Embed Size (px)
Citation preview
1
Staphylococcus aureus metabolism in a biofilm: the 1
influence of arginine on polysaccharide intercellular 2
adhesin synthesis, biofilm formation, and pathogenesis 3
4
5
Running title: Staphylococcus aureus biofilm metabolism 6
7
Yefei Zhu1, Elizabeth C. Weiss
2, Michael Otto
3, Paul D. Fey
4, Mark S. Smeltzer
2, 8
and Greg A. Somerville1 *
9
10
1 Department of Veterinary and Biomedical Sciences, University of Nebraska, Lincoln, 11
NE 68583 12
13
2 Department of Microbiology and Immunology, University of Arkansas for Medical 14
Sciences, Little Rock, AR 72205 15
16
3 Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, 17
National Institute of Allergy and Infectious Diseases, National Institutes of Health, 18
Hamilton, MT 59840 19
20
21
ACCEPTED
Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00509-07 IAI Accepts, published online ahead of print on 18 June 2007
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
2
4 Department of Pathology and Microbiology, University of Nebraska Medical Center, 1
Omaha, NE 68198 2
3
* Corresponding author. Mailing address:
Department of Veterinary and Biomedical 4
Sciences, University of Nebraska, 155 VBS, East Campus Loop, Lincoln, Nebraska 5
68583-0905. 6
Telephone: (402) 472-6063 7
Fax: (402) 472-9690 8
E-mail: [email protected] 9
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
3
[Abstract] 1
2
Staphylococcus aureus and S. epidermidis are the leading causes of nosocomial 3
infections in the USA and often associated with biofilms attached to indwelling medical 4
devices. Despite the importance of biofilms, there is very little consensus about the 5
metabolic requirements of S. aureus during biofilm growth. To assess the metabolic 6
requirements of S. aureus growing in a biofilm, we grew USA200 and USA300 clonal 7
types in biofilm flow cells, and measured the extraction and accumulation of metabolites. 8
In spite of the genetic differences, both clonal types extracted glucose and accumulated 9
lactate, acetate, formate, and acetoin, suggesting glucose was catabolized to pyruvate that 10
was then catabolized via the lactate dehydrogenase, pyruvate formate-lyase, and 11
butanediol pathways. Additionally, both clonal types selectively extracted the same six 12
amino acids from the culture medium (serine, proline, arginine, glutamine, glycine, and 13
threonine). These data and recent speculation about the importance of arginine in biofilm 14
growth and the function of arginine deiminase in USA300 clones, led us to genetically 15
inactivate the sole copy of the arginine deiminase operon by deleting the 16
arginine/ornithine antiporter (arcD) in the USA200 clonal type and assess the effect on 17
biofilm development and pathogenesis. Although inactivation of arcD did completely 18
inhibit arginine transport and did reduce polysaccharide intercellular adhesin 19
accumulation, arcD mutants formed biofilms and achieved cell densities in catheter 20
infection studies equivalent to isogenic wild-type strains. 21
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
4
[Introduction] 1
2
Staphylococcus aureus is a leading cause of nosocomial and community-acquired 3
infections. Although the types and severity of diseases produced by this opportunistic 4
pathogen vary, it is a frequent cause of infections associated with indwelling medical 5
devices (e.g., catheters and artificial heart valves). Indwelling device-associated 6
infections commonly involve the formation of a bacterial biofilm on an uncoated plastic 7
surface, or a plastic surface coated with host proteins (58). Due to the importance of S. 8
aureus biofilms in medical device-associated infections, a considerable amount of 9
research has been directed at understanding the mechanisms of biofilm formation. Much 10
of this research has focused on the bacterial mediators of biofilm formation [e.g., (41, 43, 11
56, 59)], the environmental effectors of biofilm formation [e.g., (26, 28, 50)], and more 12
recently the global changes that occur during biofilm development (2, 44, 45, 60). The 13
consensus from transcriptional profiling studies of S. aureus biofilms is that bacteria are 14
growing microaerobically or anaerobically relative to planktonic cultures (2, 45). This is 15
exemplified by increased expression of genes of the arginine deiminase and mixed acid 16
fermentation pathways and pyruvate formate lyase. Support for the idea that 17
staphylococci growing in a biofilm are growing microaerobically can be found in the 18
observations that anaerobiosis increases biofilm formation and polysaccharide 19
intercellular adhesin (PIA) synthesis (11, 53). 20
Although the number of known requirements for S. aureus biofilm formation is 21
low, a considerable amount of research has provided important information regarding 22
potential mediators of biofilm formation. As examples, S. aureus regulates the formation 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
5
of biofilms in response to nutrient availability, oxygen tension, and a variety of stresses 1
(11, 21, 25, 33, 43). Importantly, these observations highlight a recurrent regulatory 2
theme in pathogenesis; environmental factors alter the metabolic status of the bacteria, 3
resulting in an alteration of virulence (38) or, in this incidence, biofilm-forming capacity 4
(6). Despite this being a common regulatory theme, the relationship between 5
environmental factors and pathogenesis is poorly defined. Addressing this relationship is 6
particularly important in the era of “omics”, when genomics, proteomics, and high 7
throughput mutagenesis screens consistently identify the genes of bacterial physiology 8
and metabolism as being important, or essential, for pathogenesis (2, 3, 17, 30, 32, 39). 9
To enhance our understanding of the metabolic requirements of S. aureus biofilm 10
development, two S. aureus strains (UAMS-1 and UAMS-1182) were grown in flow cells 11
and the culture medium effluent was collected and analyzed for nutrient extraction, 12
secondary metabolite accumulation, and oxygen concentration. These two strains were 13
chosen because they represent both methicillin susceptible and methicillin resistant S. 14
aureus (MSSA and MRSA) phenotypes and are from distinct genetic backgrounds 15
(USA200 and USA300 clonal types). 16 ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
6
MATERIALS AND METHODS 1
2
Bacterial strains and growth conditions. By pulsed-field gel electrophoresis 3
(PFGE), strain UAMS-1 is an MSSA strain of the USA200 clonal group, while UAMS-4
1182 is an MRSA strain indistinguishable from the USA300 clonal group (data not 5
shown) (37). PFGE control strains (i.e., known USA clonal groups) were provided by 6
NARSA (Network on Antimicrobial Resistance in Staphylococcus aureus; 7
www.narsa.net). In addition, UAMS-1182 was identified as belonging to the USA300 8
clonal group based on the presence of the arginine catabolic mobile element (19) as 9
determined by PCR (data not shown). Strains and plasmids used in this study are listed in 10
Table 1. Escherichia coli strains were grown in 2xYT broth (47) or on 2xYT agar and S. 11
aureus strains were grown in tryptic soy broth containing 0.25% glucose (TSB) (BD 12
Biosciences) or on TSB containing 1.5% agar. Unless otherwise stated, all bacterial 13
cultures were inoculated 1:200 from an overnight culture (normalized for growth) into 14
TSB, incubated at 37° C, and aerated at 225 rpm with a flask-to-medium ratio of 10:1. 15
Antibiotics were purchased from Fisher Scientific or Sigma Chemical and, when used, 16
were used at the following concentrations: ampicillin, 100 µg/ml (E. coli);
erythromycin, 17
8 µg/ml and chloramphenicol, 8 µg/ml (S. aureus). 18
19
Construction of S. aureus arc mutants. A 1.8-kb internal fragment of arcD gene 20
was amplified by PCR and cloned into the SmaI site of pBluescript II K/S (+) 21
(Stratagene) to construct the plasmid pYF-1. The ermB cassette of pEC4 (7) was inserted
22
into the NdeI site within the arcD fragment of pYF-1 to generate the plasmid pYF-2. 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
7
Next, the arcD::ermB fragment was cloned into the KpnI and EcoRI site of the 1
temperature-sensitive shuttle plasmid pTS1 (22) to generate the plasmid pYF-3. The 2
temperature-sensitive plasmid pYF-3 was electroporated into S. aureus strain RN4220 3
(48) and was then introduced into strain UAMS-1 by φ85 phage transduction (40).
