Polychlorinated Biphenyl-Induced Reduction of Dopamine Transporter Expression as a Precursor to Parkinson's Disease-Associated Dopamine Toxicity

Polychlorinated Biphenyl–Induced Reduction of DopamineTransporter Expression as a Precursor to Parkinson’s

Disease–Associated Dopamine Toxicity

W. Michael Caudle,*,† Jason R. Richardson,*,†,‡ Kristin C. Delea,*,† Thomas S. Guillot,*,† Minzheng Wang,*,†Kurt D. Pennell,§ and Gary W. Miller*,†,1

*Center for Neurodegenerative Disease, School of Medicine and †Department of Environmental and Occupational Health, Rollins School of Public

Health, Emory University, Atlanta, Georgia 30322-3090; ‡Environmental and Occupational Health Sciences Institute and Department of Environmental

and Occupational Medicine, University of Medicine and Dentistry-New Jersey/Robert Wood Johnson Medical School, Piscataway, New Jersey 08854;

and §School of Civil and Environmental Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332

Received February 21, 2006; accepted March 25, 2006

Epidemiological and laboratory studies have suggested that

exposure to polychlorinated biphenyls (PCBs) may be a risk factor

for Parkinson’s disease. The purpose of this study was to examine

the potential mechanisms by which PCBs may disrupt normal

functioning of the nigrostriatal dopamine (DA) system. We

utilized an environmentally relevant exposure of PCBs (7.5 or

15 mg/kg/day Aroclor 1254:1260 for 30 days by oral gavage) to

identify early signs of damage to the DA system. This dosing

regimen, which resulted in PCB levels similar to those found in

human brain samples, did not cause overt degeneration to the DA

system as shown by a lack of change in striatal DA levels or

tyrosine hydroxylase levels. However, we did observe a dramatic

dose-dependent decrease in striatal dopamine transporter (DAT)

levels. The observed reductions appear to be specific to the DAT

populations located in the striatum, as no change was observed in

other dopaminergic brain regions or to other neurotransmitter

transporters present in the striatum. These data demonstrate that

PCB tissue concentrations similar to those found in postmortem

human brain specifically disrupt DA transport, which acts as

a precursor to subsequent damage to the DA system. Furthermore,

DAT imaging may be useful in evaluating alterations in brain

function in human populations exposed to PCBs.

Key Words: PCB; Parkinson’s disease; dopamine; tyrosine

hydroxylase; DAT.

Epidemiological studies have established a role of theenvironment in the etiology of Parkinson’s disease (PD)(Priyadarshi et al., 2000; Tanner and Goldman, 1996; Tannerand Langston, 1990; Tanner et al., 1999). Although specificenvironmental contaminants that contribute to the incidence of

PD have yet to be identified, recent studies have implicatedpolychlorinated biphenyl (PCB) exposure as a possible riskfactor. A recent mortality study of 17,000 workers occupation-ally exposed to PCBs revealed an increased incidence of PD infemale subjects (Steenland et al., 2006). Additionally, studiesby Corrigan et al. (1998, 2000) found an increased depositionof PCBs in the caudate nucleus and substantia nigra of braintissue obtained postmortem from PD patients.

PCBs are members of a class of organic compounds knownas halogenated aromatic hydrocarbons and are composed ofbiphenyl rings with varying degrees and positions of chlorinesubstitutions present on each ring. Because of their thermalstability, PCBs have been widely used as coolants andlubricants in transformers and capacitors, in hydraulic fluids,as well as in other electrical equipment (Erickson, 1986).Although the manufacturing and use of PCBs have beendiscontinued since 1977 in the United States, their physio-chemical properties allow them to persist and bioaccumulatein the environment, increasing the risk for human exposure(Kamrin and Ringer, 1994; Safe, 1993).

PCB exposure is known to pose numerous health concerns(ATSDR, 2000). Indeed, several studies have shown them to bedetrimental to the central nervous system, resulting in motorand cognitive deficits (reviewed by Faroon et al., 2001). Acommon finding has been a significant reduction of braindopamine (DA) levels following exposure to PCBs. Severalin vitro studies have demonstrated that individual congeners,congener mixtures, as well as extracts from PCB-contaminatedGreat Lakes fish produce a reduction in DA (Seegal et al.,1989, 1990, 1998; Shain et al., 1991). While the mechanism ofDA reduction is unclear, it has been postulated, based on cellculture experiments, that decreased DA levels are a result ofinhibition of tyrosine hydroxylase (TH) and L-aromatic aciddecarboxylase (L-AADC) activity, two enzymes involved in thesynthesis of DA (Angus and Contreras, 1996; Angus et al.,1997). Our laboratory and others have reported a significant

1 To whom correspondence should be addressed at Center for Neurodegen-

erative Disease, School of Medicine, Emory University, 505K Whitehead

Building, 615 Michael Street, Atlanta, GA 30322-3090. Fax: (404) 727-3728.

E-mail: [email protected].

� The Author 2006. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.For Permissions, please email: [email protected]

TOXICOLOGICAL SCIENCES 92(2), 490–499 (2006)

doi:10.1093/toxsci/kfl018

Advance Access publication May 15, 2006

by guest on June 9, 2013http://toxsci.oxfordjournals.org/

Dow

nloaded from

http://toxsci.oxfordjournals.org/

decrease in striatal DA following high-dose, acute exposure ofrodents to Aroclor 1016, 1254, or 1260 (Richardson and Miller,2004; Seegal et al., 1986). In addition, Seegal and coworkers(1991a, 1994; Seegal, 2003) have reported decreases in DA inthe striatum of nonhuman primates, as well as loss ofdopaminergic cells in the substantia nigra, both of which arehallmark features of PD. While the mechanism for thesereductions is not clear, disruption of DA handling andhomeostasis may play a role.

