Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B

j ourna l homepage: www.e lsev ie r.com/ locate /cbpb

Transporters involved in glucose and water absorption in the Dysdercus peruvianus(Hemiptera: Pyrrhocoridae) anterior midgut

Thaís D. Bifano, Thiago G.P. Alegria, Walter R. Terra ⁎Departamento de Bioquímica, Instituto de Química, Universidade de São Paulo, Caixa Postal 26077, 05513-970, São Paulo, Brazil

⁎ Corresponding author. Fax: +55 3091 2186.E-mail address: warterra@iq.usp.br (W.R. Terra).

1096-4959/$ – see front matter © 2010 Elsevier Inc. Aldoi:10.1016/j.cbpb.2010.05.014

a b s t r a c t

a r t i c l e i n f o

Article history:Received 22 April 2010Received in revised form 31 May 2010Accepted 31 May 2010Available online 4 June 2010

Keywords:Dysdercus peruvianusGLUTSGLTWater absorptionSugar absorption

Little is known about insect intestinal sugar absorption, in spite of the recent findings, and even less has beenpublished regarding water absorption. The aim of this study was to shed light on putative transporters ofwater and glucose in the insect midgut. Glucose and water absorptions by the anterior ventriculus ofDysdercus peruvianus midgut were determined by feeding the insects with a glucose and a non-absorbabledye solution, followed by periodical dissection of insects and analysis of ventricular contents. Glucoseabsorption decreases glucose/dye ratios and water absorption increases dye concentrations. Water andglucose transports are activated (water 50%, glucose 33%) by 50 mM K2SO4 and are inhibited (water 46%,glucose 82%) by 0.2 mM phloretin, the inhibitor of the facilitative hexose transporter (GLUT) or are inhibited(water 45%, glucose 35%) by 0.1 mM phlorizin, the inhibitor of the Na+–glucose cotransporter (SGLT). Theresults also showed that the putative SGLT transports about two times more water relative to glucose thanthe putative GLUT. These results mean that D. peruvianus uses a GLUT-like transporter and an SGLT-liketransporter (with K+ instead of Na+) to absorb dietary glucose and water. A cDNA library from D. peruvianusmidgut was screened and we found one sequence homologous to GLUT1, named DpGLUT, and another to asodium/solute symporter, named DpSGLT. Semi-quantitative RT-PCR studies revealed that DpGLUT andDpSGLTs mRNA were expressed in the anterior midgut, where glucose and water are absorbed, but not in fatbody, salivary gland and Malpighian tubules. This is the first report showing the involvement of putativeGLUT and SGLT in both water and glucose midgut absorption in insects.

l rights reserved.

© 2010 Elsevier Inc. All rights reserved.

1. Introduction

Glucose absorption in whole mammalian intestine comprises twocomponents: an active component and another described as equili-brative glucose transporter (GLUT). Crane et al. (1961) was the first toformulate the cotransport concept to explain active transport. Heproposed that the movement of glucose across the brush bordermembrane was coupled to downhill Na+-transport cross the brushborder with the involvement of a transporter named nowadays assodium–glucose transporter (SGLT).

SGLT and GLUT are transporters that belong to families of thesolute carrier gene series (SLC). The SGLT family (sodium-dependentglucose transporter, gene name SLC5A) includes 11 human genesexpressed in tissues from epithelia to the central nervous system. Thebest known member of this family is SGLT1 (SLC5A1) expressed inintestine, which transports glucose or galactose with Na+ and water(Wright, 2001; Wright and Turk, 2004; Scheepers et al., 2004).

The GLUT family (gene name SLC2A) is composed of 14 humangenes which can be divided into 3 subfamilies according to sequence

similarities. Class 1 GLUT includes the best known transporters:GLUT1 preferentially expressed in erythrocytes and GLUT2, constitu-tively expressed in the intestine basolateral membrane (Scheepers etal., 2004; Kellett et al., 2008). Following a glucosemeal, GLUT2 locatedin endosomes at the base of the brush border is transiently insertedinto the apical membrane of the enterocyte (Kellett et al., 2008).

Absorption of glucose by the insect midgut has been studied formore than 50 years (Treherne, 1957, 1958; Crailsheim, 1988; Turunenand Crailsheim, 1996) and the consensus is that glucose is absorbedby simple diffusion. More recently the involvement of the facilitativeglucose transporters (GLUTs) was described in insect epidermis(Giordana et al., 2003) and in insect midgut (Pascual et al., 2006; Priceet al., 2007; Caccia et al., 2007). GLUTwas also the subject ofmolecularstudies (Escher and Rasmuson-Lestander, 1999; Chen et al., 2006;Price et al., 2007). The data showed that the insect midgut GLUT issimilar to class 1 GLUT, although other GLUTs may occur in tissuesother than the midgut (Chen et al., 2006). Recently, Caccia et al.(2007) functionally demonstrated the presence of SGLT1 and GLUT2in the midgut of the hymenopteran parasitoid Aphidius ervi.Nevertheless, the corresponding cDNAs were not cloned.