Strain 4
UAMS-1 containing pYF-3 was used to construct an arcD mutant by the method 5
described by Foster (18). Putative mutants were confirmed by PCR, Southern blotting 6
(52), and enzymatic assays. 7
8 To facilitate monitoring the course of the catheter-associated infections, we 9
generated an arcD mutation in S. aureus strain Xen40 (Caliper Life Sciences, Hopkinton, 10
MA). Xen40 is strain UAMS-1 with a chromosomal insertion of the luxABCDE operon 11
modified for expression in gram-positive bacteria (27). The mutant was made using the 12
pKOR1 mutagenesis vector as previously described (1) using upstream primers ArcD1-13
attB2F and ArcD1-SacIIR and downstream primers ArcD2-SacIIF and ArcD2-attB1R 14
(Table 2). The PCR products were digested with SacII, ligated together, amplified using 15
the two outside primers (ArcD1-attB2F and ArcD2-attB1R), and ligated into pKOR1. 16
The recombinant pKOR1 arcD construct was transformed into strain Xen40 and the arcD
17
mutant was constructed as previously described (1). Inactivation of arcD was verified by 18
PCR using the ArcD1-attB2F and ArcD2-attB1R primers, by confirming 19
bioluminescence using the IVIS-200 imaging system (Caliper Life Sciences), and 20
enzymatic assays. A Xen40 arcD mutant strain (UAMS-1272) with growth 21
characteristics indistinguishable from UAMS-1-arcD::ermB was chosen for the animal 22
experiments. 23
24
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
8
PIA Immunoblot assay. PIA accumulation was determined essentially as 1
described (57). Briefly, bacterial cultures were grown for 16 h at 37° C with a flask-to-2
medium ratio of 5:1 and aerated at 160 rpm. Equivalent cell densities of S. aureus were 3
harvested by centrifugation and PIA was extracted with 0.5 M EDTA (pH 8.0) by boiling 4
for 5 min. After boiling, the samples were centrifuged and the supernatants were 5
harvested and incubated with Proteinase K (20 mg/ml;
Sigma-Aldrich) for 30 min.
100 µl 6
aliquots of PIA samples were applied to Nytran nylon membranes (Waterman Inc.) in 7
triplicate, air-dried, and blocked overnight with 5% skim milk.
Membranes were 8
incubated for 2h with anti-PIA antiserum and for 2 h with an anti-rabbit immunoglobulin 9
G (IgG) alkaline phosphatase conjugate. The presence of PIA was detected by the 10
addition of Sigma Fast BCIP/NBT substrate (Sigma-Aldrich). The integrated density 11
values of spots on autoradiographs were determined with the TotalLab software 12
(Nonlinear Dynamics Ltd.). 13
14
Flow cell biofilm formation. S. aureus strains were grown in flow-cell apparatuses 15
(Stovall Life Sciences, Greensboro, NC) coated with 20% human serum. To initiate the 16
biofilm, 500 µl of dilute overnight cultures (O.D.600 = 0.15) were injected into each 17
chamber and the flow-cell was incubated upside down at 37º C for 1 hour. Following the 18
incubation period, a continuous flow of TSB containing 0.5% glucose and 3% NaCl was 19
delivered at a flow rate of 0.5 ml per minute per chamber. 12 hours post-inoculation, 20
effluent samples were collected at 4 h intervals and analyzed for pH and dissolved 21
oxygen concentration or stored at -20º C until required. 22
23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
9
Measurement of dissolved oxygen. The dissolved oxygen (DO) concentration was 1
monitored using an Accumet AR60 meter equipped with YSI 5905 oxygen sensor (Fisher 2
Scientific). 3
4
Measurement of glucose, lactate, acetate, formate, ammonia and acetoin 5
concentrations. Glucose, lactate, acetate, formate and ammonia concentrations were 6
determined with kits purchased from R-Biopharm, Inc. and used according to the 7
manufacturer’s directions. 8
Acetoin concentrations were determined essentially as described (23). Briefly, 1 9
ml of effluent was mixed sequentially with 0.2 ml 0.5% creatine, 0.2 ml 5% α-naphthol, 10
and 0.2 ml 40% potassium hydroxide. The mixture was vortexed for 30 seconds and 11
incubated at room temperature for 1h. The absorbance at 540 nm was measured and the 12
unknown acetoin concentrations were determined with a standard curve generated using 13
known acetoin concentrations. 14
15
Enzymatic activity assays. Bacteria were grown without agitation overnight in 16
TSB supplemented with 20 mM arginine. Cell-free lysates of S. aureus were prepared as 17
follows: Aliquots (3 ml) were harvested by centrifugation, washed with cold 0.01 M 18
potassium phosphate buffer (pH 7.0), and suspended in 3.0 ml of lysis buffer containing 19
0.1 M potassium phosphate buffer and 25 µg/ml lysostaphin (AMBI). The samples were 20
incubated at 37º C for 15 min and passed through a French press (2 x at 15,000 psi). The 21
lysate was centrifuged for 5 min at 20,800 x g at 4º C. Arginine deiminase activity assays 22
were performed essentially as described (34). In brief, cell-free lysates (100 µl) were 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
10
added to Eppendorf tubes containing pre-warmed (37° C) reaction buffer (400 µl) [5.8 1
mM L-arginine and 131 mM potassium phosphate (pH 5.8)] and incubated at 37° C for 2
15 min. After 15 min, the reaction was stopped by the addition of 50 µl of ice-cold 70% 3
perchloric acid and the samples were clarified by centrifugation. The supernatant (400 µl) 4
was analyzed for citrulline production as described by Sugawara (54). One unit of ADI 5
activity was defined as the amount of enzyme that catalyzed the formation of 1 µmol of 6
citrulline per min. Protein concentrations were determined by the Lowry method (35). 7
8
Assay of amino acids. The concentrations of free amino acids in TSB were 9
determined with a Beckman Model 6300 amino acid analyzer (Scientific Research 10
Consortium, Inc., St. Paul, MN). 11
12
In vivo biofilm formation. A catheter-based murine model was used to assess 13