Recent studies have shown that PCBs affect the dopaminetransporters (DATs) important in the handling and packaging ofDA. DA that has been released into the synapse followingneurotransmission is removed through reuptake into the pre-synaptic terminal by the DAT (Giros and Caron, 1993). Inside theterminal, recycled and newly synthesized DA is transported intovesicles by the vesicular monoamine transporter 2 (VMAT2),where it is made available for release (Liu and Edwards, 1997).Several studies have determined the importance of DAT andVMAT2 in maintaining proper homeostasis of the DA system(Gainetdinov and Caron, 2003; Miller et al., 1999b). Genetic andpharmacological alteration of DAT or VMAT2 levels or functionresults in a decrease in total tissue DA (Fon et al., 1997;Fumagalli et al., 1999; Giros et al., 1996; Jones et al., 1998;Mooslehner et al., 2001; Sivam, 1995; Wang et al., 1997),suggesting that any chemical that affects DAT and VMAT2function or expression may significantly impact DA homeostasis.

Previous in vitro studies have suggested that PCBs inhibitDA uptake in synaptosomal and vesicular preparations(Mariussen and Fonnum, 2001; Mariussen et al., 1999). Fur-thermore, Seegal et al. (2002) showed alterations in extracel-lular DA concentrations following daily exposure to Aroclor1254, suggesting inhibition of the DAT by PCBs. Work fromour laboratory has shown that high-dose exposure of mice toAroclor 1016 or 1260 results in significant reductions in striatalDAT and VMAT2 protein levels (Richardson and Miller, 2004).To date, studies with PCBs have focused on loss of striatal DAor nigral DA neurons as the toxicological end points. The goalof this study was to identify the alterations in the DA systemthat precede the loss of striatal DA or DA neurons. Here, wereport that an exposure paradigm which results in PCB brainconcentrations similar to those found in postmortem humanbrains causes a dramatic reduction in DAT expression thatprecedes overt toxicity. These findings suggest that monitoringDAT expression through currently utilized imaging methods(Chou et al., 2004; Fernandez et al., 2001) may help identifyPCB-induced brain alterations.

MATERIALS AND METHODS

Chemicals and Reagents

Aroclor 1254 (Lot 124-191-C) and 1260 (Lot 021-020) were purchased from

Accustandard (New Haven, CT). Monoclonal anti-rat DAT antibodies, poly-

clonal anti-rabbit antibodies to GABA transporter 1 (GAT-1), excitatory amino

acid transporter 1 (EAAT-1), excitatory amino acid transporter 2 (EAAT-2),

TH, and VMAT2 were purchased from Chemicon (Temecula, CA). Monoclonal

anti-mouse a-tubulin antibodies were purchased from Sigma (St Louis, MO),

and monoclonal anti-mouse TH was purchased from Chemicon. Secondary

antibodies conjugated to horseradish peroxidase were obtained from MP

Biomedical, Inc. (antirat; Irvine, CA) and Bio Rad (anti-mouse and anti-rabbit;

Hercules, CA). Secondary antibodies conjugated to biotin were purchased from

Jackson Immunoresearch Labs (West Grove, PA). SuperSignal West Dura

Extended duration substrate and stripping buffer were obtained from Pierce

(Rockford, IL). Avidin-biotin complex (ABC) solution was purchased from

Vector Labs (Burlingame, CA). 3,3#-Diaminobenzidine tetrachloride (DAB)

was purchased from Sigma. Monoamine standards for DA, dihydroxyphenyl-

acetic acid (DOPAC), and homovanillic acid (HVA) were purchased from

Sigma. Mobile phase was obtained from ESA Inc (Chelmsford, MA). 3H-

Dopamine (3H-DA), 3H-nisoxetine, 3H-paroxetine, and 3H-WIN 35,428 were

purchased from Perkin-Elmer (Boston, MA). Cold tetrabenazine, nomifensine,

fluoxetine, and desipramine were obtained from Sigma.

Animals and Treatment

Eight-week-old male C57BL/6J mice were purchased from Jackson

Laboratories (Bar Harbor, ME). Mice were maintained on a 12:12 light/dark

cycle with food and water available ad libitum. All procedures were conducted

in accordance with the Guide for Care and Use of Laboratory Animals

(National Institutes of Health) and approved by the Institutional Animal Care

and Use Committee at Emory University.

Mice were orally gavaged with 30 ll of 0, 7.5, or 15 mg/kg of a 1:1 mixture

of Aroclor 1254 and 1260 dissolved in corn oil vehicle daily for 3, 7, 14, or

30 days. These concentrations and exposure time points were based on previous

studies performed in rats (Kodavanti et al., 1998; Seegal et al., 2002) in which

no change in total DA levels was observed. Oral exposure was chosen since the

most common route of human exposure to PCBs is through the ingestion of

contaminated food (ATSDR, 2000). The mixture of Aroclor 1254 and 1260 was

chosen because the congener profile determined in Great Lakes fish exhibited

high homology to the 1:1 mixture of Aroclor 1254 and 1260 (Seegal et al.,

1998) and represents an environmentally relevant mixture. Mice were sacrificed

one day following the last exposure, and tissue was collected for analysis.

Gas Chromatography

Determination of PCBs in mouse brain tissue was performed following the

extraction procedure described by Corrigan et al. (2000) and analytical method

of Harju et al. (2003). It has previously been determined that PCBs distribute

ubiquitously throughout the brain (Kodavanti et al., 1998); thus, we analyzed

whole-brain samples lacking only the striatum, which were taken for

neurochemical analysis. Approximately 200 mg of wet tissue was placed in

an amber glass vial to which 5 ml of a 1:1 mixture of acetone and hexane,

containing hexachlorobenzene as an internal standard, was added. The tissue

was homogenized using a Tissue Tearer (Biospec Products, Bartlesville, OK,

Model no. 985370) for approximately 3 min, placed in a sonication bath for 15

min, and mixed for an additional 2 min using a minivortex (VWR Scientific

Products, Atlanta, GA). The supernatant was separated by centrifugation for 10

min at 2500 rpm and transferred to a 35-ml borosilicate glass centrifuge tube

using a disposable glass Pasteur pipette. The extraction sequence was

performed five times to yield a total extract volume of approximately 25 ml.

