Trypanosoma rangeli and Trypanosoma cruzi: Molecular Characterizationof Genes Encoding Putative Calcium-Binding Proteins, Highly Conserved

in Trypanosomatids1

BETINA M. PORCEL,* ESTEBAN J. BONTEMPI,* JAN HENRIKSSON,† MARIA RYDÅKER,†LENA ÅSLUND,† ELSA L. SEGURA,* ULF PETTERSSON,† AND ANDRESM. RUIZ* ,2

*Instituto Nacional de Chagas, Ministerio de Salud y Accio´n Social, Avenida Paseo Colo´n 568, CP 1063, BuenosAires, Argentina; and †Department of Medical Genetics, Biomedical Center, Box 589, S-751 23 Uppsala, Sweden

PORCEL, B. M., BONTEMPI, E. J., HENRIKSSON, J., RYDÅKER, M., ÅSLUND, L., SEGURA, E. L.,PETTERSSON, U., AND RUIZ, A. M. 1996.Trypanosoma rangeliandTrypanosoma cruzi:Molecularcharacterization of genes encoding putative calcium-binding proteins, highly conserved in Trypano-somatids.Experimental Parasitology84, 387–399. Genes encoding a 29-kDa flagellar calcium-binding protein (F29) inTrypanosoma cruzi,strongly homologous to EF-hand calcium-bindingprotein-encoding genes previously reported in this parasite, were isolated by immunoscreening. F29is encoded by a number of very similar genes, highly conserved among differentT. cruziisolates. Thegenes are located on a pair of homologous chromosomes, arranged in one or two clusters of tandemrepeats. PCR amplification ofTrypanosoma rangeligenomic DNA, using primers derived from theT. cruzi F29 sequence made it possible to isolate the homologous gene inT. rangeli,encoding a23-kDa protein called TrCaBP. Gene sequence comparisons showed homology to EF-hand calcium-binding proteins fromT. cruzi (82.8%),Trypanosoma brucei brucei(60.2%), andEntamoeba his-tolytica (28.4%). Northern blot analysis revealed that the TrCaBP gene is expressed inT. rangeliasa polyadenylated transcript. The TrCaBP-encoding genes are present in at least 20 copies per cell,organized in tandem arrays, on largeT. rangelichromosomes in some isolates and on two smallerones in others. This gene, however, seems to be absent fromLeishmania. © 1996 Academic Press, Inc.

INDEX DESCRIPTORS ANDABBREVIATIONS: Trypanosoma rangeli; Trypanosoma cruzi; Trypano-soma brucei brucei; Trypanosoma lewisi; Leishmania brasiliensis brasiliensis; Entamoeba histo-lytica; Crithidia oncopelti; EF-hand calcium-binding proteins (CaBP); 29-kDa flagellar putativecalcium-binding protein (F29); calflagins; pulsed-field gel electrophoresis (PFGE); zymodeme; iso-enzyme classification; Tris–borate EDTA (TBE); sodium dodecyl sulfate (SDS); saline sodiumcitrate (SSC); kilobasepairs (kb); megabasepairs (Mb).

INTRODUCTION

Parasitic diseases caused by protozoans areimportant medical problems. Among the Try-panosomida species, African trypanosomes ofthe brucei group cause lethal infections in hu-mans. In America, the two species of trypano-somes with major incidence and medical impor-tance areTrypanosoma cruzi,the ethiologicalagent of Chagas disease, andTrypanosoma ran-geli,which can infect man without being patho-genic. In the genusLeishmania,a similar situ-

ation is seen, with a wide range of clinical formsof leishmaniasis, which seem to be related tocertain species of the parasite.Current evidence indicates that calcium may

play an important regulatory role in trypanoso-matids, including involvement in coordinationof life-cycle events (Rubenet al.1990; Scheibelet al. 1992; Wuet al. 1994). Recent observa-tions showed that, in addition to an increase inintracellular calcium in the host cell (Tardieuxet al. 1994), a cytosolic-free calcium elevationin infective forms is required for cell invasion ofT. cruzi (Morenoet al. 1994).Some calcium-modulated proteins have been

detected in the flagellum of trypanosomes (Ru-benet al.1987; Paindavoineet al.1992; Oguetaet al. 1994), suggesting a possible role for cal-

1 The sequence data reported herein have been submittedto EMBLBank and assigned Accession nos. Z54192 andZ54193.

2 To whom correspondence and reprint requests shouldbe addressed. Fax: (54-1) 3317142.

EXPERIMENTAL PARASITOLOGY84, 387–399 (1996)ARTICLE NO. 0127

3870014-4894/96 $18.00Copyright © 1996 by Academic Press, Inc.All rights of reproduction in any form reserved.

