TGF-β1 and IGF-1 and Anastomotic Recurrence of Crohn’sDisease After Ileo-Colonic Resection

Marco Scarpa & Marina Bortolami & Susan L. Morgan &

Andromachi Kotsafti & Cesare Ruffolo & Renata D’Incà &

Eugenia Bertin & Lino Polese & Davide F. D’Amico &

Giacomo C. Sturniolo & Imerio Angriman

Received: 19 May 2008 /Accepted: 22 July 2008 /Published online: 13 August 2008# 2008 The Society for Surgery of the Alimentary Tract

AbstractBackground After bowel resection, Crohn’s disease (CD) recurs frequently in the site of the anastomosis. Alteration ofnormal healing processes may play a role in this phenomenon. Transforming growth factor beta (TGF-β) and insulin-likegrowth factor (IGF-1) are involved in wound healing mechanisms with pro-fibrogenic properties. The aim of this study wasto assess the expression of TGF-β1 and insulin-like growth factor 1 (IGF-1) in the different zones of the bowel wall tounderstand why side-to-side anastomosis are associated to a lower recurrence rate compared to end-to-end ones.Patients and Methods Seventeen patients affected by CD who underwent ileo-colonic resection from 2004 to 2005 wereenrolled in this study. Full-thickness tissue samples were obtained from the mesenteric, the lateral, and the anti-mesentericsides of the macroscopically diseased and healthy ileum for each patient. TGF-β1 and IGF-1 messenger RNAs (mRNAs)were quantified by real-time polymerase chain reaction. Myeloperoxidase activity and histological disease activity wereassessed to quantify the ileal inflammation. Vimentin, desmin, and α-smooth muscle actin were stained withimmunohistochemistry to assess the fibroblast, smooth muscle cell, and myofibroblasts populations. Comparisons andcorrelations were carried out with nonparametric tests.Results In diseased ileum, TGF-β1 mRNA transcripts in the antimesenteric side were significantly lower than those of themesenteric side (p=0.05), and a significant correlation between TGFβ-1 levels in diseased bowel and the sampling site wasobserved (τ=0.36, p=0.03). On the contrary, neither the IGF-1 mRNA transcripts nor the distribution of fibroblast, smoothmuscle cell, and myofibroblasts populations showed any relation with the sampling site.Conclusion TGF-β1 mRNA expression was lower in the anti-mesenteric side of the diseased ileum, and this was consistentwith the success of side-to-side anastomosis in preventing CD recurrence. Since high expression of TGF-β1 was associatedto early recurrence, it seems rationale to construct the anastomosis on the anti-mesenteric side of the bowel.

J Gastrointest Surg (2008) 12:1981–1990DOI 10.1007/s11605-008-0641-5

Presented as a poster at the Digestive Disease Week, San Diego, CA,USA, May 19–24, 2008.

M. Scarpa (*) :C. Ruffolo : E. Bertin : L. Polese :D. F. D’Amico : I. AngrimanClinica Chirurgica I, Dipartimento di ScienzeChirurgiche e Gastroenterologiche,Policlinico Universitario,Università di Padova,via Giustiniani 2,35128 Padova, Italye-mail: marcoscarpa73@yahoo.it

M. Bortolami :A. Kotsafti : R. D’Incà :G. C. SturnioloGastroenterologia, Dipartimento di ScienzeChirurgiche e Gastroenterologiche, University of Padova,Padova, Italy

S. L. MorganDepartment of Pathology, Institute for Cancer Studies,Birmingham Medical School, University of Birmingham,Birmingham, UK

Keywords Crohn’s disease . Recurrence . TGF-β1 . IGF-1 .

Anastomosis

Introduction

One of the most common problems in the surgical treatmentof Crohn’s disease (CD) is the high frequency of recurrencein the site of the anastomosis after bowel resection.1,2

Several factors have been investigated for their supposedinfluence in this phenomenon but only elimination ofsmoking and prophylactic treatment with full dose 5ASAafter resection seem to reduce Crohn’s recurrence rate aftersurgery.3–5

The role of the type of anastomosis appears to be stillcontroversial. While some authors denied any influence ofthe type of the anastomosis,4–7 some other evidenced thatstapled side-to-side anastomosis after ileo-colonic resectionobtained less anastomotic recurrence compared to hand-sewn end-to-end anastomosis.8–11 Their hypothesis wasthat, even if the presence of the anastomosis on itself seemsto predispose to recurrent CD, some local factors such assuture material, local ischemia, and sub-acute obstructionwith subsequent fecal stasis might play a major role in thepathogenesis of anastomotic recurrence.11–13 In our previ-ous studies, the side-to-side configuration resulted to delaythe anastomotic recurrence independently from the type ofsuture.14,15 This conclusion was exclusively clinical since itwas obtained from the analysis of the recurrence rate afterthe different type of anastomosis, and the physiopathologyof this phenomenon remains still unknown. While end-to-end or end-to-side anastomoses involve all the ileal wallsides, the side-to-side anastomosis involves primarily theanti-mesenteric side of the gut wall. A fascinating hypothesiswas that, beside the width of the anastomosis, the site of theanastomosis may play a crucial role in CD recurrence.

