1 Running head: Symbiosis Pathway in Aeschynomene 1 Fabienne

1

Running head: Symbiosis Pathway in Aeschynomene 1 Fabienne Cartieaux 2 Address: Laboratoire des Symbioses Tropicales et Méditerranéennes 3 UMR IRD/SupAgro/INRA/UM2/CIRAD 4 Campus International de Baillarguet, TA A-82/J 5 F-34398 Montpellier Cedex 5, France 6 Phone: +33 467 59 37 32 7 [email protected] 8 Research Area: Signalling and Response 9 10

Plant Physiology Preview. Published on October 7, 2015, as DOI:10.1104/pp.15.01134

Copyright 2015 by the American Society of Plant Biologists

www.plantphysiol.orgon March 18, 2018 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Nod factor-independent nodulation in Aeschynomene evenia required the 11 common plant-microbe symbiotic “toolkit” 12 13 Sandrine Fabre1,2, Djamel Gully1, Arthur Poitout1,3, Delphine Patrel1, Jean-François 14 Arrighi1, Eric Giraud1, Pierre Czernic3 and Fabienne Cartieaux1 15 16 1 IRD, Laboratoire des Symbioses Tropicales et Méditerranéennes, 17 UMR IRD/SupAgro/INRA/UM2/CIRAD, Campus International de Baillarguet, TA A-82/J, 18 F-34398 Montpellier Cedex 5, France. 19 2 CIRAD, Réponses des Plantes aux Bioagresseurs, UMR IRD/CIRAD/UM2, 911 avenue 20 Agropolis, BP 64501, F-34394 Montpellier Cedex 5, France. 21 3 Université de Montpellier, Place Eugène Bataillon, F-34095 Montpellier Cedex 5, France. 22 23 A tropical legume recruited the common symbiosis pathway to interact with a nitrogen-fixing 24 bacterium devoid of canonical nodulation genes.25



3

This work was supported by the French National Research Agency (ANR-SESAM-2010-26 BLAN-170801). 27 Corresponding author: Fabienne CARTIEAUX 28 e-mail:[email protected] 29



4

ABSTRACT 30 Nitrogen fixation in the legume-rhizobium symbiosis is a crucial area of research for more 31 sustainable agriculture. Our knowledge of the plant cascade in response to the perception of 32 bacterial Nod Factors has increased in recent years. However, the discovery that NFs are not 33 involved in the Aeschynomene/Bradyrhizobia interaction suggests that alternative molecular 34 dialogues may exist in the legume family. We evaluated the conservation of the signalling 35 pathway common to other endosymbioses using three candidate genes: CCaMK, which plays 36 a central role in cross signalling between nodule organogenesis and infection processes, and 37 SYMRK and HK1, which act upstream and downstream of CCaMK, respectively. We showed 38 that CCAMK, SYMRK and HK1 are required for efficient nodulation in Aeschynomene 39 evenia. Our results demonstrate that CCAMK and SYMRK are recruited in NF-independent 40 symbiosis and hence may be be conserved in all vascular plant endosymbioses described so 41 far. 42 43



5

INTRODUCTION 44 As sessile organisms, plants must be able to interpret and respond to their environment 45

to grow and survive. Interactions with telluric microbes play a central role in these adaptive 46 responses. An important example of plant-microorganism interactions is root endosymbiosis 47 with fungi, which was established 400 million years ago and likely accompanied the rise of 48 terrestrial flora (Remy et al. 1994). Today, more than 80% of land plants can establish an 49 arbuscular mycorrhizal (AM) symbiosis. 50

Conversely, only plants belonging to the Rosid clade have the ability to form a 51 nitrogen-fixing symbiosis with bacteria. The predisposition for nodulation was acquired 52 around 100 million years ago by a common ancestor (Doyle 2011). Nitrogen-fixing 53 nodulation involves two distinct associations: the legume-rhizobium symbiosis and 54 actinorhizal symbiosis, formed by members of the Fagales, Rosales, and Cucurbitales orders 55 which interact with actinobacteria Frankia. The ability of such plants to symbiotically fix 56 nitrogen has attracted attention because of their ecological and agronomic implications. It is 57 now well established that nitrogen fixing symbioses partially evolved from a pre-existing 58 genetic background present in the most ancient AM symbiosis (Kouchi el al., 2010; 59 Markmann and Parniske 2009). 60

This hypothesis has been strengthened by genetic screens in two temperate legumes 61 Medicago truncatula and Lotus japonicus, both used as models to study nitrogen-fixing 62 symbioses, enabling major insights into the molecular components of the symbiotic signalling 63 pathway (Oldroyd et al., 2011). One important advance was the finding in the early 1990s, 64 that plant-derived flavonoids stimulate rhizobia to produce lipo-chitooligosaccharide signal 65 molecules called Nod factors (Lerouge et al., 1990). The perception of Nod factors (NFs) by 66 LysM-RLKs receptors (LjNFR1/MtLYK3, LjNFR5/MtNFP) is the keystone in the specific 67 recognition of bacterial symbionts by the plant (Limpens et al., 2003; Radutoiu et al., 2003; 68 Arrighi et al., 2006; Smit et al., 2007). This first recognition event is propagated by a set of 69 proteins including an LRR receptor kinase (LjSYMRK/MtDMI2), at least three nucleoporins 70 (LjNUP85, LjNUP133, NENA) and one or two cation channels (LjCASTOR, 71 LjPOLLUX/MtDMI1), all required for the induction of Ca2+ spiking (Oldroyd and Downie, 72 2006). A Ca2+/calmodulin dependent kinase (LjCCaMK/MtDMI3) is likely a decoder of 73 calcium oscillations through phosphorylation of target proteins (e.g. LjCYCLOPS/MtIPD3) 74 (Messinese et al., 2007; Yano et al., 2008). The complex formed by CCaMK and its 75 phosphorylated partner CYCLOPS triggers the expression of NIN (Singh et al., 2014), a 76 transcription factor which eventually activates another round of specific transcription factors 77



6

in the GRAS family (Kalo et al., 2005; Smit et al., 2005). This signalling cascade together 78 with a cytokinin signal detected by LHK1, enables nodule organogenesis (Tirichine et al., 79 2007; Murray et al., 2007). 80

An increasing number of genes primarily associated with rhizobial infection and 81 nodule organogenesis (including the seven genes described above) have been shown to be 82 also involved in AM symbiosis (for a review see Kouchi et al., 2010). Interestingly, two “so-83 called” common symbiotic genes, CgSYMRK/DgSymRK and CgCCaMK, have been shown to 84 be also necessary for the establishment of the symbiosis between actinorhizal plants 85 (Casuarina glauca and Datisca glomerata) and Frankia (Gherbi et al., 2008; Markmann et 86 al., 2008; Svistoonoff et al., 2013). 87

Aeschynomene evenia recently emerged as a new model legume for the study of 88 legume-rhizobium interactions (Arrighi et al., 2012). Most studies of rhizobium-legume 89 symbioses up to now were those in temperate climates, which are far from representing the 90 diversity of such interactions, particularly the range of infection processes. The best-known 91 infection process, which is encountered in most temperate legumes including L. japonicus and 92 M. truncatula, involves primary entry of bacteria into deformed root hairs through infection 93 threads (ITs) and the induction of a nodule primordium in the root cortex (Gage 2004). 94 However, in around 25% of legumes found mainly in tropical and warm temperate areas, 95 rhizobial invasion does not involve the formation of infection threads (Sprent 2007). Instead, 96 invasion occurs through epidermal cracks and the rhizobia are endocytosed directly by a 97 cortical cell. These cortical cells divide repeatedly resulting in uniformly infected tissue, with 98 bacteria maintained in symbiosomes. Some Aeschynomene spp. display a NF-independent 99 symbiotic process where the symbionts (photosynthetic Bradyrhizobium strains) are able to 100 induce nitrogen-fixing nodules in the absence of the canonical nodABC genes required for the 101 synthesis of Nod factors (Giraud et al., 2000; Giraud et al., 2007). In addition to the existence 102 of alternative infection processes, results showing that common nod genes are absent in at 103 least two photosynthetic Bradyrhizobium strains naturally associated with Aeschynomene 104 species, shows that alternative signalling pathways enabling nodulation exist even within the 105 legume family. 106

In this context it was important to investigate whether the Nodulation Signalling 107 Pathway, which is triggered by the recognition of Nod factors in legumes, is conserved in 108 Aeschynomene evenia. To this end, we analysed the function of orthologues of symbiotic 109 genes in A. evenia using RNAi approaches. We selected CCaMK as the first candidate gene 110 because it has been shown to play a central role in cross signalling between root nodule 111



7

organogenesis and infection processes. The resulting data were extended to orthologues of 112 LjSYMRK and LjHK1, which act upstream and downstream of the CCaMK respectively. The 113 data presented here show that CCaMK, SYMRK and HK1 are required for efficient 114 nodulation of A. evenia. Our results suggest that beyond the perception of Nod factors, all 115 nodulation genes are required in the legume NF-independent symbiosis and hence appear to 116 be conserved either in legumes or in nodulation in actinorhizal plants. 117 118 119 120



8

RESULTS 121 Identification of CCaMK orthologues in Aeschynomene evenia sp. serrulata 122 Screening of an expressed sequence-tag database of A. evenia. sp. serrulata enabled 123 identification of a 1686 bp EST containing the full-length CCaMK open reading frame (RNA 124 was isolated from leaves, control roots and roots sampled at different times after inoculation 125 with Bradyrhizobium ORS278; our unpublished data). The AeCCaMK deduced protein was 126 506 aa long and its alignment with available CCaMK sequences from legumes revealed 127 strong conservation of protein domains in the Aeschynomene orthologue (Fig. 1A). 128 Phylogenetic analysis revealed that AeCCaMK clusters together with CCaMK from other 129 legume species but forms an outgroup with A. hypogaea (87% amino acid identity) which 130 belongs to the same Dalbergioid clade (Fig. 1B). 131 Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was performed to 132 determine the steady-state levels of AeCCaMK transcripts in leaves, nodules and roots during 133 the nodulation process (Fig. 2A). AeCCaMK expression appeared to be restricted to the roots 134 since no expression was detected in leaves. Upon infection, a slight up-regulation of CCaMK 135 was observed in nodules (Fig. 2A), which resembles the expression profiles of CCaMK in 136 other legumes (Levy et al. 2004; Sinharoy & DasGupta 2009). To localize the expression of 137 CCaMK, we isolated its promoter region by genome walking. A 564-bp promoter region was 138 obtained corresponding to the sequence between the translation initiation site of CCaMK and 139 an upstream transposon insertion site. This fragment was therefore considered to encompass 140 the complete promoter region and was used to drive the transcription of the uidA reporter 141 gene. This promoter fusion was introduced into A. evenia sp. serrulata by transformation with 142 A. rhizogenes ARqua1 (Bonaldi et al., 2010). GUS staining was observed in the root 143 vasculature of uninoculated transgenic roots, and sectioning revealed GUS staining in cortical 144 tissue (Fig. 2B-C). The same expression pattern was observed over the five-day period 145 following inoculation with Bradyrhizobium strain ORS278 (Fig. 2D-E). At 10 dpi, the 146 promoter was active in the infected cells of the nodule (Fig. 2F-G). These observations 147 revealed that the steady state level of CCaMK expression in root is not induced during 148 rhizobial invasion even though its expression pattern extends to the nodule. 149 150 Knockdown of AeCCaMK impairs nodule development 151 To investigate the function of AeCCaMK during nodulation, we reduced CCaMK transcript 152 levels in transgenic A. evenia roots by RNAi. Two constructs were designed, one 410 and one 153 326 bp long targeting either the kinase (RNAiCCaMK1) or the visinin (RNAiCCaMK2) 154



9

domains. These constructs were introduced into A. evenia sp. serrulata via Agrobacterium 155 rhizogenes-mediated transformation with DsRED as co-transformation marker. Roots 156 transformed with the gateway vector pK7WG2D carrying the uidA reporter gene under the 157 control of a 35S promoter and a GFP as co-transformation marker were analysed as controls. 158



10

Plants with transgenic roots, identified by green or red fluorescent protein (GFP or DsRED) 159 were inoculated with Bradyrhizobium ORS278 and the efficiency of nodulation was 160 examined one week later (7 dpi) and again when the nodulation process was complete (18 161 dpi). We observed a clear impact of AeCCaMK silencing on nodulation efficiency: in the 162