cium in flagellar bending during cell motility.However, the flagellar proteins which contrib-ute to the rapid motility in trypanosomes haveyet not been identified.Most of the calcium-binding proteins de-

scribed in different eukaryotes contain two toeight copies of EF-hand or calmodulin fold cal-cium-binding motifs. These canonical domainsconsist of 29 amino acids arranged in a helix–loop–helix conformation and in which the func-tionally important amino acids involved in thecalcium coordination are highly conservedamong all calcium-modulated proteins reported(Moncrief et al. 1990).Gene sequences related to EF-hand calcium-

binding proteins have been identified inT.cruzi, Trypanosoma lewisi,and Trypanosomabrucei brucei(Gonzalezet al.1985; Engmanetal. 1989; Ouaissiet al. 1992; Barthelet al.,personal communication; Leeet al. 1990; Wuet al. 1994). Comparisons of these EF-handcalcium-modulated protein-encoding genesshowed a strong conservation in trypanosomes.This, together with the flagellar location andpotential ability to bind Ca2+, suggests thatthese calflagins are involved in Ca2+-dependentprocesses of motility such as ATP hydrolysis,which operates under Ca2+ control. Moreover,the high conservation of EF-hand calcium-binding proteins supports the idea that thesecell-surface calflagins may have a commonfunction in trypanosomatids in general cellularprocesses, such as cell movement or Ca2+ trans-port.In order to further examine the conservation

of these calcium-modulated proteins among try-panosomatids, we studied their presence and ge-nomic organization in other trypanosomes. Inthe present study, we report the cloning andsequencing of several members of a gene familyencoding a highly conserved putative flagellarEF-hand calcium-binding protein inT. cruziandT. rangeli.

MATERIALS AND METHODS

Parasites. T. cruziepimastigotes of different isolates andcloned stocks (Henrikssonet al. 1993, and referencestherein),Leishmania brasiliensis brasiliensisandT. rangeli

human isolates LDG and J-2, andRhodnius prolixusisolatesEv26 and UB66, kindly provided by Dr. Aldo Solari, Uni-versidad de Chile, Santiago, Chile, were used in this study.Epimastigotes from both parasites were grown and har-vested as previously described (Henrikssonet al. 1993;Tanakaet al. 1994). The flagellar fraction was obtainedfrom T. cruzi epimastigotes by differential centrifugationand purification on a sucrose density gradient, as previouslydescribed (Seguraet al. 1977).Expression library screening.A Trypanosoma cruzi,Mi-

randa/76 clone, genomiclgt11 expression library wasscreened with rabbit anti-flagellar fraction polyclonal anti-bodies by immunological screening as described (Sambrooket al. 1989). Polyclonal immune sera for immunoscreeningwere obtained in rabbits, by subcutaneous injection of fla-gellar fraction preparation (1 mg/rabbit) in Freund’s com-plete adjuvant. As second and third doses, the flagellarfraction in Freund’s incomplete adjuvant was administered21 and 42 days after the first dose. One of the positiveclones, called F29 clone 1, was purified to single positiveplaques and selected for further studies. The DNA insert ofF29 clone 1 was excised byEcoRI digestion and subclonedinto pUC digested byEcoRI. The resultant plasmid (pUC-F29) was sequenced.Pulsed-field gel electrophoresis(PFGE). Samples of aga-

rose blocks containingT. cruziandT. rangeliepimastigoteDNA were prepared as described (Engmanet al. 1987).Amounts of DNA corresponding to 1–20 × 106 epimasti-gotes were loaded in each slot. PFGE of intact chromo-somes from different isolates, strains, and cloned stocks ofT. cruziandT. rangeliwere performed as described in Hen-rikssonet al. (1993). The DNA was blotted by standardtechniques (Sambrooket al. 1989) to a nylon filter (PALLBiodyne) after nicking the DNA in 0.25M HCl for 15 min.All DNA probes were32P-labeled by random priming usingthe oligolabeling kit (Pharmacia) or the Rediprime kit (Am-ersham) as described by the supplier. Hybridizations werecarried out by standard methods (Sambrooket al. 1989).Washing of the filters was performed under stringent con-ditions 0.1× SSC (1× SSC4 150 mM NaCl, 15 mM sodiumcitrate), 0.1% v/v SDS at 65°C.DNA and RNA analysis.Genomic DNA (Sambrooket al.

1989) and total RNA (Siebertet al.1993) were isolated byconventional methods. Poly(A)+ selection was performedusing oligo(dT)25 Dynabeads (Dynal A.S.).T. rangeliDNAwas totally or partially digested with different restrictionenzymes, fractionated in 1% agarose gels, and transferred tonylon membranes (PALL Biodyne). Total, poly(A)+, andpoly(A)− RNAs were fractionated on 1.0% agarose gelscontaining 50% formamide and 7% formaldehyde and sub-sequently transferred to Hybond C extra nylon filters (Am-ersham). Hybridizations to nylon filters were made underthe conditions described above.PCR assay.Oligonucleotides corresponding to the 59

(BP1 59d(ATGGGTGCTTGTGGGTCGAAGG)39) and 39(BP2 59d(TCAAGCCTTCTCCGGCACGTT)39) ends ofthe gene that encodes theT. cruziEF-hand calcium-binding