The contents of each tube were reduced by heating at 50�C in an aluminum

block, weighed to obtain the dry residue mass, and redissolved in 1 ml of 1:1

hexane:acetone. The reduced extract was transferred to a 25-ml, solid-phase

extraction column containing 5 g of Florisil and 1 g of anhydrous sodium

sulfate to remove lipids. The column was eluted with 5 ml of hexane five times

to obtain a final volume of approximately 25 ml. The filtered extract was then

reduced to 1 ml at 50�C and transferred to a glass autosampler vial, which was

immediately sealed with a crimp cap and stored at 4�C.

The tissue extracts were analyzed for PCBs using a Hewlett Packard (HP)

6890N gas chromatograph (GC) equipped with a micro-electron capture

detector. Congeners were separated using a DB-XLB capillary column (60 m

PCB-INDUCED REDUCTION OF DAT EXPRESSION 491


Dow

nloaded from


length 3 0.25 mm diameter, J&W Scientific, Mountain View, CA) operated at

an initial oven temperature of 80�C, increased to 140�C (30�C/min), and

subsequently increased to 230�C (3�C/min). Of the 125 PCB congeners present

in the 1254:1260 mixture, the 66 most prominent, which accounted for 97% of

the total mass, were resolved. Chromatograph peaks were identified by

comparison of retention times with individual and mixed PCB standards

(Accustandard) and verified by analysis of selected samples using a Varian Star

3400 GC equipped with a Saturn 2000 mass spectrometer. Individual PCB

congener levels were computed from five-point calibration curves prepared in

hexane over relevant concentration ranges. The method detection limit was

approximately 0.02 lg/g, expressed per weight of wet tissue.

Western Blot Analysis

Western blots were used to quantify the amount of DAT, TH, VMAT2, and

a-tubulin present in samples of striatal tissue from treated and control mice.

Analysis was performed as previously described (Caudle et al., 2005). Briefly,

striata samples were homogenized and samples subjected to polyacrylamide gel

electrophoresis and electrophoretically transferred to polyvinylidene difluoride

membranes. Nonspecific sites were blocked in 7.5% nonfat dry milk in Tris-

buffered saline and then membranes incubated overnight in a monoclonal

antibody to the N-terminus of DAT (1:5000) (Miller et al., 1997). DAT antibody

binding was detected using a goat anti-rat horseradish peroxidase secondary

antibody (1:10,000) and enhanced chemiluminescence. The luminescence sig-

nal was captured on an Alpha Innotech Fluorochem imaging system and stored

as a digital image. Densitometric analysis was performed and calibrated to

coblotted dilutional standards of pooled striata from all control samples.

Membranes were stripped for 15 min at room temperature with Pierce Stripping

Buffer and sequentially reprobed with GAT-1 (1:1000), EAAT-1 (1:50,000),

EAAT-2 (1:50,000), a-tubulin (1:1000), TH (1:1000), and VMAT2 (1:1000)

antibodies. a-Tubulin blots were used to ensure equal protein loading across

samples.

Synaptosomal 3H-DA Uptake

DA uptake studies were performed as previously described (Elwan et al.,

2006). Briefly, crude synaptosomes were prepared from fresh striatal tissue

and incubated in assay buffer (4mM Tris, 6.25mM HEPES, 120mM NaCl,

5mM KCl, 1.2mM CaCl2, 1.2mM MgSO4, 0.6mM ascorbic acid, 5.5mM

glucose, 10lM pargyline; pH 7.4) containing a saturating concentration of DA

(1lM final concentration) and a tracer amount of 3H-DA (20nM). Uptake was

allowed to proceed for 3 min at 37�C and then terminated by the addition of ice-

cold buffer and rapid vacuum filtration over GF/B filter paper using a Brandel

harvester. Filters were washed twice more with buffer, allowed to air dry, and

placed in scintillation vials containing 8 ml of Econoscint (Fisher Scientific,

Pittsburgh, PA) for scintillation counting. Uptake rates were calculated as

specific uptake (total uptake � nonspecific uptake), with nonspecific uptake

defined by the inclusion of 10lM nomifensine. Following determination of

protein concentrations (Bradford, 1976), uptake rates were calculated as pmol/

min/mg protein and expressed as percent change from control.

Synaptosomal 3H-WIN 35,428 Binding

Determination of 3H-WIN 35,428 binding to DAT (Elwan et al., 2006)

was performed essentially as described by Coffey and Reith (1994) with

modifications to reduce the total volume to 200 ll, for assay in 96-well

microtiter plates. Preliminary studies have indicated that the binding of 3H-

WIN 35,428 to striatal synaptosomes is best fit to a one-site model determined

by nonlinear curve-fitting techniques (GraphPad Prism 3.0) with a Kd of

6.58nM and a Bmax of 1.08 lmol/mg protein. Therefore, binding studies with

crude striatal synaptosomes were conducted with a single concentration

(10nM) of 3H-WIN 35,428 in 25mM sodium phosphate buffer (125mM NaCl,

5mM KCl, pH 7.4) for 1 h at 4�C in 96-well plates. Incubations were terminated

by rapid vacuum filtration onto GF/B filter plates, and radioactivity was

determined by liquid scintillation counting. Nonspecific binding was de-

termined by the inclusion of 10lM nomifensine and specific binding calculated

as the total binding (incubated without 10lM nomifensine) minus nonspecific

binding (incubated with nomifensine). Following determination of protein

concentrations (Bradford, 1976), binding to DAT was calculated as fmol/mg

protein and expressed as percent change from control.

