TheAspergillus fumigatus cellobiohydrolaseB (cbhB )promoteris tightly regulatedand can be exploited for controlled proteinexpressionandRNAiMichael Bromley, Caroline Gordon, Nurıa Rovira-Graells & Jason Oliver

F2G Ltd, Lankro Way, Eccles, Manchester, UK

Correspondence: Michael Bromley, F2G Ltd.

Lankro Way, Eccles, Manchester, M30 0BH,

UK. Tel.: 144 161 785 1276; fax: 144 161

785 1273; e-mail: mikebromley@f2g.com

Received 7 July 2006; revised 23 August 2006;

accepted 24 August 2006.

First published online 19 September 2006.

DOI:10.1111/j.1574-6968.2006.00462.x

Editor: Bernard Prior

Keywords

Aspergillus fumigatus ; cbhB ;

cellobiohydrolase; RNAi; promoter.

Abstract

The utility of the Aspergillus fumigatus cellobiohydrolase cbhB promoter for

controlled gene expression has been investigated. cbhB message was present at high

levels in the presence of carboxymethylcellulose and undetected in the presence of

glucose. A reporter construct using the cbhB promoter showed similar behaviour

and gave lower message levels than the Aspergillus nidulans alcA promoter under

repressing conditions. An RNAi construct driven by the cbhB promoter was used to

down-regulate the alb1 gene; transformants showed low alb1 message levels and a

loss-of-function phenotype with carboxymethylcellulose, while both wild-type

message levels and phenotype were seen with glucose. The cbhB promoter is

therefore tightly controlled and can be exploited for the study of A. fumigatus.

Introduction

In recent years, the filamentous fungus Aspergillus fumigatus

has become a significant cause of infection in humans and as

such has become the focus of much study (Latge, 2001; Marr

et al., 2002). It is thought to be the leading mould pathogen

in leukaemia and transplant patients and is responsible for

mortality in a large number of individuals with immunolo-

gical disorders. Until quite recently, the ‘gold standard’

treatment for aspergillus infection has been the intravenous

application of amphotericin B. However, significant side-

effects, coupled with a poor treatment outcome, have lead to

the search for more efficacious and less toxic drugs. The

available alternatives, e.g. voriconazole and itraconazole,

show little improvement in outcome but do have fewer

side-effects (Denning, 1996; Herbrecht et al., 2002). How-

ever, isolates resistant to these azoles have been identified

(Mosquera & Denning, 2002). Current antifungal drugs are

directed against a narrow range of pathways and proteins

and the identification of novel targets is critical in the search

for new antifungal drugs. One aspect of this is the develop-

ment of new target validation technologies. In particular,

improved methods for controlled regulation of genes may be

used to investigate essentiality and therefore determine

whether a gene is suitable as a drug target.

Several inducible promoter systems have been developed

in filamentous fungi, namely the glaA, cbh1, alcA, thiA and

tet systems (Keranen & Penttila, 1995; Siedenberg et al.,

1999; Romero et al., 2003; Mouyna et al., 2004; Shoji et al.,

2005; Vogt et al., 2005); however, significant expression

occurs in repressed or ‘off ’ states. The development of an

inducible system with improved repressing capabilities is

therefore important to enable more complete analysis of

essential genes, particularly those expressed at low levels.

Here, we report studies of a number of A. fumigatus

promoters and show that the promoter for the cellobiohy-

drolase cbhB is tightly controlled, showing high message

levels in the presence of carboxymethylcellulose and low-to-

undetectable levels of message in the presence of glucose.

This represents a substantial improvement over other sys-

tems. We also show that the cbhB promoter is suitable for

protein expression and inducible RNAi studies.

Materials and methods

Aspergillus strains and culture conditions

All methods described used A. fumigatus clinical isolate

AF293 (NCPF7367) available from the NCPF at the Health

Protection Agency, Bristol, UK. Conidia were collected from

FEMS Microbiol Lett 264 (2006) 246–254c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

4- to 7-day-old cultures grown on Sabouraud Dextrose agar

flasks at 37 1C.

