PCR mixes indicates NovaTaq Hot Start Master Mix provides superior amplification and specificity.

Real-time PCR Amplification from cDNA with NovaTaq™ Hot Start Master MixReal-Time PCR was performed using a linearized plasmid containing the glycogen synthase kinase 3 alpha (GSK3α) cDNA. The stock DNA at 5 × 108 copies/µl was 10-fold serially diluted in TE and reactions were run in triplicate. The following parameters were used on the Chromo4 Real-Time PCR Detection System(Bio-Rad): initial denaturation at 95°C for 10 minutes; followed by 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 10 seconds for 45 cycles. The primer/probe mix was designed to target a 112 bp amplicon of GSK3α. DNA was

detected using a HEX-labeled probe. Figure 1, Panel A shows the amplification curves for the real-time PCR and the reproducibility of the amplification using NovaTaq Hot Start Master Mix Kit over a range of template concentrations. In figure 1, Panel B the cycle threshold (Ct) is plotted against DNA concentration. This yielded a standard curve with a correlation of 1, showing that NovaTaq Hot Start Master Mix gave linear results for 10 to 109 copies of the plasmid.

Reliable and Robust Real-time Amplification Using NovaTaq™ Hot Start Master Mix Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI

Figure 1. Linearized cDNA plasmid amplified using NovaTaq Hot Start Master Mix

Panel A

Panel A

Panel B

Panel B

Real-Time PCR Amplification from Human Genomic DNA with NovaTaq Hot Start Master MixHuman Genomic DNA (Cat No. 69237) was serially diluted 10-fold in TE (10mM Tris, pH 8 from 50 ng/µl. The primer/probe mix was designed to target a 139 bp amplicon of GSK3α. The cycling profile using the Bio-Rad Chromo4 Real-

Time PCR Detection System was: initial denaturation at 95°C for 10 minutes; followed by 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 10 seconds for 45 cycles. DNA was detected using a HEX-labeled probe. All reactions were performed in triplicate. Amplification was seen down to a level of approximately 3 copies per reaction as indicated by the

amplification curves (Figure 2, Panel A). Ct vs. DNA concentration (Figure 2, Panel B) yielded linear results for 0.01 to 100 ng genomic DNA. Note that 0.001 ng would correlate to about 0.3 copies of the target sequence and one of the three experiments performed in triplicate gave a signal while the other two were negative.

Panel A. Amplification curve Trace color 109 Copies 108 Copies 107 Copies 106 Copies 105 Copies 104 Copies 103 Copies 102 Copies 101 Copies

Figure 2. Serially diluted human genomic DNA amplified using NovaTaq Hot Start Master Mix


Thermostable DN


uide



31

RESO

URCE

GUIDE

Technical NotesPerformance of NovaTaq™ Hot Start Master Mix in quantitative PCR versus competitors' PCR mixes.Total RNA was isolated from mouse 3T3 cells and cDNA was synthesized using MMLV reverse transcriptase. A 122 bp region of the mouse b-actin coding sequence was amplified from 15 ng/µl of cDNA using NovaTaq Hot Start DNA

Polymerase or qPCR mixes from the indicated manufacturer. DNA was detected using SYBR® Green dye. Each reaction was performed in triplicate. The following parameters were used with a Corbett Rotorgene 6000: initial denaturation at 95°C for 10 min; followed by 95°C for 10 s, 55°C for 15 s, and 72°C for 20 s for 40 cycles. The amplification curves are

shown on the right. The melting analysis (curves shown on the left) was done with a temperature range of 60°C to 99°C, acquiring at each degree. A single peak in the melting curve demonstrates specificity of the reaction. Multiple peaks indicate that secondary products were also amplified.

Figure 3. NovaTaq Hot Start DNA Polymerase – Red

Invitrogen – Green

Invitrogen's polymerase shows lower amplification effi-

ciency as indicated by the lower fluorescence intensity.

SummaryWe have demonstrated that NovaTaq Hot Start Master Mix Kit may be used for real-time PCR of plasmid, genomic, and first

strand cDNA. The data obtained using this enzyme premix are reproducible and allows for the analysis of low copy number genes. NovaTaq Hot Start Master

Mix has a higher amplification efficiency and specificity than several competitors’ PCR mixes.


Qiagen - Green

NovaTaq Hot Start DNA Polymerase shows superior am-plification efficiency as indicated by the much higher fluorescence intensity.


KAPA Biosystems – Green

KAPA Biosystems polymerase demonstrates poor reaction specificity as demonstrated by the multiple peaks in the

melting curve.


Stratagene - Green

NovaTaq Hot Start DNA Polymerase shows superior am-plification efficiency as indicated by the much higher

fluorescence intensity.


32

Thermostable DN


uide



32

RESO

URCE

GUIDE

Technical Notes

Reverse transcription followed by polymerase chain reaction (RT-PCR) allows amplification and detection of very low amounts of RNA. The technique is important for gene expression profiling and RNA virus detection. In addition to using purified RNA as a template, RT-PCR kits may be used directly with crude lysates of mammalian cells, a technique that can be used to compare mRNA levels in different cells.

The Novagen® brand One Step RT-PCR Master Mix Kit allows for mRNA amplification in a single tube because it contains recombinant Thermus

thermophilus (rTth) DNA Polymerase, which functions as both a thermostable RNA–dependent DNA polymerase and a DNA–dependent DNA polymerase. The anti-rTth antibody included in the mix enhances the specificity of the reverse transcription by binding the polymerase and reducing mispriming during reaction assembly. The high optimal temperature for polymerization by rTth polymerase in reverse transcription offers the advantage of increased success by reducing secondary mRNA structure and the single reaction set up reduces chances of contaminating the samples with exogenous DNA, RNA or nucleases

allowing for a sensitive detection of RNA. One Step RT-PCR Master Mix Kit is compatible with SYBR® Green, providing fluorescent signal to detect the amplified region and melt analysis to confirm homogeneity of product. In this article, the One Step RT-PCR Master Mix Kit was used to amplify mRNA directly from mammalian extracts. Duplex RT-PCR using the same crude extract demonstrates that the One Step RT-PCR Master Mix can be used to analyze two targets in a single reaction when probes are used as the detection method.

One Step Real-Time Amplification of mRNA Using the One Step RT-PCR Master Mix Kit Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI

Real-Time PCR from Crude LysateTo test the ability of the One Step RT-PCR Master Mix Kit to amplify mRNA from HeLa cell lysates in a real-time reaction using SYBR Green I for detection.

HeLa cells (5X105 cells) were cultured in DMEM, pelleted, and stored at -70°C. The cell pellet was treated with 50 µl of

CytoBuster™ Protein Extraction Reagent (Cat. No. 71009) to lyse cells and 40 units RNase Inhibitor (Cat. No. 556881). An addition of 50 µl of TE (10 mM Tris, pH 8, 1mM EDTA) + 0.02% Triton X-100 was added to yield a lysate containing 5000 cell equivalents/µl. The lysate was two-fold serially diluted in TE + 0.02% Triton X-100, and 2 µl of each dilution was used as template in 50 µl

RT-PCR reactions that were done in triplicate. The primers used targeted a 99 bp amplicon from exon 3 to exon 4 of cyclophilin B (PPIB, genomic accession NT_010194.16).

PCR was performed Chromo4 Real-Time PCR Detection System (Bio-Rad) and SYBR Green I was from Invitrogen. Table 1 contains the cycling parameters.

CYCLING STEP Time/temperature

1. Polymerase Activation 30 s at 90°C

2. Reverse Transcription 15 min at 60°C

3. Denaturation 30 s at 94°C

4. Denaturation 1 s at 95°C

5. Annealing 15 s at 50°C

6. Extension 5 s at 72°C

Repeat Steps 4-6 for 40 cycles

Table 1


Thermostable DN


uide



33

RESO

URCE

GUIDE


Technical Notes

We observed excellent yield and reproducibility as shown in the amplification curves (Figure 1, Panel A). The signals titrated from 10,000 to 10 cells as shown by the standard curve with a correlation of 0.999 (Figure 1 Panel C). The melting curve (Figure 1, Panel B) shows a single product was amplified.

Figure 1. PPIB mRNA amplified from crude HeLa lysates

Panel A: Amplification Curve

Panel C: Ct vs. Cell Number

Panel B: Melting Curve

Trace colors 10000 Cells 5000 Cells 2500 Cells 1250 Cells 625 Cells 313 Cells 156 Cells 78 Cells 39 Cells 20 Cells 10 Cells No Template Control


34

Thermostable DN


uide



34

RESO

URCE

GUIDE

Technical Notes

SummaryReal time reverse transcription PCR is a powerful technique in functional proteomics. The Novagen® One Step RT-PCR Master Mix Kit provides results that are reproducible and robust.

Figure 3: GSK3α mRNA amplified from crude Hela cell lysates using the One Step RT-PCR Master Mix Kit and HEX Dye.

Panel A: Amplification Curve Panel B: Ct vs. Cell Number

Trace color 5000 Cells 2500 Cells 1250 Cells 625 Cells 313 Cells 156 Cells 78 Cells 39 Cells 20 Cells 10 Cells

Duplex Real-Time PCR with One-Step RT-PCR Master Mix The template used in the duplex RT- PCR experiment was the same HeLa cell preparation used in the SYBR® Green I experiments previously described. In the reactions, the primer Set I targeted a 99 bp amplicon spanning from exon 3 to exon 4 of PPIB. Primer Set II targeted an 112bp amplicon spanning from exon 4 to exon 5 of glycogen synthase kinase 3 alpha (GSK3α, genomic accession NC_000019). FAM Dye was used to detect PPIB and HEX dye was used to detect GSK3α. Reactions were performed in triplicate using the Chromo4 Real-Time PCR Detection System (Bio-Rad) with the cycling conditions described in Table 1. The plate was read after step 5 for these experiments. Figures 2 and 3 shows that PPIB and GSK3α are efficiently amplified in the same reaction and the signal titrates well from 5000 to 10 cells with a standard curve with a correlation coefficient of 0.997.

Figure 2: PPIB mRNA amplified from crude HeLa cell lysates using the One Step RT-PCR Master Mix Kit and FAM Dye.