Dysdercus peruvianus is a cotton seed sucker bug used as a modelheteropteran insect in our laboratory. The absorptions of glucose andwater occur at D. peruvianus anterior midgut, thus contrasting with

Table 1Gene-specific oligonucleotide primers used in sequencing and semi-quantitativereverse transcription (RT)-PCR.

Name Primer sequences Ampliconsize (bp)

DpGLUT(RT-PCR)

Fw 5′ CGACCATTGTTTCAGTGTGG 3′Rev 5′ TAGGAGCCATGGAATCGAAC 3′

212

DpSGLT(RT-PCR)

Fw 5′ CGCATTGTCGATGAATCAAG 3′Rev 5′ CCTTTCCCAAACCACTGAGA 3′

211

rRNA(RT-PCR)

Fw 5′ TGGTGCATGGAATAATGGAA 3′Rev 5′ GCTTTCGCTCTAGTGCGTCT 3′

169

DpGLUT Fw 5′ CAGATCTTCACAGCCGAACA 3′Rev 5′ GTTCGCCGACGTATTTCTGT 3′

–

DpSGLT Fw 5′ TCTGCAGCACAGTTCCTGAC 3′ –

Table 2Glucose/Dye ratios (G/D) and relative water content (%W) in the anterior midgut in theabsence of cations with or without inhibitors of glucose transport.

Feedingtime

No addition Phlorizin Phloretin

G/D %W G/D %W G/D %W

20 min 100±20 60±4 175±5 60±10 300±3 70±7

The additions are 0.1 mMphlorizin or 0.2 mM phloretin. The data aremeans and SEM of3 independent samples obtained form 10 animals each. Other details are as in thelegend to Fig. 1. Glucose absorption in the presence of phlorizin is probably somewhatoverestimated because phlorizin may be partly hydrolyzed by midgut β-glucosidase,thus forming phloretin. G/D figures are significantly different (one-way ANOVA,pb0.001), whereas %W figures are not significantly different.

2 T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

amino acid absorption that predominates at the posterior midgut(Silva and Terra, 1994). Nevertheless, data on the nature of theglucose and water transporters are lacking.

The aim of this paper was to re-investigate water and glucoseabsorption by D. peruvianus midguts. Since insect feeding on plants(rich in K+ ions) has amino acid-K+-symporters (Wolfersberger,2000), we included the effect of K+ ions on our absorptionexperiments. The results showed that water and glucose absorptionsare carried out by GLUT and SGLT and the putative cDNAscorresponding to those transporters were sequenced and shown tobe similar to mammalian GLUT1 and SGLT8, respectively. This is thefirst report of an insect SGLT partial sequence with a physiologicalcorrelate and the first paper that associates intestinal waterabsorption with sugar transport.

2. Materials and methods

2.1. Rearing of insects

Stock cultures of the cotton stainer bug D. peruvianus (Hemiptera:Pyrrhocoridae) were raised inside plastic bottles partly filled withsand, covered with a piece of cloth, under natural photoperiodconditions at a relative humidity of 50%–70% at 24±2 °C. The insectshad ample access to water and to cotton (Gossypium hirsutum) seeds.These seeds were previously frozen to kill any organisms which may

Fig. 1. Absorption of water (empty symbols) and glucose (solid symbols) from theanterior midgut (V1) contents in the presence of different compounds. Insects were feda solution containing glucose, glycerol, and Evans blue (control) without (●,○) or with100 mM K+ (■, □). The absorption of glucose was followed by measuring the massratio of glucose to a non-absorbable dye (Evans blue) (●, ■), whereas that of water, bydetermining the decrease in the relative water content (○, □). This decrease isinversely proportional to the increase in the concentration of Evans blue. For example, aten-fold increase in color means that the water content was reduced to 10%. Otherdetails are in Materials and methods. The data are means and SEM of 4 independentsamples obtained from 10 animals each.

have been contaminating them. Only non-mated femaleswere used inthis study, because of their larger size. Starved insects weremaintained 10 days without cotton seeds, but with access to water.

2.2. In vivo measurement of water and glucose absorption from anteriormidgut (V1) contents

Groups of 7–10 starved females maintained at 26 °C and deprivedof water for 12 h were immobilized with the aid of an adhesive tapeon a flat surface. Then, their stylets were put into capillary tubesdipped into Eppendorf tubes with a 0.02% (w/v) Evans blue solutionwith 200 mM glucose and 20 mM glycerol. The concentration ofglucose was chosen after several trials, when the amount of suckedsample was evaluated and the accuracy of determinations assured.The animals were fed for 20 min, and after different periods of time(10, 20, 30 and 40 min) groups were immobilized by placing them onice and their midguts were dissected in cold isosmotic 215 mM NaClsolution. D. peruvianus midgut (ventriculus, V) is divided into 4chambers named V1, V2, V3, and V4. V1 is the larger and moreanteriorly placed of the chambers (Silva and Terra, 1994).