Transforming growth factor beta (TGF-β) belongs to afamily of multi-functional 12-kDa polypeptide dimersproduced by a wide variety of lymphoid and non-lymphoidcells appearing to be involved in the regulation of organfibrosis.16 TGF-β functions as a healing mediator as well asan inhibitor of T and B cell proliferation and cytokineproduction.17,18 In an our previous study, the high levels ofTGF-β1 in healthy ileum of patients who undergo ileo-colonic resection for CD were demonstrated to be associatedwith early clinical disease recurrence.19

Insulin-like growth factor 1 (IGF-1) is the main localeffector of growth hormone stimulation on target cells inthe liver and other target tissues including the intestine.20 Itis a potent enterotrophic factor in the healthy intestineplaying a relevant role in chronic inflammation and woundhealing process in CD because of its pro-fibrogenicactions.20,21 In the intestinal tract, IGF-1 stimulates prolifer-

ation of fibroblasts, myofibroblasts, and smooth muscle cells,all implicated as cellular mediators of fibrosis in CD.22

The main aim of this study was to evaluate theexpression of TGF-β1 and IGF-1 in the different (mesenteric,lateral, and anti-mesenteric) sides of the ileum wall that couldbe involved in the anastomosis in patients with CD.Secondary end-point was to analyze the in vivo interactionof these cytokines with mesenchymal cell populations(fibroblast, smooth muscle cell, and myofibroblast) in healthyand diseased bowel wall in CD.

Patients and Methods

Patients and Study Design

Seventeen patients affected by CD who underwent ileo-colonic resection from 2004 to 2005 in our departmentwere enrolled in this study. The study was performedaccording to the Helsinki declaration principles, andadequate informed consent was obtained from all personsinvolved. Patients were enrolled consecutively providedthat adequate intestinal samples were available. Patientswho presented also other bowel diseases, such as cancer, orwere submitted to procedures different from ileo-colonicresection and patients with an ileostomy were excluded. Allthe patients received oral mesalazine as prophylactictherapy at the dose of 2.4 g/die at their discharge and werestrongly advised against smoking. Patient’s characteristicsare shown in Table 1.

Clinical disease activity was quantified with a modifiedversion of the Harvey–Bradshaw Activity Index (HBAI)23,24

that included a number of soft stools per day, abdominalpain, general well-being, extra-intestinal complications, andthe presence of abdominal mass.

Tissue Sampling

Ileal wall samples from the operative specimens had beenstored at −80°C immediately after the operation. Tissuesamples were obtained from the surgical specimen of theterminal ileum at the ileo-colonic resection. Complete rings(1-cm thickness) of ileal wall from the diseased ileum andfrom the healthy ileum were obtained as shown in Fig. 1.After an accurate cleaning of mesenteric fat, the “rings”were divided in the four sectors (mesenteric, anti-mesenteric,and two lateral). A 3-mm full thickness intestinal wall samplewas obtained from each sector of the macroscopicallydiseased and healthy ileum. Each sample was divided in twoparts, and one was stored in liquid nitrogen (−80°C) formolecular analysis, and one was preserved in 10% formalinsolution for histological analysis. In every side standardhistology, myeloperoxidase (MPO) activity assay, vimentin,

1982 J Gastrointest Surg (2008) 12:1981–1990

desmin, and α-smooth muscle actin (α-SMA) immuno-histochemical staining, and the determination of IGF-1 andTGF-β1 tissutal expression were performed. Each sample wasthen analyzed separately.

Tissutal Expression of TGF-β1 and IGF-1

RNA Isolation

Total RNAwas extracted from frozen small bowel tissue byacid guanidium thiocyanate–phenol–chloroform accordingto the Chomczynski and Sacchi method.25 RNA concen-tration was quantified spectrophotometrically. Integrity ofthe RNA sample was assessed by electrophoresis on a 2%agarose gel (FMC Bio Product, Rockland, ME, USA)containing ethidium bromide. Moreover, the quality of theisolated RNA was assessed using RNA 6000 Nano Assayand the Agilent 2100 bioanalyzer (Agilent technologiesPalo Alto, CA, USA). Bioanalyzer uses gel electrophoresisin the confines of a micro-fabricated chip and highlysensitive laser induced fluorescence detection using anintercalating dye, which is added to the polymer.

Reverse Transcription

Complementary DNA (cDNA) was synthesized with 2 μgof RNA, which was reverse transcribed in a final volume of

40 μl in the presence of 1X polymerase chain reaction(PCR) buffer, 1 mM each of dNTPs (dATP, dTTP, dCTP,and dGTP), 1 U/μl RNase inhibitor, 2.5 μM randomhexamers, 2.5 U/μl of murine leukemia virus (PerkinElmer, Foster City, CA, USA). The reverse transcriptionreaction was performed at 25°C for 10 min, 42°C for15 min, and 99°C for 5 min, and carried out in a PerkinElmer GeneAmp PCR System 2400. The cDNAwas storedat −20°C.

SYBR Green I Real Time PCR

The ABI 7900 Sequence Detection System (AppliedBiosystems, Foster City, CA, USA) was used to develop aquantitative real time PCR with the fluorescent dye SYBRGreen methodology. The reaction was performed in 96-wellthin-wall optical plate. PCRs were carried out in a 25-μlfinal volume containing 1× SYBR Green Master Mix(Applied Biosystems), 300-nM primers (each), and 1-μlcDNA template. After one 2-min step at 50°C to allowuracil DNA glycosylase (UDG) to act and a second one at95°C for 10 min to inactivate the UDG and activate Taqpolymerase, samples were subjected to 45 cycles of 45 s at94°C (denaturation) followed by 45 s at 62°C (annealingand extension) for TGF-β1, IGF-1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

All the determinations were performed in triplicates inorder to estimate the reproducibility. Samples in which thecDNA was omitted, as negative controls, were used. Eachassay included “no template” controls and standard curve

Figure 1 Complete rings (1-cm thickness) of ileal wall from thediseased ileum and from the healthy ileum were obtained, and after anaccurate cleaning of mesenteric fat, the “rings” were divided in thefour quadrants (mesenteric, anti-mesenteric, and two lateral).