Construction of the expression plasmids andmodified A. fumigatus strains

All primers used for plasmid construction are given in Table

1. The cbhB promoter and terminator were amplified from

A. fumigatus genomic DNA. Primers cbhBp_f and cbhBp_r

were used to amplify a 1.2-kb fragment from � 1 bp of the

ATG codon from the cbhB gene (PcbhB). This fragment was

cloned into the EcoRI site of puc19. Primers cbhBt_f and

cbhBt_r were used to amplify a 0.8 kb from 11 of the TAG

stop from the cbhB gene (TcbhB). This fragment was cloned

into the XbaI site of the puc19-PcbhB plasmid. The hygro-

mycin selectable marker hph was amplified from the pAN7.1

vector using primers hyg_f and hyg_r and cloned into the

NarI site of the puc19-PcbhB-TcbhB plasmid to give plas-

mids pMJB104 and pMJB107 (Fig. 1).

The Escherichia coli lacZ gene was amplified from pDE1

(Fungal Genetics Stock Centre) using primers lacZ-XhoI_f

and lacZ-XhoI_r and cloned into the XhoI site of the pMJB104

and pMJB107 expression cassettes immediately downstream

of the promoter to act as a reporter gene, giving plasmids

pMJB110 and pMJB201, respectively (Fig. 1). The reporter

cassettes were introduced into A. fumigatus AF293 protoplasts

to generate strains AF110-1 and AF110-2 from plasmid

pMJB110 and AF201-1 and AF201-2 from plasmid pMJB201.

0.9 kb of the Aspergillus nidulans alcA promoter

was amplified from plasmid pAL3 (Waring et al., 1989)

Table 1. Primers used in this study

Primer Sequence� Enzyme

Plasmid construction

alcApF GAATTCGTCTGGGCCACAATAGACT EcoRI

alcApR GGTACCTTAAGGTTGTTATCGGTGGGGCGA KpnI

cbhBp_f CAATTGCCCAGGCCTAATGCATGCTG MunIw

cbhBp_r CAATTGCGGTAGGAGAAGGTGGAGGCC MunIw

cbhBt_f TCTAGAGCTAGCATGGGAGTGGTGGCCTCCTCG XbaIz

cbhBt_r ACTAGTCCAGGGGACTGTCGTGGTCAA SpeIz

hyg_f GGCGCCATCGATGTACAGTGACCGGTGACTCT NarI

hyg_r GGCGCCAAGAAGGATTACCTCTAAACA NarI

lacZ-XhoI_f CTCGAGATGGTCGTTTTACAACGTCGTGAC XhoI

lacZ-XhoI_f CTCGAGTTATTATTATTTTTGACACCA XhoI

RNAi_alb1_ant2_F TCTAGAAGCAACGCACGTGCTGCAT XbaI

RNAi_alb1_ant2_R TCTAGAAGCGAGTCCATGCCCATCT XbaI

RNAi_alb1_sense2_F GAGCTCAGCAACGCACGTGCTGCAT SacI

RNAi_alb1_sense2_R CCCGGGAGCGAGTCCATGCCCATCT Cfr9I

RNAi_EGFP_R TCTAGACTTCAGCTCGATGCGGTTC XbaI

RNAi_EGFP_F CCCGGGTCCAGGAGCGCACCATCTT Cfr9I

RT PCR

ACT470F TGGTGTCACTCACGTTGTCC

ACT960R TCATAGACGAGGGAGCAAGG

CBHAF CTCCTCATCCCTGTGACGAT

CBHAR GGCAACGTTGGAGACAGAGT

CBHBF GCTCAGCAGGTCGGTACTTC

CBHBR GCCTGACCGTTGATGAACTT

INVBF TGCGTGCTTCTTTCATTCTC

INVBR TGCGTCTGTAGCGTCTCAGT

Real-time PCR

RtalbF GGAGGATGCTGAGGCTGAC

RtalbR TCGTGTGGGTTGGTGTTGG

RtbtubF GCTCACTCTTTCCGTGCTGTCT

RtbtubR AGCAGGTGAGGTAACGTCCATT

RtcbhBF TTCGATGTCGATGTCTCCAA

RtcbhBR GCCTGACCGTTGATGAACTT

RtlacZF ATCCTCTGCATGGTCAGGTC

RtlacZR TATTGGCTTCATCCACCACA

�For primers including restriction enzyme sites, these are indicated by underlined bases and the enzymes given in the ‘enzyme’ column.wMunI has an overhang compatible with EcoRI.zXbaI and SpeI produce compatible overhangs.

FEMS Microbiol Lett 264 (2006) 246–254 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

247The Aspergillus fumigatus cbhB promoter

using primers alcApF and alcApR and cloned directionally

into the puc19 plasmid at the EcoRI and KpnI sites. The

E. coli lacZ gene was amplified as before but with AflII

linkers and introduced downstream of the alcA promoter.