Panel A: Amplification Curve Panel B: Ct vs. Cell Number

Trace color 5000 Cells 2500 Cells 1250 Cells 625 Cells 313 Cells 156 Cells 78 Cells 39 Cells 20 Cells 10 Cells


Thermostable DN


uide



35

RESO

URCE

GUIDE

Technical NotesDetection of Shiga toxin-producing E. coli using multiplex colony-direct PCR with KOD XL DNA PolymeraseOkitsu, T., Suzuki, R., Yamai, H. Bacterial Pathology Department, Kanagawa Prefecture Health Research Institute, Japan

Certain strains of E. coli are known to pro-duce a family of related toxins, referred to as Shiga toxin 1 (Stx1, encoded by stx1) and Shiga toxin 2 (Stx2, encoded by stx2). Shiga toxin-producing E. coli (STEC), represented by serotype O157:H7, has a strong infectious capacity and pathoge-nicity. In recent years, this bacterium has been affecting an increasing number of victims, resulting in life-threatening ill-ness such as hemorrhagic colitis, hemo-lytic-uremic syndrome, and thrombotic thrombocytopenic purpura (1). The mor-bidity and mortality associated with STEC disease highlight the threat these organ-isms pose to public health. For this reason, there is an increasing demand for fast and efficient methods for the detection of vir-ulent strains of STEC in fecal samples and in meat and dairy products. PCR is generally considered the most sensitive means for determining if a food or fecal sample contains STEC. A multi-plex PCR method developed by Paton and Paton (2) enables simultaneous determi-nation of stx1, stx2, and correlated genes that encode accessory STEC virulence factors, such as eaeA and hlyA, in crude DNA extracts from primary fecal cul-tures. In this study, we developed a rapid typing system for STEC that improves

Lane Sample

M Markers (100-bp ladder)

1–11 STEC strains

12 K-12 strain

M 1 2 3 4 5 6 7 8 9 10 11 12 M

← IS1203

← hlyA ← eaeA ← stx2 ← stx1

Figure 1. STEC identification by CD-PCREleven STEC strains and one K-12 strain were used for CD-PCR. Reaction products were analyzed by agarose gel electrophoresis and stained with ethidium bromide.

Table 1. STEC PCR setup1

Component Concentration

PCR buffer for KOD XL 1X

dNTP mix 0.2 mM

stx1 primers (stx1-F + stx1-R) 0.2 µM each

stx2 primers (stx2-F + stx2-R) 0.2 µM each

eaeA primers (eaeA-F + eaeA-R) 0.2 µM each

hlyA primers (hlyA-F + hlyA-R) 0.2 µM each

IS1203v primers (1203v-F + 1203v-R)

0.1 µM each

Bacterial cells approximately 104 cfu

KOD XL DNA Polymerase 2.5 U

1 When using KOD XL DNA Polymerase, set up the PCR on ice.

upon the original multiplex PCR assay. With our method, a bacterial colony from a food or fecal culture was used directly as the template. In addition, four target genes were examined for the presence of the IS1203v insertion sequence discov-ered in stx2 genes (3, 4) with IS1203v-specific primers. To reduce the time need-ed for the PCR, Taq DNA polymerase was replaced with the faster KOD XL DNA Polymerase*. Multiplex CD-PCR analysis for eleven STEC strains and one control K-12 strain isolated at Kanagawa Prefec-ture, Japan, between 1996 and 1999 was performed (Figure 1). Table 1 identifies the final concentrations of the PCR com-

ponents. PCR were performed using the following conditions: initial denaturation at 94°C for 5 minutes, 30 cycles of 98°C for 15 seconds, 60°C for 5 seconds, and 74°C for 30 seconds. After the PCR, one-tenth of the reaction solution was analyzed by agarose gel electrophoresis (2% TAE gel, Figure 1). The results of the multiplex-PCR showed a clear amplification for each target: 180 bp for stx1, 255 bp for stx2, 384 bp for eaeA, 534 bp for hlyA, and 910 bp for IS1203v, in 11 STEC strains (Figure 1). Amplification of the target genes from the control K-12 strain was negative. The results clearly demon-strated that this system is effective for STEC typing. By using KOD XL DNA Polymerase, PCR was completed in less than 1.5 hours, a significant time savings compared to the nearly 3.5 hours of the original method, and a great advantage when multiple spec-imens require quick processing.

References1. Karmali, M. A. (1989) Clin. Microbiol. Rev. 2,

15–38.

2. Paton, A. W. and Paton, J. C. (1998) J. Clin. Microbiol. 36, 598–602.

3. M., Nishiya, Y., Kawamura, Y., and Shinagawa, K. (1999) J. Biosci. Bioeng. 87, 93–96.

4 Okitsu, T., Suzuki, R, and Yamai, S. (2001) Upload 63 (Toyobo Co., Ltd., Japan newsletter).


36

PCR Clean Up and N

ucleic Acid Precipitation


PCR • PCR Clean Up and Nucleic Acid Precipitation

36

The SpinPrep™ PCR Clean-Up Kit is designed for rapid purification of PCR-amplified DNA. The 10-minute procedure involves addition of binding buffer followed by adsorption of the DNA to a silica membrane in a spin column format. Following a wash step, DNA is eluted in low-salt buffer. This kit removes DNA polymerases, dNTPs, salts, and primers so that they do not interfere with downstream applications such as cloning, sequencing, or labeling. PCR products from 100 bp to >12 kb can be cleaned up, with standard recoveries of 60–90%.

SpinPrep™ PCR Clean-Up Kit Rapid purification of PCR products

Components82 ml SpinPrep Bind Buffer

27 ml SpinPrep Wash Buffer

10 ml SpinPrep Elute Buffer

100 SpinPrep Filters

100 Receiver Tubes

100 SpinPrep Eluate Receiver Tubes

Additional Information AvailableSpinPrep PCR Clean-Up Kit User Protocol TB290

Product Size Cat. No. PriceSpinPrep™ PCR Clean-up Kit

100 rxn 70976-3

bp

2000 –1500 –1000 –750 –500 –300 –

150 –

50 –

Lane Sample1 PCR Markers2 Crude PCR product3 Purified PCR product4 PCR Markers

1 2 3 4

Primer removal with theSpinPrep PCR Clean-Up Kit

SpinPrep PCR Clean-Up KitColumn binding capacity: up to 6 mg

PCR sample volume: 100 µl/rxn

Typical recovery: 60-90%

Size range: 100 bp to > 12,000 bp

Time required: < 10 min


PCR Clean Up and N




37

Features• No organic extraction or alcohol precipitation• Total preparation time < 30 minutes• No low melting point agarose required

SpinPrep™ Gel DNA Kit Rapid, efficient extraction of DNA from agarose gels

bp

← 12,000, 52%← 8000, 50%

← 1000, 90%

← 150, 90%

1 2 3 4 5

Gel analysis and quantification of DNA fragments isolated with the SpinPrep Gel DNA Kit

Known amounts (2 mg) of four DNA fragments of the indicated sizes were run in separate lanes on a 1% agarose gel. Each band was excised and the DNA extracted from the gel using the SpinPrep Gel DNA Kit and standard protocol. Recoveries shown as percentages above were determined by absorbance at 260 nm. Samples (250 ng) of each recovered band were analyzed by agarose gel electrophoresis. Lane 1 contained a mixture of the starting DNAs.

bp

← 12,000, 52%← 8000, 50%

← 1000, 90%

← 150, 90%

1 2 3 4 5

Gel analysis and quantification of DNA fragments isolated with the SpinPrep Gel DNA Kit

Known amounts (2 mg) of four DNA fragments of the indicated sizes were run in separate lanes on a 1% agarose gel. Each band was excised and the DNA extracted from the gel using the SpinPrep Gel DNA Kit and standard protocol. Recoveries shown as percentages above were determined by absorbance at 260 nm. Samples (250 ng) of each recovered band were analyzed by agarose gel electrophoresis. Lane 1 contained a mixture of the starting DNAs.

Components5 × 24 ml SpinPrep GelMelt™ Solution

27 ml SpinPrep Wash Buffer

10 ml SpinPrep Elute Buffer

100 SpinPrep Filters

100 Receiver Tubes

100 SpinPrep Eluate Receiver Tubes

Additional Information AvailableSpinPrep Gel DNA Kit User Protocol TB274

SpinPrep Gel KitColumn binding capacity: up to 20 mg

Gel slice mass: 150 mg/rxn

Typical recovery: 50-90%

Size range: 150 bp to > 12kb

Time required: < 30 min

Product Size Cat. No. PriceSpinPrep™ Gel DNA Kit 100 rxn 70852-3

The SpinPrep™ Gel DNA Kit enables efficient extraction of DNA fragments from 150 bp to >12,000 bp in size from agarose gels. The procedure uses GelMelt™ Solution to dissolve the gel slice, followed by adsorption of the DNA to a silica membrane in a spin column format. After a wash step, the purified DNA is eluted in low-salt buffer. Each spin column can bind up to 20 mg DNA. Routine recovery is 50–90%.


38

PCR Clean Up and N




38

Comparison of different carriers for precipitation of nucleic acids

Compatible with Pellet Paint glycogen tRNA

gel electrophoresis —

PCR amplification ? —

DNA sequencing —

restriction digestion

ligation ?

transformation ?

cDNA synthesis ?

kinase reactions —

random priming ? —

in vitro transcription ?

in vitro translation

RNase protection assay ?

phenol extraction

LiCl precipitation —

bacterial electroporation

? ?

PEG precipitation ? ?

Recovery of various RNA and DNA samples with Pellet Paint carrier

Sample Incorp. cpm recovered

RNA (100 nt, 0.2 ng/ml) 90%

RNA (1000 nt, 0.2 ng/ml) 92%

RNA (10,000 nt, 0.2 ng/ml) 89%

DNA (100-2000 bp, 4 pg/ml) 86%

The indicated samples of 32P-labeled RNA and DNA were prepared using standard protocols for transcription and random priming, respectively. Following the labeling reactions, incorporation was determined by DE81 filtration. Known amounts of incorporated material (300,000 cpm) were precipitated in the presence of Pellet Paint. Samples without Pellet Paint Co-Precipitant resulted in a 5- to 50-fold reduction in recovery.

Feature• Allows direct visualization and tracking of precipitated

material

Pellet Paint® Co-Precipitant Rapid, quantitative precipitation of DNA and RNA; excellent for PCR clean-up

Pellet Paint Procedure1. Add 2 ml Pellet Paint or 1 ml Pellet Paint NF Co-Precipitant

plus 0.1 volume 3 M Sodium Acetate to sample and mix briefly.2. Add 2 volumes ethanol (or 1 volume isopropanol) and briefly vortex.3. Incubate at room temperature for 2 min.4. Spin sample for 5 min.5. Discard supernatant. Wash and resuspend pellet.

Components250 ml or 2 ml1 ml or 8 ml

Pellet Paint Co-Precipitant3 M Sodium Acetate pH 5.2

Additional Information Available Pellet Paint Co-Precipitant User Protocol TB146

inNovations No. 4a, 5, 9, 12, 26

Product Size Cat. No. PricePellet Paint® Co-Precipitant 125 rxn

1000 rxn69049-369049-4

Pellet Paint® Co-Precipitant is a visible dye-labeled carrier formulated specifically for use in alcohol precipitation of nucleic acids (McCormick 1995, McCormick 1996). The 2-minute precipitation uses just 2 ml per reaction and requires no low-temperature incubations or prolonged centrifugation. Both RNA and DNA are efficiently precipitated even from dilute solutions (2 ng/ml). The pellet is easily located by its vivid pink color and can be easily followed during washing steps, preventing losses during handling.

Most PCR applications benefit from a clean-up step in which primers and other reactants are removed and the target DNA is concentrated (Taggart 1998). Pellet Paint Co-Precipitant is ideal for this cleanup because the procedure is rapid, primers < 50 nt in length are efficiently removed, and the DNA is quantitatively recovered. Furthermore, it provides visual confirmation of DNA resuspension.