Immunohistochemistry

Immunohistochemical analysis of tissue was performed as previously

described by Miller et al. (1999a). Briefly, animals were anesthetized and

perfused transcardially with 4% paraformaldehyde. Brains were removed and

serially sectioned at 25lM on a freezing microtome. Tissue was rinsed in 13

TBS and incubated in 3% H2O2 to remove endogenous peroxidases. Sections

were blocked in 10% normal goat serum for 1 h at room temperature before

being incubated overnight with monoclonal rat anti-DAT (1:750) or mono-

clonal mouse anti-TH (1:2000) primary antibodies. The following day, tissue

was rinsed in 13 TBS and then incubated for 1 h in goat anti-rat (1:200) or goat

anti-mouse (1:200) secondary antibody conjugated to biotin. Tissue was rinsed

in 13 TBS and incubated for 1 h in ABC solution. Tissue was rinsed in 13 TBS

and the final product visualized using DAB. Free-floating slices were mounted

onto slides, serially dehydrated in ethanol, and coverslipped. Immunostained

sections were analyzed using bright-field microscopy and images captured on

a Leitz microscope (Leica, Wetzlar, Germany).

High Performance Liquid Chromotography-Electroechemical

High Performance Liquid Chromotography-Electroechemical (HPLC-EC)

neurochemical analysis was performed as previously described by Richardson

and Miller (2004). Briefly, dissected left striata were sonicated in 0.1M

perchloric acid containing 347lM sodium bisulfite and 134lM EDTA.

Homogenates were centrifuged at 15,000 3 g for 10 min at 4�C, and the

supernatant was removed and filtered through a 0.22-lm filter by centrifugation

at 15,000 3 g for 10 min. The supernatants were then analyzed for levels of

DA, DOPAC, and HVA. Levels were measured using HPLC with an eight-

channel coulometric electrode array (ESA Coularray). Quantification was made

by reference to calibration curves made with individual monoamine standards.

TH Activity

TH activity was measured as described by Carlsson et al. (1972). Briefly,

mice were injected ip with 100 mg/ml of the AADC inhibitor NSD 1015 and

sacrificed 1 h later. Striata were removed bilaterally and prepared as described

above for HPLC-EC. TH activity was determined by measuring the accumu-

lation of L-DOPA (3,4-dihydroxy-L-phenylalanine).

3H-Nisoxetine and 3H-Paroxetine Binding

Determination of 3H-nisoxetine and 3H-paroxetine binding to the norepi-

nephrine transporter (NET) and the serotonin transporter (SERT) in the frontal

cortex and striatum was performed essentially as described by Tejani-Butt et al.

(1990) and Mellerup et al. (1983), respectively, with modifications to reduce

the total volume to 200 ll for the assay in 96-well microtiter plates. Briefly,

samples from the frontal cortex of control and treated animals were incubated

with a single concentration of 3H-nisoxetine (5nM) for 3–4 h at 4�C or a single

concentration of 3H-paroxetine (10nM) for 1 h at 25�C in 96-well plates.

Incubations were terminated by rapid vacuum filtration onto GF/B filter plates,

and radioactivity was determined by liquid scintillation counting. Nonspecific

binding was determined by the inclusion of 1lM desipramine (3H-nisoxetine

binding) or 1nM fluoxetine (3H-paroxetine binding) and specific binding

calculated as total binding (incubated without desipramine or fluoxetine) minus

nonspecific binding (incubated with desipramine or fluoxetine). Determination

of 3H-paroxetine binding in the striatum was performed as described for the

frontal cortex. Binding to SERT and NET was calculated as fmol/mg protein

and reported as raw values.

Dopamine Transporter mRNA

RNA isolation and cDNA synthesis. RNA was isolated from ventral

mesencephalon from control and treated animals using the Qiagen RNEasy

Lipid Tissue Mini Kit (Valencia, CA) according to instructions by the manu-

facturer. RNA concentration was determined by standard spectrophotometric

492 CAUDLE ET AL.


Dow

nloaded from


analysis and 1 lg of total RNA used for cDNA synthesis with the Applied

Biosystems High Capacity cDNA Archive kit (Bedford, MA) according to

the manufacturer’s protocol.

Quantitative reverse transcriptase PCR (real-time PCR). Primers for

mouse DAT (forward [5#–3#] atcaacccaccgcagacaccagt and reverse [5#–3#]ggcatcccggcaataaccat) were designed using the Primer Select software program

(Lasergene) and synthesized by MWG Biotech, Inc (High Point, NC). Real-

time PCR was performed using the ABI PRISM 7000 Sequence Detection

System (Applied Biosystems) to determine mRNA expression in ventral

mesencephalon. Reactions were performed in a total volume of 25 ll using

SyBr Green Master Mix reagent (Applied Biosystems); 2 ll of cDNA per

sample was used as template for the reaction with 10lM forward and reverse

primers. Both target and 18S amplifications were performed in duplicate.

Thermal cycling conditions included 2 min at 50�C and 10 min at 95�Cfollowed by 40 cycles of 95�C for 15 s and 1 min at the appropriate annealing

temperature for each primer set. To normalize the amount of total mRNA

present in each reaction, levels of the 18S ribosomal subunit were monitored in

parallel samples. Results are expressed as relative levels of mRNA, referred to

as control samples (the calibrator), chosen to represent 13 expression of the

gene. The amount of target (treated sample), normalized to an endogenous

reference (18S) and relative to the calibrator (control sample), was defined by

the Ct method as described by Livak and Schmittgen (2001). All primer sets

yielded a single PCR product of expected size by agarose gel electrophoresis,

and specificity was routinely monitored by checking product melting curves

(dissociation curves) in each reaction well.

Statistical Analysis

All statistical analysis was performed on raw data for each treatment group

by one-way ANOVA. Post hoc analysis was performed using Student-Newman-

Keuls test. Statistical significance is reported at the p < 0.05 level.

RESULTS

We chose a paradigm in which eight-week-old male C57BL/6J mice were exposed to a dose of a 1:1 mixture of Aroclor1254:1260 by oral gavage at concentrations of 0, 7.5, or 15mg/kg for 3, 7, 14, or 30 days and examined the effect on thenigrostriatal DA system. This dosing paradigm is lower thanthe lowest levels previously shown to decrease DA and resultsin tissue concentrations of PCBs similar to those found inpostmortem human brain (DeWailly et al., 1999). Administra-tion of Aroclor 1254:1260 daily for the indicated times resultedin no overt signs of toxicity, including no significant changes in

body or brain weight, and no change in appearance or grossbehavior (data not shown).