Table 1 Patients Clinical Characteristics

Patients characteristics Median Range

DemographyGender 11 males 6 femalesAge at ileocolonic resection (years) 37.5 19–73Age at CD diagnosis (years) 21.5 14–43CD duration (months) 90 8–276Indication for operationRecurrent CD 3/17Fistulizing CD 2/17Stenosing CD 15/17Disease activity at operationHarvey–Bradshaw activity index 4 1–11Number of daily stool 2 1–12Abdominal mass 5/17Abdominal pain 15/17Weight (kg) 59 46–80Hb g/l 14.1 10.5–16.3Ht % 41.75 34.5–48WBC×10.9/l 9.355 4.61–12.17PMN×10.9/l 6.805 3.21–10.52CRP mg/l 15 3.19–64.3ESR mm/h 36 17–73albumin g/l 34.16 20.76–45.5

No correlation between any of the serum markers of inflammation, ESR,or CRP and tissue inflammation or disease recurrence was observed.

J Gastrointest Surg (2008) 12:1981–1990 19831983

for each gene of interest. Nucleotide sequences for senseand anti-sense primers were synthesized to generate thefollowing oligonucleotides. The sequences for the primer ofTGF-β1 were 5′ AACCCACAACGAAATCTATGACAAG3′ (forward) and 5′ AGAGCAACACGGGTTCAGGTA 3′(reverse), and the length of this amplicone was 78 bp; thosefor IGF-1 were 5′ GGCGCTTGAGTTGCTGAGA 3′(forward) and 5′ ACTAGTTGGCCAGTTATTTGGATAGC3′ (reverse), and the length of this amplicone was 133 bp;those of GAPDH were 5′ GACACCCACTCCTCCACCTTT 3′ (forward) and 5′ TTGCTGTAGCCAAATTCGTTGT 3′ (reverse), and the length of this amplicone was101 bp.

Quantification of Gene Expression

The messenger RNA (mRNA) amounts of the unknownsamples were determined from the standard curves con-taining 108, 107, 106, 105, 104, 103, 102, and ten copies/wellfor each primer pair considered. To obtain the normalizedamount of transcripts, the TGF-β1, IGF-1 mRNA amountswere divided by the GAPDH mRNA amount for eachsample.

Histological Assessment

Histology

After fixation in 10% neutral buffered formalin, the speci-mens were dehydrated and embedded in paraffin wax;sections of 3 μm were produced and then stained withhematoxylin–eosin. In 2006, a gastro-intestinal pathologist(S.M.), unaware of the MPO, TGF-β1, and IGF-1expression results, reviewed the microscopic slides fromsurgical specimens. Since an established histologicalclassification for disease activity was not evident in theliterature, a ad hoc scoring system was devised to quantifythe severity of inflammation as shown in Table 2.19

Histochemistry and Immunohistochemistry

Histochemical staining for assessment of collagen depositionwas performed using a standard Masson’s trichrome protocol.Immunohistochemical staining was performed using the DakoEnVision horse radish peroxidase system according to themanufacturer’s instructions (Dako Corporation, Carpenteria,California, USA). Primary antibodies were used at a dilutionof 1:100 (Vimentin and α-SMA, Dako Corporation) andvisualized using 3′3′-diaminobenzidine (Sigma).

Sections were independently evaluated by a gastrointes-tinal histopathologist (S.M.) and graded for the presenceand severity of: fibrosis, neural hyperplasia, submucosalmuscularization, and myofibroblast proliferation. Thesefeatures were chosen because they were prominent featuresin these specimens and been identified as importantmorphological parameters of disease by other investigators.26

Fibrosis was assessed on the hemotoxylin and eosin,Masson’s trichrome, and immunohistochemical (Vimentin+,α-SMA−) stains. Neural hyperplasia was assessed on thehemotoxylin and eosin stain. Submucosal muscularization(Vimentin−, α-SMA+) and myofibroblast proliferation(Vimentin+, α-SMA+) was assessed using the hemotoxylinand eosin in conjunction with the immunohistochemicalstains. All these features were evaluated on a semi-quantitative scale of 0–3, where 0 = none present, 1 = focaland/or mild degree, 2 = moderate degree, and 3 = prominent/severe degree. An example of prominent fibrosis, submuco-sal muscularization and myofibroblast proliferation is shownin Fig. 2.