Pellet Paint Co-Precipitant is compatible with most molecular biology procedures and is free of contaminating nucleic acids and nucleolytic enzymes. Although it absorbs in the UV range, accurate spectrophotometric measurements of DNA or RNA samples are possible; the absorbance ratio (provided with each package) can be used as a correction factor when determining nucleic acid concentration (McCormick 1996). Pellet Paint Co-Precipitant is compatible with automated Cy5® sequencers. Pellet Paint NF Co-Precipitant is recommended for use with PE Applied Biosystems automated sequencers.

References: McCormick, M. 1995. inNovations 4a, 10.McCormick, M. 1996. inNovations 5, 10.Taggart, E. W., et al. 1998. J. Clin. Microbiol. 36, 3408.

Pellet Paint pellet (2 ml) under UV and visible illumination

ON THE WEB

www.novagen.com /PelletPaint


PCR Clean Up and N




39

Pellet Paint® NF Co-Precipitant is a nonfluorescent dye-labeled carrier compatible with fluorescent sequencing. It facilitates rapid removal of BigDye Terminators during alcohol precipitation of cycle sequencing reaction products. Cycle sequencing reactions can be precipitated rapidly with 1 ml of carrier per reaction and centrifugation times of 10 minutes. The easily visualized carrier provides a simple confirmation that precipitation has occurred. Sequencing reaction products are efficiently pelleted and dye-labeled terminators remain in the supernatant during alcohol precipitation using the standard Applied Biosystems precipitation protocols. Resuspension of pelleted sequencing reaction products in deionized formamide can be confirmed by checking for dissolution of the carrier. Pellet Paint NF Co-Precipitant is fully compatible with the ABI PRISM® BigDye Terminator Cycle Sequencing Ready Reaction. To avoid extra sample handling, Pellet Paint NF Co-Precipitant can be added directly to the reaction mix, template DNA, crude PCR samples, or dilution buffer before the cycle sequencing reaction. Although Pellet Paint NF absorbs in the UV range, accurate spectrophotometric measurements of DNA or RNA samples are possible; the absorbance ratio (provided with each package of Pellet Paint NF) can be used as a correction factor when determining nucleic acid concentration. Pellet Paint NF Co-Precipitant has no detectable effect on the sequencing reaction or sequence accuracy. Pellet Paint NF Co-Precipitant is a useful substitute for the original Pellet Paint Co-Precipitant in applications where fluorescent detection is used.

Pellet Paint® NF Co-Precipitant Non-fluorescent visible nucleic acid co-precipitant for automated sequencing applications

Features• Efficient and rapid precipitation of BigDye® cycle

sequencing products• Efficient removal of dye terminators• Direct visualization and tracking of precipitated material• No effect on sequencing reaction• Compatible with fluorescent detection applications

Components125 ml or 1 ml 1 ml or 8 ml

Pellet Paint NF Co-Precipitant3 M Sodium Acetate pH 5.2

Additional Information Available Pellet Paint NF Co-Precipitant User Protocol TB268

inNovations No. 10, 26

Product Size Cat. No. PricePellet Paint® NF Co-Precipitant 125 rxn

1000 rxn70748-370748-4

Cycle sequencing with Pellet Paint NFPellet Paint NF (2 ml)* was combined with 100 ng plasmid and 1.6 pmol primer in 10 ml BigDye Terminator Cycle Sequencing Reaction performed in 8-well Micro-Amp® reaction tubes. Following thermal cycling, reaction products were purified by addition of isopropanol and centrifugation for 10 min at 3000 × g. Samples were drained by inversion and the plate was spun at low force in an inverted position. The samples were resuspended in 20 ml Template Suppression Reagent and run on an ABI PRISM 310 automated sequencer. Sequence data were identical to those obtained with a control reaction without Pellet Paint NF (not shown). The read extended beyond 450 bases.

* Note that the standard precipitation reaction uses 1 µl.

ON THE WEB

www.novagen.com /PelletPaint


40

Molecular Size M

arkers


PCR • Molecular Size Markers

40

kbp

– 2

– 1.5– 1.4

– 1

– 0.75

– 0.5

– 0.4

– 0.3

– 0.2

– 0.1– 0.05

0.05–10 kbp

2.0% TAE agarose gel

kbp

– 12– 10– 8– 6

– 4*

– 3

– 2

– 1.5

– 1

– 0.5*– 0.4– 0.3– 0.2– 0.1

1.5% TAE agarose gel*

0.1–12 kbp

kbp

– 12– 10– 8

– 6

– 4*

– 3

– 2

– 1.5

– 1

– 0.5

0.5–12 kbp

0.8% TAE agarose gel*

*higher-intensity reference band

Perfect DNA Markers

10 864

3

ComponentsCat. No. 70087500 ml Perfect DNA Markers, 0.1–12 kbp

in 1X DNA Gel Loading Buffer1 ml 6X DNA Gel Loading Buffer

Cat. No. 69002500 ml Perfect DNA Markers 0.5-12 kbp


Cat. No. 705401 ml Perfect DNA Markers, 0.05–10 kbp


Features• Available in three size ranges: 0.05–10 kbp 0.1–12 kbp 0.5–12 kbp• Includes 6X Loading Buffer

Perfect DNA™ Markers Convenient, easy-to-remember sizes

Product Size Cat. No. PricePerfect DNA™ Markers, 0.1-12 kbp

100 lanes 70087-3

Perfect DNA™ Markers, 0.05-12 kbp

100 lanes 69002-3

Perfect DNA™ Markers, 0.5-10 kbp

100 lanes 70540-3

ON THE WEB

www.novagen.com /Markers

Perfect DNA™ Markers contain sets of DNA fragments with convenient, easy-to-remember sizes for agarose gel analysis. The markers have uniform band intensities except for the easily identifiable reference bands, which are useful for instant band identification. An extra vial of 6X DNA Gel Loading Buffer is included.


Molecular Size M

arkers


PCR • Molecular Size Markers

41

bp

– 3000

– 2000

– 1000– 900– 800– 700– 600– 500– 450– 400– 350– 300– 250– 200– 150– 100– 50

50-bp ladder


bp

– 1000– 900– 800– 700

– 600

– 500

– 400

– 300

– 200

– 100

100-bp ladder


kbp

– 10– 8– 6– 5– 4

– 3– 2.5– 2

– 1.5

– 1

– 0.5

1-kbp ladder


Perfect DNA Ladders

bp

– 2000

– 1500

– 1000

– 750

– 500

– 300

– 150

– 50


PCR Markers

Perfect DNA™ Ladders Evenly spaced DNA markers in ready-to-load format

Features• Available in three size ranges:

50–3000 bp100–1000 bp500–10,000 bp

• Includes 6X loading buffer

ComponentsCat. No. 705381 ml Perfect DNA 50 bp Ladder in 1X Loading Buffer1 ml 6X Loading Buffer

Cat. No. 70539500 ml Perfect DNA 100 bp Ladder in 1X Loading Buffer1 ml 6X Loading Buffer

Cat. No. 70537500 ml Perfect DNA 1kbp Ladder in 1X DNA Gel Loading Buffer1 ml 6X DNA Gel Loading Buffer

Features• Contains fragments from 50 to 2000 bp• Includes 6X Loading Buffer

PCR Markers For accurate sizing of PCR products

Components250 ml PCR Markers in 1X Loading Buffer1 ml 6X Loading Buffer

Product Size Cat. No. PricePerfect DNA™ 50 bp Ladder

100 lanes 70538-3

Perfect DNA™ 100 bp Ladder

100 lanes 70539-3

Perfect DNA™ 1 kbp Ladder

100 lanes 70537-3

Product Size Cat. No. PricePCR Markers, 50–2000 bp 50 lanes 69278-3

ON THE WEB


ON THE WEB


The Perfect DNA™ Ladders contain sets of DNA fragments with convenient, easy-to-remember sizes for agarose gel analysis. The markers have uniform band intensities and cover a wide range of DNA sizes. They are supplied in a convenient ready-to-load format containing dye and are ideal for routine use. An extra vial of 6X Loading Buffer (for Cat. Nos. 70538-3 and 70539-3) or 6X DNA Gel Loading Buffer (for Cat. No 70537-3) is included.

PCR Markers contain a mixture of eight defined DNA fragments ranging from 50 to 2000 bp at convenient size intervals for characterizing small DNA products. The markers are supplied ready-to-use in gel loading buffer containing two tracking dyes that do not interfere with UV illumination of ethidium bromide-stained bands. A separate vial of 6X Loading Buffer is included. Each vial of markers is enough for 50 lanes on TBE or TAE agarose stained with ethidium bromide. The recommended 5 ml per lane produces bands of even intensity that are bright, sharp, and easy to photograph.


42

PCR Cloning


PCR • PCR Cloning

42

Cloning Kits OverviewEfficient, reliable reagents for cloning PCR products

We offer a variety of cloning kits for PCR and DNA fragments. AccepTor™ Vector Kits are designed for cloning DNA fragments that have a single 3´-dA overhang, typically generated by non-proofreading, thermostable polymerases. Perfectly Blunt® Cloning Kits are designed for cloning DNA with any type of ends. DNA fragments or PCR products with

overhanging ends are blunt-ended prior to cloning into the blunt-end, dephosphorylated vector. For demanding procedures, GigaSingles™ Cloning Kits contain extremely high efficiency NovaBlue Competent Cells. The pSTBlue-1 AccepTor Vector and pSTBlue Perfectly Blunt Vector are both available as Giga Cloning Kits.

AccepTor Vector Cloning and Giga Cloning Kit ConfigurationspSTBlue-1 AccepTor Vector

Giga Cloning KitsIntroductory Kits AccepTor Vector Kits AccepTor Vector

Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn

AccepTor Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg

Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml

Clonables 2X Ligation Premix

55 ml 2 × 55 ml 4 × 55 ml 2 × 55 ml 4 × 55 ml

Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml

NovaBlue Singles Competent Cells*

11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml

SOC Medium† 2 (or 3) × 2 ml 4 (or 5) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml

Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml

* The pETBlue™ AccepTor Vector Kits also contain Tuner™(DE3)pLacl Competent Cells (0.2 ml for 10 rxn, 2 × 0.2 ml for 20 rxn, and 4 × 0.2 ml for 40 rxn). The AccepTor Vector Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles™ Competent Cells.

† The pETBlue AccepTor Vector Kits contain extra SOC Medium, as indicated in parentheses.

Perfectly Blunt Cloning and Giga Cloning Kit Configurations pSTBlue-1 Perfectly Blunt Giga Cloning KitsIntroductory Kits Perfectly Blunt Cloning Kits Blunt Vector Kits

Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn

Blunt Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg

Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml

End Conversion Mix 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml

T4 DNA Ligase 100 U 100 U 2 × 100 U 100 U 2 × 100 U

Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml

NovaBlue Singles™ Competent Cells*

11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml

SOC Medium† 2 (or 3) × 2 ml 5 (or 6) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml

Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml

* The pETBlue Perfectly Blunt Cloning Kits also contain Tuner(DE3)pLacl Competent Cells. The Perfectly Blunt Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles Competent Cells.