11

control transgenic lines (n=27) more than 90% of transgenic roots had developed nodules at 163 18 dpi whereas in lines transformed with the RNAiCCaMK1 knockdown construct (n=84), 164 only 58% of the transgenic roots had developed normal nodules at 18 dpi. In lines 165 transformed with the RNAiCCaMK2 knockdown construct (n=76), the phenotype was even 166



12

more severe as only 30% of the transgenic roots developed normal nodules. In the remaining 167 70% of RNAiCCaMK2 roots absolutely no nodules developed (Fig 3A). Besides a lower 168 percentage of nodulated plants, the number of nodules was significantly reduced in the 169 RNAiCCaMK2 lines: an average of only six nodules per plant was obtained compared with 170 11 in the control (Fisher LSD test), evidence that the formation of nodules is drastically 171 impaired when the expression level of CCAMK is knocked down. Conversely, the nodules in 172 the transgenic RNAi lines looked similar to those observed on control roots and cytological 173 analysis failed to reveal any particular disorders, pointing to normal organogenesis (Fig. 3E-174 I). In addition, we observed no intermediate phenotypes such as small nodules or bumps, on 175 these transgenic RNAi roots, suggesting an “all or nothing” response in nodule organogenesis. 176 To evaluate the efficiency of AeCCaMK knockdown in RNAi roots, CCaMK transcript levels 177 were determined using quantitative RT-PCR in a subset of the RNAiCCaMK1 and 178 RNAiCCaMK2 lines (n = 32), as well as in control lines (n = 5). A link was found between 179 the reduction in the transcript level and the severity of the phenotype (Fig. 3). Lines with the 180 greatest reduction in expression (< 20%; e.g., R2A25, R2A24 and R2A28) formed no nodules 181 (Fig. 3H-I), whereas those with > 20% expression, such as R2N21, formed normal nodules 182 (five nodules in the R2N21 line; Fig. 3E-G) suggesting that a threshold of 20% of CCAMK 183 expression is critical to switch from an “all to nothing” phenotype in nodule organogenesis. 184 185 Expression of deregulated forms of AeCCaMK leads to spontaneous nodule inception 186 Ca2+ is the initial signal induced in response to symbiotic signals from rhizobia or AM fungi. 187 A calmodulin-binding regulatory domain and a visinin-like Ca2+ binding domain including 188 three canonical EF-hand motifs are present on the C-terminal part of AeCCaMK. The N-189 terminal part of the protein contains a kinase domain with an autophosphorylation site 190 (corresponding to the threonine in position 253 in AeCCAMK). Recent studies on 191 M. truncatula CCaMK have shown that Ca2+ binding to the EF-hand domains promotes 192 autophosphorylation, which negatively regulates CCaMK by stabilizing the inactive state of 193 the protein. By contrast, calcium-dependent CaM binding overrides the effects of 194 autophosphorylation and activates protein phosphorylation, which is responsible for the 195 ability to accommodate rhizobia (Miller et al., 2013). Deregulated variants of CCaMK gain 196 autonomous activity leading to the development of spontaneous nodules in the absence of 197 rhizobia (Gleason et al., 2006; Tirichine et al., 2006). 198 To further analyse the function of CCaMK in the NF-independent nodulation process, we 199 constructed two gain-of-function CCaMK variants: a truncated and a mutated form of the 200



13

protein. The truncated form consists of a 308 aa sequence corresponding to the kinase domain 201 lacking the auto-inhibition domain while in the mutated form, the Threonine at position 253 is 202 replaced by an Aspartate (T253D), which mimics the autophosphorylation of Thr in response 203 to the symbiotic Ca2+ signal. The complete CDS of AeCCaMK and the two dominant active 204



14

forms of the protein were introduced into A. evenia roots. Three weeks after transfer to liquid 205 media, nodule-like structures were observed in 46% (n=11/24) and 39% (n=12/31) of 206 transgenic roots expressing the truncated and mutated variants of AeCCaMK, respectively. 207 Spontaneous nodules were not observed either on control wild type roots or on transgenic 208 roots carrying the complete AeCCaMK CDS (n=45). The spontaneous nodules were white and 209 round and developed at the emergence of lateral roots exactly where wild type nodules are 210 found (Fig. 4A-B). Microscope analyses showed that spontaneous nodules lacked the typical 211 central infection zone but initiated vascular bundles (Fig. 4C-F), showing that the constitutive 212 kinase activity of AeCCaMK is sufficient to induce nodule organogenesis in the absence of 213 Bradyrhizobium. 214 215 To what extent is the Nod signalling pathway conserved in A. evenia sp. serrulata? 216 To answer this question, we performed RNAi assays on two additional symbiotic genes: 217 AeSYMRK, which encodes the LLR receptor kinase acting upstream from CCaMK in the 218 common symbiosis pathway and the cytokinin receptor AeHK1 involved in cell divisions 219 downstream from CCaMK. We identified AeSYMRK and AeHK1 by screening the EST 220 database of A. evenia sp. serrulata. Phylogenetic analyses were performed to unambiguously 221 identify AeSYMRK and AeHK1 orthologues among their respective gene families (Fig. S1 and 222 S2). Two RNAi constructs were made: one with a 297-bp fragment of the AeSymRK coding 223 sequence encompassing the transmembrane domain of the protein, and the other with a 277-224 bp fragment of AeHK1 corresponding to part of the receiver domain. In total, 70 225 RNAiSYMRK and 68 RNAiHK1 roots were selected for analysis. Chimeric plants with 226 transgenic roots were inoculated with Bradyrhizobium ORS278, and nodulation was scored 227 one week later and when the nodulation process was completed (7 and 21 dpi). At 21 dpi, 228 72% of control lines exhibited N2-fixing nodules (n=24) and RNAiSYMRK and RNAiHK1 229 lines displayed 43% and 29% of nodulated roots, respectively (Fig. 5). In addition to reduced 230 nodulation, we also observed a decrease in the number of nodules. The average number of 231 nodules per root was 1.6 in RNAiSYMRK and 1.3 in RNAiHK1 lines, compared to 5.8 in the 232 control transgenic lines. A Fisher’s test revealed that the number of nodules in RNAiSYMRK 233 and RNAiHK1 lines was significantly lower than in the transgenic control lines (p value < 234 0.05). 235 RNAi nodules displayed the classical histological organization of aeschynomenoid nodules in 236 which the core infected zone is not interspersed with uninfected cells (Fig. 5E-J). 237



15

AeSYMRK and AeHK1 extinction levels were quantified by qRT-PCR in a subset of 15 and 18 238 RNAi roots displaying a major reduction in the number of nodules. A 39-89% reduction in 239 AeSYMRK mRNA levels and a 45-80% reduction in AeHK1 mRNA levels were observed, 240 demonstrating the impact of silencing on nodulation. 241



16

242 243 244



17

DISCUSSION 245 The discovery that NFs are not required for the interaction between Aeschynomene and 246 Bradyrhizobia challenged the long held view that Nod factors are essential for all 247 legume-rhizobial associations (Giraud et al., 2007). In this study, we assessed whether the 248 widely studied components of the symbiotic signalling pathway are necessary for this 249 NF-independent mode of nodulation. In all vascular plant endosymbioses described so far i.e. 250 nodulation and mycorrhization, calcium oscillations play an essential role as a secondary 251 messenger. The symbiotic calcium- and calmodulin-dependent protein kinase CCaMK is 252 required for the interpretation of this Ca2+ signature (Oldroyd and Downie, 2006; Madsen et 253 al., 2010; Singh et al., 2014). Mutations in CCaMK or CCaMK RNAi prevent root infections 254 by microsymbionts through the inhibition of either the formation of ITs or endocytosis of 255 rhizobia inside the nodules, and block or, in the case of RNAi lines, reduce nodule 256 organogenesis in legumes (Catoira et al., 2000; Lévy et al., 2004; Mitra et al., 2004; Capoen 257 et al., 2009; Sinharoy and DasGupta, 2009) and actinorhizal plants (Svistoonoff et al., 2013). 258 To address the question of the role of CCaMK in the Aeschynomene-Bradyrhizobium 259 symbiotic couple through forward and reverse genetic approaches, we isolated and 260 characterized the CCaMK gene from A. evenia spp. serrulata. The AeCCaMK protein has all 261 the features of other plant CCaMKs, i.e. a kinase domain and an auto-inhibition domain 262 overlapping a calmodulin-binding domain such that auto-inhibition is released in presence of 263 CaM. Deletion of this auto-inhibition domain or a phosphomimetic version of CCaMK lead to 264 the formation of spontaneous nodules in the absence of symbionts in legumes (Gleason et al., 265 2006; Tirichine et al., 2006; Miller et al., 2013; Takeda et al., 2012), in Casuarina glauca 266 (Svistoonoff et al., 2013) and in Parasponia andersonii, the only non-legume able to form a 267 nitrogen-fixing symbiosis with rhizobia (Op den Camp et al., 2011). 268 Our results showed that in A. evenia, two similar gain-of-function (GOF) AeCCaMK variants 269 also led to the inception of spontaneous nodules at the emergence of lateral roots where 270 nodules normally develop in legumes infected via a crack-entry process. In parallel with the 271 GOF strategy, we down-regulated the expression of AeCCaMK using an RNAi strategy. The 272 silencing of AeCCaMK led to a significant decrease in the percentage of roots that developed 273 nodules and also in the average number of nodules per root. Taken together, the data obtained 274 using GOF and RNAi approaches demonstrate the central role of CCaMK in nodule inception 275 in a legume NF-independent context. 276 The next step was to determine if other components of the nodulation signalling pathway 277 were conserved in A. evenia. To this end, we performed RNAi assays against the leucine-rich-278



18

repeat receptor kinase gene SYMRK, which acts upstream from CCaMK, and against the 279 cytokinin receptor (LHK1/CRE1), which is involved in cell divisions after Ca2+ spiking 280 perception. In model legumes, mutations in SYMRK almost completely block epidermal 281 responses to rhizobia, including root hair curling and the formation of ITs (Catoira et al., 282 2000; Endre et al., 2002; Stracke et al., 2002), while mutations in HK1 allow IT to form but 283 alter nodule development and prohibit endocytosis of bacteria in primordium cells (Gonzalez-284 Rizzo et al., 2006; Murray et al., 2007; Plet et al., 2011). Observations made on Sesbania 285 rostrata, a tropical aquatic legume like A. evenia, demonstrated that the epidermis lock 286 observed in symrk or ccamk mutants in model legumes can be bypassed (Capoen et al., 2010). 287 In S. rostrata, SrSYMRK RNAi and SrCCaMK, RNAi lines are still able to form bumps or 288 small non-functional nodules at lateral root bases. Those permissive phenotypes are correlated 289 with the nodulation features displayed by S. rostrata. On hydroponic roots, the 290 microsymbiont of S. rostrata starts to invade the cortex intercellularly via cracks at lateral 291 root bases exactly like Bradyrhizobium sp. on A. evenia roots. Thus, rhizobial invasion 292 involves the formation of intercellular infection pockets (IPs) and the subsequent formation of 293 ITs that spread toward the nodule primordium (Ndoye et al., 1994; Goormachtig et al., 2004). 294 SrSYMRK RNAi and SrCCaMK RNAi roots still form IPs and nodules, but these are not 295 functional because the ITs are no longer able to release bacteria. This study (1) demonstrated 296 that during the crack-entry infection process, the epidermal stages of nodulation are 297 independent of SYMRK and CCaMK activities, and (2) confirmed that SYMRK and CCaMK 298 play an additional role at later stages of nodule development, i.e. bacterial release into the 299 primordium cells (Capoen et al., 2005 & 2009). The role of SYMRK and CCaMK in 300 endocytosis of bacteria inside nodules is shared with HK1 (Murray et al., 2007; Plet et al., 301 2011). 302 In A. evenia, silencing of SYMRK or HK1 led to a significant reduction in the number of 303 nodules. Taken together, our data show that AeCCaMK, AeSYMRK and AeHK1 are required 304 for functional NF-independent symbiosis in Aeschynomene. 305 Another interesting observation was that for each RNAi construct, nodulation was achieved 306 with no impact on the morphology of the nodules. Contrary to what was described in 307 S. rostrata (Capoen et al., 2005 & 2009), we observed no transitional phenotypes such as 308 small, non-fixing nodule-like structures. The absence of transitional phenotypes might be 309 related to the more primitive intercellular infection process at play in A. evenia, which not 310 only bypass epidermal responses to rhizobia (no ITs) but do not involve distant induction of a 311 primordium. In Aeschynomene species, rhizobia are directly endocytosed in cortical cells 312