biofilm formation in vivo (9, 46). Briefly, anesthesia was induced by intraperitoneal 14
injection of 0.75 mg of a 2,2,2 tribromoethanol in tert-amyl alcohol (Sigma-Aldrich) per 15
gram of body weight. Sterile 1 cm Teflon intravenous catheter segments (B. Braun, 16
Bethlehem, PA) were then implanted subcutaneously in each flank of 6-8 week old NIH-17
Swiss mice (Harlan Industries, Inc., Indianapolis, IN). After wound closure with Vetbond 18
surgical adhesive (3M, St. Paul, MN), each catheter lumen was inoculated with 100 µl of 19
phosphate-buffered saline (PBS) containing 5x105 colony forming units (cfu). Groups of 20
10 mice (20 catheters total) were infected with each strain. Mice were imaged 21
immediately after inoculation for 5 min using the IVIS-200 imaging system. All mice 22
from each group were humanely sacrificed 2 days post-infection and imaged a second 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
11
time immediately following sacrifice. To quantify bioluminescence, a defined region of 1
interest corresponding to the size of the implanted catheter was created and used to 2
measure total flux (photons/sec) from each catheter. This was done both immediately 3
after inoculation and at the time of sacrifice. Statistical significance was assessed using 4
the One Way Analysis of Variance with All Pairwise Multiple Comparison Procedure 5
(Tukey Test) as formatted in SigmaStat software (SPSS Inc., Chicago, IL). To quantify 6
biofilm formation by each strain, infected catheters were removed immediately after 7
sacrifice, gently washed three times in sterile PBS to remove non-adherent bacteria, and 8
subsequently placed in 5 ml of sterile PBS. Adherent bacteria were removed from the 9
catheters by sonication. The number of recovered bacteria was then quantified by serial 10
dilution and plate counting on the appropriate selective media. Statistical significance of 11
quantitative plate counts was assessed using the Mann Whitney Rank Sum test as 12
formatted in SigmaStat software. All mouse infection experiments were reviewed and 13
approved by the University of Arkansas for Medical Sciences Animal Care and Use 14
Committee, and comply with Animal Welfare Legislation and NIH guidelines and 15
policies. 16
17
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
12
RESULTS 1
Staphylococcus aureus carbohydrate metabolism during biofilm growth. 2
Transcriptional profiling experiments suggest that S. aureus growing in a biofilm are 3
growing microaerobically or anaerobically (2, 45). To biochemically test this possibility, 4
we grew strains UAMS-1 and UAMS-1182 in a flow cell apparatus with a continuous 5
flow of TSB culture medium and analyzed the effluent for the extraction of glucose and 6
accumulation of common fermentation products (Fig. 1 and 2). Consistent with the 7
transcriptional profiling data, S. aureus growing in a biofilm extracted glucose from the 8
culture medium and accumulated the fermentation products lactic acid, acetic acid, and 9
formic acid (Fig. 2). The accumulation of organic acids in the culture medium occurred 10
coincident with a decreased pH and induction of the butanediol pathway, as suggested by 11
the accumulation of acetoin (Fig. 2). Bacteria induce the butanediol pathway in response 12
to a decrease in the environmental pH (5) and as a means to prevent a redox imbalance by 13
oxidizing NADH to NAD+. The accumulation of organic acids and alcohols in the culture 14
medium effluent is strongly indicative of oxygen-limited growth. To determine if the 15
biofilm was oxygen-limited, we measured the oxygen concentration of the culture 16
medium effluent for strains UAMS-1 and UAMS-1182 (Fig. 3). As expected, as the 17
biofilm matured, it depleted oxygen from the culture medium (Fig. 3). Taken together, 18
these data suggest that reduced oxygen tension induced a fermentative metabolism 19
resulting in increased pH stress. 20
21
S. aureus growing in a biofilm selectively extract amino acids. Bacteria regulate 22
the selective transport of amino acids into the cytosol; that is to say, they take what they 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
13
need when they need it (2, 17, 24, 49, 51). This is an advantageous adaptation allowing 1
bacteria to acquire necessary amino acids from their environment and redirect energy 2
from amino acid biosynthesis into growth. It has been postulated that amino acid 3
catabolism is important for staphylococcal biofilm formation and pH homeostasis (2, 44, 4
45). To determine which amino acids S. aureus extracted from the culture medium during 5
biofilm growth, we measured the free amino acid concentrations of culture medium 6
effluent and expressed this as function of the free amino acid concentration in sterile 7
culture medium (Fig. 2E and 2F). Although the extent to which amino acids were 8
extracted varied, strains UAMS-1 and UAMS-1182 immediately began selectively 9
extracting the free amino acids glutamine, serine, proline, glycine, threonine, and 10
arginine, while other amino acids remained in the medium (e.g., valine, tryptophan). The 11
extraction of these six amino acids differs somewhat from that seen in planktonic growth, 12
where during exponential growth serine, glycine, glutamine, glutamate, alanine, and 13
threonine are selectively extracted from the culture medium and proline and arginine are 14
not extracted until carbon becomes limiting [(51) and Somerville unpublished data.] The 15
selective extraction of amino acids from the culture medium during biofilm growth, 16
suggested the amino acids were being used for carbon and/or energy production, and not 17
just protein synthesis. Amino acid catabolism usually involves the release of ammonia 18
through a deamination step; thus, it is possible to determine the fate of amino acids by 19