Analysis of PCB Congener Levels in the Brain of MiceExposed to Aroclor 1254:1260 for 30 Days

Studies have determined that the PCB congeners 118, 138,153, and 180 accumulate in the brain of exposed animals toa greater degree than other congeners (Kodavanti et al., 1998).Thus, using GC, we determined the concentrations of thesecongeners in the brains of mice treated with 7.5 or 15 mg/kg ofAroclor 1254:1260 for 30 days (Table 1). Upon analysis of allcongeners present in the brain, we found PCB congeners 95,118, 138, 153, 170, and 180 to be at higher concentrations atboth the 7.5- and 15-mg/kg concentrations.

Effects of Subchronic Aroclor 1254:1260 Exposure onStriatal DA and Metabolite Levels, TH Synthesis,and TH Protein Expression

We examined the effects of a subchronic exposure to Aroclor1254:1260 on DA and its metabolite levels in the striatum, aswell as changes to DA synthesis. As shown in Table 2, nochanges were seen in striatal DA, DOPAC, or HVA levels.Previous groups have suggested inhibition of DA synthesisrates following exposure to PCBs as a cause for reduction intotal DA levels (Angus et al., 1997; Chishti et al., 1996). Thus,we measured DA synthesis to ensure that the lack of change instriatal DA levels we observed were not due to a compensatoryincrease in DA production. As seen with striatal DA, no changein DA synthesis was observed (control: 30 ± 4.2 pg L-DOPA/min-mg, 7.5 mg/kg: 32 ± 3.4 pg L-DOPA/min/mg, and 15mg/kg: 33 ± 1.7 pg L-DOPA/min/mg). Finally, no change in THprotein levels was measured by immunoblotting or immuno-chemical techniques (Figs. 1 and 3B).

Effects of Subchronic Aroclor 1254:1260 Exposure onNigrostriatal DAT Levels and Function

To assess the impact of PCB exposure on the DA system, welooked at the DAT, the phenotypic marker of DA neurons. Todetermine the earliest time point in which we would detect

TABLE 1

Mice Exposed to Aroclor 1254:1260 at Concentrations of 0, 7.5, or 15 mg/kg for 30 Days Show an Increase in Total Brain

Concentration of PCBs as well as PCB Congeners. Data Are Expressed as Mean ± SEM (n ¼ 3–5). Estimated Total PCB

Levels Based on the Sum of 44 Congeners, Representing Approximately 91% of the Injected Mass

Mean PCB congener levels (lg/g wet weight)

95 118 138 153 170 180 Estimated Total PCB

Control 0.15 ± 0.34 0.06 ± 0.02 0.47 ± 0.08 0.49 ± 0.15 0.34 ± 0.06 1.12 ± 0.15 6.18 ± 0.87

7.5 mg/kg 2.13 ± 0.56 1.19 ± 0.22 6.12 ± 1.43 7.42 ± 1.81 3.53 ± 0.89 10.40 ± 2.54 67.58 ± 14.37

15 mg/kg 3.02 ± 0.91 1.94 ± 0.44 9.26 ± 2.12 7.45 ± 2.10 6.22 ± 1.66 15.55 ± 3.45 113.07 ± 16.63



Dow

nloaded from


changes in the DAT in the striatum, we exposed animals to 0,7.5, or 15 mg/kg of Aroclor 1254:1260 for 3, 7, 14, or 30 days.Animals exposed for 3 or 7 days did not show any changes inDAT levels, as measured by immunoblotting, 3H-WIN 35,428binding, and 3H-DA uptake (data not shown). However, animalsexposed to Aroclor 1254:1260 for 14 days exhibited a 10%reduction in DAT at the 7.5-mg/kg dose and a 35% reduction inDATat the 15-mg/kg dose (Fig. 2A). In addition, these decreasesin DAT were confirmed by 3H-WIN 35,428 binding, whichdemonstrated a 15 and 35% reduction in DAT at each respectivedose (Fig. 2B). Finally, to examine the effects of DAT reductionon the function of the transporter, we performed 3H-DA uptakeand observed a 15 and 50% reduction in DA uptake at the 7.5-and 15-mg/kg doses, respectively (Fig. 2C). Similar to theresults observed in the 14-day exposure group, we observed a 30and 40% decrease in DAT levels by immunoblotting following30 days of exposure to 7.5 and 15 mg/kg, respectively (Fig. 2A).3H-WIN 35,428 binding showed similar levels of DAT reduc-tions in the striatum (25 and 50%, respectively, for the 7.5- and15-mg/kg doses) (Fig. 2B). Using 3H-DA uptake, we observeda 40% decrease in DA transport through the DAT with the 7.5-mg/kg dose of Aroclor 1254:1260 and a 60% reduction in DAtransport in the 15-mg/kg dose (Fig. 2C). Finally, immunohis-

tochemical analysis revealed a significant reduction in DAT inthe 7.5- and 15-mg/kg groups (Fig. 3A).

To determine whether the reduction in DAT was the result ofreduced mRNA synthesis at the cell body, we performed PCRfor DAT on samples isolated from the midbrain of animalsexposed to 7.5 or 15 mg/kg of Aroclor 1254:1260 for 30 days.Results from these experiments show no change in DAT mRNAat either concentration (Fig. 2D).

Effects of Subchronic Aroclor 1254:1260 Exposureon DAT Levels in the Frontal Cortex, Hypothalamus,and Midbrain

To determine whether the changes in DAT were specific tothe striatum, we measured DAT levels in other DA-containingregions of the brain, specifically the frontal cortex, hypothal-amus, and midbrain. In contrast to the reductions observed inthe striatum, exposure to Aroclor 1254:1260 did not alter DATlevels in the frontal cortex, hypothalamus, or the midbrain(Fig. 4A). In addition to a dense dopaminergic population ofneurons, the striatum is composed of several other neurotrans-mitter populations (GABA; Augood et al., 1995; glutamate;Lehre et al., 1995; serotonin; Boja et al., 1992). We alsoexamined possible changes to other neurotransmitter trans-porters present in the striatum to determine whether or not thechanges were specific to the DA population. Thus, byimmunoblotting we were able to determine that exposure toAroclor 1254:1260 did not alter GAT-1 or two glutamatetransporters, EAAT-2 (excitatory amino acid transporter 2) andEAAT-1 (excitatory amino acid transporter 1) in the striatum(Fig. 4B). In addition, through radioligand binding, we alsofound no change in the SERT in the striatum and frontal cortexor the NET in the frontal cortex (Table 3).