Finally, the hygromycin resistance marker was introduced

into the NarI site as for the cbhB cassette to create

palcA–LacZ (Fig. 1).

The alb1 RNAi construct was produced in a manner

similar to that described in Liu et al. (2002). A sense and

antisense alb1 fragment corresponding to 497 bp of the gene

commencing at position 5142 bp from the start codon were

amplified from A. fumigatus genomic DNA. Primers

RNAi_alb1_sense2_F and RNAi_alb1_sense2_R with SacI

and Cfr9I linkers, respectively, were used to amplify the

sense fragment and primers RNAi_alb1_ant2_F, and

RNAi_alb1_ant2_R, which are the same as the sense primers

but with XbaI linkers, were used to produce the antisense

fragment. A buffer fragment was obtained using primers

RNAi_EGFP_F and RNAi_EGFP_R to amplify a 0.1-kb

fragment of the enhanced green fluorescent protein (EGFP)

gene from the pGFP-zeo plasmid. These fragments were

sequentially cloned into pMJB107 to give plasmid pALBR2

(Fig. 1). This cassette was introduced into A. fumigatus

AF293 protoplasts to generate strains ALBR2 A-D.

HindIII linearized plasmids were introduced into A.

fumigatus AF293 by transformation of protoplasts (D’En-

fert, 1996). Transformants were screened by PCR and only

those strains with complete expression cassettes were used in

further studies. For analysis of cbhB and alcA expression

cassettes, all transformant strains were confirmed to be

single copy by Southern analysis (data not shown).

b-galactosidase assay

1� 106 conidia mL�1 were inoculated into 50 mL of Vogel’s

media, 1% w/v glucose. Cultures were incubated for 14 h at

37 1C with shaking at 220 r.p.m. Biomass was collected and

0.3 g wet weight was used to inoculate Vogel’s media

supplemented with either 1% w/v glucose or 1% w/v

carboxymethylcellulose (CMC). Cultures were incubated

for 2, 4, 6 and 8 h at 37 1C with shaking at 220 r.p.m. for

CMC cultures and 4 h only for the glucose cultures.

Fifty milligrams wet weight biomass was placed in tubes

containing DNA lysing matrix (Bio 101) with 1 mL protein

extraction buffer (50 mM NaH2PO4 pH 7.0, 5 mM EDTA,

10 mM b-mercaptoethanol, 25 g mL�1 PMSF), and samples

were processed in a fastprep FP120 (Bio 101) for 20 s at

speed five. Sample were cooled on ice for 5 min, processed

pMJB201 10 424 bp

TtrpC

Pg

pd

A

PcbhB

LacZ

pALBR2 8453 bp

TtrpC

hph

Pgd

pA

PcbhBalb1

alb1

TcbhB

puc19

pMJB107 7361 bp

TtrpC

Pgpd

A

PcbhB

TcbhB

SpeI

XhoINar I

XbaI

HindIII

HindIII

HindIII

HindIII HindIII

HindIII

pMJB104 7361 bp

Ttrp

C

hph

hph

PgpdA

PcbhB

TcbhB

SpeIXhoI

Nar IXbaI

Nar I Nar I

palcA-LacZ 9267 bp

puc19TtrpC

hph

Pg

pd

A

PalcALacZ

pMJB110 10 424 bp

Pcbh

B

puc19

puc19

LacZ

Ttrp

C

hph

hphPgpdA

puc1

9

puc1

9

Fig. 1. Schematic representation of plasmid constructs. Plasmid pMJB104 shows the cbhB expression cassette in the same orientation as the selectable

marker for hygromycin (hph). In pMJB107, the orientation of the selectable marker is reversed. Plasmids pMJB110 and pMJB201 are derivatives of

pMJB104 and pMJB107 with the Escherichia coli lacZ gene under the control of the cbhB promoter. Plasmid pALBR2 is a derivative of pMJB107 with the

alb1 antisense construct immediately downstream of the cbhB promoter. The antisense construct comprises inverted repeats of alb1 flanking a buffer

sequence (X). Plasmid pAlcA-LacZ shows the AlcA promoter upstream of the E. coli lacZ gene.

FEMS Microbiol Lett 264 (2006) 246–254c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

248 M. Bromley et al.

again as before and the lysates were placed on ice for 20 min.