A known volume (typically 20–40 μL) of the contents of the dilatedanterior midgut (V1) of each group was collected with a calibratedcapillary and adjusted to 1 mL with water. The concentration of Evansblue was calculated from absorbance readings at 610 and 800 nm.Evans blue does not absorb at 800 nm, whereas 610 nm is itsabsorption maximum. Thus, absorbance readings at 800 nm areproportional to the background absorbance of the samples and maybe used to correct the absorption maximum taking into account theabsorption ratio A610:A800. Absorption ratios were determined fromcontrol experiments in which no dye was present in the samples fedto the insects and were shown to be 1.5. Finally, the mass of Evansblue in V1 contents was calculated from the corrected absorbancereadings at 610 nm [absorbance at 610 nm− (absorbance at800 nm×1.50)].Water absorptionwas computed from the increase in Evans blueconcentration. For example, a ten-fold increase in absorbance readingsof midgut contents (after taking into account the dilution of sample onadjusting to 1 mL) means that the water content was reduced to 10% ofthe initial volume. Themass of glucose in V1was determined accordingto Dahlqvist (1968) with reduced volumes (sample 100 μL, reagent1 mL). Glucose remaining in V1 after different periods of time was

Table 3Glucose/Dye ratios (G/D) and relative water content (%W) in the anterior midgut in thepresence of cations with or without inhibitors of glucose transport.

Feedingtime

K+ K+ + Phlorizin K+ + Phloretin Na+

G/D %W(a)

G/D %W(b)

G/D %W(c)

G/D %W(d)

20 min 26±4 10±4 120±8 50±10 250±10 70±7 87±7 8±2

The cation additions were 100 mM K+ or 100 mM Na+. Other additions and details areas in legends of Table 2 and Fig. 1.The data are means and SEM of 3 independentsamples obtained from 10 animals each. G/D figures are significantly different (one-way ANOVA, pb0.01). Some %W figures are not significantly different (a × d and b × c),whereas other are significantly different (a × b, a × c, b × d, c × d, pb0.005).

Table 4Relative absorption of glucose and water by the anterior midgut in the presence of K+,K+ + phlorizin or K+ + phloretin at 20 min after ingestion.

Relative absorption K+ K+ + Phlorizin K++ Phloretin

Glucose 100 66±4 18±1Water 100 56±10 34±3

The relative absorption of glucose was the ratio of the absorption in a given condition tothat in a medium with only K+. The absorption of glucose was considered to be thedecrease in the glucose/dye ratio (300 less the ratio at a given time). The relativeabsorption of water was likewise calculated from the relative water content. The figureswere calculated from data in Table 3 and, like there, figures for glucose and waterabsorption are significantly and not significantly different, respectively. Fig. 2. Expression pattern of mRNA for sugar transporters in different tissues of

Dysdercus peruvianus as shown by semi-quantitative RT-PCR. Equal amounts (5 ng) oftotal RNA from different tissues were extracted and used as template in reversetranscription reaction. The product of this reaction was used in PCR reaction usingspecific primers for DpSGLT and DpGLUT-encoding cDNA and for ribosomal RNA. Theproduct of amplification was analyzed in 2% agarose/TAE gel. The amplified bandappears in the tissue when the corresponding mRNA is transcribed. MT, Malpighiantubules; SG, salivary gland; FB, fat body; MG, midgut; V1, first ventriculus; V2, secondventriculus; V3, third ventriculus; rRNA, ribosomal RNA. The number of amplificationcycles was chosen after several trials so that the amplification was in log phase andresulting in a clearly visible amplified band.

3T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

expressed as the ratio between the mass of glucose and the mass ofEvans blue, which is a non-absorbable dye. The smallest change inglucose absorption rate that can be detected by this method is a changein the glucose/dye ratio of 3–6. A similar procedure was used to studythe effect of several compounds in the absorption process such as:0.2 mM phloretin (GLUT2 inhibitor), 0.1 mM phlorizin (SGLT1 inhibi-tor), 50 mM K2SO4, and 50 mM Na2SO4.

2.3. Molecular cloning of midgut sugar transporters from D. peruvianus

Total RNA was extracted from midgut epithelium of D. peruvianusfollowing the instructions of the manufacturer, Invitrogen, which arebased on Chomczynski and Sacchi (1987), and sent to VertisBiotechnologie AG (Germany), in order to construct a normalizedcDNA library. At Vertis Biotechnologie AG the mRNAs were isolated,divided into two equal samples and used in cDNA synthesis with apoly-T and a random primer. Finally, the two cDNA pools were mixed(1:1) and non-directionally inserted in the vector λ ZAPII.

Two partial sequences of BLAST-identified sugar transporters werefound by random sequencing of a cDNA library obtained from D.peruvianus midgut. One cDNA containing all the putative ORFcorresponding to a GLUT (named DpGLUT) and anothercorresponding to most of an ORF coding SGLT (named DpSGLT)were sequenced. For this, partial sequences were amplified usingspecific primers (Table 1) with T7 and T3 universal primer, employingthe cDNA library as a template. The PCR reaction was performed usingTAQ DNA polymerase (2.5 units) in 20 mM Tris–HCl buffer, pH 8.4with 50 mM KCl, 0.2 mM dNTP, and 4.0 mM MgCl2. Before theamplification reaction, the medium was maintained for 5 min at94 °C. The amplification was reached using 30 cycles at the followingconditions: 45 s at 94 °C, 30 s at 58 °C and 2 min at 72 °C.