PORCEL ET AL.388

protein F29 in Miranda strain were synthesized. PCR wascarried out in a final volume of 50ml containing 50 ng ofT.rangeliepimastigote orLeishmania brasiliensis brasiliensispromastigote DNA as template, 5 pmol of each oligonucleo-tide (BP1 and BP2), 2 mM dNTPs, and 2.5 U of AmpliTaqDNA polymerase (Perkin–Elmer Cetus, U.S.A.) inTaq re-action buffer (50 mM KCl, 10 mM Tris, pH 8.3, 2.5 mMMgCl2, and 0.01% gelatin). PCR was performed in a DNA480 thermal cycler (Perkin–Elmer Cetus, U.S.A.) for 35cycles, under the following conditions: 94°C for 2 min,60°C for 3 min, and 72°C for 3 min. PCR products werethereafter purified and cloned into pGEM-T vector (Pro-mega, U.S.A.).DNA sequencing.Sequence analyses of the pGEM-T and

pUC-F29 clones were performed by standard manual se-quencing, using either the T7 Sequencing kit (Pharmacia,LKB, Sweden) or the Sequenase Version 2.0 kit (Amer-sham, U.S.A.) following the manufacturer’s recommenda-tions or using fluorescent primers and the 373A DNA Se-quencer (Applied Biosystems, U.S.A.) as described. Bothstrands of the sequence were read at least twice. Sequenceanalysis and data bank search were performed using theGCG Sequence Analysis Software Package (Devereuxet al.1984).

RESULTS

Cloning of putative calcium-binding protein-encoding genes inT. cruziandT. rangeli. Whileimmunoscreening a Miranda 76T. cruzi ge-nomiclgt11 library with an anti-flagellar frac-tion rabbit serum, a clone encoding a 29-kDaflagellar protein designated F29 was isolated. Adatabank search revealed a significant homol-ogy to aT. cruzi calcium-binding protein pre-viously identified by other investigators in sev-eral strains. An identity of 98% was shown withboth T. cruzi 1F8 genomic clone (Gonzalezetal. 1985) and ALC1 cDNA clone (Y strain)(Ouaissi et al. 1992) in terms of nucleotidealignment and 97% between the FCaBP de-scribed by Engman (1989) and our predictedprotein sequence. When compared to eachother, the Miranda sequence (F29 clone 1, Fig.1) diverged from the already published (Ystrain) only at nine positions, introducing fourconservative substitutions in the predictedamino acid sequence (Fig. 2).Calcium-binding proteins, localized in the

flagellum and basal body, are highly conservedamong trypanosomatids such asT. brucei bru-cei and T. lewisi (Lee et al. 1990; Wuet al.1994). These observations prompted us to

search for the homologous gene in the relatedparasitesT. rangeli and Leishmania.Oligonu-cleotides corresponding toT. cruzi F29 se-quence (positions underlined in Fig. 1) weresynthesized and used as primers for PCR am-plification of a gene fragment from genomicDNA of T. rangeliLDG strain. A band of theexpected size was cloned and several cloneswere completely sequenced to exclude PCR er-rors. The sequence of one of theT. rangelical-cium-binding protein-encoding genes is pre-sented in Fig. 1. Computer analysis revealed anopen reading frame of 204 amino acids, slightlyshorter than in the correspondingT. cruzi se-quence. The predicted Mw of the protein (Pep-tidesort Program) encoded by this clone was23,119 Da. A stretch of 18 bp in the proteincoding region of F29 (positions 66 to 84 in F29sequence, Fig. 1) is not present due to deletionsin the TrCaBP gene. A strong codon bias for G(43%) and C (39%) was observed in the thirdcodon position in the coding region comparedto A and T (3 and 14%, respectively). Suchbiased base preference has previously been re-ported by other groups for housekeeping genesfrom trypanosomes (Michels 1986; Bontempietal. 1993; Bernardiet al. 1993).The presence of an EF-hand calflagin was

also investigated inLeishmania.However, noPCR product was observed after DNA amplifi-cation with the BP1/BP2 primers and differentconditions used. This result agreed with previ-ous observations, where no related protein wasrecognized using specific anti-T. cruzi flagellarfraction antibodies selected with the help of theF29 recombinant protein onL. brasiliensisbrasiliensisprotein extracts (data not shown).TrCaBP is homologous to calflagins from

different parasites.A search in the Swiss pro-tein bank using the FASTA Program revealedhigh homology between TrCaBP and severalEF-hand calflagins from different trypano-somes. EF-hand calcium-binding proteins fromT. cruzi, T. brucei brucei,and E. histolyticagave the highest scores. A sequence identity of82% was found between TrCaBP and theT.cruzi flagellar calcium-binding protein previ-ously described by several groups (Gonzalezet

CALCIUM BINDING IN TRYPANOSOMATIDS 389

FIG.1.Com

pletesequence

ofoneTrCaB

Pgene

(TrCaB

Pclone6),com

paredwith

thatof

T.cruziF29

(F29

clone1).S

tartandstop

codons

areinboldtype.V

erticallines

show

identity.The

dotsindicategaps

inthesequence,introducedduringthealignm

enttoallowoptim

alsequence

comparison.The

positions

oftheprimersused

forPCRam

plification

areunderlined.