19

from intercellular spaces (Bonaldi et al., 2011). The infected cortical cells, so-called founder 313 cells, then divide repeatedly to form the typical aeschynomenoid nodule characterized by the 314 absence of uninfected cells in the central symbiotic tissue. As a consequence, we hypothesise 315 that in the RNAi lines in which the residual amount of the targeted gene transcripts is 316 necessary and sufficient to allow at least one rhizobial endocytosis event inside a founder cell, 317 nodule organogenesis can be triggered. This could explain the drastic differences in the 318 symbiotic phenotype, ranging from the complete absence of nodules to the formation of a few 319 perfectly functional nodules, depending on the transgenic line concerned. 320 The fact AeCCaMK, AeSYMRK and AeHK1 are required for functional NF-independent 321 symbiosis strengthens the well-established evolutionary hypothesis that a core set of common 322 symbiotic genes is conserved in all vascular plant endosymbioses described so far (Markmann 323 & Parniske, 2009). Our results are consistent with the development of functional nodules in 324 L. japonicus mutants (affected in the perception of the Nod factors and able to form 325 spontaneous nodules) upon infection with a Nod- bacteria mutant (Madsen et al., 2010). In 326 other words, nodulation can occur even in the absence of Nod factors, as long as the common 327 symbiosis signal transduction pathway is switched on; the so-called "ground state" described 328 by Madsen et al. (2010). Our Aeschynomene-Bradyrhizobium pair probably represents a 329 natural case of such a "ground state" infection process. 330 Similar symbiotic cascade requirements were also found in the actinorhizal plant Casuarina 331 glauca in which both SYMRK (Gherbi et al., 2008) and CCaMK (Svistoonoff et al., 2013) 332 were shown to be required for nodulation. It is noteworthy that a microorganism lacking nod 333 genes activates such a signalling pathway. Indeed, the sequencing of several Frankia genomes 334 revealed the absence of the common nod genes (Normand et al., 2007), as is the case for 335 Bradyrhizobium ORS278 (Giraud et al., 2007). A simple explanation could be the existence 336 of original signal molecule(s) originating from these symbiotic partners. In the case of 337 Frankia, the only published data concern a root hair deforming factor whose biochemical 338 properties differ from those of Nod factors (Cérémonie et al., 1999). In Bradyrhizobium sp., a 339 mutant screen was conducted on the ORS278 strain, but neither complete nod-minus mutants 340 nor mutants affected in the synthesis of a putative signal molecule were isolated (Bonaldi et 341 al., 2011). However, several mutants were found to be affected in the synthesis of purine, 342 suggesting a role for bacterial cytokinins as a signal. This hypothesis has since been evaluated 343 and although bacterial cytokinins contribute positively to nodule development in 344 Aeschynomene plants, they are not the key signal which triggers nodule formation during NF-345 independent symbiosis (Podlešáková et al., 2013). The absence of nod-mutants could be due 346



20

to either functional redundancy or to the need for bacterial viability. A putative candidate 347 could be the bicyclic sugar bradyrhizose, which is the O-antigen specific component of 348 Bradyrhizobium lipopolysaccharide (Silipo et al., 2011). Notably, bradyrhizose does not 349 trigger innate immune response in different plant families (Silipo et al., 2011). It remains to 350 be seen if bradyrhizose is able to induce the Aeschynomene symbiotic pathway and the 351 expression of symbiotic genes. Another argument in favour of a structural component of the 352 bacteria as a signal comes from the specific environment of the symbiotic interaction in our 353 model. Aeschynomene is a tropical flooded legume and a diffusible signal such as the Nod 354 factor would be highly diluted. Alternatively, a diffusible signal may be involved but at a later 355 stage of infection, when the Bradyrhizobiums colonize the sub-epidermal layers of the root. It 356 is worth noting that such behaviour is also observed in the Sesbania infection process upon 357 flooding (Goormachtig et al., 2004). Identifying Aeschynomene genes as markers of the early 358 steps in the symbiotic interaction would be useful in the search for the Bradyrhizobium 359 ORS278 signal. 360 Another consequence of the existence of a Bradyrhizobium ORS278 signal concerns its 361 perception. Until recently, Nod factors and plant NF receptors (LysM-RLK) were considered 362 to be specific to nitrogen-fixing root nodule symbioses. However, this border has been 363 crossed through the identification of the Myc-LCO whose structure appears very close to that 364 of the Nod factors (Maillet et al., 2011) and the discovery in P. andersonii of a LysM-RLK 365 receptor involved in both rhizobial and mycorrhizal recognition (Op den Camp et al., 2011). 366 Another member of the LysM-RLK family, OsCERK1, was recently shown to be involved in 367 the perception of pathogenic and symbiotic microbial patterns (Miyata et al., 2014). These 368 data support the hypothesis of a role for LysM-RLKs in the perception of a broad range of 369 microbial patterns, and our next goal is to identify their role in legume-rhizobium NF-370 independent symbioses. Exploring such avenues supports the current goal of circumventing 371 the nodulation lock in non-nodulating plants by redirecting the existing symbiosis pathway to 372 enable the creation of artificial plant-bacteria associations/symbioses. 373 374 375 MATERIALS AND METHODS 376 Plant and Bacterial strains 377 A. evenia seeds used in this study came from the line IRFL6945 (USDA) (Arrighi et al., 378 2012). Seeds were scarified with concentrated (95%) sulfuric acid for 40 min. The seeds were 379 then abundantly rinsed with sterile deionized water, surface sterilized with sodium 380



21

hypochlorite (3%) for 5 min, and again rinsed abundantly. They were then incubated 381 overnight in sterile water at room temperature, transferred onto 0.8% water agar plates, and 382 put upside down for another night at 34 °C to induce germination. 383 Agrobacterium rhizogenes strain ARqua1 (Quandt et al., 1993) was used for hairy root 384 transformation of A. evenia (Bonaldi et al., 2010). Bradyrhizobium sp. strain ORS278 385 (Molouba et al., 1999) was used for nodulation assays (Giraud et al., 2000). 386 387 Isolation of AeCCaMK, AeSYMRK and AeHK1 sequences 388 A full-length AeCCaMK fragment was amplified from nodule cDNA using CCaMK(CDS)-F: 389 CACCATGGGACAAGAAACCAGAAAG and CCaMK(CDS)-R: 390 CTATAGTGGGCGAAGAGAAGAAA primers designed from Aeschynomene evenia EST 391 library homologous to the CCaMK gene. The complete AeCCaMK CDS was then cloned in 392 the pENTR™/D-TOPO® vector (Invitrogen). The AeCCaMK promoter (564 bp) was cloned 393 using the Universal Genome Walker kit (Clontech) applied to genomic DNA following the 394 manufacturer’s recommendations. An amplified fragment was cloned into pGEM-T vector 395 (Promega) and sequenced. Screening of the A. evenia EST database enabled identification of 396 two ESTs corresponding to SYMRK and HK1 gene transcripts, respectively. For phylogenetic 397 analyses, CCaMK sequences (GenBank accession numbers in parentheses) from Zea mays 398 (162459834), Oryza sativa (115464591), Lilium longiflorum (71152362), Nicotiana tabacum 399 (5814023), Petunia hybrida (148607974), Vitis vinifera (225465367), Casuarina glauca 400 (511630596), Populus trichocarpa (224110060), Arachis hypogaea (195542475), Sesbania 401 rostrata (186909461), Glycine max (356526360), Pisum sativum (71152364), Medicago 402 truncatula (357515671) and Lotus japonicus (122250440) were retrieved from GenBank. 403 Sequences similar to AeSYMRK and AeHK1 were also recovered from GenBank. 404 The sequence data cited in this article can be found in the GenBank/EMBL data libraries 405 under the accession numbers: AeCCaMK (KT248236); AeSYMRK (KT248237); AeHK1 406 (KT248238). 407 408 Agrobacterium rhizogenes-mediated root transformation 409 The procedure is described by Arrighi and associates (2012). Four-day-old seedlings were 410 inoculated by direct application of A. rhizogenes on freshly sectioned radicles. One week after 411 transformation with A. rhizogenes, the plantlets were sub-cultured twice at 7-day intervals on 412 solid half-strength Murashige Skoog medium containing cefotaxim (300 mg/litre). Chimeric 413 root systems obtained after A. rhizogenes transformation using binary vectors derived from 414



22

pK7WG2D or pK7GWIWG2D(II)-RedRoot gateway vectors were dissected in sterile 415 conditions to select one co-transformed root expressing GFP or DsRED. Dissected plants 416 were transferred to Falcon® tubes containing liquid BNM supplemented with 1 mM KN03, 417 which were covered with aluminium to protect the root system from light. The plants were 418 grown in a growth chamber 28 °C, a 16 h/8 h light regime, and 70% humidity. 419 For studies of nodulation, plants were inoculated with 1 ml of a 5 day-old Bradyrhizobium 420 ORS278 culture grown in YMm medium. Plants were regularly inspected for nodule 421 formation and nodulation was quantified one week after inoculation and when the nodulation 422 process was completed (corresponding to the beginning of the second infection wave when 423 new young nodules started to appear, usually between 18 and 21 days after inoculation). The 424 significance of the difference between treatments was determined with a Fisher’s test. 425 426 Transgenic Roots 427 RNAiCCaMK1 and RNAiCCaMK2 constructs corresponding to respectively 410 bp of the 428 AeCCaMK kinase domain and to 326 bp of the visinin domain were generated by 429 amplification from AeCCaMK cDNA template with primers: CCaMKRNAi1-F (5’-430 CACCTGTGAGAAAAGGCATCAGGA-3’), CCaMKRNAi1-R (5’-431 CAGGAACAAGCAATTCTCAGG-3’), CCaMKRNAi2-F (5’-432 CACCATGTGGAAATGGGGAGAATG-3’) and CCaMKRNAi2-R (5’-433 TCTCATCCAACTTCCCAGGT-3’). RNAiSYMRK and RNAiHK1 constructs were 434 generated by amplification from A. evenia nodules cDNA template with Gateway modified 435 primers TOPO-AeSYMRKfor (5’- CACCAATAACTTTCCAGAACAAGCAATC-3’), 436 TOPO-AeSYMRKrev (5’- GTAGACCGAACCGAACCC-3’), CRE1(RNAi)-F (5’- 437 CACCACGGTGATCATGAAGCCTCT-3’) and CRE1(RNAi)-R (5’-438 CCATGAAGCAAGCATCAAAA-3’). The specificity of all the fragments used for silencing 439 was checked by a BLAST analysis against the Aeschynomene EST database. Amplified 440 fragments were cloned into pENTRTM/D-TOPO® (Invitrogen) and then into binary vector 441 pK7GWIWG2D(II)-RedRoot (VIB-Ghent University) by gateway technology. 442 The AeCCaMK promoter was identified with the Universal Genome Walker kit (Clontech) 443 applied to genomic DNA, and the 564 bp region upstream from the start codon was amplified 444 with primers PromAeCCaMK.fwd (5’- CACCCTAGTACATGTTGCATATCCT-3’) and 445 PromAeCCaMK.rev2 (5’- CATGGTGGGGTGTGGGAATGA-3’) and recombined into 446 pENTRTM/D-TOPO® (Invitrogen) and then into binary vector pKGWFS7 (Karimi et al., 447 2002). 448