measuring the concentration of ammonia in the culture medium effluent (Fig 2B). 20
Concomitant with the extraction of amino acids from the culture medium was the 21
accumulation of ammonia in the effluent, indicating amino acid catabolism. These data 22
led us to speculate that interfering with amino acid transport and/or catabolism might 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
14
limit biofilm formation, PIA synthesis, or virulence. To test these possibilities, we chose 1
to genetically inactivated the arcD gene (arcD encodes the arginine/ornithine antiporter) 2
of strain UAMS-1 and assessed its ability to synthesize PIA and form a biofilm. The 3
choice to inactivate the arginine transporter, as opposed to a transporter of one of the 4
other selectively extracted amino acids, was based on previous transcriptional profiling 5
data (2, 45, 60), proteomic data (44), and speculation about the potential importance of 6
the arginine deiminase pathway in staphylococcal pathogenesis (15). 7
8
Growth of UAMS-1 arcD mutant strain. In S. aureus, the genes coding for the 9
anaerobic catabolism of arginine are contained within the arginine deiminase (arc) 10
operon. The arc operon is comprised of arginine deiminase (arcA), ornithine 11
transcarbamylase (arcB), the arginine/ornithine antiporter (arcD), and carbamate kinase 12
(arcC). The arginine/ornithine antiporter is a cationic exchange system that catalyzes a 13
one-to-one stoichiometric exchange of arginine and ornithine (12, 16, 42); hence, as the 14
bacteria extract arginine from the culture medium, ornithine accumulates in the medium. 15
As expected, inactivation of the arcD gene prevented the extraction of arginine from the 16
culture medium and the accumulation of ornithine in the medium during biofilm growth 17
(Fig. 4A). Inactivation of arcD also reduced the accumulation of ammonia in the culture 18
medium (after 48 h growth, the concentration of ammonia in the culture medium effluent 19
was 3.31 µM in UAMS-1 and 1.38 µM in UAMS-1-arcD::ermB.) Additionally, under 20
microaerobic growth conditions (5:1 flask-to-medium ratio and 100 rpm aeration), the 21
arcD mutant strain (UAMS-1-arcD::ermB) accumulated a significantly lower 22
concentration of ammonia in the culture medium relative to the isogenic wild-type strain 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
15
(Fig. 4D), suggesting that arginine catabolism was inhibited. Taken together, these data 1
confirm the correct gene was inactivated and that it was the sole arginine transporter. 2
3
Arginine transport and/or catabolism enhance the accumulation of PIA. Two 4
different S. aureus clonal types selectively extracted six amino acids, including arginine, 5
from the culture medium during growth in a biofilm (Fig. 2E and 2F). These data and the 6
fact that arcD inactivation does not cause a growth defect during planktonic growth (Fig. 7
4B) suggest that arginine may be important for one or more aspects of biofilm 8
maturation. To test this possibility, we assessed the ability of UAMS-1 and UAMS-1-9
arcD::ermB strains to grow in biofilm flow-cells. The gross morphology of biofilms 10
formed by strain UAMS-1-arcD::ermB and strains UAMS-1 and UAMS-1182 was very 11
similar (Fig. 1), demonstrating that bacterial attachment and biofilm maturation can occur 12
independent of arginine transport or catabolism. To determine if arcD inactivation 13
affected PIA accumulation, we determined the amount of cell-associated PIA during the 14
exponential and stationary phases of planktonic growth. Interestingly, the accumulation 15
of PIA was lower in strain UAMS-1-arcD::ermB relative to the isogenic strain UAMS-1 16
(46-51% reduction, P = 0.0015), suggesting the biofilm formed by the arcD mutant strain 17
(Fig. 1) might be PIA-limited. 18
19
The affect of arginine transport on catheter-associated infections. To facilitate 20
monitoring the course of the catheter-associated infections, we deleted the arcD gene 21
from a strain of UAMS-1 carrying the luxABCDE operon (strain Xen40) and measured in 22
vivo bioluminescence. Consistent with strain UAMS-1-arcD::ermB, the Xen40 arcD 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
16
deletion mutant (strain UAMS-1272) had reduced PIA accumulation (46-51% reduction, 1
P = 0.0015) and formed a biofilm in a flow cell equivalent to the isogenic wild-type 2
strain (data not shown). Additionally, genetic inactivation of arcD in both UAMS-1 and 3
Xen40 inhibited arginine deiminase activity (data not shown). The in vivo growth of the 4
arc operon mutant and the wild-type strains was statistically equivalent using the Mann 5
Whitney rank sum test (p = 0.218). Similarly, bioluminescence on day 2 was equivalent 6
between the wild-type and arcD mutant strains (data not shown). Taken together, these 7
demonstrate that in vitro and in vivo biofilms can mature in the absence of the arginine 8
deiminase/arc operon. 9
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
17
DISCUSSION 1
2
Indwelling medical device-associated infections caused by bacterial biofilms are a 3
significant source of morbidity in the United States, with two of the more common 4
causative agents of these infections being S. aureus and S. epidermidis (55). In spite of 5
the prevalence of biofilm-associated staphylococcal infections, there is little consensus 6
about the requirements necessary to form a biofilm. To address the metabolic aspects of 7
this deficiency, we grew two genetically distinct S. aureus strains in biofilm flow cells, 8
measured the extraction and accumulation of metabolites, and assessed the importance of 9
one metabolite, arginine, on biofilm development and pathogenesis. 10
Consistent with previous observations (2, 45), our data demonstrate that S. aureus 11
growing in a biofilm are growing microaerobically (Fig. 2 and 3). We found that mature 12