PORCEL ET AL.390

al. 1985; Engmanet al. 1989; Ouaissiet al.1992). Moreover, our TrCaBP sequenceshowed 60% identity at the amino acid se-quence level withT. brucei bruceicalflagins(Leeet al.1990; Wuet al.1994) and 28% withE. histolytica(Prasadet al. 1992).Trypanosomatid proteins with homology to

the deduced amino acid sequence of TrCaBP arecompared in Fig. 2. When theT. cruziF29 se-quence was compared to theT. cruzicalflaginspreviously described (1F8/FCaBP/24-kDa Ag/FCaBP-pBoL) a few differences were noticed.Most of those can be attributed to either strainpolymorphism (Miranda, PBol, and Y strains)and/or can reflect sequence variations betweendifferent gene copies. However, the four EF-hand domains remained well conserved.In contrast to the calflagins inT. brucei(Wu

et al. 1994) theT. rangeli calflagin sequencewas highly conserved both in the N- and C-termini, with exception of a few conservativeamino acid substitutions. Neither of theT. cruziandT. rangeliCaBPs carry the well-conservedhexapeptide sequence (GANEGD) located inthe C-terminal end ofT. bruceicalflagins (Wuet al. 1994). Thus, the TrCaBP seems to bemore closely related to theT. cruzi calcium-binding protein than with the CaBP inT. bruceibrucei.Comparison of theT. rangelicalflagins with

the canonical calcium-binding motif revealedfour putative EF-hand calcium-binding sites. Ashas been reported, most of the EF-hand proteinscontain two to eight calcium-binding motifs,consisting of a 12-residue loop flanked on bothsides by a 12-residuea-helical domain, posi-tions 1, 3, and 12 being the most conserved(Strynadka and James 1989). In the case ofTrCaBP EF-hand calcium domains 1, 3, and 4,all the residues identified as being essential forcalcium binding are conserved (Moncriefet al.1990; Nakayama and Kretsinger 1994), al-though domain 3 has a Met at the Gly position(position 15). Domain 2, however, lacks the fullcomplement of calcium-coordinating ligandssince two inserted residues (lysine in position90 and leucine in position 98) were present (Fig.2). Likewise,T. cruziF29 might bind three cal-

cium equivalents by domains 1, 3, and 4, whichresemble the canonical motif.BothT. rangeliTrCaBP andT. cruziF29 had

a high percentage of acidic residues (25%), ashas been shown using the Peptidesort Program.Genes forT. rangeliandT. cruziCaBPs are

arranged in clusters of tandem repeats.The or-ganization of the TrCaBP-encoding genes wasevaluated by Southern blot hybridization usingthe PCR product as a probe. Partial digestion ofT. rangeli genomic DNA withSalI and AvaI,enzymes which cut only once in the sequence ofthe TrCaBP gene, revealed a ladder-like pattern,indicating that the CaBP genes are arranged astandem repeats, with the length of the repeatunit around 800 bp (Fig. 3A). The pattern ob-tained after cleavage ofT. rangeli total DNAwith five different restriction enzymes (e.g.EcoRI) consisted of a very large single DNAband (Fig. 3A). One explanation for this resultis the lack of recognition sites inside the tandemunits, resulting in a DNA fragment containingthe whole tandem array.The resulting band obtained afterSacI diges-

tion was smaller than those produced by eitherAvaI or SalI, suggesting that there might be atleast twoSacI sites in each repeat unit. Based onthe established sequence, restriction, and South-ern blot analyses using different combinationsof enzymes in double digestions of total DNA(data not shown), a scheme of the unit is pro-posed (Fig. 3B).From the ladder it can be estimated that the

minimal number of repeat units in the clustermust be at least 20. Thus, the genes that encodethe CaBP ofT. rangeliare organized in a tan-dem array which contains at least 20 adjacentrepeats, as judged by the largest band observedafter the partial digestion, as in the case of F29-encoding genes (data not shown). No hybridiza-tion signal was seen using either TrCaBP orT.cruziF29 product as a probe, in genomic South-ern blots and PFGE blots of differentLeishmai-nia isolates (data not shown).RNA analysis.As shown in Fig. 4A, the

TrCaBP is encoded by a polyadenylated tran-script. High nonspecific background was ob-served using theT. rangeli PCR product as a

CALCIUM BINDING IN TRYPANOSOMATIDS 391

PORCEL ET AL.392

FIG.2.Com

parison

oftheCaB

PproteinsequencesfromT.rangeli,T.bruceibrucei,andT.cruzi.Alignm

entsofthededucedam

inoacidsequencesofEF-handcalcium-binding

proteins

from

differenttrypanosom

atidsweremadeusingtheLINEUPprogram.The

sequencesused

were:

T.rangeliTrCaB

P(Z54792),T.bruceibruceiTb-44A(U06463),Tb-17

(X53464),Tb-24

(U06644),Tb-1.7g

(U05882);

T.cruziCaB

P-1F8(X02838),FCaB

P(Engmanetal.1989),24-kDaAg(S43664),FCaB

P-PBol(L26971),F29

(Z54793),and

from

T.lewisi(Leeetal.1990).Num

bersindicatethepositionofam

inoacidsinTrCaB

Psequence.A

sterisks

show

identity.BarsindicatetheputativeEF-handcalcium-binding

motifs.Bar

anditalic

indicatetheATP/GTPloop

Amotif.Gaps,introduced

foran

optim

alsequence

alignm

ent,areindicatedby

dots.