23

The gain-of-function CCaMK constructs were generated by PCR with the following primers 449 CCaMK(CDS)-F (5’-CACCATGGGACAAGAAACCAGAAAG-3’), CCaMK(truncated)-R 450 (5’-CTAGCTTTGCAGCCTCGACAC-3’), CCaMK-T253D-F (5’-451 GCTTCTATGAGAAGGACTGGAAGGGCATTTC-3’) and CCaMK-T253D-R (5’- 452 GAAATGCCCTTCCAGTCCTTCTCATAGAAGC-3’), using AeCCaMK cDNA cloned into 453 the Gateway entry vector pENTRTM/D-TOPO® (Invitrogen) as template. The PCR products 454 were recombined into the destination vector pK7WG2D (Karimi et al., 2002). 455 As transgenic control construct, we used the PENTR™-gus positive control provided with 456 Gateway® LR clonase II enzyme mix (Invitrogen) cloned in pK7WG2D vector (Karimi et al., 457 2002). All binary vectors were introduced into A. rhizogenes Arqua1 by the freeze-thaw 458 method as described by Höfgen and Willmitzer (1988). 459 460 Expression Analysis of AeCCaMK, AeSYMRK and AeHK1 461 Total RNA was extracted from roots using the SV total RNA Isolation System (Promega) and 462 quantified using a NanoDrop ND-1000 spectrophotometer. Two hundred ng per sample were 463 reverse transcribed using SuperScriptII reverse transcriptase (Invitrogen) and oligo(dT)12–18. 464 Real time qPCR was performed using the Brilliant II SYBR® Green QPCR Master Mix 465 (Agilent Technologies). The primers used were qPCRAeCCaMKfwd (5’- 466 CCTTTCATTGCTCAGACTAATCGC-3’), qPCRAeCCaMKrev (5’- 467 TTGGCTCCATCACCTCTCACC-3’), AeSYMRKqPCRfor (5’- 468 AATGTGGAGAGTGGTGGAAGTAGC-3’), AeSYMRKqPCRrev (5’- 469 TGATGATGGAGTAGCGGTTGGAC-3’), AeCre1qPCRfor (5’- 470 AGCAAGTCAAATGGGCAAGTCAC-3’), AeCre1qPCRrev (5’- 471 GTACCACCGTAGTTCCGAGAGG-3’), qPCRAeEF1.for (5’- 472 AATGGTGATGCTGGTATGGTTAAG-3’) and qPCRAeEF1.rev (5’- 473 TCTTCTTCTGTGCTGCCTTGG-3’). The Real Time SYBR® Green cycling PCR program 474 on a Stratagene MX3005P (Agilent Technologies) was as follows: 1 cycle at 95 °C for 10 475 min, 40 cycles at 95 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s, ended by 1 cycle at 95 °C 476 for 1 min, 55 °C for 30 s, and 95 °C for 30 s. Reactions were performed in triplicate, and the 477 efficiency-corrected comparative quantification method was used to quantify AeCCaMK, 478 AeSYMRK and AeHK1 expressions (Pfaffl 2001). The results were standardised with AeEF1æ 479 expression levels. 480 481 Histochemical Analysis and Microscopy 482



24

Observations were made either with a fluorescence MACROscope (Nikon® AZ100), a 483 microscope (Olympus® PROVIS) or a confocal laser-scanning microscope (Carl Zeiss LSM 484 700; Jena, Germany). Semi-thin nodule sections (40-to 60-µm-thick) were prepared using a 485 vibratome (VT1000S; Leica, Nanterre, France). For confocal microscopy observations, the 486 nodule sections were incubated for 20 min in live/dead staining solution (5 µM SYTO 9 and 487 30 µM propidium iodide (PI) in 50 mM Tris-HCl pH 7.0 buffer; Live/Dead BacLight, 488 Invitrogen). Sections were then removed and incubated for 15 min more in 10 mM phosphate 489 saline buffer (PBS) containing Calcofluor White M2R (Sigma, Munich) at a final 490 concentration of 0.01% (w/v) to stain the plant cell wall (Nagata and Takebe 1970). After 491 washing with PBS, the sections were mounted on microscope slides in PBS containing 492 glycerol at a final concentration of 50% (v/v). Calcofluor was exited at 405 nm and detected 493 with a 460 to 500 nm emission filter. Excitation wavelengths of 488 nm and 555 nm were 494 used for SYTO 9 and PI with emission signal collection at 490 to 522 nm and 600 to 700 nm, 495 respectively. Images were obtained using the ZEN 2008 software (Zeiss). GUS activity was 496 localized by incubating roots or sectioned nodules for one hour at -20 °C in 90% methanol, 497 samples were rinsed in 0.2 M phosphate buffer (pH 7.0) and finally incubated in a GUS assay 498 buffer at 37 °C for 12 h in the dark. The substrate mixture (adapted from Mendel et al., 1989) 499 contained 100 µM X-Gluc (5-bromo-4-chloro-3-indolyl-β-D-glucuronide) in 50 mM K/Na-500 phosphate buffer (pH 8.0), 1% Triton X-100, 1 mM K-ferricyanide and 1 mM K-501 ferrocyanide. 502 503 504 FIGURE LEGENDS 505 Figure 1. Features of the Ca2+/calmodulin-dependent protein kinase (CCaMK) of 506 Aeschynomene evenia. A, Alignment of CCaMK from Aeschynomene evenia, Arachis 507 hypogea, Lotus japonicus, Medicago truncatula and Casuarina glauca. Sequences were 508 aligned using ClustalW. Identical amino acids are in black and different amino acids are in 509 red. On the basis of in silico predictions, catalytic domain, calmodulin-binding domain, EF-510 hands of visinin-like domain are highlighted in blue, red, and green respectively, and the auto-511 phosphorylation site is indicated by a star. B, Position of A. evenia CCaMK in a distance tree 512 predicted based on available CCaMK protein sequences. The tree was generated based on a 513 Clustal Omega alignment of 474 amino acids. Numbers at nodes represent bootstrap values 514 (% of 100 replicates; only values > 90% were retained). Accession numbers of the proteins 515 are NP_001105906.1 (Zea mays), NP_001055895.1 (Oriza sativa), Q43531.1 (Lilium 516



25

longiflorum), AAD52092.1 (Nicotiana tabacum), ABQ95545.1 (Petunia hybrida), 517 XP_002273342.1 (Vitis vinifera), CCW43374.1 (Casuarina glauca), XP_002315401.2 518 (Populus trichocarpa), ACB46142.1 (Arachis hypogaea), ACC94267.1 (Sesbania rostrata), 519 XP_003531786.1 (Glycine max), A0AAR7.1 (Lotus japonicus), Q6RET6.2 (Pisum sativum) 520 and XP_003628124.1 (Medicago truncatula). 521 522 Figure 2. Expression analysis of Aeschynomene evenia Ca2+/calmodulin-dependent protein 523 kinase (AeCCaMK). A, Relative transcript abundance of AeCCaMK in roots, mature nodules 524 (2 weeks after inoculation) and leaves. Relative transcript abundance was determined by 525 quantitative reverse-transcription polymerase chain reaction and normalized against the 526 A. evenia elongation factor EF1α, which was constitutively expressed in all tissues tested. B-527 G, Histochemical localization of GUS activity in the transgenic roots expressing 528 pAeCCaMK–GUS. B-C, uninoculated transgenic roots showing faint AeCCaMK promoter 529 activity in root vasculature and cortical tissue. D-E, In transgenic roots five days after 530 inoculation with Bradyrhizobium ORS278, GUS staining is visible in the same tissues as in 531 non-infected roots. F-G, In 10-day old nodules, GUS activity is restricted to the infection 532 zone. C, E and G are longitudinal sections of roots and nodules. Bars: 100 µm 533 534 Figure 3. Nodulation phenotype of AeCCaMK knockdown mutants. A, Percentage of 535 nodulated roots calculated at 7 and 18 days post inoculation with the Bradyrhizobium 536 ORS278 strain (the control corresponds to transgenic roots transformed with an empty vector; 537 transgenic control n=27, RNAi-CCaMK1 n=84, RNAi-CCaMK2 n=76). Different letters 538 above the bars represent statistically significant differences (chi-square test, p<0.05). B-D, 539 transgenic control nodule. E-I, RNAi-CCaMK2 18 days after inoculation. D-G, longitudinal 540 sections (60 µm) of nodules. Bars: 500 µm. J, Quantification of AeCCaMK mRNA levels in 541 RNAi plants determined by real-time qPCR. Quantification was performed on 5 independent 542 RNAi-CCaMK2 lines. AeEF1α was used as a reference gene. Relative expression level of 543 AeCCaMK in three independent transgenic control roots. Expression levels are relative to the 544 transgenic control line #5. 545 546 Figure 4. Induction of spontaneous nodules in A. evenia roots expressing gain-of-function 547 CCaMK variants. A, C and E, nodules induced by the Bradyrhizobium ORS278 strain on 548 wild-type roots. B, D and F, spontaneous nodules. A, wild-type nodule 3 weeks after 549 Bradyrhizobium inoculation. B, spontaneous nodules on hairy roots formed 4 weeks after 550



26

transfer to hydroponics. C-D, semi-thin sections (60 µm) of nodules observed with a confocal 551 microscope. The wild-type nodule displays a typical central infection zone with infected cells 552 filled with Bradyrhizobium expressing GFP (C) while the spontaneous nodule lacks the 553 typical infection zone but is starting to form vascular bundles (D, arrows). E-F, close-up of C 554 and D, respectively. In the wild-type nodule, bacteria have differentiated into spherical 555 bacteroids. The spontaneous nodule is devoid of bacteria. Bars: 500 µm in A,B; 100 µm in 556 C,D and 10 µm in E,F. 557 558 Figure 5. Nodulation phenotypes of SYMRK and HK1 knockdown in A. evenia. A, 559 Percentage of nodulated roots calculated at 7 and 21 days post-inoculation with the 560 Bradyrhizobium ORS278 strain (the control corresponds to transgenic roots transformed with 561 an empty vector; transgenic control n=24, RNAiSYMRK n=70, RNAiHK1 n=68). Different 562 letters above the bars represent statistically significant differences (chi-square test, p<0,05). 563 B-D, transgenic control nodules; E-G, and H-J, wild-type phenotype of nodules obtained on 564 roots silenced for SymRK and HK1, respectively. B, E and F, bright-field view of mature 565 nodules obtained 3 weeks after Bradyrhizobium inoculation. C, F and I, UV-light view of the 566 same images (the transgenic line contains the GFP marker gene and the RNAi lines express 567 the RFP). D, E and J, longitudinal sections (60 µm) of corresponding nodules. Bars: 500 µm 568 in B,C,E,F,H,I and 200 µm in D,G,J. 569 570 Figure S1. AeSymRK, the SymRK orthologue of A. evenia. A, Sequence alignment of the 571 AeSymRK protein and orthologues. AeSymRK shows 72% and 71% similarity to L. 572 japonicus LjSymRK and M. truncatula MtDMI2, respectively. Identical amino acids are in 573 black and different amino acids are in red. B, Distance tree of predicted SYMRK protein 574 sequences based on a Clustal Omega alignment. Numbers above the branches represent the 575 percentages of 100 bootstrap replications. Accession numbers of the proteins are 576 AAM67418.1 (Lotus japonicus), AAV88623.1 (Sesbania rostrata), XP_003517193.1 577 (Glycine max), AAM76684.1 (Pisum sativum), Q8L4H4.2 (Medicago truncatula), 578 AFL47812.1 (Arachis hypogaea), AAY22386.1 (Alnus glutinosa), ABY90094.1 (Casuarina 579 glauca), AAY22388.1 (Tropaeolum majus), XP_002272055.21 (Vitis vinifera), AM851092 580 (Populus trichocarpa), NP_001234869.1 (Solanum lycopersicum), BAC83202.1 (Oriza 581 sativa) and ABD67490.1 (Zea mays). 582 583



27

Figure S2. The A. evenia Histidine Kinase (HK) Protein Family. This unrooted relationship 584 tree is based on the alignment of 855 amino acids from L. japonicus (LHK1, LHK1A 585 [formerly LHK2; Murray et al., 2007], LHK2, and LHK3), Arabidopsis (AHK4, AHK2, and 586 AHK3), Medicago truncatula (MtCRE1, MtHK2 and MtHK3) and A. evenia (AeHK1, AeHK2 587 and AeHK3). Protein sequences were aligned with Clustal Omega. Numbers above the 588 branches represent the percentages of 100 bootstrap replications. GenBank accession 589 numbers: LHK1, ABI48271.1; LHK1A, ABI48270.1; LHK2, AHY24023.1; LHK3, 590 AHY24025.1; AHK4, NP_565277.1; AHK2, NP_568532.1; AHK3, NP_564276.1; MtCRE1, 591 XP_003631014.1; MtHK2, XP_003617960.1; MtHK3, XP_003601762.1. 592 593



Parsed CitationsArrighi J-F, Barre A, Ben Amor B, Bersoult A, Soriano LC, Mirabella R, de Carvalho-Niebel F, Journet E-P, Ghérardi M, ... Gough C(2006) The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes.Plant Physiol 142: 265-79.

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Arrighi J-F, Cartieaux F, Brown SC, Rodier-Goud M, Boursot M, Fardoux J, Patrel D, Gully D, Fabre S, ... Giraud E (2012)Aeschynomene evenia, a Model Plant for Studying the Molecular Genetics of the Nod-Independent Rhizobium-Legume Symbiosis.Mol Plant Microbe Interact 25: 851-61.