† The pETBlue Perfectly Blunt Vector Kits contain extra SOC Medium, as indicated in parentheses.


PCR Cloning


PCR • PCR Cloning

43

AccepTor Vector Kit Applications Vector Features

pSTBlue-1 ArchivingSubcloningSequencingIn vitro transcription

Opposing SP6/T7 promotersAmp and Kan selectionDual EcoRI sites flank insert

pETBlue™-1 Protein expression:T7lac-driven, tightly controlled, high-level expression in E. coli

No fusion tagsInsert provides ATG start codon

Perfectly Blunt Cloning Applications Vector Features

pSTBlue-1

ArchivingSubcloningSequencingIn vitro transcription

Opposing SP6/T7 promotersAmp and Kan selectionDual EcoRI sites flank insert

pT7Blue-3 T7 promoterAmp or Kan selectionDual EcoRI sites flank insert

pT7Blue T7 promoterNdeI/BamHI sites flank insert

pT7Blue-2 Protein expression:T7-driven in vitro protein synthesisIn vitro transcription/translationSequencing

T7 promoterN-terminal S•Tag™ sequenceOptimal Kozak translation initiationXenopus globin 5'-UTR

pETBlue-1

Protein expression:T7lac-driven, tightly controlled, high-level expression in E. coli

T7 promoterNo fusion tagInsert provides ATG start codon

pETBlue-2 T7 promoterOptional C-terminal HSV•Tag® and

His•Tag® sequencesVector provides ATG start codon

Procedure time*:• 20-minute end conversion• 15-minute ligation• 8-minute transformation†

Features:• Blue/white screening• > 95% recombinants• Also compatible with restriction fragments

Ends required:• Any ends (kit makes blunt ends)

Polymerase compatibility:• Any DNA polymerase

* All times listed refer to kits using NovaBlue Singles™ Competent Cells. Giga kits, which use NovaBlue GigaSingles™ Competent Cells, require one hour for outgrowth.

† Time to plating transformants is with ampicillin selection. For kanamycin selection, add 30 minutes.

Perfectly Blunt® Cloning Kits

Cloning Kits Overview Continued

AccepTor™ Vector Kits

Procedure time*:• 30-minute ligation• 8-minute transformation†

Features:• Blue/white screening• > 80% recombinants

Ends required:• Single 3′- dA overhang

Polymerase compatibility:• Nonproofreading DNA polymerases


44

PCR Cloning


PCR • PCR Cloning

44

Amplify target usingTaq DNA or KOD XLpolymerase.

LIGATE15 min - 2 h

TRANSFORM8 min

PLATE0 min incubation (Amp),30 min incubation (Kan)

PCR productAccepTor Vector2X Ligation Premix

NovaBlue SinglesCompetent Cells

SOC Medium

AA

AccepTor™ Vector KitsRapid, direct cloning with patented UA cloning technology

Features• Does not require restriction digestion or special primers• Perform direct ligation of PCR product with vector• Compatible with polymerases that leave single 3´-dA

overhangs• Blue/white screening with pSTBlue-1 or pETBlue™-1

vectors• Simple protocol takes as little as 40 min from PCR

product to plating transformants

AccepTor™ Vector Cloning Kits are designed to simplify cloning of PCR products with single 3´-dA nucleotide overhangs, which are generated by non-proofreading thermostable DNA polymerases, such as KOD XL polymerase and native and recombinant Taq polymerases. The linearized AccepTor Vector contains single 3´-dU DNA ends that are compatible with direct ligation of these products without the need for intermediate reactions. The dU residues are converted to dT residues in vivo following transformation.In the AccepTor Vector Kits, vectors are supplied ready-to-ligate. Simply mix the vector with your PCR product, add Clonables™ 2X Ligation Premix, and transform into NovaBlue Singles™ Competent Cells.

AccepTor Vector Kits are available in an introductory 10-reaction size as well as 20- and 40-reaction configurations. The linearized AccepTor Vectors are also available separately without the ligation and transformation components. See Giga Cloning Kits for information on the pSTBlue-1 AccepTor Vector Giga Kit with higher-efficiency competent cells.


PCR Cloning


PCR • PCR Cloning

45

Primer design for expression of inserts in pETBlue-1 ccep or VectorpETBlue-1 is designed for the expression of unfused proteins from inserts that have an ATG start codon. The AccepTor cloning site is located just downstream of the T7 gene 10 RBS (ribosome binding site). Amplification of the insert using sense primers beginning with ATG at the 5’-end will ensure optimal spacing between the RBS and translation initiation sites for efficient protein synthesis in E. coli. There are no restrictions on the C-terminal (antisense) primers.

Met...Sense Primer: 5'-ATGXXX...Antisense primer: No restrictions

Kp

n I

Sp

h I

Pst

IM

lu I

Sna

B I

Bam

H I

Eco

R I

Eco

R I

Sal

IA

cc I

Hin

c II

Hin

d II

IX

ho I

Avr

IIS

ty I

Nhe

IX

ba

IR

leA

IP

ml I

Bst

X I

Eco

O10

9 I

Ap

a I

Sac

IN

ot I

Eag

I

ori

Amp

lacZ

pSTBlue-13851 bp

Kan

f1origin

T7 SP6dUdU

T7 terminator

rrnB terminator

Eco

R I

Sm

a I

Srf

I

ori

f1 origin

lacZ

Amp

T7lac tet

pETBlue-13476 bp

dUdU

AccepTor™ Vector Kits Continued

Two different vectors, pSTBlue-1 and pETBlue™-1, are available as AccepTor™ Vector kits. Each is carefully prepared and tested for optimal cloning efficiency and provides easy visualization of recombinants by blue/white screening using LacZ α-complementation. The pSTBlue-1 vector is a general purpose vector with dual opposed T7 and SP6 promoters, both amp and kan resistance cassettes, and an array of flanking restriction sites. The pETBlue-1 vector is a plasmid specifically developed to enable high-level T7 RNA polymerase-driven expression of target genes in E. coli, while providing the convenience of blue/white screening and high plasmid copy number. Initial cloning is performed in the non-expression host NovaBlue, and the recombinant plasmid is transformed into Tuner™(DE3)pLacI Competent Cells (included in kits) for protein expression.

Additional Information Available AccepTor Vector Kits User Protocol TB248

pETBlue System Manual TB249

Vector Maps and Sequences novagen.com

pSTBlue-1 Kits & DNAProduct Size Cat. No. PriceIntroductory pSTBlue-1 AccepTor™ Vector Kit

10 rxn 70594-3

pSTBlue-1 AccepTor™ Vector Kit

20 rxn40 rxn

70595-370595-4

pSTBlue-1 AccepTor™ Vector Giga Kit

20 rxn40 rxn

71228-371228-4

pSTBlue-1 AccepTor™ Vector (linearized vector)

20 rxn40 rxn

70596-370596-4

pSTBlue-1 DNA 20 µg 70199-3

ComponentsSee table on page 42 for kit components.

pETBlue-1 Kits & DNAProduct Size Cat. No. PriceIntroductory pETBlue™-1 AccepTor™ Vector Kit

10 rxn 70597-3

pETBlue™-1 AccepTor™ Vector Kit

20 rxn40 rxn

70598-370598-4

pETBlue™-1 AccepTor™ Vector (linearized vector)

20 rxn40 rxn

70599-370599-4

pETBlue™-1 DNA 20 µg 70608-3



46

PCR Cloning


PCR • PCR Cloning

46

Kp

n I

Sp

h I

Pst

IM

lu I

Sna

B I

Bam

H I

Eco

R I

Eco

R I

Sal

IA

cc I

Hin

c II

Hin

d II

IX

ho I

Avr

IIS

ty I

Nhe

IX

ba

IR

leA

IP

ml I

Bst

X I

Eco

O10

9 I

Ap

a I

Sac

IN

ot I

Eag

I

Kp

n I

Sp

h I

Pst

IM

lu I

Sna

B I

Bam

H I

Eco

R I

Eco

R I

Sal

IA

cc I

Hin

c II

Hin

d II

IX

ho I

Avr

IIS

ty I

Nhe

IX

ba

IR

leA

IP

ml I

Bst

X I

Eco

O10

9 I

Ap

a I

Sac

IN

ot I

Eag

I

ori

Amp

lacZ

pSTBlue-1

Kan

f1origin

pT7Blue-3

pSTBlue-1

pT7Blue-3

SP6T7

T7

Perfectly Blunt® Cloning Kits Efficient cloning of DNA amplified by any polymerase

Features• 7 different vectors available, including pETBlue™

expression vectors• No restriction enzymes or special primers required• Compatible with inserts generated by any DNA

polymerase, regardless of end type generated• Blue/white screening• Simple protocol takes less than 1 h from PCR product to

plating transformants

Amplify target usingany thermostableDNA polymerase.

LIGATE15 min

TRANSFORM8 min

PLATE0 min incubation (Amp),30 min incubation (Kan)

Blunt VectorLigase

NovaBlue SinglesCompetent Cells

SOC Medium

P

P

AC

A

AA

PCR ProductEnd Conversion MixCONVERT ENDS

20 min

With the Perfectly Blunt® Cloning Kits, DNA with any type of end can be cloned with high efficiency. DNA products are treated in the end conversion reaction to produce blunt, phosphorylated ends, which are compatible with the linearized, dephosphorylated blunt vector.

The Perfectly Blunt Cloning Kits are designed to simplify cloning of DNA generated by PCR using any type of DNA polymerase. This approach enables the use of high-fidelity proofreading enzymes for amplification, which decreases the probability of generating mutations in the target sequence. In addition, under many conditions blunt cloning is more efficient than T-cloning, probably because the efficiency of single 3´-dA addition by Taq DNA polymerase varies significantly depending on the sequence context of the DNA ends, and the number of PCR cycles performed (Novy 1996, Clark 1998, Brownstein 1996, Magnuson, 1996, Hu 1993).

With the Perfectly Blunt cloning protocol, you can go from PCR product to plating transformants in less than one hour with minimal hands-on time. The finished PCR product is converted to a blunt, phosphorylated DNA in a 15-minute reaction using premixed reagents. Following a 5-minute heat inactivation step, the treated insert is combined with the ready-to-use vector and

Primer design for expression of inserts in pT7Blue-2 Blunt VectorpT7Blue-2 is designed for T7 promoter-driven expression in reticulocyte lysate or lac promoter-driven expression in E. coli of proteins fused with an upstream, cleavable S•Tag™ sequence. The blunt cloning site (SmaI) is located just downstream from the enterokinase cleavage site coding sequence. For in-frame cloning of PCR products, the first base of the 5’ (sense) primer is the last base of the CCN proline codon. N can be any base, however G and A form preferred codons in E. coli. There are no restrictions on the design of the C-terminal (antisense) primer.

Sense Primer: 5'-NXXX...*Antisense primer: No restrictions

*where N = any base (completes Pro codon; G or A is recommended) and XXX = the initial codon of the insert.