CALCIUM BINDING IN TRYPANOSOMATIDS 393

probe for Northern blot hybridization. How-ever, the probe highlighted a single band of ap-proximately 1.6 kb, both in total and poly(A)+

epimastigote RNA. The mRNA is thus consid-erably longer than needed to encode TrCaBP(coding region of 615 bp). InT. cruzi,however,Northern blots hybridized with F29 revealed a900-nucleotide RNA, just about the right sizefor the predicted mature F29 mRNA (Fig. 4B).The degree of hybridization to bothT. rangeli

andT. cruziRNAs showed a comparative weaksignal, taking into consideration different filterexposures. This result was unexpected, consid-ering the high gene copy number established forboth genes.Chromosomal localization ofT. rangeliand

T. cruzi CaBP genes.The size of the chromo-somes containing TrCaBP-encoding genes inT.rangelivary among different isolates, from verylarge chromosomes in some isolates like UB66,J-2, and LDG to small ones such as in the caseof Ev26, as shown by PFGE blot hybridization(data not shown).Likewise, a dramatic karyotype variability

has been reported among different isolates ofT. cruzi,with high chromosomal size heteroge-neity suggesting a great genome plasticity(Henrikssonet al. 1993, 1995). In order to de-termine if the chromosomal position of F29genes was conserved between differentT. cruzistrains, chromosomes belonging to a large col-lection of T. cruzi samples, characterized byboth zymodeme typing and randomly amplifiedpolymorphic DNA (Henrikssonet al. 1993;Tibayrenacet al. 1993) were size fractionatedand hybridized with the MirandaT. cruzi F29insert. These experiments revealed the presenceof the F29 genes in one or two chromosomalbands in allT. cruzi samples tested (Fig. 5).Using PFGE conditions that allowed optimalseparation of chromosomes in the 650–900 sizerange, the prominent band present in several ofthe isolates studied (e.g., MCV and CBB, seeFig. 5) was resolved in two homologous chro-mosomes of slightly different size (data notshown). Similar pattern of one or two bandswere seen after PFGE–Southern analysis withrare cutting restriction enzymes, which do notcut inside the tandem array, thus generating asingle restriction fragment containing the wholetandem array (data not shown). This indicated adisomic chromosome constitution. Hybridiza-tion experiments suggest that the two copies ofthe TrCaBP tandem array are located on ho-mologous chromosomes.T. cruziCA11:29, an anonymous marker, has

been shown to be genetically linked to the F29cluster in CL, CAI/72 and Sylvio X10/7T. cruzi

FIG. 3. (A) Southern blot of total digested DNA fromT.rangeli, using the restriction endonucleases stated aboveeach lane.SalI partial digestion shows a ladder pattern,suggesting a tandem repeat organization. (B) Schematic re-striction map of one repeat unit of the TrCaBP tandemarray. Filled box represents the TrCaBP coding region.Cleavage sites forAvaI (A), SacI (S), andSalI (SI) areindicated.

PORCEL ET AL.394

strains (Henrikssonet al. 1995). Hybridizationof this marker with the collection ofT. cruziisolates confirms the linkage between the twomarkers (data not shown).A correlation betweenT. cruzi isoenzymatic

classification and chromosomal hybridizationpatterns was shown for some isolates (Fig. 5), aswas reported for cruzipain, and parts of genesencoding antigens 2, 13, and SAPA, inT. cruzi(Henrikssonet al.1993). When F29 genes fromstrains corresponding to the main zymodemeswere PCR amplified and sequenced, 96–99%homology was observed, with only a few at-random conservative nucleotide substitutions

(data not shown). These results confirm the highconservation of the F29 gene cluster amongT.cruzi isolates.

DISCUSSION

In this paper we report the sequence and ge-nomic organization of EF-hand calcium-binding protein-encoding genes ofT. rangeliandT. cruzi.The complete sequence of one ofthe TrCaBP-encoding genes is presented here.The product of this gene was 7 amino acidsshorter than the corresponding one predicted forthe T. cruzi counterpart and showed a signifi-cant homology to calflagins from other trypano-

FIG. 4. Northern blot analysis. Hybridization of (A) TrCaBP clone 6 probe toT. rangeliLDG epimastigote and (B) F29clone 1 probe toT. cruziTul 2 total RNA (T), poly(A)−, and poly(A)+ fractions. As size markers low- and high-molecular-weight RNA ladders (Gibco BRL) were used.

CALCIUM BINDING IN TRYPANOSOMATIDS 395

somes. Another observation was the presence,exclusively inT. rangeli,of a conserved ATP/GTP-binding site motif A (P-loop) identified bysequence comparison (Motif program) (Fig. 2).Our results suggest that TrCaBP could alternatebetween a GDP-bound inactive form to a Ca2+/GTP-bound active form and that this conforma-tional change could be crucial for the recogni-tion and interaction with its target molecule,during the signal transduction process, as hasbeen shown for other signal-transducing GTP-binding proteins (Kaziroet al.1991). However,functional and biochemical studies on the native

TrCaBP must be done to corroborate this hy-pothesis.The requirement of calcium and flagellar cal-

cium-modulated proteins for cell motility inparasites is not well understood. However, com-mon features like low molecular weight (usu-ally below 20 kDa), acidic isoelectric point,high affinity for Ca2+, and calcium-induced al-terations in molecular conformation are sharedby all members of the calcium-modulated regu-latory protein family, including calmodulin.This protein has been shown to be responsiblein the determination of flagellar wave direction

FIG. 5. Chromosomal localization of F29 genes inT. cruzi.As an example, hybridization with F29 clone 1probe to Southern blot of chromosome-sized DNA molecules from severalT. cruzi isolates and cloned stocksseparated by PFGE is shown. The parasite clones used are indicated above each lane. The zymodeme classifi-cation is indicated by arrows. The classification at 12 or more loci is indicated above the isolate names.Abbreviations: ND, not determined zymodeme; MxCh, MxCh88; Esm., Esmeraldo clone 3. Chromosomes fromSaccharomyces cerevisiae(Bio-Rad) were used as molecular weight markers.