Bonaldi K, Gargani D, Prin Y, Fardoux J, Gully D, Nouwen N, Goormachtig S, Giraud E (2011) Nodulation of Aeschynomeneafraspera and A. indica by photosynthetic Bradyrhizobium Sp. strain ORS285: the nod-dependent versus the nod-independentsymbiotic interaction. Mol Plant Microbe Interact 24: 1359-71.


Bonaldi K, Gherbi H, Franche C, Bastien G, Fardoux J, Barker D, Giraud E, Cartieaux F (2010) The Nod factor-independentsymbiotic signaling pathway: development of Agrobacterium rhizogenes-mediated transformation for the legume Aeschynomeneindica. Mol Plant Microbe Interact 23: 1537-44.


Capoen W, Den Herder J, Sun J, Verplancke C, De Keyser A, De Rycke R, Goormachtig S, Oldroyd GED, Holsters M (2009) Calciumspiking patterns and the role of the calcium/calmodulin-dependent kinase CCaMK in lateral root base nodulation of Sesbaniarostrata. Plant Cell 21: 1526-40.


Capoen W, Goormachtig S, De Rycke R, Schroeyers K, Holsters M (2005) SrSymRK, a plant receptor essential for symbiosomeformation. Proc Natl Acad Sci U S A 102: 10369-74.


Capoen W, Oldroyd GED, Goormachtig S, Holsters M (2010) Sesbania rostrata: a case study of natural variation in legumenodulation. New Phytol 186: 340-5.


Catoira R, Galera C, de Billy F, Penmetsa R V, Journet E-P, Maillet F, Rosenberg C, Cook DR, Gough C, Dénarié J (2000) Fourgenes of Medicago truncatula controlling components of a nod factor transduction pathway. Plant Cell 12: 1647-66.


Cérémonie H, Debellé F, Fernandez MP (1999) Structural and functional comparison of Frankia root hair deforming factor andrhizobia Nod factor. Can J Bot 77: 1293-1301.


Doyle JJ (2011) Phylogenetic Perspectives on the Origins of Nodulation. Mol Plant-Microbe Interact 24: 1289-1295.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Endre G, Kereszt A, Kevei Z, Mihacea S, Kaló P, Kiss GB (2002) A receptor kinase gene regulating symbiotic nodule development.Nature 417: 962-6.


Gage DJ (2004) Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes.Microbiol Mol Biol Rev 68: 280-300.


Gherbi H, Markmann K, Svistoonoff S, Estevan J, Autran D, Giczey G, Auguy F, Péret B, Laplaze L, ... Bogusz D (2008) SymRK www.plantphysiol.orgon March 18, 2018 - Published by Downloaded from

Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 142%5BVolume%5D AND 265%5BPagination%5D AND Arrighi J%2DF%2C Barre A%2C Ben Amor B%2C Bersoult A%2C Soriano LC%2C Mirabella R%2C de Carvalho%2DNiebel F%2C Journet E%2DP%2C Gh�rardi M%2C %2E%2E%2E Gough C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Arrighi J-F, Barre A, Ben Amor B, Bersoult A, Soriano LC, Mirabella R, de Carvalho-Niebel F, Journet E-P, Gh�rardi M, ... Gough C (2006) The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes. Plant Physiol 142: 265-79.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Arrighi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Arrighi&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 25%5BVolume%5D AND 851%5BPagination%5D AND Arrighi J%2DF%2C Cartieaux F%2C Brown SC%2C Rodier%2DGoud M%2C Boursot M%2C Fardoux J%2C Patrel D%2C Gully D%2C Fabre S%2C %2E%2E%2E Giraud E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Arrighi J-F, Cartieaux F, Brown SC, Rodier-Goud M, Boursot M, Fardoux J, Patrel D, Gully D, Fabre S, ... Giraud E (2012) Aeschynomene evenia, a Model Plant for Studying the Molecular Genetics of the Nod-Independent Rhizobium-Legume Symbiosis. Mol Plant Microbe Interact 25: 851-61.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Arrighi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Aeschynomene evenia, a Model Plant for Studying the Molecular Genetics of the Nod-Independent Rhizobium-Legume Symbiosis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Aeschynomene evenia, a Model Plant for Studying the Molecular Genetics of the Nod-Independent Rhizobium-Legume Symbiosis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Arrighi&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28indica by photosynthetic Bradyrhizobium Sp%2E strain ORS%5BTitle%5D%29 AND 285%5BVolume%5D AND Bonaldi K%2C Gargani D%2C Prin Y%2C Fardoux J%2C Gully D%2C Nouwen N%2C Goormachtig S%2C Giraud E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bonaldi K, Gargani D, Prin Y, Fardoux J, Gully D, Nouwen N, Goormachtig S, Giraud E (2011) Nodulation of Aeschynomene afraspera and A. indica by photosynthetic Bradyrhizobium Sp. strain ORS285: the nod-dependent versus the nod-independent symbiotic interaction. Mol Plant Microbe Interact 24: 1359-71.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bonaldi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nodulation of Aeschynomene afraspera and A&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nodulation of Aeschynomene afraspera and A&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bonaldi&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 23%5BVolume%5D AND 1537%5BPagination%5D AND Bonaldi K%2C Gherbi H%2C Franche C%2C Bastien G%2C Fardoux J%2C Barker D%2C Giraud E%2C Cartieaux F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bonaldi K, Gherbi H, Franche C, Bastien G, Fardoux J, Barker D, Giraud E, Cartieaux F (2010) The Nod factor-independent symbiotic signaling pathway: development of Agrobacterium rhizogenes-mediated transformation for the legume Aeschynomene indica. Mol Plant Microbe Interact 23: 1537-44.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bonaldi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Nod factor-independent symbiotic signaling pathway: development of Agrobacterium rhizogenes-mediated transformation for the legume Aeschynomene indica&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Nod factor-independent symbiotic signaling pathway: development of Agrobacterium rhizogenes-mediated transformation for the legume Aeschynomene indica&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bonaldi&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 21%5BVolume%5D AND 1526%5BPagination%5D AND Capoen W%2C Den Herder J%2C Sun J%2C Verplancke C%2C De Keyser A%2C De Rycke R%2C Goormachtig S%2C Oldroyd GED%2C Holsters M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Capoen W, Den Herder J, Sun J, Verplancke C, De Keyser A, De Rycke R, Goormachtig S, Oldroyd GED, Holsters M (2009) Calcium spiking patterns and the role of the calcium/calmodulin-dependent kinase CCaMK in lateral root base nodulation of Sesbania rostrata. Plant Cell 21: 1526-40.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Capoen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium spiking patterns and the role of the calcium/calmodulin-dependent kinase CCaMK in lateral root base nodulation of Sesbania rostrata&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium spiking patterns and the role of the calcium/calmodulin-dependent kinase CCaMK in lateral root base nodulation of Sesbania rostrata&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Capoen&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 102%5BVolume%5D AND 10369%5BPagination%5D AND Capoen W%2C Goormachtig S%2C De Rycke R%2C Schroeyers K%2C Holsters M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Capoen W, Goormachtig S, De Rycke R, Schroeyers K, Holsters M (2005) SrSymRK, a plant receptor essential for symbiosome formation. Proc Natl Acad Sci U S A 102: 10369-74.


http://scholar.google.com/scholar?as_q=SrSymRK, a plant receptor essential for symbiosome formation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SrSymRK, a plant receptor essential for symbiosome formation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Capoen&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 186%5BVolume%5D AND 340%5BPagination%5D AND Capoen W%2C Oldroyd GED%2C Goormachtig S%2C Holsters M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Capoen W, Oldroyd GED, Goormachtig S, Holsters M (2010) Sesbania rostrata: a case study of natural variation in legume nodulation. New Phytol 186: 340-5.


http://scholar.google.com/scholar?as_q=Sesbania rostrata: a case study of natural variation in legume nodulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Sesbania rostrata: a case study of natural variation in legume nodulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Capoen&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 12%5BVolume%5D AND 1647%5BPagination%5D AND Catoira R%2C Galera C%2C de Billy F%2C Penmetsa R V%2C Journet E%2DP%2C Maillet F%2C Rosenberg C%2C Cook DR%2C Gough C%2C D�nari� J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Catoira R, Galera C, de Billy F, Penmetsa R V, Journet E-P, Maillet F, Rosenberg C, Cook DR, Gough C, D�nari� J (2000) Four genes of Medicago truncatula controlling components of a nod factor transduction pathway. Plant Cell 12: 1647-66.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Catoira&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Four genes of Medicago truncatula controlling components of a nod factor transduction pathway&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Four genes of Medicago truncatula controlling components of a nod factor transduction pathway&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Catoira&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Can J Bot%5BTitle%5D%29 AND 77%5BVolume%5D AND 1293%5BPagination%5D AND C�r�monie H%2C Debell� F%2C Fernandez MP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=C�r�monie H, Debell� F, Fernandez MP (1999) Structural and functional comparison of Frankia root hair deforming factor and rhizobia Nod factor. Can J Bot 77: 1293-1301.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=C�r�monie&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and functional comparison of Frankia root hair deforming factor and rhizobia Nod factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and functional comparison of Frankia root hair deforming factor and rhizobia Nod factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=C�r�monie&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant%2DMicrobe Interact%5BTitle%5D%29 AND 24%5BVolume%5D AND 1289%5BPagination%5D AND Doyle JJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Doyle JJ (2011) Phylogenetic Perspectives on the Origins of Nodulation. Mol Plant-Microbe Interact 24: 1289-1295.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Doyle&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phylogenetic Perspectives on the Origins of Nodulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phylogenetic Perspectives on the Origins of Nodulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Doyle&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 417%5BVolume%5D AND 962%5BPagination%5D AND Endre G%2C Kereszt A%2C Kevei Z%2C Mihacea S%2C Kal� P%2C Kiss GB%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Endre G, Kereszt A, Kevei Z, Mihacea S, Kal� P, Kiss GB (2002) A receptor kinase gene regulating symbiotic nodule development. Nature 417: 962-6.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Endre&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A receptor kinase gene regulating symbiotic nodule development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A receptor kinase gene regulating symbiotic nodule development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Endre&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Microbiol Mol Biol Rev%5BTitle%5D%29 AND 68%5BVolume%5D AND 280%5BPagination%5D AND Gage DJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gage DJ (2004) Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev 68: 280-300.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gage&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gage&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1


defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria.Proc Natl Acad Sci U S A 105: 4928-32.


Giraud E, Hannibal L, Fardoux J, Verméglio A, Dreyfus B (2000) Effect of Bradyrhizobium photosynthesis on stem nodulation ofAeschynomene sensitiva. Proc Natl Acad Sci U S A 97: 14795-800.


Giraud E, Moulin L, Vallenet D, Barbe V, Cytryn E, Avarre J-C, Jaubert M, Simon D, Cartieaux F, ... Sadowsky M (2007) Legumessymbioses: absence of Nod genes in photosynthetic bradyrhizobia. Science 316: 1307-12.


Gleason C, Chaudhuri S, Yang T, Muñoz A, Poovaiah BW, Oldroyd GED (2006) Nodulation independent of rhizobia induced by acalcium-activated kinase lacking autoinhibition. Nature 441: 1149-52.


Gonzalez-Rizzo S, Crespi M, Frugier F (2006) The Medicago truncatula CRE1 cytokinin receptor regulates lateral rootdevelopment and early symbiotic interaction with Sinorhizobium meliloti. Plant Cell 18: 2680-93.


Goormachtig S, Capoen W, James EK, Holsters M (2004) Switch from intracellular to intercellular invasion during water stress-tolerant legume nodulation. Proc Natl Acad Sci U S A 101: 6303-8.


Höfgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877-9877.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kaló P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long S, ... Oldroyd GED (2005) Nodulation signaling inlegumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308: 1786-9.


Karimi M, Inzé D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193-195.


Kouchi H, Imaizumi-Anraku H, Hayashi M, Hakoyama T, Nakagawa T, Umehara Y, Suganuma N, Kawaguchi M (2010) How many peasin a pod? Legume genes responsible for mutualistic symbioses underground. Plant Cell Physiol 51: 1381-97.


Lerouge P, Roche P, Faucher C, Maillet F, Truchet G, Promé JC, Dénarié J (1990) Symbiotic host-specificity of Rhizobium melilotiis determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature 344: 781-4.


Lévy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet E-P, Ané J-M, Lauber E, ... Debellé F (2004) A putative Ca2+ andcalmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 1361-4.


Limpens E, Franken C, Smit P, Willemse J, Bisseling T, Geurts R (2003) LysM domain receptor kinases regulating rhizobial Nodfactor-induced infection. Science 302: 630-3.