Note: For additional information, please refer to User Protocol TB183


PCR Cloning


PCR • PCR Cloning

47

Msc

IN

co I

Kp

n I

Pin

A I

Bse

R I

Pst

IM

lu I

Sna

B I

Bam

H I

Eco

R I

Eco

R V

Sal

IH

inc

IIA

cc I

Hin

d II

IX

ho I

Avr

IIN

he I

Xb

a I

Pm

l IB

stX

IA

pa

IS

ac I

Not

IE

a g I

Hin

d II

IS

ph

IP

st I

Sse

8387

IS

al I

Hin

c II

Acc

IX

ba

IS

pe

IN

de

I

Bam

H I

Sm

a I

Ava

IK

pn

IS

ac I

Eco

R I

pT7Blue

pT7Blue-2

T7 globin UTR

enterokinase site

S•Tag SP6

pT7BluepT7Blue-2

Amp

f1origin

lacZ

ori

T7

Perfectly Blunt® Cloning Kits Continued

pT7Blue-2 Kits & DNAProduct Size Cat. No. PricepT7Blue-2 Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70190-370190-4

pT7Blue-2 Blunt Vector (linearized)

20 rxn40 rxn

70186-370186-4

pT7Blue-2 DNA (uncut)

20 µg 69141-3

ComponentsSee table on page 42 for kit components..

pT7Blue Kits & DNAProduct Size Cat. No. PriceIntroductory pT7Blue Perfectly Blunt® Cloning Kit

10 rxn 70183-3

pT7Blue Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70189-370189-4

pT7Blue Blunt Vector (linearized)

20 rxn40 rxn

70174-370174-4

pT7Blue DNA (uncut) 20 µg 69967-3

pSTBlue-1 Kits & DNAProduct Size Cat. No. PriceIntroductory pSTBlue-1 Perfectly Blunt® Cloning Kit

10 rxn 70184-3

pSTBlue-1 Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70191-370191-4

pSTBlue-1 Blunt Vector (linearized)

20 rxn40 rxn

70188-370188-4

pSTBlue-1 Perfectly Blunt® Giga Cloning Kit

20 rxn40 rxn

71229-371229-4

pSTBlue-1 DNA 20 µg 70199-3


pT7Blue-3 Kits & DNAProduct Size Cat. No. PriceIntroductory pT7Blue-3 Perfectly Blunt® Cloning Kit

10 rxn 70075-3

pT7Blue-3 Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70182-370182-4

pT7Blue-3 Blunt Vector (linearized)

20 rxn40 rxn

70187-370187-4

pT7Blue-3 DNA (uncut)

20 µg 70025-3



ligated in an optimized 15-minute reaction. An exclusive 8-minute transformation procedure using high efficiency NovaBlue Singles™ Competent Cells generates recombinant colonies that are easily visualized by blue/white screening.

The Perfectly Blunt® method is not limited to cloning PCR products; these kits are also suitable for cloning restriction fragments, cDNA, or sheared DNA using the same protocols. Six different vectors are available as Perfectly Blunt Cloning Kits: pETBlue™-1, pETBlue-2, pSTBlue-1, pT7Blue, pT7Blue-2, and pT7Blue-3. Vector choices include those designed for general cloning, sequencing, optimal in vitro transcription/translation, and T7-driven protein expression in E. coli. Each vector is available in a kit containing sufficient reagents for 10, 20, or 40 reactions.

“Vector only” kits are also available in 20- and 40-reaction sizes without ligase and competent cells. For highest-efficiency competent cells, use pSTBlue-1 Perfectly Blunt Giga Cloning Kit.

References: Novy, R.E., et al. 1996. inNovations 6, 7. Clark, J.M. 1988. Nucleic Acids Res. 16, 9677. Brownstein, J.M., et al. 1996. BioTechniques 20, 1004. Magnuson, V.L., et al. 1996. BioTechniques 21, 700. Hu, G. 1993. DNA Cell Biol. 12, 763.


48

PCR Cloning


PCR • PCR Cloning

48

Primer design for expression of inserts in pETBlue™-1 and pETBlue-2 Blunt VectorspETBlue-1 is designed for the expression of unfused proteins from inserts that have an ATG start codon. The blunt cloning site is located just downstream from the T7 gene 10 RBS (ribosome binding site). Amplification of the insert using sense primers beginning with ATG at the 5’-end will ensure optimal spacing between the RBS and translation initiation sites for efficient protein synthesis in E. coli. There are no restrictions on the design of C-terminal (antisense) primer.

Met...Sense Primer: 5'-ATGXXX...Antisense primer: No restrictions

pETBlue-2 is designed for the expression of proteins fused with C-terminal HSV•Tag® and His•Tag® sequences to facilitate detection and purification. In addition, this vector encodes an ATG start codon 8 base pairs downstream of the T7 gene 10 RBS. The blunt cloning site is located such that the insert will specify the fourth amino acid following Met-Ala-Ile at the N-terminus of the expressed protein. In order to achieve the correct reading frame, the 5’-end of the insert (and the sense PCR primer) should begin with the third base of the Ile/Met codon. To express a target protein fused with C-terminal HSV•Tag and His•Tag peptides, the antisense primer should begin with two bases in any combination except TA or CA, and specify an antisense codon beginning with the third base.

MetAlaIle....insert.....SerVector: ATGGCGATNXXX...........ATCCTACCGCTA..........YYYNNTAGGSense Primer: 5'-NXXX......If N = G, Met codon is generated instead of lle.Antisense primer: 5'-NNYYY.....If NN = CA or TA, stop codon is generated in sense strand.

T7 terminator

rrnB terminator

ori

f1 origin

lacZ

Amp

T7lac tet

Nco

I

Sm

a I

Ecl

136

IIB

amH

IE

coR

IB

srG

IA

sc I

Bss

H II

Sse

8387

IP

st I

Sal

IA

at II

Kp

n I

Cla

IM

lu I

Nsp

VH

ind

III

Not

IE

ag I

Pvu

IIB

st11

07 I

Pm

l I

Xho

I

Pac

I

Eco

R I

Sm

a I

Srf

I

pETBlue-1pETBlue-2

HSV•Tag His•Tag

pETBlue-1

pETBlue-2

Perfectly Blunt® Cloning Kits Continued

pETBlue-1 Kits & DNAProduct Size Cat. No. PriceIntroductory pETBlue™-1 Perfectly Blunt® Cloning Kit

10 rxn 70633-3

pETBlue™-1 Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70634-370634-4

pETBlue™-1 Blunt Vector (linearized)

20 rxn40 rxn

70620-370620-4

pETBlue™-1 DNA 20 µg 70608-3


pETBlue-2 Kits & DNAProduct Size Cat. No. PriceIntroductory pETBlue™-2 Perfectly Blunt® Cloning Kit

10 rxn 70635-3

pETBlue™-2 Perfectly Blunt® Cloning Kit

20 rxn40 rxn

70636-370636-4

pETBlue™-2 Blunt Vector (linearized)

20 rxn40 rxn

70621-370621-4

pETBlue™-2 DNA (uncut)

20 µg 70609-3


Additional Information Available Perfectly Blunt Cloning Kits User ProtocolpETBlue System ManualinNovationsVector Maps and Sequences

TB183TB249

No. 6, 8novagen.com


PCR Cloning


PCR • PCR Cloning

49

Clonables™ Ligation/Transformation KitSimple, reproducible ligation and transformation—in as little as 23 minutes

Clonables™ 2X Ligation PremixSingle solution for optimal ligation in 15 minutes

Components55 ml10 ml1.5 ml11 × 50 ml2 × 2 ml10 ml

Clonables 2X Ligation PremixClonables Positive ControlNuclease-free WaterNovaBlue Singles Competent CellsSOC MediumTest Plasmid

Additional Information Available Clonables Kit User Protocol TB233

Features• Rapid 15-min ligation, 8-min transformation with

ampicillin selection• Premixed ligation components decrease pipetting steps

and increase reliability• One reaction condition, optimized for cohesive ends,

single base overhangs, and blunt ends• Single-use competent cells eliminate need to aliquot,

freeze/thaw, or waste partially used vials• Compatible with PCR buffer, TE, restriction enzyme buffer,

and End Conversion Mix

The Clonables 2X Ligation Premix is a single solution containing optimized concentrations of the highest quality T4 DNA ligase, buffer, stabilizer, and cofactors needed for efficient ligation of any type of compatible DNA ends. The premix is tested for ligation of compatible 2- to 4-base cohesive DNA ends as well as blunt ends and single-base overhangs found on some PCR products. Under most conditions excellent ligation occurs in only 15 minutes. With T/A or U/A overhangs, more colonies can be obtained by incubating for up to two hours. Although maximal efficiencies are obtained using NovaBlue Singles Competent Cells, this reagent is compatible with transformation of any type of chemically competent cells. The high performance, minimal pipetting requirement, and single-addition format make the premix suitable for high-throughput applications.

One vial of the 2X Ligation Premix contains enough reagent for 11 ligation reactions (10-µl scale).

Additional Information Available Clonables Kit User ProtocolinNovations

TB233 No. 9

Product Size Cat. No. PriceClonables™ Ligation/Transformation Kit

11 rxn 70526-3

Product Size Cat. No. PriceClonables™ 2X Ligation Premix

55 µl2.5 ml

70573-370573-4

The Clonables™ Kit enables convenient, dependable, high-efficiency ligation and transformation of any compatible DNA ends. The kit features a unique, universal Ligation Premix, containing ligase, buffer, and cofactors, which supports ligation of any type of DNA cohesive or blunt ends in a 15-minute reaction. Ligated DNA is transformed into NovaBlue Singles™ Competent Cells, which use a streamlined protocol that takes less than 8 minutes for ampicillin-resistant plasmids and 38 minutes for other antibiotic-resistant plasmids. This kit can be used with a variety of cloning vectors and is compatible with any type of DNA end, without altering the ends or desired cloning junctions.

The Clonables Kit contains sufficient reagents to perform 11 ligation and transformation reactions, and includes a control vector and insert mix to verify performance.


50

PCR Cloning


PCR • PCR Cloning

50

Components11 × 50 ml or 22 × 50 ml Competent Cells2 × 2 ml or 4 × 2 ml SOC Medium10 ml Test Plasmid

NovaBlue Competent Cell Formats High efficiency and convenient aliquot sizes for reduced cell waste

NovaBlue is a K-12 strain ideally suited as an initial cloning host due to its high transformation efficiency, blue/white screening capability (with appropriate plasmids), and recA and endA mutations, which result in high yields of high-quality plasmid DNA. NovaBlue competent cells come in a variety of formats including: Singles™ format (50-ml single-

use tubes); HT96™ format (20-ml volume in a 96-well plate); and a standard format (0.2-ml volume sufficient for ten transformations). For applications in which animal-derived products are prohibited, Veggie™ Singles are prepared with animal-free reagents. Please refer to the table at right and the following pages for more information.