biofilms maintain a dynamic metabolic flux of carbon and amino acid uptake and 13
excretion (Fig. 2), a situation similar to that proposed for static S. aureus biofilms (45). 14
This dynamic metabolic flux contrasts with that observed in S. epidermidis biofilms 15
where it was determined that growth in a biofilm leads to “low metabolic” activity (60). 16
Specifically, our data strongly suggest that S. aureus catabolize glucose to pyruvate by 17
glycolysis and then catabolize pyruvate via lactate dehydrogenase (EC 1.1.1.27) and 18
pyruvate formate-lyase (EC 2.3.1.54) (Fig. 2C and D). Glycolysis generates two 19
molecules of pyruvate for every molecule of glucose consumed; however, in the process 20
it reduces two molecules of NAD+ to NADH. Reduction of NAD
+ to NADH, without an 21
equivalent means to oxidize NADH, can create a redox imbalance and inhibit growth. 22
Under microaerobic or anaerobic growth conditions, the majority of pyruvate is reduced 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
18
to lactic acid (29, 31), concomitant with a 1:1 stoichiometric oxidation of NADH back to 1
NAD+. To compensate for the diversion of pyruvate into pyruvate formate-lyase, S. 2
aureus also shunt pyruvate into the butanediol pathway via acetolactate synthase (EC 3
2.2.1.6) (Fig. 2C and D). Shunting pyruvate into the butanediol pathway will facilitate 4
oxidation of NADH and decrease the accumulation of organic acids. These data and 5
deductions suggest that a tenuous redox balance exists during biofilm growth, a 6
potentially exploitable weakness for therapeutic intervention. This suggestion is 7
supported by the observation that inactivation of the butanediol pathway at acetolactate 8
decarboxylase (EC 4.1.1.5) inhibits biofilm formation (8). In addition, this suggestion is 9
a reasonable explanation for the absence of dramatic effects on in vivo or in vitro biofilm 10
formation in arginine transport and/or catabolism deficient strains; specifically, the 11
arginine deiminase pathway is not involved in the reduction or oxidation of NAD+ or 12
NADH. 13
In a complex medium containing glucose, S. aureus will preferentially catabolize 14
glucose for carbon and energy through the glycolytic and pentose phosphate pathways (4, 15
10, 20, 29, 36). Despite a preference for glucose and a high concentration of glucose in 16
the medium (>15 mM; Fig. 2A), S. aureus strains growing in a biofilm selectively extract 17
and catabolize six amino acids, including arginine, from the culture medium (Fig. 2 and 18
4). These data lend credence to the speculation that arginine metabolism may be 19
important for staphylococcal survival and/or pathogenesis (2, 15, 44, 45). This 20
speculation generated two very reasonable hypotheses regarding the role of arginine 21
catabolism in staphylococcal host-pathogen interactions: First, the deamination of 22
arginine by the arginine deiminase pathway results in the extracellular accumulation of 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
19
ammonia, facilitating bacterial pH homeostasis (2, 44, 45). Second, the staphylococcal 1
arginine deiminase may function in a capacity similar to that in Streptococcus pyogenes 2
(15); specifically, arginine deiminase may aid in evasion of the host immune response by 3
inhibiting peripheral blood mononuclear cell proliferation (13, 14). Hence, one function 4
of arginine may be to induce transcription of the arginine deiminase (arc) operon. To test 5
the first hypothesis, we genetically inactivated the arcD gene, eliminating arginine 6
transport (Fig. 4A), and assessed the affect on ammonia accumulation and the 7
extracellular pH (Fig. 4). Inactivation of arcD completely inhibited the transport of 8
arginine, the accumulation of ornithine (Fig. 4A), and significantly decreased the 9
accumulation of ammonia; however, the pH of the biofilm effluent was unchanged (Fig. 10
4B). Therefore, in contrast to previous speculation (2, 15, 44, 45), our results demonstrate 11
that the ammonia generated by the arginine deiminase pathway is insufficient to offset 12
the pH decrease due to the accumulation of organic acids (Fig. 4B and C). To test the 13
second hypothesis, we assessed the affect arcD inactivation in a mouse indwelling device 14
infection model. Mutants lacking arcD have dramatically reduced arginine deiminase 15
activity (data not shown), yet they achieved in vivo cell densities equivalent to the 16
isogenic wild-type strain, suggesting that arginine deiminase is not required for biofilm 17
formation and survival in vivo at least as defined by this model. It is possible that 18
arginine deiminase is important in certain types of infections, such as when preferred 19
nutrients are limiting or during a more active and prolonged immune response; however, 20
additional work will be needed to address these possibilities. 21
22
23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
20
1
2
ACKNOWLEDGEMENTS 3
4
This manuscript is a contribution of the University of Nebraska Agricultural 5
Research Division, supported in part by funds provided through the Hatch Act, the 6
National Institute of General Medical Sciences (GM076585), and the American Heart 7
Association (0760005Z) to GAS, the National Institute of Allergy and Infectious 8
Diseases (AI43356) to MSS, and the Intramural Research Program of the NIAID to MO. 9
We would also like to thank the Network on Antimicrobial Resistance in Staphylococcus 10
aureus (NARSA) for providing the PFGE strain standards used in this study. 11
12
13
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
21
REFERENCES 1
2
1. Bae, T., and O. Schneewind. 2006. Allelic replacement in Staphylococcus 3
aureus with inducible counter-selection. Plasmid 55:58-63. 4
2. Beenken, K. E., P. M. Dunman, F. McAleese, D. Macapagal, E. Murphy, S. J. 5