Protein extracts were separated from cellular debris by

centrifugation and stored in 200 mL aliquots at � 80 1C.

The b-galactosidase assay was performed in 96-well plates

using 100mL sample or standard (E. coli b-galactosidase,

Sigma) in protein extraction buffer and 100 mL ortho-

nitrophenol-b-D-galactoside (2 mg mL�1). Samples were in-

cubated at 37 1C for 1 h and then read at 415 nm.

Reverse Transcription-PCR analysis

1� 106 conidia mL�1 were inoculated into 50 mL of Vogel’s

media with 1% w/v glucose, 1% w/v sucrose or 1%

carboxymethylcellulose. Total RNA was extracted using the

FastRNA kit (QBIOgene) following the manufacturer’s in-

structions. cDNA was synthesized from 1 mg RNA using an

Avian Myeloblastosis Virus-Reverse Transcriptase kit (Pro-

mega) with random hexamers. Semi-quantitative PCR was

carried out using appropriate dilutions of cDNA and

primers; actin, ACT470F and ACT960R; invB, INVBF and

INVBR; cbhA, CBHAF and CBHAR; and cbhB, CBHBF and

CBHBR (Table 1). All PCRs comprised 30 cycles of 95 1C

1 min, 55 1C 1.5 min and 72 1C 1 min.

Real-time PCR analysis

cDNA was prepared as described above. The growth condi-

tions were as described in ‘b-galactosidase assay’, with

samples taken after 4 h. Reactions were carried out in an

iCycler thermal cycler fitted with an iQ real-time PCR

Detection System (BioRad) running iCycler iQ Optical

System software (version 3a, BioRad). PCRs were typically

performed in triplicate in 96-well plates with each 25 mL

reaction containing 12.5 mL iQ SYBR Green Super-mix

(BioRad), 5 pmol of each primer (Table 1) and 50 ng

template cDNA. PCR conditions were 3 min at 95 1C then

60 cycles of 30 s at 95 1C, 30 s at 55 1C and 15 s at 72 1C.

Fluorescence was measured at the end of the annealing step.

Average Ct points were calculated and the DDCt method

(Pfaffl, 2001) was used to calculate the relative expression

represented by the equation:

EDCtLacZðrepressed-inducedÞLacZ =E

DCtb-tubulinðrepressed-inducedÞb-tubulin :

Results

Regulation of the cellobiohydrolase andinvertase genes

Many of the fungal cellulases and invertases are known to be

regulated by carbon catabolite repression, via the creA-

mediated pathway. Initial experiments assessed the expres-

sion of candidate genes under conditions thought likely to

induce and repress.

Semi-quantitative PCR was used to assess the expression

of the invertase gene invB (Afu2g01240) from mycelia grown

in Vogel’s media using either 1% glucose or 1% sucrose as

the sole carbon source. At the 12-h time-point, products

were detected for invB at cDNA dilutions down to one in

5000 in the presence of sucrose and one in 500 in the

presence of glucose, indicating a 10-fold difference in invB

expression on sucrose compared with glucose, with expres-

sion still clearly visible on glucose (Fig. 2a). No difference

could be seen in the glucose and sucrose samples by the 16

and 24 h time-points (data not shown). Similar analysis was

CMC

cbhA

cbhB

Actin

cDNA dilutions

N − +

Glucose

cbhA

cbhB

Actin

(b)

Glucose

Sucrose

invB

Actin

invB

Actin

(a)

cDNA dilutions

N − +

cDNA dilutions

N − +

cDNA dilutions

N − +

Fig. 2. Regulation of invB, cbhA and cbhB genes by carbon sources.

Agarose gels showing semi-quantitative PCR using (a) invB primer sets on

cDNA samples from 1% (w/v) sucrose and glucose (Vogel’s) cultures after

12 h (b) cbhA and cbhB primer sets on cDNA samples from 1% CMC and

glucose (Vogel’s) cultures after 16 h. PCR was performed on actin as a

control to ensure that comparative levels of cDNA were present between

samples. Negative reverse transcriptase cDNA controls were performed

to demonstrate that there was no genomic DNA contamination.

FEMS Microbiol Lett 264 (2006) 246–254 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

249The Aspergillus fumigatus cbhB promoter

conducted for the invA gene (Afu6g05000) but no difference

could be seen at any time-point (data not shown).