NovaBlue GigaSingles™ Competent Cells 109 efficiency in chemically competent cells

Features• Guaranteed efficiency >1 × 109 cfu/mg• Ideal for high-efficiency cloning• Enables production of high-quality plasmid DNA • Easy-to-use Singles format• Prepared using an optimized chemical method

NovaBlue Competent Cells Transformation Efficiency* Reaction Size ApplicationGigaSingles™ > 1.0 × 109 cfu/mg 50 ml High-efficiency cloning

Singles > 1.5 × 108 cfu/mg 50 ml Routine cloning

Veggie Singles > 1.5 × 108 cfu/mg 50 ml Applications requiring nonanimal-derived materials

Routine cloningHT96 > 1.0 × 108 cfu/mg 96 × 20 ml High-throughput cloningStandard > 1.5 × 108 cfu/mg 20 ml Routine cloning* Measured as cfu/mg test plasmid

Product Size Cat. No. PriceNovaBlue GigaSingles™ Competent Cells

11 rxn22 rxn

71227-371227-4

NovaBlue Genotype:endA1 hsdR17(rK12

– mK12+) supE44 thi-1 recA1 gyrA96

relA1 lac F’[proA+B+ lacIqZM15::Tn10] (TetR)

NovaBlue GigaSingles™ Competent Cells produce >1 × 109 colonies/mg plasmid DNA for cloning applications requiring high-efficiency transformations.

ON THE WEB

www.novagen.com /CompCells


PCR Cloning


PCR • PCR Cloning

51

ComponentsCatalog No. 70181 11 × 50 ml or 22 × 50 ml Singles Competent Cells2 × 2 ml or 4 × 2 ml SOC Medium10 ml Test Plasmid

Catalog No. 698252 x 0.2 ml or 5 x 0.2 ml Competent Cells10 ml Test Plasmid

NovaBlue Singles™ Competent Cells Cost-effective, high-efficiency transformation of E. coli in less than 8 minutes

Features• Guaranteed efficiency >1.5 × 108 cfu/mg• Provided frozen as single-use tubes in

11-reaction or 22-reaction kits• Reliably high transformation efficiency• Enables high-quality plasmid DNA preparation• Rapid: perform transformation directly in the supplied

tube

Product Size Cat. No. PriceNovaBlue Singles™ Competent Cells 11 rxn

22 rxn70181-370181-4

NovaBlue Competent Cells 0.4 ml1.0 ml

69825-369825-4

Components11 × 50 ml or 22 × 50 ml NovaBlue T1R Singles Competent Cells2 × 2 ml or 4 × 2 ml SOC Medium10 ml Test Plasmid

NovaBlue T1R Singles™ Competent Cells Resistant to T1 and T5 phage

Features• Guaranteed efficiency >1.5 × 108 cfu/mg• Resistant to T1 and T5 phage• Enables production of high-quality plasmid DNA • Easy-to-use Singles format• Prepared using an optimized chemical method

Product Size Cat. No. PriceNovaBlue T1R Singles™ Competent Cells

11 rxn22 rxn

71318-371318-4

NovaBlue Singles™ Competent Cells, like all Novagen® Singles Competent Cells, are designed for ultimate convenience and reliability in plasmid transformation. The cells are grown and made chemically competent using an optimized procedure. Cells are provided in 50-µl volumes to eliminate the need to aliquot, freeze/thaw, or waste partially used vials. This saves time, money, and ensures reliable cell performance. To use, simply thaw, add DNA, incubate five minutes on ice, heat shock for 30 seconds, place on ice for two minutes, add SOC Medium, and plate directly (when selecting for ampicillin resistance) or after incubation at 37˚C for 30 minutes (when selecting for other antibiotic resistances).

The NovaBlue T1R strain has the same features as NovaBlue, with the added benefit of being resistant to T1 and T5 phage. NovaBlue is a K-12 strain ideally suited as an initial cloning host because it has high transformation efficiency, blue/white screening capability (with appropriate plasmids), and mutations in endA and recA, which result in high yields of high-quality plasmid DNA.NovaBlue T1R Genotype:endA1 hsdR17 (rK12

– mK12+) supE44 thi-1 recA1 gyrA96 relA1 lac tonA F’[proA+B+

lacIqZM15::Tn10] (TetR)

ON THE WEB

ON THE WEB




52

PCR Cloning


PCR • PCR Cloning

52

Zappers™ Electrocompetent Cells 1010 cloning efficiency in phage-resistant strains

Features• Conveniently packaged• Guaranteed transformation efficiency of

>1 × 1010 cfu/mg• Methylation restriction minus• Recombination and restriction minus• Resistant to T1 and T5 phage• Enables blue/white screening by α-complementation with

appropriate plasmids

Components11 × 50 ml or 22 × 50 ml Veggie NovaBlue Singles Competent Cells2 × 2 ml or 4 × 2 ml Veggie SOC Medium10 ml Test Plasmid

Veggie™ NovaBlue Singles™ Competent Cells Certified animal-free chemically competent cells

Features• Guaranteed efficiency >1.5 × 108 cfu/mg• Manufactured free of animal-derived media and

components• Reproducible high-efficiency cloning• Enables production of high-quality plasmid DNA • Easy-to-use Singles format• Prepared using an optimized chemical method

Product Size Cat. No. PriceVeggie™ NovaBlue Singles™ Competent Cells

11 rxn22 rxn

71251-371251-4 NovaBlue Genotype:

endA1 hsdR17(rK12– mK12

+) supE44 thi-1 recA1 gyrA96 relA1 lac F’[proA+B+ lacIqZM15::Tn10] (TetR)

*Anim

al-Derived MaterialsFR E E

AD M

*

Veggie™ NovaBlue Singles™ Competent Cells are appropriate for standard cloning applications when absence of animal-derived components is essential. NovaBlue is a K-12 strain ideally suited as an initial cloning host due to its high transformation efficiency, blue/white screening capability (with appropriate plasmids), and mutations in recA and endA, which result in excellent yields of high-quality plasmid DNA. Veggie NovaBlue Singles Competent Cells are supplied with an animal-free prepared SOC medium.

NovaXG and NovaXGF´ Zappers™ Electrocompetent Cells combine favorable genotypes with high-transformation efficiency for the most demanding cloning applications. Both cell types have tonA mutations conferring resistance to T1 and T5 phage. NovaXG features deletion of genes involved in restriction of methylated DNA [(mcrC–mrr)], and recA and endA mutations, which facilitate excellent yields of high-quality plasmid DNA. The lacZ w fragment is expressed constitutively from the genome of NovaXG and allows blue/white screening for recombinants by lacZ α-complementation.

NovaXGF´ cells have the same genotype as NovaXG, but harbor an F´ episome which confers tetracycline resistance and allows infection by M13 for single strand DNA production. Because the F´ carries the lacIq repressor gene, addition of IPTG is required for blue/white screening of recombinants. In the absence of IPTG, transcription of insert DNA from the lac promoter is kept to a minimum.

Both NovaXG and NovaXGF´ strains are manufactured for ultra-high transformation efficiency (>1 × 1010 cfu/mg) by electroporation. Ultra-high efficiency is especially important when working with limited amounts of DNA or when constructing raries. Cells are packaged at two reactions per tube to minimize waste.

NovaXG Genotype:F– mcrA (mcrC-mrr) endA1 recA1 φ80dlacZM15 lacX74 araD139 (ara-leu)7697 galU galK rpsL nupG l– tonA

NovaXGF’ Genotype:mcrA (mcrC-mrr) endA1 recA1 φ80dlacZM15 lacX74 araD139 (ara-leu)7697 galU galK rpsL nupG l tonA F’[lacIq Tn10] (TetR)

ON THE WEB


ON THE WEB


Components5 × 50 ml or 10 × 50 ml NovaXG or XGF' Zappers Electrocompetent Cells10 ml Test Plasmid

Product Size Cat. No. PriceNovaXG Zappers™ Electrocompetent Cells

10 rxn20 rxn

71315-371315-4

NovaXGF’ Zappers™ Electrocompetent Cells

10 rxn20 rxn

71317-371317-4


PCR Cloning


PCR • PCR Cloning

53

Features• Guaranteed efficiency >1 × 108 cfu/mg• High-throughput, 96-well format

HT96™ NovaBlue Competent Cells High-efficiency competent cells predispensed in a 96-well plate for high-throughput applications

Components1 or 4 plates HT96 NovaBlue Competent Cells1 × 14 ml or 4 × 14 ml SOC Medium 1 × 10 ml or 2 × 10 ml Test Plasmid 1 or 4 pkg 8-Cap Strips1 or 4 Reagent Reservoirs

Product Size Cat. No. PriceHT96™ NovaBlue Competent Cells 1 plate

4 plates71011-371011-4

HT96™ Isothermal Block Efficient thermal transfer to samples in an HT96 plate

The HT96 Isothermal Block is an anodized aluminum, solvent-resistant block specifically designed to hold one HT96 plate and to provide efficient thermal transfer to samples held within the 96-well plate. Using an HT96 Isothermal Block for each temperature, samples can be rapidly transferred between the low-temperature and heat-shock steps in transformation protocols. Simply preincubate the anodized aluminum block at the desired temperature and place the HT96 Competent Cell plate in the block. The HT96 Isothermal Block is compatible with most 96-well PCR plates and robotic platforms.

Product Size Cat. No. PriceHT96™ Isothermal Block 1 ea 71195-3

ON THE WEB


HT96™ NovaBlue Competent Cells are designed for high-throughput transformation. The cells are predispensed in 20-ml volumes in a sturdy 96-well polypropylene plate compatible with a variety of thermal cyclers and water baths. Wells are individually sealed and have raised rims to prevent cross-contamination. Seals can be pierced with standard pipet tips or removed for easier access. Strips of caps are also provided for reliable sealing during manipulation and storage. Groups of 24 wells can be easily split from the plate for processing smaller numbers of samples.


54

Molecular Biology Essentials


PCR • Molecular Biology Essentials

54

Molecular Biology ReagentsON THE W

EB

www.calbiochem.com /MolecularBiology


Ethidium Bromide AbsorberSafely remove ethidium bromide

Gray-brown suspension. Developed specifically for the safe and simple removal of ethidium bromide (EtBr) from aqueous staining solutions and running buffers used in nucleic acid separation gels. Typical concentrations in these solutions are 0.5-10 mg/L. EtBr is bound and concentrated by the adsorber column, allowing filtrate removal. Each column normally binds at least 300 mg of ethidium bromide from TAE or TBE buffers. Residual capacity is easily visualized because the EtBr appears as a dark red to black band on the column. As long as this band has not reached the bottom of the column bed, the concentration of dye is still below the column capacity. EC 214-984-6, RTECS SF7950000, CAS 1239-45-8. Merck Index: 14, 4731

Formaldehyde, Molecular Biology GradeCH2O

A solution of 37% by weight of formaldehyde gas in water, with 10% methanol added to prevent polymerization. Useful as a preservative, stabilizer, and disinfectant. Purity: ≥37% by acidometry. Contaminants: RNases: none detected. Heavy metals: 0.0002% (as Pb). RTECS LP8925000, CAS 50-00-0. Merck Index: 14, 4235. R: 23/24/25-34-40-43; S: 26-36/37/39-45-51.