The PCR products were separated electrophoretically on 1%agarose gels and extracted from gel slices (QIAquick, Qiagen). DNAsequencing was performedwith the DNA kit Big Dye Terminator Cyclesequencing (PE Applied Biosystems) employing the PCR-primers inthe sequencing reaction. The partial sequences of DpGLUT andDpSGLT were then employed to design specific primers to be usedin PCR to complete the partial sequences. The products of PCR were

Table 5Relative absorption of glucose and water by anterior midgut GLUT and SGLT 20 minafter ingestion.

Transporter Glucose Water

GLUT 82±5 66±6SGLT 34±2 44±8

The relative absorption of glucose and water by GLUT and SGLT may be calculated fromthe absorption decrease caused by phloretin and phlorizin, respectively, as shown inTable 4. The relative importance of SGLT is probably somewhat overestimated becausephlorizin may be partly hydrolyzed by midgut β-glucosidase, thus forming phloretin.The relative absorption of glucose and water are significantly and not significantlydifferent, respectively.

then cloned into pGEM-T vector (Promega) and sequenced using theplasmid specific primers T7 and SP6 (Table 1). The quality of thesequences was above 20 as determined by the algorithm Phred-Phrap(http://www.phrap.org/phredphrapconsed.html) (Ewing et al., 1998;Ewing and Green, 1998). Amino acid translations of DpGLUT andDpSGLT sequences were carried out using ORFinder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Putative signal peptide cleav-age sites and glycosylation sites of ε-amino groups of Lys residueswere determined with the prediction servers SignalP V2.0.b2 (http://www.cbs.dtu.dl/services/SignalIP) (Nielsen et al., 1997) and NetN-Glycate.1.0 (http://www.cbs.dtu.dk/services/NetOGlycate/), respec-tively. Theoretical molecular weights and isoelectric points weredetermined by Peptide Mass (http://www.ca.expasy.org/tools/pi_tool.html) (Gasteiger et al., 2005).

2.4. Semi-quantitative reverse transcription (RT)-PCR

Females immobilized on ice were dissected in cold 215 mM NaClwith gloves, sterile forceps and glassware previously treated withdiethylpyrocarbonate. The dissected tissues were maintained in anethanol-ice bath and eventually were stored at −80 °C. RNAs wereextracted from the tissues using Trizol (Invitrogen) according to themanufacturer's protocol, which is based on Chomczynski and Sacchi(1987), and used to synthesize the corresponding cDNA with the aidof a reverse transcriptase present in the kit Superscript™ First StrandSynthesis System for RT-PCR (Invitrogen) with samples free fromcontaminating genomic DNA. The resulting cDNA was used as atemplate for amplifying sequences by PCR with primers specific forDpGLUT and DpSGLT. The presence of contaminating genomic DNAwas ruled out by the lack of sequence amplification observed whenthe initial extracted RNA was used in PCR reactions.

The primers usedwere shown at Table 1. PCR reactionwas performedafter initial denaturation at 94 °C (2 min) using TAQ DNA polymerase(Invitrogen) in a reactionbuffer containing 1.5 mMMgCl2. PCR conditionswere: 25 cycles of 45 s at 94 °C (denaturation), 30 s at 53 °C (annealing)and 2 min at 72 °C (synthesis). The number of cycles was chosen afterseveral trials so that the amplification was in log phase and resulting in aclearly visible amplifiedband. The size of the RT-PCRproducts agreeswithone thatwould be expected fromRNA. This rules out the possibility of theexistence of remaining DNA contaminants in the preparations. DNAcontaminants may result in larger than expected bands because ofamplification of exon and intron sequences.

Fig. 3. Nucleotide and deduced amino acid sequence from facilitated glucose transporter from Dysdercus peruvianus (DpGLUT). The predicted cleavage site of the signal peptide ismarked with an arrowhead. The potential lysine glycosylation residues are: 47, 94, 152, 245, 267, 302 and 336. Sequences presumed to correspond to membrane-spanning helices(TM 1–12) are underlined. Residues conserved amongst facilitative sugar transporters are shaded in gray and those characteristic of GLUT class 1 are shown in bold. DpGLUTGenBank accession number is GU014570.

4 T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

2.5. Phylogenetic analysis

Phylogenetic analysis using DpGLUT and DpSGLT was performedwith the program MEGA 4.1 (Tamura et al., 2007). Distance analysiswas carried out using neighbor-joining algorithm (Saitou and Nei,1987). Bootstrap (Felsenstein, 1985; Hillis and Bull, 1993) support forthe clades was evaluated based on 1000 replicates.

2.6. Statistical analyses

The significance of differences between groups was calculated byapplying one-way ANOVA and Tukey's multiple comparison test. A valueof pb0.05 was considered to be significant. When only two groups werecompared, differences were considered as statistically relevant if pb0.05in a unpaired Student's t-test.