MPO Activity Assay

Myeloperoxidase (MPO) activity was evaluated as parameterof local inflammation.24,25 MPO activity assay was per-formed to quantify ileal inflammation. Ileal samples wereminced in 1 ml of 50 mM potassium phosphate buffer(pH 6.0) containing 14 mM hexadecyltrimethyl–ammonium

Table 2 Histological Ad HocInflammation Score Score Description

Inflammation score0 No inflammation (excluding mild serosal inflammation intraoperative)1 Mild, acute, or chronic inflammation limited to the mucosa,

without crypt abscesses or ulceration2 Moderate inflammation, as above but including crypt abscesses,

small apthous ulcers, and transmural inflammation3 Large areas of acute ulceration, superficial, or fissuring

Granuloma score0 None1 Occasional multinucleated giant cells2 Microgranulomas3 Well-formed granulomas

1984 J Gastrointest Surg (2008) 12:1981–1990

bromide (Fluka), homogenized, and sonicated. The lysateswere frozen and thawed three times, then centrifuged for2 min in cold at 15,000×g. Aliquots of the supernatants weremixed with potassium phosphate buffer containing o-dianisidine–HCl (Sigma-Aldrich, St. Louis, MO, USA) and0.0005 % H2O2. MPO activity was expressed as units pergram of wet tissue. The change in absorbance at 460 nm wasassessed with a spectrophotometer. The enzyme unit wasdefined as the conversion of 1 μmol of H2O2 per min at 25°C,and it was normalized as unit per gram tissue.27,28

Blood Tests

Blood samples were taken from fasting patients on the daybefore the operation. Systemic inflammatory activity was

assessed by erythrocyte sedimentation rate (ESR), whiteblood cell count (WBC), polymorphonuclear cells count(PMN), and C-reactive protein (CRP). ESR was measuredby the Westergren method. CRP was detected by immuno-nephelometry (normal, <6 mg/l; pathological, >6 mg/l).Total protein and albumin were assessed with the biuretemethod. WBC, PMN, and hemoglobinemia (Hb) wereobtained with standard full blood cell count.

Statistical Analyses

Since no assumption on normality of the distribution of thedata was possible, they were presented as median (range)unless otherwise specified and non-parametric statistics wasused. Comparisons were performed with Wilcoxon

Figure 2 a (1) Hematoxylin- and eosin-stained section of affectedbowel in Crohn’s disease showing an area of myofibroblasticproliferation, (2) positive vimentin staining in the same area, and (3)positive α-smooth muscle actin in the same area. b (1) Hematoxylin-and eosin-stained section of affected bowel in Crohn’s diseaseshowing an area of submucosal muscularization, (2) negative vimentin

staining in the same area, and (3) positive α-smooth muscle actin inthe same area. MM muscularization. c (1) Hematoxylin- and eosin-stained section of affected bowel in Crohn’s disease showing an areaof fibrosis in the bowel wall, (2) positive vimentin staining in the samearea, and (3) negative α-smooth muscle actin in the same area.

J Gastrointest Surg (2008) 12:1981–1990 19851985

matched-pair test or with Kruskal–Wallis analysis ofvariance (ANOVA) where appropriated. Linear associationbetween wound repair parameters was quantified usingKendall t correlation test; only correlations with t>0.30were considered relevant. Statistical significance was set atp<0.05 for all tests.

Results

In diseased ileum, TGF-β1 mRNA transcripts in theantimesenteric side were significantly lower than those ofthe mesenteric side [0 (0–0.118) versus 1.018 (0–11.497),p=0.05], and a significant correlation between TGFβ-1mRNA transcripts and the sampling site was observed(t=0.36, p=0.03). As shown in Fig. 3, the closer thesampling site was to the mesenteric side, the higher werethe TGFβ-1 mRNA transcripts. In comparison, neitherIGF-1 mRNA transcripts nor MPO activity, inflammatoryscore, presence of granuloma, neural hyperplasia, submu-cosal muscularization, myofibroblast proliferation, andfibrosis showed any relation with the sampling site.Comparison of TGFβ-1, IGF-1 mRNA transcripts levels,MPO activity inflammatory score, presence of granuloma,neural hyperplasia, submucosal muscularization, myofibro-blasts proliferation, and fibrosis in the different quadrants ofthe ileal wall are shown in Table 3.

As might be expected, histological scoring demonstrateda high median score for inflammatory parameters inmacroscopically diseased bowel and a low median scorein healthy bowel (p<0.01). Similarly, the prevalence ofgranuloma was higher in the diseased bowel compared to

that in the healthy intestine (mean±standard deviation:0.65±1.15 versus 0.26±0.77, p=0.04). No significantdifference was observed in TGFβ-1 and IGF-1 mRNAtranscripts levels in diseased ileum compared to the healthyone. Submucosal muscularization, fibrosis, and neuralhyperplasia were significantly more evident in the diseasedbowel compared to the healthy one (p<0.01, p<0.01, andp=0.02, respectively). In particular, active myofibroblastswere observed significantly more frequently in the diseasedthan in the healthy bowel (mean±standard deviation: 0.35±0.66 versus 0.02±0.15, p=0.02). A comparison of TGFβ-1,IGF-1 mRNA transcripts levels, MPO activity, inflamma-tory score, presence of granuloma, neural hyperplasia,submucosal muscularization, myofibroblast proliferation,and fibrosis in diseased versus healthy bowel is shown inTable 4.

In the diseased ileum and in the healthy ileum, TGFβ-1mRNA transcripts levels correlated directly with therespective IGF-1 mRNA transcript levels. However, inter-estingly, TGFβ-1 expression in the diseased bowel corre-lated inversely with the IGF-1 expression and with thegrade of submucosal muscularization in healthy bowel(even if this last correlation showed just a trend towardsignificance). In healthy ileum, TGFβ-1 mRNA transcriptlevels also correlated inversely with neural hyperplasia. Inthe diseased ileum, prevalence of myofibroblasts stronglycorrelated with IGF-1 mRNA transcript levels, while theircorrelation with TGFβ-1 mRNA levels showed just a trendtoward significance. IGF-1 mRNA in the healthy bowelcorrelated directly with the MPO activity in the diseasedbowel. Relevant correlation between TGFβ-1, IGF-1mRNA transcripts levels in the ileum wall of patients withCD and local inflammation, and wound repair parameterswere shown in Table 5.