Levels of mRNA for cbhA (Afu6g07070) and cbhB

(Afu6g11610) were determined for cultures grown in Vogel’s

media with either 1% glucose or 1% CMC as the sole carbon

source. Expression of both genes was detected at 16 h in

cultures grown with CMC, the cbhA gene being expressed c.

50-fold higher than the cbhB gene (Fig. 2b). No message

could be detected for cbhB in the presence of glucose at 16 h

even after extending the number of PCR cycles to 60. Low

levels of expression, representing an approximate 1000-fold

reduction on the CMC grown levels, were detected for cbhA

in glucose-grown cultures. Similar results were seen at 24 h

(data not shown). Insufficient biomass was obtained at the

12 h time-point to provide analysis. The promoter of the cbhB

gene therefore showed optimal expression characteristics and

was chosen for the development of an inducible system.

Reporter gene analysis of the cellobiohydrolaseB promoter

In filamentous fungi, transcriptional cis-acting elements are

generally thought to be restricted to 1 kb upstream of the

initiation codon (Punt et al., 1995). Therefore, 1.2 kB of the

cbhB upstream-regulatory region was amplified by PCR and

used in analysis of the promoter. Two plasmids were

constructed using the cbhB promoter coupled to the lacZ

reporter gene with the hygromycin marker gene hph, under

control of the strong gpdA promoter, in opposite orienta-

tions (Fig. 1). These constructs were used to transform

A. fumigatus strain AF293. Transformant strains AF110-1 and

AF110-2 from plasmid pMJB110 and strains AF201-1 and

AF201-2 from plasmid pMJB201 were selected for further

analysis. None of the strains showed any obvious phenotypic

variation from the wild-type strain and each carried only a

single copy of the transforming plasmid (data not shown).

To study the regulation of the cbhB promoter over time, b-

galactosidase activity was determined in crude protein extracts

from mycelia. Low levels of native b-galactosidase activity were

detected in the wild-type strain AF293, reaching a maximum

of around 0.9 U mg�1 of protein 8 h after transfer to CMC

(Fig. 3). No activity could be detected after 4 h on glucose.

For transformant strains AF110-1 and AF110-2, b-galac-

tosidase activity significantly above basal levels could be seen

after only 2 h on CMC and activity increased dramatically at

the 4-h time-point (Fig. 3). In comparison, no activity could

be detected in the 4-h glucose sample. The cbhB reporter

construct is therefore regulated in a manner similar to the

endogenous gene. Interestingly, transformants that were

generated using the pMJB201 plasmid, in which the cbhB

promoter is divergent from the selectable marker, showed

no b-galactosidase activity above basal levels even in the

presence of CMC (Fig. 2).

mRNA levels in transformant strains

To determine whether the absence of b-galactosidase activity

in pMJB201 transformant strains (AF201-1 and -2) repre-

sented inactivity of the promoter, quantitative analysis of

mRNA levels were performed using real-time PCR. Cultures

were grown as for the b-galactosidase activity experiment

and samples was taken 4 h after transfer to CMC or glucose.

Expression of the reporter gene could be detected in both

pMJB110-transformed strains (AF110-1 and -2) and

pMJB201-transformed strains (AF201-1 and -2). AF110-1

and -2 transformants on CMC showed lacZ levels that were

approximately a third of the control b-tubulin level; how-

ever, expression could still be detected on glucose at values c.

0.0

2.0

4.0

6.0

8.0

10.0

12.0

Af293 AF110-1 AF110-2 AF201-1 AF201-2

β-G

alac

tosi

das

e ac

tivi

ty f

rom

cru

de

pro

tein

ext

ract

s (U

mg

)

Glucose 4 h

CMC 2 h

CMC 4 h

CMC 6 h

CMC 8 h

Fig. 3. b-galactosidase activity of crude

protein extracts from wild-type (AF293) and

transformant AF110-1, -2, AF201-1 and -2

strains. After incubation for 14 h in 1% glucose

cultures, 0.3 g wet weight biomass was

transferred to fresh cultures. Samples were taken

from either 1% glucose (4 h after transfer) or 1%

CMC (2, 4, 6 or 8 h after transfer) cultures.

FEMS Microbiol Lett 264 (2006) 246–254c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

250 M. Bromley et al.

100-fold lower than that on CMC (Fig. 4a). In AF201-1 and

AF201-2, lacZ expression was c. 300-fold less than b-tubulin

levels on CMC, accounting for the inability to detect b-

galactosidase activity in these strains. On glucose, lacZ

expression was c. 100-fold lower than on CMC, 30 000-fold

less than the b-tubulin levels (Fig. 4a).