Projan, J. S. Blevins, and M. S. Smeltzer. 2004. Global gene expression in 6
Staphylococcus aureus biofilms. J. Bacteriol. 186:4665-4684. 7
3. Bischoff, M., P. Dunman, J. Kormanec, D. Macapagal, E. Murphy, W. 8
Mounts, B. Berger-Bächi, and S. Projan. 2004. Microarray-based analysis of 9
the Staphylococcus aureus sigmaB regulon. J. Bacteriol. 186:4085-4099. 10
4. Blumenthal, H. J. 1972. Glucose catabolism in staphylococci, p. 111-135. In J. 11
O. Cohen (ed.), The staphylococci. Wiley-Interscience, New York. 12
5. Booth, I. R., and R. G. Kroll. 1983. Regulation of cytoplasmic pH (pH1) in 13
bacteria and its relationship to metabolism. Biochem. Soc. Trans. 11:70-72. 14
6. Bowden, G. H., and Y. H. Li. 1997. Nutritional influences on biofilm 15
development. Adv. Dent. Res. 11:81-99. 16
7. Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and 17
Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1-8. 18
8. Cassat, J., P. M. Dunman, E. Murphy, S. J. Projan, K. E. Beenken, K. J. 19
Palm, S. J. Yang, K. C. Rice, K. W. Bayles, and M. S. Smeltzer. 2006. 20
Transcriptional profiling of a Staphylococcus aureus clinical isolate and its 21
isogenic agr and sarA mutants reveals global differences in comparison to the 22
laboratory strain RN6390. Microbiology 152:3075-3090. 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
22
9. Christensen, G. D., W. A. Simpson, A. L. Bisno, and E. H. Beachey. 1983. 1
Experimental foreign body infections in mice challenged with slime-producing 2
Staphylococcus epidermidis. Infect. Immun. 40:407-410. 3
10. Collins, F. M., and J. Lascelles. 1962. The effect of growth conditions on 4
oxidative and dehydrogenase activity in Staphylococcus aureus. J. Gen. 5
Microbiol. 29:531-535. 6
11. Cramton, S. E., M. Ulrich, F. Götz, and G. Döring. 2001. Anaerobic conditions 7
induce expression of polysaccharide intercellular adhesin in Staphylococcus 8
aureus and Staphylococcus epidermidis. Infect. Immun. 69:4079-4085. 9
12. Crow, V. L., and T. D. Thomas. 1982. Arginine metabolism in lactic 10
streptococci. J. Bacteriol. 150:1024-1032. 11
13. Degnan, B. A., M. C. Fontaine, A. H. Doebereiner, J. J. Lee, P. Mastroeni, G. 12
Dougan, J. A. Goodacre, and M. A. Kehoe. 2000. Characterization of an 13
isogenic mutant of Streptococcus pyogenes Manfredo lacking the ability to make 14
streptococcal acid glycoprotein. Infect. Immun. 68:2441-2448. 15
14. Degnan, B. A., J. M. Palmer, T. Robson, C. E. Jones, M. Fischer, M. 16
Glanville, G. D. Mellor, A. G. Diamond, M. A. Kehoe, and J. A. Goodacre. 17
1998. Inhibition of human peripheral blood mononuclear cell proliferation by 18
Streptococcus pyogenes cell extract is associated with arginine deiminase activity. 19
Infect. Immun. 66:3050-3058. 20
15. Diep, B. A., S. R. Gill, R. F. Chang, T. H. Phan, J. H. Chen, M. G. Davidson, 21
F. Lin, J. Lin, H. A. Carleton, E. F. Mongodin, G. F. Sensabaugh, and F. 22
Perdreau-Remington. 2006. Complete genome sequence of USA300, an 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
23
epidemic clone of community-acquired meticillin-resistant Staphylococcus 1
aureus. Lancet 367:731-739. 2
16. Driessen, A. J., B. Poolman, R. Kiewiet, and W. Konings. 1987. Arginine 3
transport in Streptococcus lactis is catalyzed by a cationic exchanger. Proc. Natl. 4
Acad. Sci. 84:6093-6097. 5
17. Dunman, P. M., E. Murphy, S. Haney, D. Palacios, G. Tucker-Kellogg, S. 6
Wu, E. L. Brown, R. J. Zagursky, D. Shlaes, and S. J. Projan. 2001. 7
Transcription profiling-based identification of Staphylococcus aureus genes 8
regulated by the agr and/or sarA Loci. J. Bacteriol. 183:7341-7353. 9
18. Foster, T. J. 1998. Molecular genetic analysis of staphylococcal virulence., p. 10
433-454. In P. Williams, J. Ketley, and G. P. C. Salmond (ed.), Methods in 11
microbiology, bacterial pathogenesis, vol. 27. Academic Press, Inc., San Diego. 12
19. Goering, R. V., L. K. McDougal, G. E. Fosheim, K. K. Bonnstetter, D. J. 13
Wolter, and F. C. Tenover. 2007. Epidemiologic distribution of the arginine 14
catabolic mobile element (ACME) among selected methicillin-resistant and 15
methicillin-susceptible Staphylococcus aureus isolates. J. Clin. Microbiol. 45: 16
1981-1984 17
20. Goldschmidt, M. C., and D. M. Powelson. 1953. Effect of the culture medium 18
on the oxidation of acetate by Micrococcus pyogenes var. aureus. Arch. Biochem. 19
Biophys. 46:154-163. 20
21. Götz, F. 2002. Staphylococcus and biofilms. Mol. Microbiol. 43:1367-1378. 21
22. Greene, C., D. McDevitt, P. Francois, P. E. Vaudaux, D. P. Lew, and T. J. 22
Foster. 1995. Adhesion properties of mutants of Staphylococcus aureus defective 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
24
in fibronectin-binding proteins and studies on the expression of fnb genes. Mol. 1
Microbiol. 17:1143-1152. 2
23. Grundy, F. J., D. A. Waters, T. Y. Takova, and T. M. Henkin. 1993. 3
Identification of genes involved in utilization of acetate and acetoin in Bacillus 4
subtilis. Mol. Microbiol. 10:259-271. 5
24. Horsburgh, M. J., M. D. Wiltshire, H. Crossley, E. Ingham, and S. J. Foster. 6
2004. PheP, a putative amino acid permease of Staphylococcus aureus, 7
contributes to survival in vivo and during starvation. Infect. Immun. 72:3073-8
3076. 9
25. Johnson, M., A. Cockayne, P. H. Williams, and J. A. Morrissey. 2005. Iron-10
responsive regulation of biofilm formation in Staphylococcus aureus involves 11
Fur-dependent and Fur-independent mechanisms. J. Bacteriol. 187:8211-8215. 12
26. Jones, G. L., C. T. Muller, M. O'Reilly, and D. J. Stickler. 2006. Effect of 13
triclosan on the development of bacterial biofilms by urinary tract pathogens on 14
urinary catheters. J. Antimicrob. Chemother. 57:266-272. 15
27. Kadurugamuwa, J. L., L. V. Sin, J. Yu, K. P. Francis, T. F. Purchio, and P. 16