Effects of Subchronic Aroclor 1254:1260 Exposureon Striatal VMAT2 Levels

Newly synthesized DA, as well as DA that has been retrievedfrom the synapse by DAT, is sequestered into neurotransmittervesicles by VMAT2 and packaged for release. This actionhighlights VMAT2 as an important player in DA handling inthe cytoplasm. Exposure to Aroclor 1254:1260 for 30 daysproduced a dose-dependent reduction in VMAT2 levels inthe striatum, with a significant reduction of 20% seen with the15-mg/kg concentration (Fig. 5).

DISCUSSION

Given the potential link between PD and PCB exposure(Corrigan et al., 1998, 2000; Steenland et al., 2006), wedecided to examine the neurochemical events that precede theloss of striatal DA following PCB exposure. In this study wehave empirically demonstrated that an exposure paradigm thatresults in tissue concentrations of PCBs similar to those foundin postmortem human brain shows a dose-dependent reduction

TABLE 2

Striatal DA, DOPAC, and HVA Levels Following 30 Days

of Exposure to 0, 7.5, or 15 mg/kg of Aroclor 1254:1260.

Data Represents Raw Values (ng/mg tissue) ± SEM (four to

five animals per treatment group)

DA DOPAC HVA

Control 21.33 ± 0.77 0.96 ± 0.06 1.30 ± 0.07

7.5 mg/kg 21.76 ± 1.21 0.87 ± 0.12 1.18 ± 0.13

15 mg/kg 20.61 ± 1.05 0.97 ± 0.06 1.29 ± 0.05

FIG. 1. Immunoblotting for striatal TH showed no change in protein levels

following 14 or 30 days of exposure to Aroclor 1254:1260. Columns represent

the percent change from control. Data represent the mean ± SEM (four to five

mice per treatment group). Light gray column ¼ control, gray column ¼ 7.5

mg/kg group, and black column ¼ 15 mg/kg group.

494 CAUDLE ET AL.


Dow

nloaded from


in DAT and VMAT2 levels in the striatum, leaving striatal DAand TH levels unchanged. Changes to the DAT appear to bespecific to the dopaminergic population in the striatum, as nochanges to DAT were recorded in other dopaminergic brainregions or in other neurotransmitter transporters in the striatum.These changes demonstrate a marked disruption of nigrostriatalDA function in the absence of overt toxicity and may representan early event in PCB-induced DA neuron degeneration.

PCBs consist of approximately 209 congeners that differ inthe position and number of chlorines present on the phenylrings. The dopaminergic reductions observed following PCBexposure appear to be due to only a limited number of PCBcongeners that have been shown to accumulate in the brain(Seegal et al., 1991a, 1994). These congeners are typicallyhighly chlorinated and ortho substituted. Specifically, it hasbeen determined that congeners 138, 153, and 180 accumulatein the highest concentrations in the striatum of nonhumanprimates and rats following exposure to Aroclor 1254 and 1260

(Seegal et al., 1991a,b). In addition, analyses of PCB congenerspresent in the plasma and adipose tissue of workers occupa-tionally exposed to PCBs have determined PCB 118, 138, 153,and 180 to be present in higher concentrations than othercongeners (Wolff et al., 1982). In our study, exposure of miceto 1:1 mixture of Aroclor 1254:1260 resulted in a greateraccumulation of PCB 95, 118, 138, 153, 170, and 180 thanother congeners found in these mixtures. Similar to our study,Kodavanti et al. (1998) found the more highly chlorinatedcongeners predominantly collected in the brain, specificallyPCB 138 and 153, following a 30-day exposure to 25 mg/kg ofAroclor 1254. Furthermore, the concentrations of the con-geners found in our study are in the same range as thoseobserved in postmortem samples collected from humanautopsies in Greenland (DeWailly et al., 1999). Although thelevels of PCBs that were detected in the mice were higher thanthose found in the postmortem human samples (Corrigan et al.,1998, 2000; DeWailly et al., 1999), these measurements were

FIG. 2. Mice exposed to Aroclor 1254:1260 at concentrations of 0, 7.5, or 15 mg/kg for 14 or 30 days show a dose-dependent reduction in DAT protein level

and function in the striatum. (A) Immunoblotting determination of DAT reductions. (B) 3H-WIN 35,428 binding measurement of DAT decreases. Mice treated for

14 days with Aroclor 1254:1260. Control: 807 ± 20.8, 7.5 mg/kg: 701 ± 29.8, and 15 mg/kg: 458 ± 19.4. Mice treated for 30 days with Aroclor 1254:1260. Control:

810 ± 29.8, 7.5 mg/kg: 669 ± 13.5, and 15 mg/kg: 476 ± 13.2. (C) 3H-DA uptake shows reduction of DA uptake by DAT. Mice treated for 14 days with Aroclor

1254:1260. Control: 230 ± 5.2, 7.5 mg/kg: 200 ± 5.3, and 15 mg/kg: 120 ± 17.8. Mice treated for 30 days with Aroclor 1254:1260. Control: 240 ± 4.7, 7.5 mg/kg:

182 ± 9.0, and 15 mg/kg: 127 ± 3.9. (D) DAT mRNA in the ventral mesencephalon of animals exposed to 0, 7.5, or 15 mg/kg of Aroclor 1254:1260 for 30 days.

Columns represent the percent change from control. Data represent mean ± SEM (four to five mice per treatment group). Light gray column ¼ control, gray ¼ 7.5

mg/kg group, and black column ¼ 15 mg/kg group. ***Values for treated animals that are significantly different from controls (p < 0.001). **Values for

animals that are significantly different from controls (p < 0.01). *Values for animals that are significantly different from controls (p < 0.05).