Expression of the native cbhB could not be detected in any

of the transformed stains on glucose, mirroring the results

from the wild-type strain (data not shown). However, on

CMC expression of cbhB could be clearly seen (Fig. 4a). The

levels of cbhB expression in the highly expressing lacZ strains

AF110-1 and -2 were reduced c. fivefold compared with the

AF201-1 and -2 strains, indicating that the activity of the

reporter gene was impacting on the expression levels of the

native cbhB gene (Fig. 4a).

Currently, the most efficient inducible promoter system for

use in Aspergillus strains is the A. nidulans alcA expression

system. We coupled the lacZ reporter cassette to the alcA

promoter to compare directly the alcA and cbhB expression

systems. The expression levels achieved using the alcA pro-

moter were very high and comparable to the expression of

b-tubulin (Fig. 4b). Upon repression, a 76-fold reduction in

expression was seen. The cbhB promoter system gave greater

reduction of expression, with the pMJB110 strains (AF110-1

and -2) giving a 123-fold decrease, while the pMJB201 strains

(AF201-1 and -2) gave a 119-fold decrease. Furthermore, the

actual levels of expression on glucose were much lower for the

cbhB system, particularly pMJB 201 strains.

The cbhB promoter can be used to regulate RNAi

Previous examples of regulated RNAi in A. fumigatus have

shown incomplete recovery of the wild-type phenotype,

presumably due to the leaky nature of the inducible promo-

ters (Romero et al., 2003). The strong regulation exhibited

by the cbhB promoter suggests that it could provide an

improved regulatory element for RNAi.

β-tubulin alcA (ind) alcA (rep) cbhB AF110 CMC

cbhB AF110 glucose

cbhB AF201 CMC

cbhB AF201 glucose

0.00001

0.0001

0.001

0.01

0.1

1

10

AF110-1 AF110-2 AF201-1 AF201-2

Rel

ativ

e ex

pre

ssio

n

0.00001

0.0001

0.001

0.01

0.1

1

10

Rel

ativ

e ex

pre

ssio

n =

1

(a)

(b)Fig. 4. Control of lacZ expression by the cbhB

promoter. (a) Expression levels of cbhB and lacZ

in strains AF110-1, -2, AF201-1 and -2, relative

to that of b-tubulin. After incubation for 14 h

in 1% glucose cultures, 0.3 g wet weight

biomass was transferred to fresh cultures.

Samples were taken 4 h after transfer from

either 1% glucose or 1% CMC cultures.

No expression of the native cbhB gene was

detected in the glucose cultures (not shown).

(b) Expression levels of the lacZ reporter gene

under the control of the alcA promoter of

A. nidulans compared with those seen for the

cbhB promoter. Levels are normalized to that

of b-tubulin. cbhB AF110 data are combined

data from the AF110-1 and -2 strains, while

AF201 data are combined data from the

AF201-1 and -2 strains.

FEMS Microbiol Lett 264 (2006) 246–254 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

251The Aspergillus fumigatus cbhB promoter

An RNAi construct under the control of the cbhB

promoter was produced (pALBR2; Fig. 1), targetting the

alb1 gene, which encodes a polyketide synthetase involved in

spore pigmentation (Tsai et al., 1998). In alb1� strains,

conidia have white spores as opposed to the green-blue

appearance of wild-type spores. The RNAi construct was

transcribed divergently from the marker gene hph. Of four

transformants containing the RNAi construct, all showed a

spore colour change on CMC, two (R2B and R2C) having

pure white colonies indicative of complete repression of alb1

(Fig. 5a). On glucose, R2B showed no obvious spore colour

difference compared with the wild-type strain, while R2C

100.0113.3

101.6

1.90

20

40

60

80

100

120

140

160

AF293 Glucose AF293 CMC R2B Glucose R2B CMC

AF

alb

1 re

lati

ve e

xpre

ssio

n

AF293

R2B

R2C

CMCGlucose

(a)

(b) Fig. 5. RNAi of alb1. (a) Phenotypic characteristics

of AF293 and transformant strains R2B and R2C

showing growth on Vogel’s media with either 1%

glucose or 1% CMC as the sole carbon source.