Madsen LH, Tirichine L, Jurkiewicz A, Sullivan JT, Heckmann AB, Bek AS, Ronson CW, James EK, Stougaard J (2010) Themolecular network governing nodule organogenesis and infection in the model legume Lotus japonicus. Nat Commun 1: 1-12.

Pubmed: Author and Title www.plantphysiol.orgon March 18, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 105%5BVolume%5D AND 4928%5BPagination%5D AND Gherbi H%2C Markmann K%2C Svistoonoff S%2C Estevan J%2C Autran D%2C Giczey G%2C Auguy F%2C P�ret B%2C Laplaze L%2C %2E%2E%2E Bogusz D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gherbi H, Markmann K, Svistoonoff S, Estevan J, Autran D, Giczey G, Auguy F, P�ret B, Laplaze L, ... Bogusz D (2008) SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria. Proc Natl Acad Sci U S A 105: 4928-32.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gherbi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankiabacteria&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gherbi&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 97%5BVolume%5D AND 14795%5BPagination%5D AND Giraud E%2C Hannibal L%2C Fardoux J%2C Verm�glio A%2C Dreyfus B%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Giraud E, Hannibal L, Fardoux J, Verm�glio A, Dreyfus B (2000) Effect of Bradyrhizobium photosynthesis on stem nodulation of Aeschynomene sensitiva. Proc Natl Acad Sci U S A 97: 14795-800.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Giraud&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of Bradyrhizobium photosynthesis on stem nodulation of Aeschynomene sensitiva&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of Bradyrhizobium photosynthesis on stem nodulation of Aeschynomene sensitiva&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Giraud&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 316%5BVolume%5D AND 1307%5BPagination%5D AND Giraud E%2C Moulin L%2C Vallenet D%2C Barbe V%2C Cytryn E%2C Avarre J%2DC%2C Jaubert M%2C Simon D%2C Cartieaux F%2C %2E%2E%2E Sadowsky M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Giraud E, Moulin L, Vallenet D, Barbe V, Cytryn E, Avarre J-C, Jaubert M, Simon D, Cartieaux F, ... Sadowsky M (2007) Legumes symbioses: absence of Nod genes in photosynthetic bradyrhizobia. Science 316: 1307-12.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Giraud&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Legumes symbioses: absence of Nod genes in photosynthetic bradyrhizobia&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Legumes symbioses: absence of Nod genes in photosynthetic bradyrhizobia&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Giraud&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 441%5BVolume%5D AND 1149%5BPagination%5D AND Gleason C%2C Chaudhuri S%2C Yang T%2C Mu�oz A%2C Poovaiah BW%2C Oldroyd GED%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gleason C, Chaudhuri S, Yang T, Mu�oz A, Poovaiah BW, Oldroyd GED (2006) Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition. Nature 441: 1149-52.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gleason&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gleason&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 18%5BVolume%5D AND 2680%5BPagination%5D AND Gonzalez%2DRizzo S%2C Crespi M%2C Frugier F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gonzalez-Rizzo S, Crespi M, Frugier F (2006) The Medicago truncatula CRE1 cytokinin receptor regulates lateral root development and early symbiotic interaction with Sinorhizobium meliloti. Plant Cell 18: 2680-93.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gonzalez-Rizzo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Medicago truncatula CRE1 cytokinin receptor regulates lateral root development and early symbiotic interaction with Sinorhizobium meliloti&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Medicago truncatula CRE1 cytokinin receptor regulates lateral root development and early symbiotic interaction with Sinorhizobium meliloti&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gonzalez-Rizzo&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 101%5BVolume%5D AND 6303%5BPagination%5D AND Goormachtig S%2C Capoen W%2C James EK%2C Holsters M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Goormachtig S, Capoen W, James EK, Holsters M (2004) Switch from intracellular to intercellular invasion during water stress-tolerant legume nodulation. Proc Natl Acad Sci U S A 101: 6303-8.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goormachtig&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Switch from intracellular to intercellular invasion during water stress-tolerant legume nodulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Switch from intracellular to intercellular invasion during water stress-tolerant legume nodulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goormachtig&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nucleic Acids Res%5BTitle%5D%29 AND 16%5BVolume%5D AND 9877%5BPagination%5D AND H�fgen R%2C Willmitzer L%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=H�fgen R, Willmitzer L (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res 16: 9877-9877.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=H�fgen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Storage of competent cells for Agrobacterium transformation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Storage of competent cells for Agrobacterium transformation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=H�fgen&as_ylo=1988&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nodulation%5BTitle%5D%29 AND 2%5BVolume%5D AND a member of the GRAS family of transcriptional regulators%2E Science 308%3A 1786%5BPagination%5D AND Kal� P%2C Gleason C%2C Edwards A%2C Marsh J%2C Mitra RM%2C Hirsch S%2C Jakab J%2C Sims S%2C Long S%2C %2E%2E%2E Oldroyd GED%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kal� P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long S, ... Oldroyd GED (2005) Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308: 1786-9.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kal�&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kal�&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 7%5BVolume%5D AND 193%5BPagination%5D AND Karimi M%2C Inz� D%2C Depicker A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Karimi M, Inz� D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193-195.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karimi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=GATEWAY vectors for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=GATEWAY vectors for Agrobacterium-mediated plant transformation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karimi&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Legume genes responsible for mutualistic symbioses underground%2E Plant Cell Physiol%5BTitle%5D%29 AND 51%5BVolume%5D AND 1381%5BPagination%5D AND Kouchi H%2C Imaizumi%2DAnraku H%2C Hayashi M%2C Hakoyama T%2C Nakagawa T%2C Umehara Y%2C Suganuma N%2C Kawaguchi M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kouchi H, Imaizumi-Anraku H, Hayashi M, Hakoyama T, Nakagawa T, Umehara Y, Suganuma N, Kawaguchi M (2010) How many peas in a pod? Legume genes responsible for mutualistic symbioses underground. Plant Cell Physiol 51: 1381-97.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kouchi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=How many peas in a pod&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=How many peas in a pod&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kouchi&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 344%5BVolume%5D AND 781%5BPagination%5D AND Lerouge P%2C Roche P%2C Faucher C%2C Maillet F%2C Truchet G%2C Prom� JC%2C D�nari� J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lerouge P, Roche P, Faucher C, Maillet F, Truchet G, Prom� JC, D�nari� J (1990) Symbiotic host-specificity of Rhizobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature 344: 781-4.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lerouge&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Symbiotic host-specificity of Rhizobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Symbiotic host-specificity of Rhizobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lerouge&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 303%5BVolume%5D AND 1361%5BPagination%5D AND L�vy J%2C Bres C%2C Geurts R%2C Chalhoub B%2C Kulikova O%2C Duc G%2C Journet E%2DP%2C An� J%2DM%2C Lauber E%2C %2E%2E%2E Debell� F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=L�vy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet E-P, An� J-M, Lauber E, ... Debell� F (2004) A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 1361-4.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=L�vy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=L�vy&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 302%5BVolume%5D AND 630%5BPagination%5D AND Limpens E%2C Franken C%2C Smit P%2C Willemse J%2C Bisseling T%2C Geurts R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Limpens E, Franken C, Smit P, Willemse J, Bisseling T, Geurts R (2003) LysM domain receptor kinases regulating rhizobial Nod factor-induced infection. Science 302: 630-3.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Limpens&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=LysM domain receptor kinases regulating rhizobial Nod factor-induced infection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=LysM domain receptor kinases regulating rhizobial Nod factor-induced infection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Limpens&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Commun%5BTitle%5D%29 AND 1%5BVolume%5D AND 1%5BPagination%5D AND Madsen LH%2C Tirichine L%2C Jurkiewicz A%2C Sullivan JT%2C Heckmann AB%2C Bek AS%2C Ronson CW%2C James EK%2C Stougaard J%5BAuthor%5D&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Maillet F, Poinsot V, André O, Puech-Pagès V, Haouy A, Gueunier M, Cromer L, Giraudet D, Formey D, ... Dénarié J (2011) Fungallipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza. Nature 469: 58-63.


Markmann K, Giczey G, Parniske M (2008) Functional adaptation of a plant receptor-kinase paved the way for the evolution ofintracellular root symbioses with bacteria. PLoS Biol 6: e68.


Markmann K, Parniske M (2009) Evolution of root endosymbiosis with bacteria: How novel are nodules? Trends Plant Sci 14: 77-86.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mendel RR, Miiuer B, Schuize J, Kolesnikov V, Zelenin A (1989) Delivery of foreign genes to intact barley cells by high-velocitymicroprojectiles. Theor Appl Genet 78: 31-34.


Messinese E, Mun J-H, Yeun LH, Jayaraman D, Rougé P, Barre A, Lougnon G, Schornack S, Bono J-J, ... Ané J-M (2007) A novelnuclear protein interacts with the symbiotic DMI3 calcium- and calmodulin-dependent protein kinase of Medicago truncatula. MolPlant Microbe Interact 20: 912-21.


Miller JB, Pratap A, Miyahara A, Zhou L, Bornemann S, Morris RJ, Oldroyd GED (2013) Calcium/Calmodulin-Dependent ProteinKinase Is Negatively and Positively Regulated by Calcium, Providing a Mechanism for Decoding Calcium Responses duringSymbiosis Signaling. Plant Cell 25: 5053-5066.


Mitra RM, Gleason C a, Edwards A, Hadfield J, Downie JA, Oldroyd GED, Long SR (2004) A Ca2+/calmodulin-dependent proteinkinase required for symbiotic nodule development: Gene identification by transcript-based cloning. Proc Natl Acad Sci U S A 101:4701-5.


Miyata K, Kozaki T, Kouzai Y, Ozawa K, Ishii K, Asamizu E, Okabe Y, Umehara Y, Miyamoto A, ... Nakagawa T (2014) Bifunctionalplant receptor, OsCERK1, regulates both chitin-triggered immunity and arbuscular mycorrhizal symbiosis in rice. Plant Cell Physiol55: 1864-72.


Molouba F, Lorquin J, Willems A, Hoste B, Giraud E, Dreyfus B, Gillis M, de Lajudie P, Masson-Boivin C. (1999) Photosyntheticbradyrhizobia from Aeschynomene spp. are specific to stem-nodulated species and form a separate 16S ribosomal DNA restrictionfragment length polymorphism group. Appl Environ Microbiol 65: 3084-94.


Murray JD, Karas BJ, Sato S, Tabata S, Amyot L, Szczyglowski K (2007) A cytokinin perception mutant colonized by Rhizobium inthe absence of nodule organogenesis. Science 315: 101-4.


Ndoye I, de Billy F, Vasse J, Dreyfus B, Truchet G (1994) Root nodulation of Sesbania rostrata. J Bacteriol 176: 1060-8.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Normand P, Lapierre P, Tisa LS, Gogarten JP, Alloisio N, Bagnarol E, Bassi CA, Berry AM, Bickhart DM, ... Benson DR (2007)Genome characteristics of facultatively symbiotic Frankia sp. strains reflect host range and host plant biogeography. Genome Res17: 7-15.