3. Results

3.1. Midgut absorption of water and glucose

A solution containing 0.02% (w/v) Evans blue, 200 mM glucose and20 mM glycerol (glucose/Evans blue ratio: 300) was fed to females. Afterdifferent time intervals, groups of females were dissected and theconcentration of dye and glucose in V1 contents was determined. Abouttwo thirds of glucose and one half of water in V1 were absorbed after20 min after ingestion (Fig. 1). Glucose absorption is completely inhibitedby phloretin (GLUT inhibitor) and little affected by phlorizin (SGLTinhibitor),whereaswater absorption is not clearly changedbynone of theinhibitors (Table 2). Nevertheless, on K+ addition the absorption ofglucose and water increased remarkably (see Fig. 1 and compare Table 2with Table 3). Both phlorizin and phloretin decrease water and glucose

Fig. 4. Nucleotide and deduced amino acid of the partial sequence from the putative potassium/glucose cotransporter from Dysdercus peruvianus (DpSGLT). Potential lysineglycosylation residues are: 13, 50, 120, 136, 232, 284 and 328. Sequences presumed to correspond to membrane-spanning helices (TM 1–10) are underlined. Residues conservedamongst SGLT proteins are in italic and bold. DpSGLT GenBank accession number is GU066262.

5T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

absorption after 20 min of ingestion in the presence of K+ (Table 3).Glucose/Dye data with no cation are 100±20 (Table 2), whereas thefigures forNa+are 87±7and for K+ is 26±4 (Table 3). Glucose/Dyedatawith no cation are not significantly different (unpaired t-test) from datawithNa+. Thus, the data indicate the occurrence of a facilitative and a K+-driven glucose transporter, as Na+ does not increase glucose absorption.

The relative importance of GLUT- and SGLT-like transporters (namedfor the sake of brevity GLUT and SGLT, respectively) in water and glucoseabsorption may be evaluated if one assumes that phloretin and phlorizininhibition is due to GLUT and SGLT, respectively (Tables 4 and 5). GLUT ismore important than SGLT (Table 5). The results also showed that SGLTtransports more water molecules relative to glucose than GLUT (Table 5).

3.2. Molecular cloning and sequencing cDNAs coding for GLUT and SGLTfrom D. peruvianus midgut

Random sequencing of a cDNA library prepared from D. peruvianusmidgut led to the finding of BLAST-identified partial sequencescorresponding to GLUT (DpGLUT) and SGLT (DpSGLT).

Semi-quantitative RT-PCR analysis showed that the mRNAs forDpGLUT and DpSGLT are transcribed only in midguts and here only inanterior parts (Fig. 2). This lent support to the assumption that

DpGLUT and DpSGLT correspond to the physiologically identifiedtransporters in D. peruvianus midguts.

A cDNA containing the putative ORF corresponding to DpGLUTwascompleted by PCR with the use of the partial sequence and specificprimers taking the cDNA library as template. The complete GLUTsequence (Fig. 3) includes the signal peptide and the stop codon andcodes for a protein with 481 amino acid residues. The majortheoretical parameters of the protein are: molecular mass,56.62 kDa, pI, 8.94 and its GenBank accession number is GU014570.

DpGLUT shows the characteristic motifs of glucose facilitativetransporters (InterPro IPR003663, IPR005828, IPR005829), including the12 transmembrane sequences predicted by the software TMHMM 2.0(http://www.cbs.dtu.dk/services/TMHMM/) and the signatures(IIGINCGLNAGLAPLYINEVSPTKIR, SVWLVEKFGRKPLLLVA) recognized bythe software NPS@PROSCAN (http://www.npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_server.html) (Combet et al., 2000).DpGLUT has also 7 putative sites of N-glycosylation identified by thesoftware NetGlycate 1.0 (http://www.cbs.dtu.dk/services/NetGlycate/)(Johansen et al., 2006) (Fig. 3). DpGLUT is similar (39%) to humanGLUT 1.

DpSGLT was sequenced up until 395 residues that were sufficient todisplay the SGLT characteristic conserved residues Gly 95, Arg 135, Gly195, and Gly 196 (human SGLT1 numbering, Turk andWright, 1997) (seeFig. 4) and 10 of the expected 14 transmembrane regions. DpSGLT

Fig. 5. Alignment of the putative Dysdercus peruvianus protein encoded by DpSGLT with other sequences of cotransporters from insects and the human SGLT8. The sequences wereretrieved from NCBI Reference Sequence data bank with the following accession numbers: P. humanus corporis (Pediculus humanus corporis) (XP_002428928), A. aegypti (Aedesaegypti) (XP_001652483), C. quinquefasciatus (Culex quinquefasciatus) (XP_001844203.1) and H. sapiens SGLT8 (Homo sapiens) (AAP46193.1). The alignment was performed withClustalW in the standard conditions. Black balls indicate the four residues conserved that correspond to human SGLT1 residues Gly95 in the second external domain, Arg135 in thesecond internal domain, and Gly195 and Gly196 in the inward half of the transmembrane span 5 (Turk and Wright, 1997).

6 T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

GenBank accession number is GU066262. The similarities of DpSGLTwithhuman SGLT are: SGLT8, 37%; SGLT2, 24%; SGLT1, 14%. Alignment ofDpSGLTwith the sequences of human SGLT8 and those fromother insectsshowed that (Fig. 5): (1) DpSGLT lacks few residues at the N-terminuswhich corresponds to the cation binding site (Wright, 2001); (2) DpSGLTdid not include most of the C-terminus that includes C5, the residuesforming the sugar-binding translocating domain (Wright, 2001).