R. Contag. 2004. Noninvasive optical imaging method to evaluate postantibiotic 17
effects on biofilm infection in vivo. Antimicrob. Agents Chemother. 48:2283-18
2287. 19
28. Karaolis, D. K., M. H. Rashid, R. Chythanya, W. Luo, M. Hyodo, and Y. 20
Hayakawa. 2005. c-di-GMP (3'-5'-cyclic diguanylic acid) inhibits 21
Staphylococcus aureus cell-cell interactions and biofilm formation. Antimicrob. 22
Agents Chemother. 49:1029-1038. 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
25
29. Kendall, A. I., T. E. Friedemann, and M. Ishikawa. 1930. Quantitative 1
observations on the chemical activity of "resting" Staphylococcus aureus. J. 2
Infect. Dis. 47:223-228. 3
30. Kohler, C., C. von Eiff, G. Peters, R. A. Proctor, M. Hecker, and S. 4
Engelmann. 2003. Physiological characterization of a heme-deficient mutant of 5
Staphylococcus aureus by a proteomic approach. J. Bacteriol. 185:6928-6937. 6
31. Krebs, H. A. 1937. Dismutation of pyruvic acid in Gonococcus and 7
Staphylococcus. Biochem. J. 31:661-671. 8
32. Kuroda, M., H. Kuroda, T. Oshima, F. Takeuchi, H. Mori, and K. 9
Hiramatsu. 2003. Two-component system VraSR positively modulates the 10
regulation of cell-wall biosynthesis pathway in Staphylococcus aureus. Mol. 11
Microbiol. 49:807-821. 12
33. Lim, Y., M. Jana, T. T. Luong, and C. Y. Lee. 2004. Control of glucose- and 13
NaCl-induced biofilm formation by rbf in Staphylococcus aureus. J. Bacteriol. 14
186:722-729. 15
34. Liu, S., G. G. Pritchard, M. J. Hardman, and G. J. Pilone. 1995. Occurrence 16
of arginine deiminase pathway enzymes in arginine catabolism by wine lactic acid 17
bacteria. Appl. Environ. Microbiol. 61:310-316. 18
35. Lowry, O. H., N. J. Rosebrough, L. Farr, and R. J. Randall. 1951. Protein 19
measurement with the Folin phenol reagent. J. Biol. Chem. 193:267-275. 20
36. Mah, R. A., D. Y. Fung, and S. A. Morse. 1967. Nutritional requirements of 21
Staphylococcus aureus S-6. Appl. Microbiol. 15:866-870. 22
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
26
37. McDougal, L. K., C. D. Steward, G. E. Killgore, J. M. Chaitram, S. K. 1
McAllister, and F. C. Tenover. 2003. Pulsed-field gel electrophoresis typing of 2
oxacillin-resistant Staphylococcus aureus isolates from the United States: 3
establishing a national database. J. Clin. Microbiol. 41:5113-5120. 4
38. Mekalanos, J. J. 1992. Environmental signals controlling expression of virulence 5
determinants in bacteria. J. Bacteriol. 174:1-7. 6
39. Mongodin, E., J. Finan, M. W. Climo, A. Rosato, S. Gill, and G. L. Archer. 7
2003. Microarray transcription analysis of clinical Staphylococcus aureus isolates 8
resistant to vancomycin. J. Bacteriol. 185:4638-4643. 9
40. Novick, R. P. 1991. Genetic systems in staphylococci, p. 587-636, Methods in 10
Enzymology, vol. 204. Academic Press, Inc., San Diego. 11
41. Pamp, S. J., D. Frees, S. Engelmann, M. Hecker, and H. Ingmer. 2006. Spx is 12
a global effector impacting stress tolerance and biofilm formation in 13
Staphylococcus aureus. J. Bacteriol. 188:4861-4870. 14
42. Poolman, B., A. J. Driessen, and W. N. Konings. 1987. Regulation of arginine-15
ornithine exchange and the arginine deiminase pathway in Streptococcus lactis. J. 16
Bacteriol. 169:5597-5604. 17
43. Rachid, S., K. Ohlsen, U. Wallner, J. Hacker, M. Hecker, and W. Ziebuhr. 18
2000. Alternative transcription factor sigma(B) is involved in regulation of 19
biofilm expression in a Staphylococcus aureus mucosal isolate. J. Bacteriol. 20
182:6824-6826. 21
44. Resch, A., S. Leicht, M. Saric, L. Pásztor, A. Jakob, F. Götz, and A. 22
Nordheim. 2006. Comparative proteome analysis of Staphylococcus aureus 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
27
biofilm and planktonic cells and correlation with transcriptome profiling. 1
Proteomics 6:1867-1877. 2
45. Resch, A., R. Rosenstein, C. Nerz, and F. Götz. 2005. Differential gene 3
expression profiling of Staphylococcus aureus cultivated under biofilm and 4
planktonic conditions. Appl. Environ. Microbiol. 71:2663-2676. 5
46. Rupp, M. E., J. S. Ulphani, P. D. Fey, K. Bartscht, and D. Mack. 1999. 6
Characterization of the importance of polysaccharide intercellular 7
adhesin/hemagglutinin of Staphylococcus epidermidis in the pathogenesis of 8
biomaterial-based infection in a mouse foreign body infection model. Infect. 9
Immun. 67:2627-2632. 10
47. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular cloning: A 11
laboratory manual, Second ed. Cold Spring Harbor Laboratory Press, Plainview. 12
48. Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of 13
Staphylococcus aureus. FEMS Microbiol. Lett. 73:133-138. 14
49. Schwan, W. R., K. J. Wetzel, T. S. Gomez, M. A. Stiles, B. D. Beitlich, and S. 15
Grunwald. 2004. Low-proline environments impair growth, proline transport and 16
in vivo survival of Staphylococcus aureus strain-specific putP mutants. 17
Microbiology 150:1055-1061. 18
50. Shanks, R. M., J. L. Sargent, R. M. Martinez, M. L. Graber, and G. A. 19
O'Toole. 2006. Catheter lock solutions influence staphylococcal biofilm 20
formation on abiotic surfaces. Nephrol. Dial. Transplant 21:2247-2255. 21
51. Somerville, G. A., M. S. Chaussee, C. I. Morgan, J. R. Fitzgerald, D. W. 22
Dorward, L. J. Reitzer, and J. M. Musser. 2002. Staphylococcus aureus 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
28
aconitase inactivation unexpectedly inhibits post-exponential-phase growth and 1
enhances stationary-phase survival. Infect. Immun. 70:6373-6382. 2
52. Southern, E. M. 1975. Detection of specific sequences among DNA fragments 3
separated by gel electrophoresis. J. Mol. Biol. 98:503-517. 4
53. Stepanović, S., N. Djukić, V. Djordjević, and S. Djukić. 2003. Influence of the 5
incubation atmosphere on the production of biofilm by staphylococci. Clin. 6
Microbiol. Infect. 9:955-958. 7
54. Sugawara, K., Y. Yoshizawa, S. Tzeng, W. L. Epstein, and K. Fukuyama. 8