Dow

nloaded from


taken directly after exposure as opposed to decades after peakexposure in the human population. This suggests that theexposure paradigm used in this study results in a deposition ofPCBs in the mouse brain similar to that observed in the humanpopulation.

While we were able to detect significant levels of PCBdeposition in the brain, we did not observe any reductions oftotal tissue DA in the striatum or reductions in striatal THprotein levels. While several studies have reported reductionsin striatal DA levels following PCB exposure, these studieshave generally employed an exposure paradigm that utilizedhigher concentrations of PCBs or have used chronic dosingparadigms that resulted in a much higher cumulative dose(Richardson and Miller, 2004; Seegal et al., 1991a,b, 1994).The dopaminergic reductions observed in these studies wereprimarily seen in the substantia nigra, caudate nucleus, andputamen, regions most susceptible to DA loss in PD (Milleret al., 1997). Interestingly, changes to other neurotransmitterswere not observed in brain regions expressing serotonergic,

glutamatergic, noradrenergic, or GABAergic innervation(Seegal et al., 1990, 1991a). Our data are in agreement withothers, who have used a similar dosing paradigm in rats andmice and found neuronal dysfunction in the absence of DA loss(Kodavanti et al., 1998; Seegal et al., 2002). These results areespecially striking given the fact that the dosing levels used inour study are lower than those used in previously reportedstudies. Finally, TH is considered to be a reliable marker of DAneuron terminal integrity and terminal loss. Given the un-changed striatal TH protein levels with the dosing paradigmobserved in this study, the alterations to the nigrostriatal DAsystem were likely not due to neuronal toxicity. Interestingly,we have previously demonstrated an intermediate state ofdopaminergic neuron toxicity following a single 500-mg/kgexposure of Aroclor 1260 to mice (Richardson and Miller,2004). With the single, high-dose exposure, we not onlyobserved a reduction in DAT and VMAT2, similar to thepresent study, but also observed a decrease in striatal DA.However, no change was seen in TH protein expression.

FIG. 3. Immunohistochemical analysis of striatal DAT and TH following a 30-day exposure to 0, 7.5, or 15 mg/kg of Aroclor 1254:1260. Analysis performed

on three to four animals per treatment group. Representative sections are shown; scale bar, 300 lm.

FIG. 4. (A) Immunoblotting for DAT in the frontal cortex, hypothalamus, and midbrain of mice treated with 15 mg/kg of Aroclor 1254:1260 for 30 days.

Columns represent the percent change from control. Light gray column ¼ control, gray column ¼ 7.5 mg/kg group, and black column ¼ 15 mg/kg group. (B)

Immunoblotting for GAT-1, GLAST, and GLT in the striatum following 30 days of exposure to 15 mg/kg of Aroclor 1254:1260 showed no change in protein levels.

Data represent the mean ± SEM (four to five mice per treatment group).

496 CAUDLE ET AL.


Dow

nloaded from


Furthermore, although not as robust as the reductions observedin DAT protein expression, the decrease in VMAT2 proteinexpression following 30 days of exposure to 15 mg/kg ofAroclor 1254:1260 may serve as an initial sign of DA terminaldegeneration. Thus, the reduction in DAT observed in our studymay represent a precursory event leading to deficits in DAlevels and further damage to the dopaminergic system.

By utilizing a more sensitive end point (DAT), we were ableto detect changes in the DA system at a cumulative dose lowerthan that previously reported (Kodavanti et al., 1998; Seegal,2003; Seegal et al., 1991a, 1994, 2002). Disruption of the DAThas been shown to lead to a reduction of tissue DA levels, as

well as increase the amount of time DA remains in the synapse(Giros et al., 1996; Jones et al., 1998). Thus, the DAT plays animportant role in regulating DA homeostasis. Recent studieshave utilized single-photon emission tomography to furtherdefine the progression of dopaminergic neuronal loss in PD.Utilization of these techniques has consistently shown theability to measure changes in striatal DAT before the appear-ance of parkinsonian symptoms in humans, as well as animalmodels of PD (Chalon et al., 1999; Chou et al., 2004;Fernandez et al., 2001; Prunier et al., 2003). The implicationsof this concept are substantial given that it defines a period inwhich DA depletion progresses without symptoms.

In conclusion, exposure of mice to short-term, low-levels ofAroclor 1254:1260 results in a congener profile and concen-tration similar to those found in human brain samples. Thesesimilar concentrations result in inhibition of the DAT andVMAT2 (Mariussen and Fonnum, 2001; Mariussen et al.,1999; our unpublished observations). We propose that theprolonged inhibition of VMAT2 and DAT by PCBs leads toaltered DA compartmentalization (Miller et al., 1999b) andthereby increased oxidative damage (Hastings et al., 1996; Leeand Opanashuk, 2004). This is followed by downregulation ofDAT, and to a lesser extent, VMAT2. Together, these changesdecrease the recycling of DA, which over time should result inreduced striatal DA content. The prolonged disruption of DAhomeostasis is likely to increase the vulnerability of the DAneuron and ultimately result in a higher degree of cell death.These data provide a plausible mechanism by which PCBsdamage the nigrostriatal DA system and lead to an increasedincidence of PD. Finally, monitoring of DAT expression in thestriatum could serve as a biomarker of PCB exposure, but itshould be noted that interpreting such a reduction as a sign ofDA terminal loss is not warranted.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grants U54

ES012068 as part of the Collaborative Centers for Parkinson’s Disease

Environmental Research (G.W.M.), F32ES013457 (J.R.R.), and an EPA STAR

Fellowship (T.S.G.).

REFERENCES

Agency for Toxic Substances and Disease Registry (ATSDR). (2000).

Toxicological Profile for Polychlorinated Biphenyls (update). United States

Department of Health and Human Services Agency for Toxic Substances and

Disease Registry.

Angus, W. G., and Contreras, M. L. (1996). Effects of polychlorinated

biphenyls on dopamine release from PC12 cells. Toxicol. Lett. 89, 191–199.