All insect sequences of SGLT-like proteins were recovered from thenon-redundant protein sequence data bank from the NCBI (http://www.ncbi.nlm.nih.gov) with the software BLASTP, using as query thesequence of DpSGLT. The sequences recovered were accepted afterbeing checked for the presence of the 4 SGLT-conserved residues. Thesequences pertained to several Paraneopteran (Phthiraptera andHemiptera) and Holometabolan (Hymenoptera, Coleoptera, and

Fig. 6. Cladogram of insect and chosen vertebrate SGLT sequences deposited in the non-redundant protein sequence data bank. The dendogram of SGLT sequences was generatedwith the neighbor-joining algorithm. The branches were statistically supported by Bootstrap analysis (cut-off 50) based on 1000 replicates. Only the N-terminal (430 residues) ofeach sequence was used to prepare the tree, because the N-terminal sequences of SGLT are more conserved. C, Coleoptera; D, Diptera; H, Hemiptera; Hy, Hymenoptera; Ph,Phthiraptera.

7T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

Diptera) orders. To have a balanced tree, Drosophila sequences wererestricted to those from the species melanogaster. As the N-terminalsequences of SGLT are more conserved, only the N-terminal (430

residues) of each sequence was used to prepare a sequencecladogram, including DpSGLT and human SGLT1, 2, and 8 (Fig. 6).There are several monophyletic branching with sequences from

8 T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

insects of different orders (Fig. 6). This means that there are severaldifferent SGLT-like proteins in insects and that they have divergedfrom the Paraneopteran–Holometabolan ancestor, or even earlier.

4. Discussion

4.1. Water and sugar transporters in the anterior midgut of D.peruvianus

Glucose and water absorptions by the anterior midgut of D.peruvianus were determined by feeding the insects with a glucose-non-absorbable dye solution, followed by periodical dissection andanalysis of midgut contents. The data showed that water and glucoseabsorptions are activated by K+ (but not by Na+) and are inhibited byphloretin (GLUT inhibitor) and phlorizin (SGLT inhibitor). These resultsmean that D. peruvianus uses a facilitative hexose transporter (GLUT-like transporter, GLUT for brevity) and a K+-glucose transporter (SGLT-like transporter, SGLT for brevity) to absorb dietary glucose and water,as observed in mammals (Loo et al., 1996; Zeuthen et al., 2007),although for some this is controversial (Duquette et al., 2001).Sequences homologous to GLUT (DpGLUT) and SGLT (DpSGLT) werefound by random sequencing a cDNA library corresponding to D.peruvianusmidgut. DpGLUT was almost completely sequenced (few N-terminal residues were lost) and classified into the class 1 of GLUT,whereas DpSGLT partial sequence has all the SGLT-conserved residuesand is closer to the louse sequence than to any other sequence (Fig. 6).As the louse SGLT is expected to cotransport Na+ and glucose, themajordifference separating the SGLT sequences are phylogenetic distancethan its specificity towards the cation cotransported with glucose.

There are several SGLT-like proteins in each insect and theseproteins seem to have diverged from the Paraneopteran–Holometa-bolan ancestor, or even earlier.

Both DpGLUT and DpSGLT mRNAs are expressed, according to RT-PCR data, only in the anterior midgut, where glucose and water areabsorbed. This lends support to the claim that DpGLUT and DpSGLTsequences actually correspond to the transporters functionallydetected in D. peruvianus midgut.

4.2. Absorption of sugar and water by the anterior midgut of D.peruvianus

Lipids are themajor storage reserve in cotton seeds that are also rich insugars,mainly the trisaccharide raffinose(galactose-α1, 6-glucoseα1,β2-fructose) (Shiroya, 1963). This sugar is hydrolyzed to an equimolecularmixture of glucose, fructose, and galactose in D. peruvianus anteriormidgut by the combined action of a soluble α-galactosidase (Silva andTerra, 1997) and a membrane-bound α-glucosidase (Silva and Terra,1995). Before proposing a model of how the resulting monosaccharidesare absorbed, it is necessary first to discuss the peculiarities of thehemipteran midgut cell biology.

Themicrovillar border ofmidgut cells inHemiptera is characterizedbythe presence of two membranes. The microvillar membrane (MM) isensheathed by the perimicrovillar membrane (PMM), which extendstoward the luminal compartment with a dead end. The MM and PMMdelimit a closed compartment, the perimicrovillar space (PMS) (Silva etal., 1995, 2004). PMM originates from double membrane vesicles that onattaining the cell apex fuse their outermembraneswithMMand the innermembranes with PMM. The double membrane Golgi cisternae, onbudding, form double membrane vesicles (Silva et al., 1995).

The remarkable hemipteran midgut cell apex is believed to be anadaptation that enabled the sap-sucking hemipteran ancestors to absorbdilutenutrients, suchas essential aminoacids, by aputativemechanismasfollows (Terra and Ferreira, 1994): MM actively transports K+ ions (themost important ion in sap and plant tissues) from PMS into midgut cells,generating a concentration gradient between the gut luminal contentsand PMS. This concentration gradient may be the driving force for the

active absorption of organic compounds by appropriate transporterspresent in PMM. Organic compounds once in the PMS, may diffuse up tospecific transporters on the microvillar surface.