Discussion

Our data showed that, in diseased ileum of CD patients,TGF-β1 mRNA expression was lower in the anti-mesen-teric side, and a significant correlation between TGFβ-1mRNA transcripts and the sampling site was observed.TGF-β1 mRNA expression in CD localized mostly to cellsof the lamina propria with the highest concentration ininflammatory cells closest to the luminal surface.29 Theanti-mesenteric zone might have a relatively more periph-eral vascular and lymphatic system compared to themesenteric zone that could affect the number of laminapropria cells. The lack of activation of TGF-β-mediatedpathways might decrease the extracellular matrix generationand, subsequently, the intramural fibrosis that leads tointestinal obstruction.30 Since low expression of TGF-β1 inthe ileum wall was associated to a lower rate of recur-

Figure 3 The closer the sampling site was to the mesenteric side, thehigher were the TGFβ-1 mRNA transcripts levels.

1986 J Gastrointest Surg (2008) 12:1981–1990

rence,19 this could explain, in part, why constructing theanastomosis on the anti-mesenteric side of the bowel in aside-to-side configuration could minimize the recurrence riskof CD. On the other hand, the fact that no other fibrogenicparameter showed any relation with the sampling site maysuggest caution in taking this conclusion. From this point ofview, the low mRNA levels of TGF-β1 in the antimesentericside of the diseased ileum wall might be simply due to highfrequency of ulceration in this peripheral zone that couldhave destroyed the lamina propria cells expressing TGF-β1.

Histological ad hoc score and the distribution ofgranuloma showed that there was a good correspondence

between the macroscopical and the microscopical inflam-mation. Although some authors found that TGF-β1 mRNAlevels were higher in active CD,29 in our series, nosignificant difference in TGFβ-1 and IGF-1 mRNA levelswere observed in diseased ileum compared to the healthyone. Similarly, Dal Zotto et al. observed that, TGF-β1production in healthy and diseased bowel was compara-ble.31 In patients with CD, the high expression of TGF-β1was demonstrated to be associated to a failure of TGF-β1-mediated negative regulation of proinflammatory cytokineproduction because of increased intracellular expression ofthe endogenous inhibitor, Smad7.32 Post-transcriptional

Table 3 Comparison of TGFβ-1, IGF-1 mRNA Levels, MPO Activity, Inflammatory Score, Granuloma Score, Neural Hyperplasia, SubmucosalMuscularization, Myofibroblasts Proliferation, and Fibrosis (All These Features were Evaluated on a Semi-quantitative Scale of 0–3, Where 0 =None Present, 1 = Focal and/or Mild Degree, 2 = Moderate Degree, 3 = Prominent/Severe Degree) in the Different Sector of the Ileum Wall inCrohn’s Disease with Kruskal–Wallis ANOVA

Antimesenteric side Lateral side Mesenteric side Kruskal–Wallis’s ANOVAMedian (range) Median (range) Median (range) p value

Diseased bowelInflammatory score 2.5 (0–3) 3 (0–3) 3 (0–3) 0.871Granuloma score 0 (0–3) 0 (0–3) 0 (0–3) 0.361MPO activity (units per milligram tissue) 6.3 (1.64–20.10) 7.5 (0.67–20.78) 4.655 (0.08–21.83) 0.507Neural hyperplasia scale 1 (0–3) 1 (0–2) 1 (0–3) 0.687Submucosal muscularization scale 3 (0–3) 3 (0–3) 3 (0–3) 0.792Myofibroblast proliferation scale 0 (0–2) 0 (0–2) 0 (0–1) 0.594Fibrosis scale 2 (0–3) 2 (0–3) 1.5 (0–3) 0.443TGFβ-1/GAPDH mRNA levels 0 (0–0.118) 0.334 (0–4.145) 1.018 (0–11.497) 0.198IGF-1/GAPDH mRNA levels 0 (0–0.012) 0 (0–0.266) 0.003 (0–0.068) 0.488Healthy bowelInflammatory score 0 (0–2) 0 (0–3) 0 (0–3) 0.815Granuloma score 0 (0–2) 0 (0–2) 0 (0–3) 0.782MPO activity (units per milligram tissue) 5.585 (0.97–15.97) 6.66 (1.64–11.13) 5.18 (0.84–19.43) 0.923Neural hyperplasia scale 1 (0–3) 0 (0–2) 1 (0–2) 0.182Submucosal muscularization scale 0 (0–2) 0 (0–3) 0 (0–3) 0.934Myofibroblast proliferation scale 0 (0–0) 0 (0–1) 0 (0–0) 0.331Fibrosis scale 0 (0–3) 0 (0–2) 1 (0–1) 0.884TGFβ-1/GAPDH mRNA levels 0.058 (0–3.784) 0.072 (0–0.51) 0.117 (0.84–19.43) 0.936IGF-1 GAPDH mRNA levels 0 (0–0.415) 0.002 (0–3.547) 0.0005 (0–0.052) 0.832

Table 3 Comparison of TGFβ-1, IGF-1 mRNA Levels, MPOActivity, Inflammatory Score, Granuloma Score, Neural Hyperplasia,Submucosal Muscularization, Myofibroblasts Proliferation, and Fibro-sis (All These Features were Evaluated on a Semi-quantitative Scale

of 0–3, Where 0 = None Present, 1 = Focal and/or Mild Degree, 2 =Moderate Degree, 3 = Prominent/Severe Degree) in the DifferentSector of the Ileum Wall in Crohn’s Disease with Kruskal–WallisANOVA