PORCEL ET AL.396

in the related trypanosomatidCrithidia on-copelti (Sugrueet al. 1988). The predicted iso-electric point of the complete TrCaBP protein is4.7, in agreement with the isoelectric points ofT. cruzi FCaBP (Engmanet al. 1989) and thededuced isoelectric point ofT. brucei bruceiandE. histolyticaCaBPs. In addition, some ofthese proteins have phosphorylated forms, bothATP/GTP-binding and phosophorylation re-quirements for calcium-modulated motility(Strynadka and James (1989). This, togetherwith all the characteristics described before,makes the TrCaBP a possible candidate to beinvolved in flagellar motility.The genomic organization of TrCaBP- and

F29-encoding genes is not uncommon in try-panosomatids. Several authors have describedthe presence of tandemly arranged genes encod-ing housekeeping functions or highly expressedgene products inT. cruzi, such as cruzipain(Campetellaet al.1992), TAT (Bontempiet al.1993), and histones (Puertaet al.1994; Garcı´a-Salcedoet al. 1994; Bontempiet al. 1994; Ås-lund et al. 1994). InT. rangeli, the same situa-tion has been reported for the main cystein pro-teinase (Martinezet al. 1995). The sizevariation between individual copies of the geneseems to be minimal, since only one mRNAspecies (1.6 kb) was observed and since all se-quenced clones so far studied were very similar.The mRNA encoding the TrCaBP is muchlarger than expected, as was recently reportedfor the GP72 and TAT transcripts inT. cruzi(Cooperet al. 1991; Bontempiet al. 1993).Despite the many similarities between the

genes encoding TrCaBP and F29 and their ge-nomic organization, there is a large differencein chromosomal location of the F29 andTrCaBP clusters. PFGE patterns revealed a dra-matic variation of the TrCaBP gene chromo-somal organization among different isolates(not shown). The same type of hybridizationpattern has also been seen using theT. rangelicystein proteinase (Martinezet al.1995). Muchlarger chromosomes have been shown inT. ran-geli (Henrikssonet al., in press). However, thefact that in some isolates the TrCaBP clusters arelocated in small chromosomes confirms the

karyotype variability between differentT. ran-geli isolates, recently demonstrated by Henriks-sonet al. (in press).PCR amplification ofL. brasiliensis bra-

siliensisDNA failed to detect any specific band.The fact that no hybridization signal was ob-served using the TrCaBP or theT. cruzi F29product as a probe in genomic Southern blotsand PFGE blots of differentLeishmainiaiso-lates together with the absence of a related pro-tein in L. brasiliensis brasiliensisprotein ex-tracts suggest that this protein is not present oris highly divergent inLeishmania.Diagnosis of Chagas’ disease is frequently

nonspecific in some endemic areas because ofcross-reactivity withT. rangeliandLeishmaniaantigens. Although PCR amplification ofminiexon genes allows the differentiation be-tweenT. cruziandT. rangeliby the electropho-retic mobilities of their respective amplificationproducts, further Southern blot analyses withunique species-specific probes should be doneto confirm the results (Murthyet al.1992). Thecalcium-modulated protein-encoding gene de-scribed in here is not present inLeishmaniaspe-cies. Although it is present inT. rangeli, thesequence differences within the genes betweenT. cruziandT. rangelicould be utilized in a newPCR-based diagnosis system to specifically dif-ferentiate between these two related parasites.

ACKNOWLEDGMENTS

This research work received financial support from theUNDP/World Bank/WHO Special Programme for Researchand Training in Tropical Diseases, the Ministerio de Saludy Accion Social of Argentina, and SAREC (the SwedishAgency for Research Cooperation with Developing Coun-tries). E.L.S. and A.M.R. are members of the Carrera delInvestigador Cientifico and B.P. is a Research Fellow fromthe Consejo Nacional de Investigaciones Cientı´ficas y Tec-nicas de la Repu´blica Argentina (CONICET).

REFERENCES

BERNARDI, G. 1993. The isochore organization of the humangenome and its evolutionary history—a review.Gene135,57–66.

BONTEMPI, E. J., BUA, J., ÅSLUND, L., PORCEL, B., SEGURA,E. L., HENRIKSSON, J., ÖRN, A., PETTERSSON, U., AND

RUIZ, A. M. 1993. Isolation and characterisation of a genefrom Trypanosoma cruziencoding a 46-kilodalton pro-

CALCIUM BINDING IN TRYPANOSOMATIDS 397

tein with homology to human and rat tyrosine amino-transferase.Molecular and Biochemical Parasitology59(2), 253–262.