DpSGLT should be located at PMMand transport K+with glucose intoPMS, in agreement with the proposed model. Nevertheless, thesimultaneous occurrence of DpGLUT at PMM is not clear at the moment.In mammals, GLUT is recruited to the intestine microvillar membrane inthe presence of high sugar content (Kellett and Helliwell, 2000; Kellett etal., 2008). Perhaps the same is true forD. peruvianus.Notice, however, thatsuch recruitment would bemuchmore complicated in hemipterans thanin mammals, because of the double membranes of the insect microvillarborder. FromPMS, glucoseprobably crosses theMM.Once inside the cells,glucose may be used to synthesize trehalose or pass into hemolymphthrough a putative GLUT placed at the basal membrane. Ion balance maybe assured by aNa+–K+–Cl− cotransporter placed at the basalmembranethat may resemble those found inmany epithelial cells, includingmidgutones (Gillen et al., 2006, and references therein). Water probably passesinto the hemolymph following glucose and/or accompanying the ionstransported by the putative basal Na+–K+–Cl− cotransporter.

The monosaccharides other than glucose formed during raffinosehydrolysis, fructose and galactose, are expected to follow a routesimilar to the one proposed for glucose.

The model of glucose and water absorption presented here shouldbe considered as a working hypothesis to guide new research aimedto bring light to this important physiological process.

Acknowledgements

This work was supported by the Brazilian research agenciesFAPESP and CNPq. We thank Dr. C. Ferreira for discussions and fouranonymous reviewers for their suggestions to improve the paper. T.D.Bifano and T.P. Alegria were graduate and undergraduate fellows,respectively, from FAPESP, whereasW.R. Terra is a staff member of hisdepartment and a research fellow of CNPq.

References

Caccia, S., Casartelli, M., Grimaldi, A., Losa, E., de Eguileor, M., Pennacchio, F., Giordana,B., 2007. Unexpected similarity of intestinal sugar absorption by SGLT1 and apicalGLUT2 in an insect (Aphidius ervi, Hymenoptera) and mammals. Am. J. Physiol.Regul. Integr. Comp. Physiol. 292, 2284–2291.

Chen, M.-E., Holmes, S.P., Pietrantonio, P.V., 2006. Glucose transporter 8 (GLUT8) fromthe red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae).Arch. Insect Biochem. Physiol. 62, 55–72.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acidguanidinium triocyanate–phenol–chloroform extraction. Anal. Biochem. 162,156–159.

Combet, C., Blanchet, C., Geourjon, C., Deléage, G., 2000. NPS@: Network ProteinSequence Analysis TIBS, 25, 3 [291], pp. 147–150.

Crailsheim, K., 1988. Intestinal transport of sugars in the honeybee (Apis mellifera). J.Insect Physiol. 34, 839–845.

Crane, R.K., Miller, D., Bihler, I., 1961. The restrictions on possible mechanisms ofintestinal active transport and metabolism. In: Kleizeller, A., Kotyk, A. (Eds.),Membrane Transport and Metabolism. Academic Press, London, pp. 439–449.

Dahlqvist, A., 1968. Assay of intestinal disaccharidases. Anal. Biochem. 22, 99–107.Duquette, P.-P., Bissonotte, P., Lapointe, J.-Y., 2001. Local osmotic gradients drive the

water flux associated with Na+/glucose cotransport. Proc. Nat. Acad. Sci. U.S.A. 98,3796–3801.

Escher, S.A., Rasmuson-Lestander, Å., 1999. The Drosophila glucose transporter gene:cDNA sequence, phylogenetic comparisons, analysis of functional sites andsecondary structures. Hereditas 130, 95–103.

Ewing, B., Green, P., 1998. Base-calling of automated sequencer traces using phred. II.Error probabilities. Genome Res. 8, 186–194.

Ewing, B., Hillier, L.D., Wendl, M.C., Green, P., 1998. Base-calling of automatedsequencer traces using Phred. I. Accuracy assessment. Genome Res. 8, 175–185.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.

Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M.R., Appel, R.D., Bairoch, A.,2005. Protein identification and analysis tools on the ExPASy server. In:Walker, J.M.(Ed.), The Proteomics Protocols Handbook. Humana Press, Totowa.

Gillen, C.M., Blair, C.R., Heilman, N.R., Somple, M., Stulberg, M., Thombre, R., Watson, N.,Gillen, K.M., Itagaki, H., 2006. The cation-chloride, masBSC, is widely expressed inManduca sexta tissues. J. Insect Physiol. 52, 661–668.

Giordana, B., Milani, A., Grimaldi, A., Farneti, R., Casartelli, M., Ambrosecchio, M.R.,Digilio, M.C., Leonardi, M.G., Eguileor, M., Pennacchio, F., 2003. Absorption of sugars

9T.D. Bifano et al. / Comparative Biochemistry and Physiology, Part B 157 (2010) 1–9

and amino acids by the epidermis of Aphidius ervi larvae. J. Insect Physiol. 49,1115–1124.