(b) Relative expression levels of alb1 in the AF293

wild-type strain and the transformant strain

R2B harbouring the alb1 RNAi construct. After

incubation for 14 h in 1% glucose cultures,

0.3 g wet weight biomass was transferred to fresh

cultures. Samples were taken 4 h after transfer

from either 1% glucose or 1% CMC cultures.

Expression was normalized to b-tubulin so that

direct comparisons could be made.

FEMS Microbiol Lett 264 (2006) 246–254c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

252 M. Bromley et al.

presented light green spores indicating partial reduction in

alb1 activity.

Real-time PCR was performed on the R2B strain to assess

expression of alb1 (Fig. 5b). alb1 expression on glucose

matched that of the wild-type strain, indicating that no

RNAi was occurring. On CMC, levels of alb1 expression

were o 2% of that seen in the wild-type strain.

Discussion

We have demonstrated that the cbhB promoter of A. fumiga-

tus is tightly regulated, providing quantitative evidence for

this. Few studies have to date focused on the quantitative

aspects of the control of gene expression by specific gene

promoters in Aspergilli, although this is a prerequisite for the

development of a robust expression system.

Our data for cbhA resemble those reported for the cbhA

gene of A. nidulans, which was induced by cellulose and

repressed by glucose (Lockington et al., 2002). However, the

regulation of the A. nidulans homologue seems to differ in

that it is negatively regulated by the global nitrogen metabo-

lite repression system mediated by areA. In contrast, we were

able to see expression of cbhA despite our experiments being

carried out in Vogel’s medium, which uses ammonium nitrate

as the nitrogen source. This indicates that there are differences

in cbhA regulation between the two species of Aspergillus.

We found that the cbhB promoter gave very low expression

levels on glucose and c. a 100-fold increase in the level of

message on CMC in our reporter strains. In our hands, the A.

nidulans alcA promoter yielded c. an 80-fold increase in level

of induced over repressed, and showed a higher level of gene

expression under repression than cbhB on glucose. The

effectiveness of A. nidulans alcA in A. fumigatus has pre-

viously been studied by Romero et al. (2003). Here, the

endogenous essential nudC gene was placed under the control

of the alcA promoter. Transformants containing the construct

were unable to grow on glucose (repressing conditions) but

could grow on threonine (inducing conditions), indicating

efficient control of the nudC gene. However, as the nudC gene

is essential, is was not possible to determine nudC message

levels under repressing conditions, although partially

repressed conditions gave substantial inhibition, estimated at

3–4% of induced levels. We suggest that if a high level of

control is required, the cbhB system may be more suitable

than alcA. It should be noted that our studies used CMC

as the sole carbon source. For comparative assessment

of growth, CMC alone may not be appropriate as it is such a

poor carbon source. Such studies can, however, be performed

using culture media supplemented with glycerol, as this

does not negatively affect the expression of the cbhB promoter

(M. Bromley, unpublished observation).

Two inducible systems based on noncarbon-based induc-

tion have been reported for use in Aspergilli. The thiA

promoter of A. oryzae is responsible for regulation of

thiamine biosynthesis and is repressed at the transcription

and translation levels by thiamine and has been shown to

regulate egfp expression in A. nidulans as well as A. oryzae

(Shoji et al., 2005). In addition, an E. coli promoter system

based on the tetracycline-resistance operon has been

adapted for use in A. fumigatus (Vogt et al., 2005). This

system provides a significant advance in inducible promoter

systems in filamentous fungi as it has the potential for

regulation during in vivo infection experiments. However,

both these systems share the same problem as the previously

described carbon-based systems in that significant expres-

sion still occurs in repressed or ‘off ’ states.

RNAi is an increasingly important system for the investi-

gation of gene function in fungi; however, little has as yet

been done with a regulated system in the human pathogen

A. fumigatus. Mouyna et al. (2004) used the A. niger glaA

promoter in A. fumigatus to drive RNAi constructs directed

against alb1 and b(1-3) glucan synthase (fks1). While

inhibition was successful, under repressed conditions (xy-

lose), the fks1 construct was found to be leaky, with RNA

levels 25% of those in wild-type strain. In comparison, our

levels on glucose were the same as the wild type. Like us,

Mouyna et al. observed a range of phenotypes on induction,

from partial to full knockout. It was suggested that this

could be due to different sites of integration of the RNAi

construct, leading to variations in the efficiency with which

the construct is expressed. This could be overcome using a

nonintegrative plasmid such as AMA.