X-Gal SolutionFor blue/white screening

The β-galactosidase substrate X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) is a chromogenic stain for b-gal activity. It is commonly used to distinguish between recombinants and nonrecombinants by lacZ α-complementation with appropriate vectors and hosts. X-Gal Solution is provided as a convenient 40 mg/ml concentrate in DMSO (3 × 1-ml tubes), ready for dilution into culture medium or appropriate buffers.

Sodium Chloride Tablets (10 Tablets)Each tablet contains 9 g sodium chloride. Note: 1 each = 10 tablets. RTECS VZ4725000, CAS 7647-14-5.

Product Size Cat. No. PriceAgarose, Type I, Molecular Biology Grade

100 g500 g

121853

EDTA, 0.5 M, pH 8.0, Molecular Biology Grade, DEPC-Treated

100 ml 324506

EDTA, Disodium Salt, Dihydrate, Molecular Biology Grade

100 g1 kg

324503

Ethidium Bromide 1 g 331564

Ethidium Bromide Adsorber 1 ea 331569

Formaldehyde, Molecular Biology Grade

250 ml 344198

X-Gal Solution 3 ml 71077-3

Sodium Chloride Tablets 1 ea (10 tablets)

567442

Agarose, Type 1, Molecular Biology GradeFor nucleic acid electrophoresis

Suitable for the preparation of gels for nucleic acid electrophoresis. Gel strength: ≥1200 g/cm2. PROTECT FROM MOISTURE. Gelling range (1.5%): 36-39°C. Melting range: 87-89°C. EEO -mr: ≤0.10. Contaminants: Sulfate: ≤0.15%; DNase, RNase, protease: none detected. EC 2327318, CAS 9012-36-6.

EDTA, 0.5M, pH 8.0, Molecular Biology Grade, DEPC-TreatedEthylenediaminetetraacetic Acid Trisodium Salt

Sterile-filtered solution of 0.5 M EDTA in H2O treated with diethyl pyrocarbonate (DEPC). Suitable for use in molecular biology applications. CAS 150-38-9.

EDTA, Disodium Salt, Dihydrate, Molecular Biology GradeEthylenediaminetetraacetic Acid, 2Na

A chelating agent used to sequester divalent and trivalent metal ions. HYGROSCOPIC. Contaminants: DNases, proteases, RNases: none detected. RTECS AH4410000, CAS 6381-92-6. Merck Index: 14, 3517 R: 22.

Ethidium BromideNucleic acid stain

Red to purple solid. PROTECT FROM LIGHT. Fluorescent dye that produces fluorescent intercalation complexes with DNA. Suitable for use in gel electrophoresis and DNA isolation procedures. Purity: 95% HPLC. EC 214-984-6, RTECS SF7950000, CAS 1239-45-8. Merck Index: 14, 4731

Molecular Biology ReagentsON THE W

EB





55

Molecular Biology Grade Buffers

Product Size Cat. No. PriceHEPES, Free Acid, Molecular Biology Grade

25 g250 g

391340

Tris Base, Molecular Biology Grade 500 g2.5 kg

648310

Tris Buffer, 1.0 M, pH 8.0, Molecular Biology Grade

100 ml 648314

Tris Buffer, 100 mM, pH 7.4, Molecular Biology Grade

100 ml 648315

TAE Buffer, 10X, Molecular Biology Grade

1 L 574797

TE Buffer, 100X, Molecular Biology Grade

1 l 574793

TBE Buffer, 10X, Molecular Biology Grade

1 L 574795

HEPES, Free Acid, Molecular Biology Grade N-2-Hydroxyethylpiperazine-N’-2-ethanesulfonic Acid

A zwitterionic N-substituted aminosulfonic acid buffering agent suitable for use with proteins, nucleic acids, and cell culture. pKa 7.48 at 25°C. Useful in the pH 6.8-8.2 range. Maintains buffering capacity at low temperatures. Purity: ≥99% by alkalimetric assay. Contaminants: DNase, RNase, and protease: none detected. Heavy metals: ≤0.0005%. pKa 7.55.

RTECS TL6809000, CAS 7365-45-9. Merck Index: 14, 4654.

Tris Base, Molecular Biology Gradetris(Hydroxymethyl)aminomethane

Widely used to prepare buffers for nucleic acids. pKa 8.1 at 25°C. Useful in the pH range of 7.0-9.0. Purity: ≥99% by titration test (perchloric acid titration). Contaminants: RNases, DNases, proteases: none detected. Absorbance (260 nm): ≤0.03; (280 nm): 0.02. Heavy metals: ≤0.0005%. pKa 8.30 at 20°C.

RTECS TY2900000, CAS 77-86-1. Merck Index: 14, 9772. R: 36/38; S: 26.

Tris Buffer, 1.0 M, pH 8.0, Molecular Biology GradeSterile 1 M solution. Suitable for DNA and RNA applications. Contaminants: DNases, RNases: none detected.

RTECS TY2900000, CAS 77-86-1. R: 36/38; S: 26.

ON THE WEB


Tris Buffer, 100 mM, pH 7.4, Molecular Biology GradeSterile 100 mM solution, pH 7.4. Widely used biological buffer. Suitable for DNA and RNA applications. Contaminants: DNases, RNases: none detected.

RTECS TY2900000, CAS 77-86-1. Merck Index: 14, 9772. R: 36/38; S: 26.

TAE Buffer, 10X, Molecular Biology Grade Tris-Acetate-EDTA Buffer

Used in the preparation of agarose gels and as a running buffer for nondenaturing nucleic acid electrophoresis. TAE is recommended over TBE for preparative gels. With a lower buffering capacity than TBE, recirculation of buffer during extended electrophoresis is recommended. Supplied as 10X solution containing 400 mM Tris acetate, 10 mM EDTA, pH 8.3.

TE Buffer, 100X, Molecular Biology GradeA widely-used buffer for nucleic acids. This concentrated formulation is 1M Tris, 100 mM EDTA, pH 8.0.

TBE Buffer, 10X, Molecular Biology GradeTris-Borate-EDTA Buffer

Used in the preparation of agarose gels and as a running buffer for nondenaturing nucleic acid electrophoresis. TBE has better buffering capacity than TAE, so recirculation of buffer during extended electrophoresis is not necessary. TBE is not recommended for preparative gels. The 10X concentrate is 0.89 M Tris, 0.89 M boric acid, 20 mM EDTA, pH 8.3. Contaminants: DNase, RNase, protease: none detected.

R: 36/37/38; S: 36/37/39


56




56

Molecular Biology Enzymes

Product Size Cat. No. PriceDNase I, RNase free 1000 U 69182-3

DNase I, ds Qualified 50 U 69164-3

Phosphatase, Alkaline, Calf Intestine, Molecular Biology Grade

1000 U 524576

DNase I, RNase free and DNase I, ds Qualified For applications in which maintenance of RNA integrity is critical

RNase-free DNase I digests either single- or double-stranded DNA, producing a mixture of mono- and oligonucleotides. Purified to be free of RNase, this preparation is qualified for applications in which maintenance of RNA integrity is critical. The enzyme selectively degrades DNA in the presence of RNA and can be used to remove DNA template following in vitro transcription reactions. This enzyme is also useful in other applications such as DNase footprinting and nick translation. For applications requiring the use of DNase I for random double-stranded cleavage of DNA, use DNase I, ds Qualified.

Unit definition: One unit will degrade 1 mg DNA in 10 minutes at 37˚C. The reaction mixture (50 ml) contains 80 mM HEPES pH 7.5, 10 mM NaCl, 5 mM MgCl2, 10 mM DTT, 1 mg plasmid DNA, and enzyme.

Phosphatase, Alkaline, Calf Instestine, Molecular Biology GradeDephosphorylation of nucleic acids

Calf Intestine Alkaline Phosphatase catalyzes the hydrolysis of 5´-terminal phosphates of DNA, RNA, and deoxy- and ribonucleoside triphosphates (Moessner 1990). The enzyme will dephosphorylate vector DNA to prevent “empty vector” religation in cloning experiments, and remove 5´-phosphate groups in preparation for labeling with polynucleotide kinase. Specific activity is 2000 U/mg protein. No contaminating DNase or RNase are detected. Supplied as a liquid in 25 mM Tris-HCl, 1 mM MgCl2, 100 µM ZnCl2, 50% glycerol, pH 7.6. pH optimum is 8.0–10.5, pI 5.7. EC 3.1.3.1, CAS 9001-78-9, M.W. 140,000.

Unit definition: One unit is defined as the amount of enzyme that will hydrolyze 1.0 mmol of pNPP per minute at 37˚C, pH 9.8.

Reference: Moessner, E., et al. 1980. Hoppe-Seylers Z. Physiol. Chem. 361, 543.

ON THE WEB


This is a select list of our molecular biology reagents.

For a comprehensive listing, see the Calbiochem catalog or visit www.calbiochem.com/molecularbiology





57

Product Size Cat. No. PriceProteinase K Solution, 600 mAU/ml

2 ml10 ml

71049-371049-4

Proteinase K, Lyophilized 100 mg500 mg

70663-470663-5

RNase A, Protease-Free, Highly Purified, Bovine Pancreas

10 KU50 KU

556746

RNase A Solution 1 ml 70856-3

T4 DNA Ligase 100 U500 U

69839-369839-4

T4 Polynucleotide Kinase 250 U 69248-3

Proteinase K Efficient removal of proteins from nucleic acid solutions

Proteinase K is a highly active 28,904-Da serine protease isolated from the fungus Tritirachium album. The enzyme exhibits broad cleavage specificity on native and denatured proteins and is widely used in the purification of DNA and RNA. Its activity is increased in the presence of denaturants such as SDS (1%) and elevated temperature (50–60˚C). The recommended working concentration is 50–100 µg/ml for protein removal and enzyme inactivation, and up to 2 mg/ml for tissue treatment. The Proteinase K, Lyophilized powder can be prepared as a 20 mg/ml stock solution in water and stored in aliquots at –20˚C. The enzyme is also available as a ready-to-use concentrated stock solution (600 mAU/ml) that is convenient for routine use in most applications. 1 mg of Proteinase K is the equivalent of 30 mAU (AU = Anson unit). Proteinase K products are free of detectable DNase and RNase.

Unit definition: One AU (AU = Anson unit) is defined as the amount of enzyme that liberates 1.0 mmol (181 mg) of tyrosine from casein per minute at pH 7.5 at 37˚C.

Ribonuclease A, Protease-FreeDephosphorylation of nucleic acids

Ribonuclease A, Protease-Free is a chromatographically purified, pyrimidine-specific endoribonuclease that acts on single-stranded RNA. Supplied lyophilized.

Unit definition: One unit is defined as the amount of enzyme that will catalyze the hydrolysis of RNA to yield a first-order velocity constant equal to 1.0 at 25˚C, pH 5.0.

Molecular Biology EnzymesON THE W

EB


Merck Index 13, 8286.Reference: Moessner, E., et al. 1980. Hoppe-Seylers Z.

Physiol. Chem. 361, 543.