BONTEMPI, E. J., PORCEL, B., HENRIKSSON, J., CARLSSON, L.,RYDÅKER, M., SEGURA, E. L., RUIZ, A. M., AND PETTERS-SON, U. 1994. Genes for histone H3 inTrypanosomacruzi. Molecular and Biochemical Parasitology66,147–151.

CAMPETELLA, O., HENRIKSSON, J., ÅSLUND, L., FRASCH,A. C. C., PETTERSSON, U., AND CAZULLO, J. J. 1992. Themajor cysteine proteinase (cruzipain) fromTrypanosomacruzi is encoded by multiple polymorphic tandemly or-ganized genes located on different chromosomes.Mo-lecular and Biochemical Parasitology50, 225–234.

COOPER, R., INVERSO, J. A., ESPINOSA, M., NOGUEIRA, N.,AND CROSS, G. A. M. 1991. Characterisation of a candi-date gene for GP72, and insect stage-specific antigen ofTrypanosoma cruzi. Molecular and Biochemical Parasi-tology49, 45–60.

DEVEREUX, J., HAEBERLI, J.,AND SMITHIES, O. 1984. A com-prehensive set of sequence analysis programs for theVAX. Nucleic Acids Research12, 387–395.

ENGMAN, D. M., REDDY, L. V., DONELSON, J. E., ANDKIRCHHOFF, L. V. 1987.Trypanosoma cruziexhibits in-ter- and intra-strain heterogeneity in molecular karyotypeand chromosomal gene location.Molecular and Bio-chemical Parasitology22, 115–123.

ENGMAN, D. M., KRAUSE, K.-H., BLUMIN , J. H., KIM, K. S.,KIRCHHOFF, L. V., AND DONELSON, J. E. 1989. A novelflagellar Ca-binding protein in Trypanosomes.Journal ofBiological Chemistry264(31), 18627–18631.

GARCIA-SALCEDO, J. A., OLIVER, J. L., STOCK, R. P., ANDGONZALEZ, A. 1994. Molecular characterisation and tran-scription of the histone H2B gene from the protozoanparasiteTrypanosoma cruzi. Molecular Microbiology13,1033–1043.

GONZALEZ, A., LERNER, T. J., HUECAS, M., SOSA-PINEDA,B., NOGUEIRA, N., AND LIZARDI, P. M. 1985. Apparentgeneration of a segmented mRNA from two separate tan-dem gene families inTrypanosoma cruzi. Nucleic AcidsResearch13(16), 5789–5804.

HENRIKSSON, J., PETTERSSON, U., AND SOLARI, A. 1993.Try-panosoma cruzi:Correlation between karyotype variabil-ity and isoenzyme classification.Experimental Parasitol-ogy77, 334–348.

HENRIKSSON, J., PORCEL, B. M., RYDÅKER, M., RUIZ, A.,SABAJ, V., GALANTI , N., CAZZULO, J. J., FRASCH, A. C. C.,AND PETTERSSON, U. 1995. Chromosome specific markersreveal conserved linkage groups in spite of extensivechromosomal size variation inTrypanosoma cruzi. Mo-lecular and Biochemical Parasitology73, 63–74.

KAZIRO, Y., ITOH, H., KOZASA, T., NAKAFUKU , M., AND

SATOH, T. 1991. Structure and function of signal-transducing GTP-binding proteins.Annual Review ofBiochemistry60, 349–400.

LEE, G. S. M., CHEN, J., HO, A. W. M., D’ALESANDRO, P.,AND VAN DER PLOEG, L. H. T. 1990. A putative flagellar

Ca2+-binding protein of the flagellum of trypanosomatidprotozoan parasites.Nucleic Acids Research18, 4252.

MARTINEZ, J., HENRIKSSON, J., RYDÅKER, M., CAZZULO, J. J.,AND PETTERSSON, U. 1995. Genes for cystein proteinasesfrom Trypanosoma rangeli. FEMS Microbiology Letters129,135–142.

MICHELS, P. A. M. 1986. Evolutionary aspects of Trypano-somes: analysis of genes.Journal of Molecular Evolution24, 45–52.

MONCRIEF, N. D., KRETSINGER, R. H., AND GOODMAN, M.1990. Evolution of EF-hand calcium-modulated proteins.I Relationships based on amino acid sequences.Journalof Molecular Evolution30, 522–562.

MORENO, S. N. J., SILVA , J., VERCESI, A. E., AND DOCAMPO,R. 1994. Cytosolic-free calcium elevation inTrypano-soma cruziis required for cell invasion.Journal of Ex-perimental Medicine180,1535–1540.

MURTHY, V. K., DIBBERN, K. M., AND CAMPBELL, D. A.1992. PCR amplification of mini-exon genes differenti-atesTrypanosoma cruzifrom Trypanosoma rangeli. Mo-lecular and Cellular Probes6, 237–243.

NAKAYAMA , S.,AND KRETSINGER, R. H. 1994. Evolution ofthe EF-hand family of proteins.Annual Review of Bio-physics and Biomolecular Structure23, 473–507.