Table 4 Comparison of TGFβ-1, IGF-1 expression, MPO Activity Inflammatory Score, Presence of Granuloma, Neural Hyperplasia,Submucosal Muscularization, Myofibroblasts Proliferation, and Fibrosis in Diseased Versus Healthy Bowel with Wilcoxon Matched-Pair Test

Diseased bowel Healthy bowel Wilcoxon rank testMedian (range) Median (range) p value

Inflammatory score 3 (0–3) 0 (0–3) 0.000Granuloma score 0 (0–3) 0 (0–3) 0.045MPO activity (units per milligram tissue) 6.73 (0.08–21.83) 5.65 (0.84–19.43) 0.671Neural hyperplasia scale 1 (0–3) 1 (0–3) 0.019Submucosal muscularization scale 3 (0–3) 0 (0–3) 0.000Myofibroblast proliferation scale 0 (0–2) 0 (0–1) 0.017Fibrosis scale 2 (0–3) 0 (0–3) 0.000TGFβ-1/GAPDH mRNA levels 0.034 (0–11.49) 0.074 (0–3.784) 0.826IGF-1/ GAPDH mRNA levels 0 (0–0.266) 0.0002 (0–3.547) 0.182

J Gastrointest Surg (2008) 12:1981–1990 19871987

overexpression of Smad7 in the gut of patients withinflammatory bowel diseases blocks TGF-β1 signaling,and defective TGF-β1 signaling helps maintain high NF-kB activity, thereby expanding its local inflammatoryresponse.33 As suggested by TGF-β1’s different effects onfibroblasts in strictures and in inflamed bowels, it ispossible that its pro-fibrogenic activity remains and thus isenhanced.34 In fact, according to our data, fibrosis,submucosal muscularization, myofibroblasts distribution,and neural hyperplasia were significantly more evident inthe diseased bowel compared to the healthy one.

TGF-β seems to enhance the effects of IGF-I on cellproliferation and differentiation, and both IGF-1 and TGF-β seem to act synergistically to stimulate intestinalcells.22,35 In fact, in our series, in the diseased and healthyileum, TGFβ-1 mRNA transcripts levels correlated directlywith the respective IGF-1 ones. Surprisingly, TGFβ-1mRNA levels in the diseased bowel correlated inverselywith the IGF-1 expression in healthy bowel, suggesting twodifferent expression regulation in the two situations(healthy and diseased bowel) and a sort of negativefeedback between the two growth factors. A similarlynegative feedback might be hypothesized to explain theinverse correlation between TGFβ-1 mRNA levels in thediseased bowel and the grade of submucosal musculariza-tion in surrounding healthy bowel. Curiously, in the healthyileum, TGFβ-1 mRNA levels correlated inversely also withneural hyperplasia: Probably, where the disease is notactive, TGFβ-1 has an inhibitory effect on the autonomicplexa. In the diseased ileum, the correlation between thedistribution of myofibroblasts and IGF-1 mRNA wassignificantly stronger than that of TGFβ-1 mRNA, suggest-ing that IGF-1 could be the main in vivo growth factor forthese mesenchymal cells. The low correlation betweenTGFβ-1 expression and myofibroblasts population mightalso be due to the production of TGFβ-1 by myofibroblastson themselves.36

Surprisingly, no significant correlation between TGFβ-1and IGF-1 mRNA expression and fibrosis was observed. Infact, the major drawback of the study was that TGF- β1 andIGF-1 mRNA levels may or may not correlate withfibrongenetic activity due to the complex regulation ofthese proteins both pre- and post-transcriptionally. Furtherstudies focused on the examination of pre- and post-transcription signal of TGF-β1 and IGF-1, additionalmediators of fibrosis, such as TGF-β2 and β3, andinflammatory mediators, such as TNFα and IL-6, will beessential to clarify the complex network that is at the basisof intestinal fibrosis in CD.

On the other hand, even the most comprehensiveimmunohistochemical or molecular analyses of resectedbowel from patients with CD can provide only a snapshotat one particular point in time and cannot define thecomplex relation between growth factors and mesenchymalcells during initiation or progression of fibrosis.37 Moreover,these studies are limited by patients’ heterogeneity anddisease presentation variability, in contrast to studies withcell lines; however, they are crucial if basic mechanismselucidated in vitro are to be translated to humans.32

In conclusion, our study showed that TGF-β1 mRNAexpression is lower in the anti-mesenteric side of the ileumaffected by active CD, and this is consistent with thesuccess of side-to-side anastomosis in preventing CDrecurrence. However, no other relation with bowel sideswere observed among the inflammation and repair parameters.Although no difference in the expression of TGFβ-1 and IGF-1 in healthy and diseased bowel was observed, the inversecorrelation between TGFβ-1 expression in the diseased boweland that of IGF-1 in healthy bowel suggested two differentexpression regulation in the two situations (healthy anddiseased bowel) and a sort of negative feedback between thetwo growth factors. Finally, myofibroblasts proliferation insmall bowel affected by active CD appeared to be strictlycorrelated with IGF-1 levels.