RNase A SolutionConvenient solution for selective degradation of RNA

RNase A Solution is a convenient alternative to powdered RNase A. It is a highly purified preparation of bovine pancreatic ribonuclease A suitable for use in selective removal of RNA. It has been pretreated to remove DNase I and is suitable for RNA digestion in plasmid purification procedures. Supplied at a concentration of 10 mg/ml in 10 mM Tris-HCl, 1 mM EDTA, 50% glycerol, pH 7.5.

T4 DNA LigaseQualified for the most stringent cloning conditions

T4 DNA Ligase catalyzes the formation of phosphodiester bonds between 3´-hydroxyl and 5´-phosphate groups of adjacent DNA and RNA nucleotides in blunt-end or cohesive-end configurations. The enzyme joins RNA and DNA strands only in duplex molecules and does not join single-stranded nucleic acids. Novagen® T4 DNA Ligase is rigorously tested in a blue-white cloning assay under conditions that maximize exposure of DNA ends to any contaminating nucleases. The enzyme is qualified for any ligation or cloning application.

Unit definition: 4 Weiss units/µl; one Weiss unit is defined as the amount of enzyme required to catalyze the exchange of 1 nmole 32P from pyrophosphate into ATP as Norit®-absorbable material in 20 minutes at 37˚C. 0.01 Weiss unit is the amount of enzyme required to ligate > 95% of 1 µg bacteriophage l HindIII fragments at 16˚C in 20 minutes.

T4 Polynucleotide KinaseQualified for the most stringent cloning conditions

T4 Polynucleotide Kinase (PNK) catalyzes the transfer of the γ-phosphate from ATP to the 5´-hydroxyl of single and double stranded DNA or RNA. This activity makes PNK useful for 5´–end labeling of DNA or RNA molecules for hybridization probes or labeled primers for sequencing. The enzyme is also useful for preparing non-radioactive phosphorylated DNA for cloning or PCR primers.

Novagen PNK has been rigorously tested for contaminating exonuclease, endonuclease, and ribonuclease activities. For convenience and reliable performance, 10X Kinase Buffer and ATP solution are provided with the enzyme.

Unit definition: One unit is defined as the amount of enzyme required to catalyze the transfer of 1 nmol phosphate to the 5´-OH end of an oligonucleotide from [γ-32P]ATP in 30 min. Unit assay conditions: 40 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.1 mM [γ-32P]ATP, and 0.5 mM 5´-OH polynucleotide end concentration.


58




58

Product Size Cat. No. PriceD-Tube™ Dialyzer Mini, MWCO 6-8 kDa

1 kit 71504-3 b

D-Tube™ Dialyzer Mini, MWCO 12-14 kDa

1 kit 71505-3 b

D-Tube™ Dialyzer Midi, MWCO 3.5 kDa

1 kit 71506-3 b

D-Tube™ Dialyzer Midi, MWCO 6-8 kDa

1 kit 71507-3 b

D-Tube™ Dialyzer Maxi, MWCO 3.5 kDa

1 kit 71508-3 b

D-Tube™ Dialyzer Maxi, MWCO 6-8 kDa

1 kit 71509-3 b

D-Tube™ Dialyzer Maxi, MWCO 12-14 kDa

1 kit 71510-3 b

Floating Rack, Mini 10 racks 71512-3

Floating Rack, Midi 10 racks 71513-3

Floating Rack, Maxi 10 racks 71514-3

D-Tube™ DialyzersDialysis and electroelution from polyacrylamide or agarose gels

Features: • Easy-to-handle dialyzers for buffer exchange and removal

of detergents and urea• One-step procedure that does not require syringes or any

special equipment • Typical volume recovery of sample in solution >97% • Free of Protease, RNAse, DNAse, and PCR products• Ideal for electroelution of proteins, protein-DNA

complexes, oligonucleotides, DNA, and RNA from polyacrylamide and agarose gels

D-Tube Dialyzer Size Volume MW Cutoff

Mini 10 to 250 µl10 to 250 µl

6-8 kDa12-14 kDa

Midi 50 to 800 µl50 to 800 µl

3.5 kDa6-8 kDa

Maxi 100 to 3000 μl100 to 3000 μl100 to 3000 μl

3.5 kDa6-8 kDa12-14 KDa

ComponentsCat. No. 71504 – 7151010 D-Tubes1 Floating Rack

Additional Information Available D-Tube Dialyzer Mini, Midi, Maxi and D-Tube96 User Protocol TB422inNovations Nos. 21, 27

The D-Tube™ Dialyzers can be used for dialysis and electroelution of proteins, RNA, DNA, and oligonucleotides from polyacrylamide or agarose gels. The disposable, single-use tubes require no syringes, microcentrifuge, or laborious steps to manipulate small sample volumes. The sample is added and removed using a standard laboratory pipette. Available with molecular weight cutoffs (MWCO) from 3.5 to 14 kDa, the D-Tube Dialyzers are designed in three volume capacities: mini (10–250 µl), midi (50–800 µl), and maxi (500–3000 µl). The membrane is ultra-clean, EDTA-treated regenerated cellulose, sulfur- and heavy metal-free. Each kit contains 10 D-Tube Dialyzers and one floating rack that can hold up to four D-Tube Dialyzers in the exchange buffer.





59

Features: • Efficient extraction of protein, protein-DNA complexes,

oligonucleotides, DNA, and RNA from 1D and 2D polyacrylamide and agarose gels

• More than 60% protein recovery• More than 90% recovery of oligonucleotides , RNA, and

DNA from 15 nt to 80 kb in size• Procedure compatible with variety of downstream

applications including MALDI-MS, functional assays, and HPLC

D-Tube™ Electroelution Accessory KitOptimized reagents for protein and nucleic acid precipitation following electroelution

Product Size Cat. No. PriceD-Tube™ Electroelution Accessory Kit

1 kit 71511-3

Components1 ml MS Precipitation Buffer 10 ml TCA, 20%2 × 1 ml 3 M NaAc, pH 5.23 Supporting Trays, Mini, Midi, Maxi

The combination of D-Tube™ Dialyzers and the D-Tube Electroelution Accessory Kit provides a unique tool for extraction of any protein, protein-protein complex, or protein-DNA complex from non-denaturing and denaturing (SDS) polyacrylamide gels with 60% recovery yield in less than 2 hours. Extracted proteins are compatible with most downstream applications such as MALDI-MS, animal immunization for antibody production, HPLC, peptide mapping, and functional assays. In addition, D-Tube Dialyzers can be used for oligonucleotides, RNA, and DNA extraction from both polyacrylamide and agarose gels. Efficient extraction (> 90%) is achieved for 15-nt oligos and for DNA fragments of up to 80 kb. The D-Tube Electroelution Accessory Kit provides, three D-Tube support trays, one for each size D-Tube which is compatible with most commercially available horizontal electrophoresis units and optimized reagents for protein and nucleic acid precipitation following electroelution.

For any questions on our PCR portfolio, contact your local sales representative or Technical Support.


ArgentinaMerck Quimica Argentina S.A.I.C.Tel: +54 11 4546 8100 Fax: +54 11 4546 7369E-mail: [email protected]

AustraliaMerck Pty. LimitedTel: +61 3 9728 7600Fax: +61 3 9728 1351E-mail: [email protected]

BrazilMerck S.A.Toll Free: 0800 21 9292Tel: +55 11 3346 8500Fax: +55 11 3207 5040E-mail: [email protected]

Imprint do Brasil Ltda.Tel: +55 19 3772 2900Fax: +55 19 3273 5389E-mail: [email protected]

CaribbeanMerck, S.A.See information under Central America

Central AmericaMerck, S.A. GuatemalaTel: +50 2 2410 2300Fax: +50 2 2250 5193E-mail: [email protected]

ChileMerck S.A.Tel: +56 2 3400 000Fax: +56 2 3400 399E-mail: [email protected]

ChinaMerck ChinaTech Service: 400 820 8872Tel: +86 21 3222 4788Fax: +86 21 6247 9680E-mail: [email protected]

ColombiaMerck Colombia S.A.Tel: +57 1 425 4770Fax: +57 1 425 5407 E-mail: [email protected]

EcuadorMerck C.A.Tel: +593 2 298 1677Fax: +593 2 298 1644E-mail: [email protected]

GuatemalaMerck S.A.See information under Central America

Hong KongOnwon Trading LimitedTel: +852 2757 7569Fax: +852 2757 7211E-mail: [email protected]

IndiaMerck Specialities Private LimitedTel: +91 22 6660 9184Tel: +91 22 6660 9000Fax: +91 22 2495 4590Fax: +91 22 2495 0307E-mail: [email protected]

IndonesiaPt. Merck Tbk.Toll Free: 0800 140 1253Tel: +62 21 841 3889Fax: +62 21 841 5537E-mail: [email protected]

IsraelMercury Scientific & Industrial Products Ltd.Tel: +972 3 938 7164Fax: +972 3 938 7174E-mail: [email protected]

JapanMerck Ltd. Tel: +81 0120 189 390Fax: +81 0120 189 350E-mail: [email protected]

KoreaMerck LimitedTel: +82 2 2185 3836Tel: +82 2 2185 3840, 3842Fax: +82 2 2185 3870 E-mail: [email protected]

MalaysiaMerck Sdn BhdTel: +6 03 7494 3688Fax: +6 03 7491 0850 Fax: +6 03 7491 0860 E-mail: [email protected]

MexicoControl Técnico Y Representaciones Monterrey, Nuevo, LeónTel: +52 81 8158 0600Fax: +52 81 8373 2891E-mail: [email protected]

Mexico CityTel: +52 55 5208 5197 +52 55 5208 5198 +52 55 5208 8116Fax: +52 55 5203 6229

New ZealandMerck LimitedToll Free: 0800 46 37 25Tel: +64 06 356 7328Fax: +64 06 356 7311E-mail: [email protected]

PakistanMerck (Private) LimitedTel: +92 21 455 9210Fax: +92 21 453 5294E-mail: [email protected]

PeruMerck Peruana S.A.Tel: +51 1 6187 500Fax: +51 1 4372 955E-mail: [email protected]

PhilippinesMerck Inc.Tel: +63 2 815 4067Tel: +63 2 815 4208Fax: +63 2 815 4882E-mail: [email protected]

SingaporeMerck Pte. Ltd.Customer Hotline: +65 6890 6660Tel: +65 6890 6660Fax: +65 6890 6639E-mail: [email protected]

South AfricaMerck Laboratory Supplies DivisionTel: +27 11 345 9000National Contact No. 08600 63725Fax: +27 11 345 9251E-mail: [email protected]

TaiwanMerck Ltd.Tel: +886 2 2742 2788Fax: +886 2 2742 2766E-mail: [email protected]

ThailandMerck Ltd. Tel: +66 2 667 8333Fax: +66 2 667 8338E-mail: [email protected]

VenezuelaMerck S.A. Tel: +58 21 2235 1379Fax: +58 21 2237 7632E-mail: [email protected]

VietnamMerck Representative Office Tel: +84 8 932 0187Fax: +84 8 526 0201E-mail: [email protected]

10002722PCR Tools 2008 APLA

Documents

201008.164.ProNet