OGUETA, S. B., SOLARI, A., AND TELLEZ-INON, M. T. 1994.Trypanosoma cruziepimastigote form possess a Ca2+-calmodulin dependent protein kinase.FEBS Letters337,293–297.

OUAISSI, A., AGUIRRE, T., PLUMAS-MARTY, B., PIRAS, M.,SCHONEK, R., GRAS-MASSE, H., TAIBI , A., LOYENS, M.,TARTAR, A., CAPRON, A. AND PIRAS, R. 1992. Cloning andsequencing of a 24-kDa.Trypanosoma cruzispecific an-tigen released in association with membrane vesicles anddefined by a monoclonal antibody.Biology of the Cell75,11–17.

PAINDAVOINE , P., ROLIN, S., VAN ASSEL, S., GEUSKENS, M.,JAUNIAUX , J. C., DINSART, C., HUET, G., AND PAYS, E.1992. A gene from the variant surface glycoprotein ex-pression site encodes one of several transmembrane ad-enylate cyclases located on the flagellum ofTrypano-soma brucei. Molecular and Cellular Biology12, 1218–1225.

PUERTA, C., MARTIN, J., ALONSO, C., AND LOPEZ, M. C.1994. Isolation and characterisation of the gene encodinghistone H2A fromTrypanosoma cruzi. Molecular andBiochemical Parasitology64, 1–10.

PRASAD, J., BHATTACHARYA , S., AND BHATTACHARYA , A.1992. Cloning and sequence analysis of a calcium-binding protein gene from a pathogenic strain ofEnt-amoeba histolytica. Molecular and Biochemical Parasi-tology52(1), 137–140.

RUBEN, L., AND PATTON, C. L. 1987. Calmodulin fromTry-panosoma brucei:immunological analysis and genomicorganisation.Methods in Enzymology139,262–276.

RUBEN, L., AND HAGHIGHAT, N. 1990. Calcium-dependentregulatory pathways inTrypanosoma brucei:Character-isation of 22,000-dalton calcium-binding protein, calci-

PORCEL ET AL.398

medins, and calmodulin.In ‘‘Calcium as an IntracellularMessenger in Eucaryotic Microbes’’ (D. H. O’Day, Ed.),pp. 317–342. Am. Soc. for Microbiol. Press, Washington,DC.

SAMBROOK, J., FRITSCH, E. T., AND MANIATIS, T. 1989.‘‘Molecular Cloning. A Laboratory Manual.’’ ColdSpring Harbor Laboratory, Cold Spring Harbor, NY.

SCHEIBEL, L. W. 1992. Role of calcium/calmodulin-mediated processes in protozoa.International Review ofCytology134,165–242.

SEGURA, E. L., VAZQUEZ, C., BRONZINA, A., CAMPOS, J. M.,CERISOLA, J. A., AND GONZALEZ CAPPA, S. M. 1977. An-tigens of the subcellular fractions ofTrypanosoma cruzi:II. Flagellar and membrane fraction.The Journal of Pro-tozoology24, 540–543.

SIEBERT, P. D., AND CHENCHIK, A. 1993. Modified gua-nidium thiocyanate-phenol-choloroform RNA extractionmethod which greatly reduces DNA contamination.Nucleic Acids Research21, 2019–2020.

STRYNADKA , N. C., AND JAMES, M. N. 1989. Crystal struc-tures of the helix-loop-helix calcium-binding proteins.Annual Review of Biochemistry58, 951–98.

SUGRUE, P., HIRONS, M. R., ADAM, J. U., AND HOLWILL ,M. E. J. 1988. Flagellar wave reversal in the kinetoplastidflagellate Crithidia oncopelti. Biology of the Cell63,127–131.

TANAKA , T., KANEDA, Y., IIDA, A., AND TANAKA , M. 1994.Homologous cysteine proteinase genes located on twodifferent chromosomes fromTrypanosoma rangeli. Inter-national Journal for Parasitology24(2), 179–188.

TARDIEUX, I., NATHANSON, M. H., AND ANDREWS, N. W.1994. Role in host cell invasion ofTrypanosoma cruzi-induced cytosolic-free Ca2+ transients.Journal of Experi-mental Medicine179,1017–1022.

TIBAYREN, M., NEUBAUER, K., BARNABE, C., GUERRINI, F.,SKARECKY, D., AND AYALA , F. J. 1993. Genetic charac-terisation of six parasitic protozoa: Parity between ran-dom-primer DNA typing and multilocus enzyme electro-phoresis.Proceedings of the National Academy of Sci-ences90(4), 1335–1339.

WU, Y., DEFORD, J., BENJAMIN, R., LEE, M. G.-S.,AND RU-BEN, L. 1994. The gene family of EF-hand calcium-binding proteins from the flagellum ofTrypanosoma bru-cei. Biochemical Journal304,833–841.

ÅSLUND, L., CARLSSON, L., HENRIKSSON, J., RYDÅKER, M.,TORO, G. C., GALANTI , N., AND PETTERSSON, U. 1994. Agene family encoding heterogeneous histone H1 proteinsin Trypanosoma cruzi. Molecular and Biochemical Para-sitology65, 317–330.

Received 11 March 1996; accepted with revision 12 July1996

CALCIUM BINDING IN TRYPANOSOMATIDS 399