Table 5 Relevant Correlation Between TGFβ-1, IGF-1 Expression in the Ileum Wall of Patients with CD, and Local Inflammation and RepairParameter were Evaluated with Kendall’s t Correlation Test

Repairing mechanism Bowel site Correlation with Kendall’s t p level

TGFβ-1 Diseased Sampling site in diseased ileum −0.363 0.035IGF-1 in diseased bowel 0.361 0.036Myofibroblasts proliferation in diseased bowel 0.372 0.063IGF-1 in healthy bowel −0.396 0.039Submucosal muscularization in healthy bowel −0.349 0.069

Healthy IGF-1 in healthy bowel 0.495 0.000Neural hyperplasia in healthy bowel −0.316 0.018

IGF-1 Diseased TGFβ-1 in diseased bowel 0.361 0.036Myofibroblasts proliferation in diseased bowel 0.693 0.001

Healthy TGFβ-1 in healthy bowel 0.495 0.000TGFβ-1 in diseased bowel −0.396 0.039MPO activity in diseased bowel 0.371 0.004

1988 J Gastrointest Surg (2008) 12:1981–1990

Acknowledgment We are very grateful to Mrs. C. Carlotto(Gastroenterology, University of Padova, Italy) for her technical helpin the detection of MPO levels and mRNA extraction and isolation.We are also very grateful to Dr. Duilo Pagano (Clinica Chirurgica I,University of Padova, Italy) for retrieving part of the bowel samples.This paper was funded, in part, by the MIUR grant ex 60%.

References

1. Williams JG, Wong WD, Rothenberger DA, Goldberg SM.Recurrence of Crohn’s disease after resection. Br J Surg1991;78:10–19. doi:10.1002/bjs.1800780106.

2. Tytgat GNJ, Mulder GJI, Brummerlkamp WH. Endoscopic lesionin Crohn’s disease early after ileocecal resection. Endoscopy1988;20:260–262.

3. Wolff BG. Factors determining recurrence following surgery forCrohn’s disease. World J Surg 1998;22:364–369. doi:10.1007/s002689900398.

4. Boreley NR, Mortensen NJ, Jewell DP. Preventing postoperativerecurrence of Crohn’s disease. Br J Surg 1997;84(11):1493–1502.doi:10.1002/bjs.1800841104.

5. Moskovitz D, McLeod RS, Greenberg GR, Cohen Z. Operativeand environmental risk factors for recurrence of Crohn’s disease.Int J Colorectal Dis 1999;14(4–5):224–226. doi:10.1007/s003840050215.

6. Scott NA, Sue-Ling HM, Hughes LE. Anastomotic configurationdoes not affect recurrence of Crohn’s disease after ileo-colonicresection. Int J Colorectal Dis 1995;10:67–69. doi:10.1007/BF00341197.

7. Cameron JL, Hamilton SR, Coleman J, Sitzmann JV, Bayless TM.Patterns of ileal recurrence in Crohn’s disease. A prospectiverandomized study. Ann Surg 1992;215(5):546–551. doi:10.1097/00000658-199205000-00018.

8. Hashemi M, Novell JR, Lewis AA. Side-to-side anastomosis maydelay recurrence in Crohn’s disease. Dis Colon Rectum 1998;41(10):1293–1296. doi:10.1007/BF02258231.

9. Yamamoto T, Bain IM, Mylonakis E, Allan RN, Keighley MRB.Stapled functional end-to-end anastomosis versus sutured end-to-end anastomosis after ileocolonic resection in Crohn’s disease.Scand J Gastroenterol 1999;7:708–713. doi:10.1080/003655299750025921.

10. Ikeuchi H, Kusunoki M, Yamamura T. Long term results ofstapled and hand sewn anastomosis in patients with Crohn’sdisease. Dig Surg 2000;17(5):493–496. doi:10.1159/000051946.

11. Munoz-Juarez M, Yamamoto T, Wolff BG, Keighley MRB. Wide-lumen stapled anastomosis versus conventional end-to-end anas-tomosis in the treatment of Crohn’s disease. Dis Colon Rectum2001;44(1):20–25. doi:10.1007/BF02234814.

12. Scott AD, Uff C, Phillips RK. Suppression of macrophagefunction by suture materials and anastomotic recurrence ofCrohn’s disease. Br J Surg 1993;80:387–391. doi:10.1002/bjs.1800800342.

13. Osborne MJ, Hudson M, Piasecki C, Dhillon AP, Lewis AAM,Pounder RE et al. Crohn’s disease and anastomotic recurrencemicrovascular ischemia and anastomotic healing in an animalmodel. Br J Surg 1993;80:226–229. doi:10.1002/bjs.1800800236.

14. Scarpa M, Angriman I, Barollo M, Polese L, Ruffolo C, Bertin Met al. Role of stapled and hand-sewn anastomoses in recurrence ofCrohn’s disease. Hepatogastroenterology 2004;51(58):1053–1057.

15. Scarpa M, Ruffolo C, Bertin E, Polese L, Filosa T, Prando D et al.Surgical predictors of recurrences of Crohn’s disease after

ileocolonic resection. Int J Colorectal Dis 2007;22(9):1061–1069. doi:10.1007/s00384-007-0329-4.

16. Del Zotto B, Mumolo G, Pronio AM, Montesani C, Tersigni R,Boirivant M. TGF-b1 production in inflammatory bowel disease:differing production patterns in Crohn’s disease and ulcerativecolitis. Clin Exp Immunol 2003;134:120–126. doi:10.1046/j.1365-2249.2003.02250.x.

17. Massague J. Transforming growth factor beta. Annu Rev Cell Biol1990;6:597–646. doi:10.1146/annurev.cb.06.110190.003121.