Oldroyd GED, Downie JA (2006) Nuclear calcium changes at the core of symbiosis signalling. Curr Opin Plant Biol 9: 351-7. www.plantphysiol.orgon March 18, 2018 - Published by Downloaded from


http://search.crossref.org/?page=1&rows=2&q=Madsen LH, Tirichine L, Jurkiewicz A, Sullivan JT, Heckmann AB, Bek AS, Ronson CW, James EK, Stougaard J (2010) The molecular network governing nodule organogenesis and infection in the model legume Lotus japonicus. Nat Commun 1: 1-12.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Madsen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular network governing nodule organogenesis and infection in the model legume Lotus japonicus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular network governing nodule organogenesis and infection in the model legume Lotus japonicus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Madsen&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 469%5BVolume%5D AND 58%5BPagination%5D AND Maillet F%2C Poinsot V%2C Andr� O%2C Puech%2DPag�s V%2C Haouy A%2C Gueunier M%2C Cromer L%2C Giraudet D%2C Formey D%2C %2E%2E%2E D�nari� J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Maillet F, Poinsot V, Andr� O, Puech-Pag�s V, Haouy A, Gueunier M, Cromer L, Giraudet D, Formey D, ... D�nari� J (2011) Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza. Nature 469: 58-63.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Maillet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fungal lipochitooligosaccharide symbiotic signals in arbuscular mycorrhiza&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Maillet&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLoS Biol%5BTitle%5D%29 AND 6%5BVolume%5D AND 68%5BPagination%5D AND Markmann K%2C Giczey G%2C Parniske M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Markmann K, Giczey G, Parniske M (2008) Functional adaptation of a plant receptor-kinase paved the way for the evolution of intracellular root symbioses with bacteria. PLoS Biol 6: e68.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Markmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional adaptation of a plant receptor-kinase paved the way for the evolution of intracellular root symbioses with bacteria&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional adaptation of a plant receptor-kinase paved the way for the evolution of intracellular root symbioses with bacteria&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Markmann&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 14%5BVolume%5D AND 77%5BPagination%5D AND Markmann K%2C Parniske M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Markmann K, Parniske M (2009) Evolution of root endosymbiosis with bacteria: How novel are nodules? Trends Plant Sci 14: 77-86.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Markmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evolution of root endosymbiosis with bacteria: How novel are nodules&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evolution of root endosymbiosis with bacteria: How novel are nodules&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Markmann&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Theor Appl Genet%5BTitle%5D%29 AND 78%5BVolume%5D AND 31%5BPagination%5D AND Mendel RR%2C Miiuer B%2C Schuize J%2C Kolesnikov V%2C Zelenin A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mendel RR, Miiuer B, Schuize J, Kolesnikov V, Zelenin A (1989) Delivery of foreign genes to intact barley cells by high-velocity microprojectiles. Theor Appl Genet 78: 31-34.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mendel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Delivery of foreign genes to intact barley cells by high-velocity microprojectiles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Delivery of foreign genes to intact barley cells by high-velocity microprojectiles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mendel&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 20%5BVolume%5D AND 912%5BPagination%5D AND Messinese E%2C Mun J%2DH%2C Yeun LH%2C Jayaraman D%2C Roug� P%2C Barre A%2C Lougnon G%2C Schornack S%2C Bono J%2DJ%2C %2E%2E%2E An� J%2DM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Messinese E, Mun J-H, Yeun LH, Jayaraman D, Roug� P, Barre A, Lougnon G, Schornack S, Bono J-J, ... An� J-M (2007) A novel nuclear protein interacts with the symbiotic DMI3 calcium- and calmodulin-dependent protein kinase of Medicago truncatula. Mol Plant Microbe Interact 20: 912-21.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Messinese&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel nuclear protein interacts with the symbiotic DMI3 calcium- and calmodulin-dependent protein kinase of Medicago truncatula&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel nuclear protein interacts with the symbiotic DMI3 calcium- and calmodulin-dependent protein kinase of Medicago truncatula&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Messinese&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 25%5BVolume%5D AND 5053%5BPagination%5D AND Miller JB%2C Pratap A%2C Miyahara A%2C Zhou L%2C Bornemann S%2C Morris RJ%2C Oldroyd GED%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Miller JB, Pratap A, Miyahara A, Zhou L, Bornemann S, Morris RJ, Oldroyd GED (2013) Calcium/Calmodulin-Dependent Protein Kinase Is Negatively and Positively Regulated by Calcium, Providing a Mechanism for Decoding Calcium Responses during Symbiosis Signaling. Plant Cell 25: 5053-5066.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Miller&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium/Calmodulin-Dependent Protein Kinase Is Negatively and Positively Regulated by Calcium, Providing a Mechanism for Decoding Calcium Responses during Symbiosis Signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium/Calmodulin-Dependent Protein Kinase Is Negatively and Positively Regulated by Calcium, Providing a Mechanism for Decoding Calcium Responses during Symbiosis Signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Miller&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 101%5BVolume%5D AND 4701%5BPagination%5D AND Mitra RM%2C Gleason C a%2C Edwards A%2C Hadfield J%2C Downie JA%2C Oldroyd GED%2C Long SR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mitra RM, Gleason C a, Edwards A, Hadfield J, Downie JA, Oldroyd GED, Long SR (2004) A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning. Proc Natl Acad Sci U S A 101: 4701-5.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mitra&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mitra&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Bifunctional%5BTitle%5D%29 AND 1%5BVolume%5D AND Miyata K%2C Kozaki T%2C Kouzai Y%2C Ozawa K%2C Ishii K%2C Asamizu E%2C Okabe Y%2C Umehara Y%2C Miyamoto A%2C %2E%2E%2E Nakagawa T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Miyata K, Kozaki T, Kouzai Y, Ozawa K, Ishii K, Asamizu E, Okabe Y, Umehara Y, Miyamoto A, ... Nakagawa T (2014) Bifunctional plant receptor, OsCERK1, regulates both chitin-triggered immunity and arbuscular mycorrhizal symbiosis in rice. Plant Cell Physiol 55: 1864-72.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Miyata&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Miyata&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28are specific to stem%2Dnodulated species and form a separate 16S ribosomal DNA restriction fragment length polymorphism group%2E Appl Environ Microbiol%5BTitle%5D%29 AND 65%5BVolume%5D AND 3084%5BPagination%5D AND Molouba F%2C Lorquin J%2C Willems A%2C Hoste B%2C Giraud E%2C Dreyfus B%2C Gillis M%2C de Lajudie P%2C Masson%2DBoivin C%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Molouba F, Lorquin J, Willems A, Hoste B, Giraud E, Dreyfus B, Gillis M, de Lajudie P, Masson-Boivin C. (1999) Photosynthetic bradyrhizobia from Aeschynomene spp. are specific to stem-nodulated species and form a separate 16S ribosomal DNA restriction fragment length polymorphism group. Appl Environ Microbiol 65: 3084-94.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Molouba&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthetic bradyrhizobia from Aeschynomene spp&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthetic bradyrhizobia from Aeschynomene spp&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Molouba&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 315%5BVolume%5D AND 101%5BPagination%5D AND Murray JD%2C Karas BJ%2C Sato S%2C Tabata S%2C Amyot L%2C Szczyglowski K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Murray JD, Karas BJ, Sato S, Tabata S, Amyot L, Szczyglowski K (2007) A cytokinin perception mutant colonized by Rhizobium in the absence of nodule organogenesis. Science 315: 101-4.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Murray&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A cytokinin perception mutant colonized by Rhizobium in the absence of nodule organogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A cytokinin perception mutant colonized by Rhizobium in the absence of nodule organogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Murray&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Bacteriol%5BTitle%5D%29 AND 176%5BVolume%5D AND 1060%5BPagination%5D AND Ndoye I%2C de Billy F%2C Vasse J%2C Dreyfus B%2C Truchet G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ndoye I, de Billy F, Vasse J, Dreyfus B, Truchet G (1994) Root nodulation of Sesbania rostrata. J Bacteriol 176: 1060-8.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ndoye&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Root nodulation of Sesbania rostrata&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Root nodulation of Sesbania rostrata&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ndoye&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28strains reflect host range and host plant biogeography%2E Genome Res%5BTitle%5D%29 AND 17%5BVolume%5D AND 7%5BPagination%5D AND Normand P%2C Lapierre P%2C Tisa LS%2C Gogarten JP%2C Alloisio N%2C Bagnarol E%2C Bassi CA%2C Berry AM%2C Bickhart DM%2C %2E%2E%2E Benson DR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Normand P, Lapierre P, Tisa LS, Gogarten JP, Alloisio N, Bagnarol E, Bassi CA, Berry AM, Bickhart DM, ... Benson DR (2007) Genome characteristics of facultatively symbiotic Frankia sp. strains reflect host range and host plant biogeography. Genome Res 17: 7-15.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Normand&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome characteristics of facultatively symbiotic Frankia sp&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome characteristics of facultatively symbiotic Frankia sp&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Normand&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1



Oldroyd GED, Murray JD, Poole PS, Downie JA (2011) The rules of engagement in the legume-rhizobial symbiosis. Annu RevGenet 45: 119-44.


Op den Camp R, Streng A, De Mita S, Cao Q, Polone E, Liu W, Ammiraju JSS, Kudrna D, Wing R, ... Geurts R (2011) LysM-typemycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia. Science 331: 909-12.


Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, Crespi M, Frugier F (2011) MtCRE1-dependent cytokinin signalingintegrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. Plant J 65: 622-633.


Podlešáková K, Fardoux J, Patrel D, Bonaldi K, Novák O, Strnad M, Giraud E, Spíchal L, Nouwen N (2013) Rhizobial synthesizedcytokinins contribute to but are not essential for the symbiotic interaction between photosynthetic Bradyrhizobia andAeschynomene legumes. Mol Plant Microbe Interact 26: 1232-8.


Quandt H-J, Pühler A, Broer I (1993) Transgenic Root Nodules of Vicia hirsuta: a fast and efficient system for the study of geneexpression in indeterminate-type nodules. Mol Plant-Microbe Interact 6: 699-706.


Radutoiu S, Madsen LH, Madsen EB, Felle HH, Umehara Y, Grønlund M, Sato S, Nakamura Y, Tabata S, ... Stougaard J (2003) Plantrecognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585-92.


Remy W, Taylor TN, Hass H, Kerp H (1994) Four hundred-million-year-old vesicular arbuscular mycorrhizae. Proc Natl Acad Sci 91:11841-11843.


Silipo A, Leone MR, Erbs G, Lanzetta R, Parrilli M, Chang W-S, Newman M-A, Molinaro A. 2011. A Unique Bicyclic Monosaccharidefrom the Bradyrhizobium Lipopolysaccharide and Its Role in the Molecular Interaction with Plants. Angew Chemie Int Ed 50: 12610-12612.


Singh S, Katzer K, Lambert J, Cerri M, Parniske M (2014) CYCLOPS, a DNA-binding transcriptional activator, orchestratessymbiotic root nodule development. Cell Host Microbe 15: 139-52.


Sinharoy S, DasGupta M (2009) RNA interference highlights the role of CCaMK in dissemination of endosymbionts in theAeschynomeneae legume Arachis. Mol Plant Microbe Interact 22: 1466-75.


Smit P, Limpens E, Geurts R, Fedorova E, Dolgikh E, Gough C, Bisseling T (2007) Medicago LYK3, an entry receptor in rhizobialnodulation factor signaling. Plant Physiol 145: 183-91.


Smit P, Raedts J, Portyanko V, Debellé F, Gough C, Bisseling T, Geurts R (2005) NSP1 of the GRAS protein family is essential forrhizobial Nod factor-induced transcription. Science 308: 1789-91.

Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon March 18, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr Opin Plant Biol%5BTitle%5D%29 AND 9%5BVolume%5D AND 351%5BPagination%5D AND Oldroyd GED%2C Downie JA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Oldroyd GED, Downie JA (2006) Nuclear calcium changes at the core of symbiosis signalling. Curr Opin Plant Biol 9: 351-7.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oldroyd&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear calcium changes at the core of symbiosis signalling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear calcium changes at the core of symbiosis signalling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oldroyd&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu Rev Genet%5BTitle%5D%29 AND 45%5BVolume%5D AND 119%5BPagination%5D AND Oldroyd GED%2C Murray JD%2C Poole PS%2C Downie JA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Oldroyd GED, Murray JD, Poole PS, Downie JA (2011) The rules of engagement in the legume-rhizobial symbiosis. Annu Rev Genet 45: 119-44.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oldroyd&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The rules of engagement in the legume-rhizobial symbiosis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The rules of engagement in the legume-rhizobial symbiosis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oldroyd&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 331%5BVolume%5D AND 909%5BPagination%5D AND Op den Camp R%2C Streng A%2C De Mita S%2C Cao Q%2C Polone E%2C Liu W%2C Ammiraju JSS%2C Kudrna D%2C Wing R%2C %2E%2E%2E Geurts R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Op den Camp R, Streng A, De Mita S, Cao Q, Polone E, Liu W, Ammiraju JSS, Kudrna D, Wing R, ... Geurts R (2011) LysM-type mycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia. Science 331: 909-12.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Op&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=LysM-type mycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=LysM-type mycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Op&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nucleic Acids Res%5BTitle%5D%29 AND 29%5BVolume%5D AND 45%5BPagination%5D AND Pfaffl MW%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pfaffl&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new mathematical model for relative quantification in real-time RT-PCR&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new mathematical model for relative quantification in real-time RT-PCR&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pfaffl&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 65%5BVolume%5D AND 622%5BPagination%5D AND Plet J%2C Wasson A%2C Ariel F%2C Le Signor C%2C Baker D%2C Mathesius U%2C Crespi M%2C Frugier F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, Crespi M, Frugier F (2011) MtCRE1-dependent cytokinin signaling integrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. Plant J 65: 622-633.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Plet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MtCRE1-dependent cytokinin signaling integrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MtCRE1-dependent cytokinin signaling integrates bacterial and plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Plet&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 26%5BVolume%5D AND 1232%5BPagination%5D AND Podle?�kov� K%2C Fardoux J%2C Patrel D%2C Bonaldi K%2C Nov�k O%2C Strnad M%2C Giraud E%2C Sp�chal L%2C Nouwen N%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Podle?�kov� K, Fardoux J, Patrel D, Bonaldi K, Nov�k O, Strnad M, Giraud E, Sp�chal L, Nouwen N (2013) Rhizobial synthesized cytokinins contribute to but are not essential for the symbiotic interaction between photosynthetic Bradyrhizobia and Aeschynomene legumes. Mol Plant Microbe Interact 26: 1232-8.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Podle?�kov�&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rhizobial synthesized cytokinins contribute to but are not essential for the symbiotic interaction between photosynthetic Bradyrhizobia and Aeschynomene legumes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rhizobial synthesized cytokinins contribute to but are not essential for the symbiotic interaction between photosynthetic Bradyrhizobia and Aeschynomene legumes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Podle?�kov�&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant%2DMicrobe Interact%5BTitle%5D%29 AND 6%5BVolume%5D AND 699%5BPagination%5D AND Quandt H%2DJ%2C P�hler A%2C Broer I%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Quandt H-J, P�hler A, Broer I (1993) Transgenic Root Nodules of Vicia hirsuta: a fast and efficient system for the study of gene expression in indeterminate-type nodules. Mol Plant-Microbe Interact 6: 699-706.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Quandt&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transgenic Root Nodules of Vicia hirsuta: a fast and efficient system for the study of gene expression in indeterminate-type nodules&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transgenic Root Nodules of Vicia hirsuta: a fast and efficient system for the study of gene expression in indeterminate-type nodules&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Quandt&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 425%5BVolume%5D AND 585%5BPagination%5D AND Radutoiu S%2C Madsen LH%2C Madsen EB%2C Felle HH%2C Umehara Y%2C Gr�nlund M%2C Sato S%2C Nakamura Y%2C Tabata S%2C %2E%2E%2E Stougaard J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Radutoiu S, Madsen LH, Madsen EB, Felle HH, Umehara Y, Gr�nlund M, Sato S, Nakamura Y, Tabata S, ... Stougaard J (2003) Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585-92.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Radutoiu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Radutoiu&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci%5BTitle%5D%29 AND 91%5BVolume%5D AND 11841%5BPagination%5D AND Remy W%2C Taylor TN%2C Hass H%2C Kerp H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Remy W, Taylor TN, Hass H, Kerp H (1994) Four hundred-million-year-old vesicular arbuscular mycorrhizae. Proc Natl Acad Sci 91: 11841-11843.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Remy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Four hundred-million-year-old vesicular arbuscular mycorrhizae&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Four hundred-million-year-old vesicular arbuscular mycorrhizae&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Remy&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Angew Chemie Int Ed%5BTitle%5D%29 AND 50%5BVolume%5D AND 12610%5BPagination%5D AND Silipo A%2C Leone MR%2C Erbs G%2C Lanzetta R%2C Parrilli M%2C Chang W%2DS%2C Newman M%2DA%2C Molinaro A%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Silipo A, Leone MR, Erbs G, Lanzetta R, Parrilli M, Chang W-S, Newman M-A, Molinaro A. 2011. A Unique Bicyclic Monosaccharide from the Bradyrhizobium Lipopolysaccharide and Its Role in the Molecular Interaction with Plants. Angew Chemie Int Ed 50: 12610-12612.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Silipo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Unique Bicyclic Monosaccharide from the Bradyrhizobium Lipopolysaccharide and Its Role in the Molecular Interaction with Plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Unique Bicyclic Monosaccharide from the Bradyrhizobium Lipopolysaccharide and Its Role in the Molecular Interaction with Plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Silipo&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell Host Microbe%5BTitle%5D%29 AND 15%5BVolume%5D AND 139%5BPagination%5D AND Singh S%2C Katzer K%2C Lambert J%2C Cerri M%2C Parniske M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Singh S, Katzer K, Lambert J, Cerri M, Parniske M (2014) CYCLOPS, a DNA-binding transcriptional activator, orchestrates symbiotic root nodule development. Cell Host Microbe 15: 139-52.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Singh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=CYCLOPS, a DNA-binding transcriptional activator, orchestrates symbiotic root nodule development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=CYCLOPS, a DNA-binding transcriptional activator, orchestrates symbiotic root nodule development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Singh&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Microbe Interact%5BTitle%5D%29 AND 22%5BVolume%5D AND 1466%5BPagination%5D AND Sinharoy S%2C DasGupta M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sinharoy S, DasGupta M (2009) RNA interference highlights the role of CCaMK in dissemination of endosymbionts in the Aeschynomeneae legume Arachis. Mol Plant Microbe Interact 22: 1466-75.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sinharoy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=RNA interference highlights the role of CCaMK in dissemination of endosymbionts in the Aeschynomeneae legume Arachis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=RNA interference highlights the role of CCaMK in dissemination of endosymbionts in the Aeschynomeneae legume Arachis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sinharoy&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Medicago%5BTitle%5D%29 AND 3%5BVolume%5D AND an entry receptor in rhizobial nodulation factor signaling%2E Plant Physiol 145%3A 183%5BPagination%5D AND Smit P%2C Limpens E%2C Geurts R%2C Fedorova E%2C Dolgikh E%2C Gough C%2C Bisseling T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Smit P, Limpens E, Geurts R, Fedorova E, Dolgikh E, Gough C, Bisseling T (2007) Medicago LYK3, an entry receptor in rhizobial nodulation factor signaling. Plant Physiol 145: 183-91.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Smit&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Smit&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 308%5BVolume%5D AND 1789%5BPagination%5D AND Smit P%2C Raedts J%2C Portyanko V%2C Debell� F%2C Gough C%2C Bisseling T%2C Geurts R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Smit P, Raedts J, Portyanko V, Debell� F, Gough C, Bisseling T, Geurts R (2005) NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science 308: 1789-91.


Google Scholar: Author Only Title Only Author and Title

Sprent JI (2007) Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation. NewPhytol 174: 11-25.


Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, ... Parniske M (2002) A plantreceptor-like kinase required for both bacterial and fungal symbiosis. Nature 417: 959-62.


Svistoonoff S, Benabdoun FM, Nambiar-Veetil M, Imanishi L, Vaissayre V, Cesari S, Diagne N, Hocher V, de Billy F, ... Gherbi H(2013) The Independent Acquisition of Plant Root Nitrogen-Fixing Symbiosis in Fabids Recruited the Same Genetic Pathway forNodule Organogenesis. PLoS One 8: e64515.


Takeda N, Maekawa T, Hayashi M (2012) Nuclear-localized and deregulated calcium- and calmodulin-dependent protein kinaseactivates rhizobial and mycorrhizal responses in Lotus japonicus. Plant Cell 24: 810-22.


Tirichine L, Imaizumi-Anraku H, Yoshida S, Murakami Y, Madsen LH, Miwa H, Nakagawa T, Sandal N, Albrektsen AS, ... Stougaard J(2006) Deregulation of a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule development. Nature 441: 1153-1156.


Tirichine L, Sandal N, Madsen LH, Radutoiu S, Albrektsen AS, Sato S, Asamizu E, Tabata S, Stougaard J (2007) A gain-of-functionmutation in a cytokinin receptor triggers spontaneous root nodule organogenesis. Science 315: 104-7.


Yano K, Yoshida S, Müller J, Singh S, Banba M, Vickers K, Markmann K, White C, Schuller B, ... Parniske M (2008) CYCLOPS, amediator of symbiotic intracellular accommodation. Proc Natl Acad Sci U S A 105: 20540-5.



http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Smit&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Smit&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 174%5BVolume%5D AND 11%5BPagination%5D AND Sprent JI%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sprent JI (2007) Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation. New Phytol 174: 11-25.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sprent&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sprent&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 417%5BVolume%5D AND 959%5BPagination%5D AND Stracke S%2C Kistner C%2C Yoshida S%2C Mulder L%2C Sato S%2C Kaneko T%2C Tabata S%2C Sandal N%2C Stougaard J%2C %2E%2E%2E Parniske M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, ... Parniske M (2002) A plant receptor-like kinase required for both bacterial and fungal symbiosis. Nature 417: 959-62.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stracke&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A plant receptor-like kinase required for both bacterial and fungal symbiosis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A plant receptor-like kinase required for both bacterial and fungal symbiosis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stracke&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLoS One%5BTitle%5D%29 AND 8%5BVolume%5D AND 64515%5BPagination%5D AND Svistoonoff S%2C Benabdoun FM%2C Nambiar%2DVeetil M%2C Imanishi L%2C Vaissayre V%2C Cesari S%2C Diagne N%2C Hocher V%2C de Billy F%2C %2E%2E%2E Gherbi H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Svistoonoff S, Benabdoun FM, Nambiar-Veetil M, Imanishi L, Vaissayre V, Cesari S, Diagne N, Hocher V, de Billy F, ... Gherbi H (2013) The Independent Acquisition of Plant Root Nitrogen-Fixing Symbiosis in Fabids Recruited the Same Genetic Pathway for Nodule Organogenesis. PLoS One 8: e64515.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Svistoonoff&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Independent Acquisition of Plant Root Nitrogen-Fixing Symbiosis in Fabids Recruited the Same Genetic Pathway for Nodule Organogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Independent Acquisition of Plant Root Nitrogen-Fixing Symbiosis in Fabids Recruited the Same Genetic Pathway for Nodule Organogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Svistoonoff&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 810%5BPagination%5D AND Takeda N%2C Maekawa T%2C Hayashi M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Takeda N, Maekawa T, Hayashi M (2012) Nuclear-localized and deregulated calcium- and calmodulin-dependent protein kinase activates rhizobial and mycorrhizal responses in Lotus japonicus. Plant Cell 24: 810-22.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Takeda&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear-localized and deregulated calcium- and calmodulin-dependent protein kinase activates rhizobial and mycorrhizal responses in Lotus japonicus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear-localized and deregulated calcium- and calmodulin-dependent protein kinase activates rhizobial and mycorrhizal responses in Lotus japonicus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takeda&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 441%5BVolume%5D AND 1153%5BPagination%5D AND Tirichine L%2C Imaizumi%2DAnraku H%2C Yoshida S%2C Murakami Y%2C Madsen LH%2C Miwa H%2C Nakagawa T%2C Sandal N%2C Albrektsen AS%2C %2E%2E%2E Stougaard J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tirichine L, Imaizumi-Anraku H, Yoshida S, Murakami Y, Madsen LH, Miwa H, Nakagawa T, Sandal N, Albrektsen AS, ... Stougaard J (2006) Deregulation of a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule development. Nature 441: 1153-1156.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tirichine&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Deregulation of a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Deregulation of a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tirichine&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 315%5BVolume%5D AND 104%5BPagination%5D AND Tirichine L%2C Sandal N%2C Madsen LH%2C Radutoiu S%2C Albrektsen AS%2C Sato S%2C Asamizu E%2C Tabata S%2C Stougaard J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tirichine L, Sandal N, Madsen LH, Radutoiu S, Albrektsen AS, Sato S, Asamizu E, Tabata S, Stougaard J (2007) A gain-of-function mutation in a cytokinin receptor triggers spontaneous root nodule organogenesis. Science 315: 104-7.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tirichine&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A gain-of-function mutation in a cytokinin receptor triggers spontaneous root nodule organogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A gain-of-function mutation in a cytokinin receptor triggers spontaneous root nodule organogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tirichine&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 105%5BVolume%5D AND 20540%5BPagination%5D AND Yano K%2C Yoshida S%2C M�ller J%2C Singh S%2C Banba M%2C Vickers K%2C Markmann K%2C White C%2C Schuller B%2C %2E%2E%2E Parniske M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yano K, Yoshida S, M�ller J, Singh S, Banba M, Vickers K, Markmann K, White C, Schuller B, ... Parniske M (2008) CYCLOPS, a mediator of symbiotic intracellular accommodation. Proc Natl Acad Sci U S A 105: 20540-5.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yano&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=CYCLOPS, a mediator of symbiotic intracellular accommodation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=CYCLOPS, a mediator of symbiotic intracellular accommodation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yano&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


Documents

1 Running head: Symbiosis Pathway in Aeschynomene 1 Fabienne