Hillis, D.B., Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessingconfidence in phylogenetic analysis. Syst. Biol. 42, 182–192.

Johansen, M.B., Kiemer, L., Brunak, S., 2006. Analysis and prediction of mammalianprotein glycation. Glycobiology 16, 844–853.

Kellett, G.L., Helliwell, P.A., 2000. The diffusive component of intestinal glucoseabsorption is mediated by the glucose-induced recruitment of GLUT2 to thebrush-border membrane. Biochem. J. 350, 155–162.

Kellett, G.L., Brot-Laroche, E., Mace, O.J., Leturque, A., 2008. Sugar absorption in theintestine: the role of GLUT2. Annu. Rev. Nutr. 28, 35-54.

Loo, D.D.F., Zeuthen, T., Chandy, G., Wright, E.M., 1996. Cotransport of water by the Na+/glucose cotransporter. Proc. Nat. Acad. Sci. U.S.A. 93, 13.367–13.370.

Nielsen,H., Engelbrecht, J., Brunak, S., vonHeijne, G., 1997. Identificationof prokaryotic andeukaryotic signal peptides and prediction of their cleavage sites. Prot. Engine. 10, 1–6.

Pascual, I., Berjón, A., Lostao, M.P., Barber, A., 2006. Transport of D-galactose by thegastrointestinal tract of the locust, Locusta migratoria. Comp. Biochem. Physiol. B.143, 20–26.

Price, D.R.G., Wilkinson, H.S., Gatehouse, J.A., 2007. Functional expression andcharacterisation of a gut facilitative glucose transporter, NlHT1, from thephloem-feeding insect Nilaparvata lugens (rice brown planthopper). InsectBiochem. Mol. Biol. 37 (11), 1138–1148.

Saitou, N., Nei, M., 1987. Neighbor-joining method: a new method for reconstructingphylogenetic trees. Mol. Biol. Evol. 4, 406–425.

Scheepers, A., Joost, H.-G., Schürmann, A., 2004. The glucose transporter families SGLTand GLUT: molecular basis of normal and aberrant function. J. Parenter. Nutr. 28,364–371.

Shiroya, T., 1963. Metabolism of raffinose in cotton seeds. Phytochemistry 2, 33–46.Silva, C.P., Ribeiro, F.A., Gulbenkian, S., Terra, W.R., 1995. Organization origin and

functions of the outer microvillar (perimicrovillar) membrane of Dysdercusperuvianus (Hemiptera) midgut cells. J. Insect Physiol. 41, 1093–1103.

Silva, C.P., Silva, J.R., Vasconcelos, F.F., Petretski, M.D.A., DaMatta, R.A., Ribeiro, A.F.,Terra, W.R., 2004. Occurrence of midgut perimicrovillar membranes in

paraneopteran insect orders with comments on their function and evolutionarysignificance. Arthropod Struct. Dev. 33, 139–148.

Silva, C.P., Terra, W.R., 1994. Digestive and absorptive sites along the midgut of thecotton seed sucker bug Dysdercus peruvianus (Hemiptera: Pyrrhocoridae). InsectBiochem. Mol. Biol. 24, 493–505.

Silva, C.P., Terra, W.R., 1995. An alpha-glucosidase from the perimicrovillar membranesof Dysdercus peruvianus midgut cells. Purification and properties. Insect Biochem.Mol. Biol. 25 (4), 487–494.

Silva, C.P., Terra, W.R., 1997. Alpha-galactosidase activity in ingested seeds and in themidgut of Dysdercus peruvianus (Hemiptera: Pyrrhocoridae). Arch. Insect Biochem.Physiol. 34, 443–460.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA 4.1: Molecular EvolutionaryGenetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599Publication PDF at (http://www.kumarlab.net/publications).

Terra, W.R., Ferreira, C., 1994. Insect digestive enzymes: properties,compartmentalization and function. Comp. Biochem. Physiol. B 109, 1–62.

Treherne, J.E., 1957. Glucose absorption in the cockroach. J. Exp. Biol. 34, 478–485.Treherne, J.E., 1958. The absorption of glucose from the alimentary canal of the locust

Schistocerca gregaria. J. Exp. Biol. 35, 297–306.Turk, E., Wright, E.M., 1997. Membrane topology motifs in the SGLT cotransporter

family. J. Memb. Biol. 159, 1–20.Turunen, S., Crailsheim, K., 1996. Lipid and sugar absorption. In: Lehane, M.J.,

Billingsley, P.F. (Eds.), Biology of the Insect Midgut. Chapman and Hall, London,pp. 293–320.

Wolfersberger, M.G., 2000. Amino acid transport in insects. Annu. Rev. Entomol. 45,111–120.

Wright, E.M., 2001. Renal Na+–glucose cotransporters. Am. J. Physiol. 280, F10–F18.Wright, E.M., Turk, E., 2004. The sodium/glucose cotransport family SLC5. Pfluegers

Arch. 447, 510–518.Zeuthen, T., Zeuthen, E., MacAulay, N., 2007. Water transport by GLUT2 expressed in

Xenopus laevis oocytes. J. Physiol. 579, 345–361.