18. Walia B, Wang L, Merlin D. Sitaraman TGF-beta down-regulatesIL-6 signalling in intestinal epithelial cells: critical role of SMAD-2. FASEB J 2003;17(14):2130–2132.

19. Scarpa M, Bortolami M, Morgan SL, Kotsafti A, Ferraro S,Ruffolo C et al. TGF-b1 and IGF-1 production and recurrence ofCrohn’s disease after ileo-colonic resection. J Surg Res 2008; in press.doi:10.1016/j.jss.2008.04.014.

20. Theiss AL, Fruchtman S, Lund PK. Growth factors in inflammatorybowel disease the actions and interactions of growth hormone andinsulin-like growth factor-I. Inflamm Bowel Dis 2004;10:871–880.doi:10.1097/00054725-200411000-00021.

21. El Yafi F, Winkler R, Delvenne P, Boussif N, Belaiche J, Louis E.Altered expression of type I insulin-like growth factor receptor inCrohn’s disease. Clin Exp Immunol 2005;139:526–533.doi:10.1111/j.1365-2249.2004.02724.x.

22. Simmons JG, Pucilowska JB, Keku TK, Lund PK. IGF-1 andTGF-b1 have distinct effects on phenotype and proliferation ofintestinal fibroblasts. Am J Physiol Gastrointest Liver Physiol2002;283:G809–G818.

23. Harvey RF, Bradshaw JM. A simple index of Crohn’s diseaseactivity. Lancet 1980;1:514. doi:10.1016/S0140-6736(80)92767-1.

24. Kane SV, Sandborn WJ, Rufo PA, Zholudev A, Boone J, Lyerly Det al. Fecal lactoferrin is a sensitive and specific marker inidentifying intestinal inflammation. Am J Gastroenterol 2003;98(6):1309–1314. doi:10.1111/j.1572-0241.2003.07458.x.

25. Chomczynski P, Sacchi N. Single step method of RNA isolation byacid guanidinium thiocyanate-phenol-chloroform extraction. AnalBiochem 1987;162:156–159. doi:10.1016/0003-2697(87)90021-2.

26. Pucilowska JB, Williams KL, Lund PK. Fibrosis and inflammatorybowel disease: cellular mediators and animal models. Am J PhysiolGastrointest Liver Physiol 2000;279:G653–G659.

27. La JH, Kim TW, Sung TS, Kang JW, Kim HJ, Yang IS. Visceralhypersensitivity and altered colonic motility after subsidence ofinflammation in a rat model of colitis. World J Gastroenterol2003;9(12):2791–2795.

28. Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acuteintestinal inflammation based on myeloperoxidase activity. Assess-ment of inflammation in rat and hamster models. Gastroenterology1984;87:1344–1350.

29. Babyatsky MW, Rossiter G, Podolsky DK. Expression of trans-forming growth factors alpha and beta in colonic mucosa ininflammatory bowel disease. Gastroenterology 1996;110(4):975–984. doi:10.1053/gast.1996.v110.pm8613031.

30. Di Mola FF, Friess H, Scheuren A, Di Sebastiano P, Graber H,Egger B et al. Transforming growth factor-bs and their signalingreceptors are coexpressed in Crohn’s disease. Ann Surg 1999;229(1):67–75. doi:10.1097/00000658-199901000-00009.

31. Del Zotto B, Mumolo G, Pronio AM, Montesani C, Tersigni R,Boirivant M. TGF-b1 production in inflammatory bowel disease:differing production patterns in Crohn’s disease and ulcerativecolitis. Clin Exp Immunol 2003;134:120–126. doi:10.1046/j.1365-2249.2003.02250.x.

32. Monteleone G, Del Vecchio Blanco G, Monteleone I, Fina D,Caruso R, Gioia V et al. Post-transcriptional regulation of Smad7in the gut of patients with inflammatory bowel disease. Gastro-enterology 2005;129(5):1420–1429. doi:10.1053/j.gastro.2005.09.005.

J Gastrointest Surg (2008) 12:1981–1990 19891989

33. Monteleone G, Mann J, Monteleone I, Vavassori P, Bremner R,Fantini M et al. A failure of transforming growth factor-b1negative regulation maintains sustained NF-kB activation in gutinflammation. J Biol Chem 2004;279(6):3925–3932. doi:10.1074/jbc.M303654200.

34. Stallmach A, Schuppan D, Riese HH, Matthes H, Riecken EO.Increased collagen type III synthesis by fibroblasts isolated fromstrictures of patients with Crohn’s disease. Gastroenterology1992;102(6):1920–1929.

35. Zimmermann EM, Li L, Hou YT, Mohapatra NK, Pucilowska JB.Insulin-like growth factor I and insulin-like growth factor binding

protein 5 in Crohn’s disease. Am J Physiol Gastrointest Liver Physiol2001;280:G1022–G1029.

36. McKaig BC, Hughes K, Tighe PJ, Mahida YR. Differentialexpression of TGF-b isoforms by normal and inflammatory boweldisease intestinal myofibroblasts. Am J Physiol Cell Physiol2002;282:C172–C182.

37. Pucilowska JB, McNaughton KK, Mohapatra NK, Hoyt EC,Zimmermann EM, Sartor RB et al. IGF-I and procollagen a1(I)are coexpressed in a subset of mesenchymal cells in activeCrohn’s disease. Am J Physiol Gastrointest Liver Physiol2000;279:G1307–G1322.

1990 J Gastrointest Surg (2008) 12:1981–1990