1998. Colorimetric determination of citrulline residues in proteins. Anal. 9
Biochem. 265:92-96. 10
55. Trampuz, A., and A. F. Widmer. 2006. Infections associated with orthopedic 11
implants. Curr. Opin. Infect. Dis. 19:349-356. 12
56. Trotonda, M. P., A. C. Manna, A. L. Cheung, I. Lasa, and J. R. Penadés. 13
2005. SarA positively controls bap-dependent biofilm formation in 14
Staphylococcus aureus. J. Bacteriol. 187:5790-5798. 15
57. Vuong, C., J. B. Kidder, E. R. Jacobson, M. Otto, R. A. Proctor, and G. A. 16
Somerville. 2005. Staphylococcus epidermidis polysaccharide intercellular 17
adhesin production significantly increases during tricarboxylic acid cycle stress. J. 18
Bacteriol. 187:2967-2973. 19
58. Vuong, C., and M. Otto. 2002. Staphylococcus epidermidis infections. Microbes 20
Infect. 4:481-489. 21
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
29
59. Vuong, C., H. L. Saenz, F. Götz, and M. Otto. 2000. Impact of the agr quorum-1
sensing system on adherence to polystyrene in Staphylococcus aureus. J. Infect. 2
Dis. 182:1688-1693. 3
60. Yao, Y., D. E. Sturdevant, and M. Otto. 2005. Genomewide analysis of gene 4
expression in Staphylococcus epidermidis biofilms: insights into the 5
pathophysiology of S. epidermidis biofilms and the role of phenol-soluble 6
modulins in formation of biofilms. J. Infect. Dis. 191:289-298. 7
8
9
10
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
30
Table 1. Strains and plasmids used in this study. 1
Plasmid or strain
Relevant genotype and/or
characteristic(s) Source or Reference
pBluescript II KS(+) E. coli phagemid cloning vector Stratagene
pTS1
S. aureus - E. coli temperature-
sensitive shuttle vector (22)
pEC4
pBluescript II KS(+) with ermB
inserted into ClaI site (7)
pYF-1
pBluescript II KS(+) containing an
internal fragment of the arcD gene
of UAMS-1 inserted into SmaI site This study
pYF-2
pYF-1 containing the ermB cassette
of pEC4 inserted into the NdeI site
of the arcD fragment This study
pYF-3
The arcD::ermB PCR product pYF-
2 inserted into the KpnI and EcoRI
site of pTS1 This study
RN4220 Restriction-negative S. aureus (40)
UAMS-1 S. aureus clinical isolate
Mark Smeltzer strain
collection
UAMS-1182 S. aureus clinical isolate
Mark Smeltzer strain
collection
UAMS-1-arcD::ermB
UAMS-1 containing an ermB
insertion into arcD This study
Xen40
Strain UAMS-1 containing
luxABCDE Caliper Life Sciences
UAMS-1272 Xen40 arcD deletion strain This study
2
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
31
Table 2. Primers used in this study. 1
Primer Nucleotide sequence (5′′′′ - 3′′′′)
arcDf GCGAGTCAATATGGTGGTTCAG
arcDr ACCCGATAACTGCAAGTACG
ermBNdeIf CCGATTCATATGGTGATTACGCAGATAAATAAATACG
ermBNdeIr CCGATTCATATGCAAAAGCGACTCATAGAATTATTTCC
arcDKpnIf GCGGGTACCGCGAGTCAATATGGTGGTTCAG
arcDEcoRIr GCGGAATTCACCCGATAACTGCAAGTACG
arcDVf GAAGGAATAAACTTAACTTACGTTGGA
arcDVr GCTTCTGTTGTCTGTATCGCATT
arcAf ACACGGTATAACAATCAATCGG
arcAr TCACTACAACGCCTGGTC
arcBf GTAGAGGATACTGCGAAAG
arcBr TGGAATGCTGGTAAACAA
arcCf TGCGTCACCACTACCTCA
arcCr GCTTCGTATGCCTGCTCT
icaAf CTTGCCTGTTATAACGAAAGTGAAAC
icaAr GAGTGAAGACACCCGAAATAGTATTG
ArcD1-
attB2F
GGGGACCACTTTGTACAAGAAAGCTGGGTTTGTTGTGCTTCAGCTGTTGCTTC
TTT
ArcD1-
SacIIR ATATTTCCCGCGGTCAATTAGATTCGCCAAGTATGGCACA
ArcD2-
SacIIF TATAACCCGCGGAT TATATTGAACGCACCGCCACCAAT
ArcD2-
attB1R
GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACAGACGATTGGCA
TCCTACACAAA
2
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
32
Fig. 1. Growth of S. aureus strains UAMS-1, UAMS-1182, and UAMS-1-arcD::ermB in 1
a 3-chamber flow cell. Bacterial strains were grown at 37° C with a continuous flow (0.5 2
ml per minute per chamber) of TSB containing 0.5% glucose and 3% NaCl. The results 3
are representative of multiple (>3) independent experiments. In the figure, strain UAMS-4
1-arcD::ermB is abbreviated as U1-arcD::ermB. 5
6
Fig. 2. Metabolite extraction and accumulation by S. aureus strains UAMS-1 and 7
UAMS-1182 during biofilm growth in flow cells. (A) The decreased pH of the culture 8
medium corresponds to decreasing glucose concentrations. (B) Ammonia accumulation 9
in the culture medium effluent. (C) Accumulation of organic acids and acetoin in the 10
culture medium effluent of strains UAMS-1 and (D) UAMS-1182. (E) Free amino acid 11
extraction from the culture medium by strains UAMS-1 and (F) UAMS-1182. The results 12
presented are representative of at least two independent experiments. Symbols are 13
defined in the figure insets. 14
15
Fig. 3. Dissolved oxygen concentration in the culture medium effluent of strains UAMS-16
1 and UAMS-1182 grown in flow cells. Symbols are defined in the figure insets. The 17
results presented are representative of at least three independent experiments. 18
19
Fig. 4. Growth characteristics of strains UAMS-1 and UAMS-1-arcD::ermB grown under 20
biofilm and planktonic conditions. (A) Arginine extraction and ornithine accumulation in 21
culture medium of strains UAMS-1 and UAMS-1-arcD::ermB grown in biofilm flow 22
cells. (B) pH of the biofilm culture medium effluent from panel A. (C and D) Planktonic 23
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
33
growth of strains UAMS-1 and UAMS-1-arcD::ermB under microaerobic conditions 1
(5:1 flask-to-medium ratio, TSB, and 100 rpm aeration.) (C) Growth and pH of the 2
culture medium of strains UAMS-1 and UAMS-1-arcD::ermB. (D) Ammonia 3
accumulation in the culture medium as a function of growth (A600) for the cultures in 4
panel C. The results presented are representative of at least two independent experiments. 5
6
7
8
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
40 h
28 h
44 h
32 h
16 h
36 h
20 h
48 h
24 h
Flow
UAMS-1
UAMS-1182
U1- ::arcD ermB
UAMS-1
UAMS-1182
U1- ::arcD ermB
UAMS-1
UAMS-1182
U1- ::arcD ermB
ACCEPTED
on February 6, 2021 by guest
http://iai.asm.org/
Dow
nloaded from