For studies of gene function and RNAi experiments in

particular, effective repression is as important a factor as

good levels on induction. Our data indicate that, in A.

fumigatus, cbhB is more suitable than existing promoter

systems and should facilitate the identification of essential

genes in A. fumigatus, thereby contributing to the discovery

of novel anti-fungal drug targets.

Acknowledgements

The authors would like to thank Peter Hey for his technical

assistance. The cbhB promoter system is the subject of patent

application GB602435.

References

D’Enfert C (1996) Selection of multiple disruption events in

Aspergillus fumigatus using the orotidine-50-decarboxylase

gene, pyrG, as a unique transformation marker. Curr Genet 30:

76–82.

Denning DW (1996) Therapeutic outcome in invasive

aspergillosis. Clin Infect Dis 23: 608–615.

FEMS Microbiol Lett 264 (2006) 246–254 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

253The Aspergillus fumigatus cbhB promoter

Herbrecht R, Denning DW, Patterson TF et al. (2002)

Voriconazole versus amphotericin B for primary therapy of

invasive aspergillosis. N Engl J Med 347: 408–415.

Keranen S & Penttila M (1995) Production of recombinant

proteins in the filamentous fungus Trichoderma reesei. Curr

Opin Biotechnol 6: 534–537.

Latge JP (2001) The pathobiology of Aspergillus fumigatus. Trends

Microbiol 9: 382–389.

Liu H, Cottrell TR, Pierini LM, Goldman WE & Doering TL

(2002) RNA interference in the pathogenic fungus

Cryptococcus neoformans. Genetics 160: 463–470.

Lockington RA, Rodbourn L, Barnett S, Carter CJ & Kelly JM

(2002) Regulation by carbon and nitrogen sources of a family

of cellulases in Aspergillus nidulans. Fungal Genet Biol 37:

190–196.

Marr KA, Patterson T & Denning D (2002) Aspergillosis.

Pathogenesis, clinical manifestations, and therapy. Infect Dis

Clin North Am 16: 875–894.

Mosquera J & Denning DW (2002) Azole cross-resistance in

Aspergillus fumigatus. Antimicrob Agents Chemother 46:

556–557.

Mouyna I, Henry C, Doering TL & Latge J-P (2004) Gene

silencing with RNA interference in the human pathogenic

fungus Aspergillus fumigatus. FEMS Microbiol Lett 237:

317–324.

Pfaffl MW (2001) A new mathematical model for relative

quantification in real-time RT-PCR. Nucleic Acids Res 29:

2002–2007.

Punt PJ, Strauss J, Smit R, Kinghorn JR, van den Hondel CA &

Scazzocchio C (1995) The intergenic region between the

divergently transcribed niiA and niaD genes of Aspergillus

nidulans contains multiple NirA binding sites which act

bidirectionally. Mol Cell Biol 15: 5688–5699.

Romero B, Turner G, Olivas I, Laboura F & De Lucas JR (2003)

The Aspergillus nidulans alcA promoter drives tightly regulated

conditional gene expression in Aspergillus fumigatus

permitting validation of essential genes in this human

pathogen. Fungal Genet Biol 40: 103–114.

Shoji JY, Maruyama J, Arioka M & Kitamoto K (2005)

Development of Aspergillus oryzae thiA promoter as a tool for

molecular biological studies. FEMS Microbiol Lett 244: 41–46.

Siedenberg D, Mestric S, Ganzlin M, Schmidt M, Punt PJ, van den

Hondel CAMJJ & Rinas U (1999) GlaA promoter controlled

production of a mutant green fluorescent protein (S65T)

by recombinant Aspergillus niger during growth on defined

medium in batch and fed-batch cultures. Biotechnol Progr 15:

43–50.

Tsai HF, Chang YC, Washburn RG, Wheeler MH & Kwon-Chung

KJ (1998) The developmentally regulated alb1 gene of

Aspergillus fumigatus: its role in modulation of conidial

morphology and virulence. J Bacteriol 180: 3031–3038.

Vogt K, Bhabhra R, Rhodes JC & Askew DS (2005) Doxycycline-

regulated gene expression in the opportunistic fungal

pathogen Aspergillus fumigatus. BMC Microbiol 5: 1.

Waring RB, May GS & Norris NR (1989) Characterization of an

inducible expression system in Aspergillus nidulans using alcA

and tubulin-coding genes. Gene 79: 119–130.

FEMS Microbiol Lett 264 (2006) 246–254c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

254 M. Bromley et al.