Angus, W. G., Mousa, M. A., Vargas, V. M., Quensen, J. F., Boyd, S. A., and

Contreras, M. L. (1997). Inhibition of L-aromatic amino acid decarboxylase

by polychlorinated biphenyls. Neurotoxicology 18, 857–867.

Augood, S. J., Herbison, A. E., and Emson, P. C. (1995). Localization of GAT-1

GABA transporter mRNA in rat striatum: Cellular coexpression with

TABLE 3

SERT and NET Binding in the Frontal Cortex and Striatum

of Mice Exposed to Aroclor 1254:1260 for 30 Days.

Data Represent the Mean (fmol/mg protein) ± SEM (four to

five mice per treatment group)

3H-Nisoxetine and 3H-paroxetine binding

in striatum and frontal cortex

3H-nisoxetine

(cortex)

3H-paroxetine

(cortex)

3H-paroxetine

(striatum)

Control 98 ± 13 380 ± 17 360 ± 21

7.5 mg/kg 100 ± 10 386 ± 26 359 ± 13

15 mg/kg 104 ± 11 367 ± 20 339 ± 45

FIG. 5. Immunoblotting of striatal VMAT2. Immunoblotting for VMAT2

showed no change in protein levels after 14 days of exposure. Conversely,

a significant reduction in VMAT2 was observed in the 15-mg/kg treatment

group after 30 days of exposure (asterisk indicates p < 0.01). Data represent the

mean ± SEM (four to five mice per treatment group). Light gray column ¼control, gray column ¼ 7.5 mg/kg group, and black column ¼ 15 mg/kg group.



Dow

nloaded from


GAD67 mRNA, GAD67 immunoreactivity, and parvalbumin mRNA.

J. Neurosci. 15, 865–874.

Boja, J. W., Mitchell, W. M., Patel, A., Kopajtic, T. A., Carroll, F. I., Lewin,

A. H., Abraham, P., and Kuhar, M. J. (1992). High-affinity binding of

[125I]RTI-55 to dopamine and serotonin transporters in rat brain. Synapse

12, 27–36.

Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye

binding. Anal. Biochem. 72, 248–254.

Carlsson, A., Davis, J. N., Kehr, W., Lindqvist, M., and Atack, C. V. (1972).

Simultaneous measurement of tyrosine and tryptophan hydroxylase activities

in brain in vivo using an inhibitor of the aromatic amino acid decarboxylase.

Naunyn-Schmiedeberg’s Arch. Pharmacol. 275, 153–168.

Caudle, W. M., Richardson, J. R., Wang, M., and Miller, G. W. (2005). Perinatal

heptachlor exposure increases expression of presynaptic dopaminergic

markers in mouse striatum. Neurotoxicology 26, 721–728.

Chalon, S., Emond, P., Bodard, S., Vilar, M.-P., Thiercelin, C., Besnard, J.-C.,

and Guilloteau, D. (1999). Time course of changes in striatal dopamine

transporters and D2 receptors with specific iodinated markers in a rat model

of Parkinson’s disease. Synapse 31, 134–139.

Chishti, M. A., Fisher, J. P., and Seegal, R. F. (1996). Aroclors 1254 and 1260

reduce dopamine concentrations in rat striatal slices. Neurotoxicology 17,

653–660.

Chou, K. L., Hurtig, H. I., Stern, M. B., Colcher, A., Ravina, B., Newberg, A.,

Mozley, P. D., and Siderowf, A. (2004). Diagnostic accuracy of

[99mTc]TRODAT-1 SPECT imaging in early Parkinson’s disease. Parkinson.

Rel. Dis. 10, 375–379.

Coffey, L. L., and Reith, M. E. (1994). [3H] WIN 35,428 binding to the

dopamine uptake carrier. I. Effect of tonicity and buffer composition.

J. Neurosci. Methods 51, 23–30.

Corrigan, F. M., Murray, L., Wyatt, C. L., and Shore, R. F. (1998).

Diorthosubstituted polychlorinated biphenyls in caudate nucleus in Parkin-

son’s disease. Exp. Neurol. 150, 339–342.

Corrigan, F. M., Wienburg, C. L., Shore, R. F., Daniel, S. E., and Mann, D.

(2000). Organochlorine insecticides in substantia nigra in Parkinson’s

disease. J. Toxicol. Environ. Health A 59, 229–234.

DeWailly, E., Mulvad, G., Pedersen, H. S., Ayotte, P., Demers, A., Weber, J. P.,

and Hansen, J. C. (1999). Concentrations of organochlorines in human brain,

liver, and adipose tissue autopsy samples from Greenland. Environ. Health

Perspect. 107, 823–828.

Elwan, M. A., Richardson, J. R., Guillot, T. S., Caudle, W. M., and Miller, G. W.

(2006). Pyrethroid pesticide-induced alterations in dopamine transporter

function. Toxicol. Appl. Pharmacol. 211, 188–197.

Erickson, M. D. (1986). Analytical Chemistry of PCBs. Butterworth, Boston,

MA.

Faroon, O. M., Jones, D., and de Rosa, C. (2001). Effects of polychlorinated

biphenyls on the nervous system. Toxicol. Ind. Health 16, 305–333.

Fernandez, H. H., Friedman, J. H., Fischman, A. J., Noto, R. B., and

Lannon, M. C. (2001). Is altropane SPECT more sensitive to fluorDOPA

PET for detecting early Parkinson’s disease? Med. Sci. Monit. 7, 1339–

1343.

Fon, E. A., Pothos, E. N., Sun, B. C., Killeen, N., Sulzer, D., and Edwards, R. H.

(1997). Vesicular transport regulates monoamine storage and release but is

not essential for amphetamine action. Neuron 19, 1271–1283.

Fumagalli, F., Gainetdinov, R. R., Wang, Y. M., Valenzano, K. J., Miller, G. W.,

and Caron, M. G. (1999). Increased methamphetamine neurotoxicity in

heterozygous vesicular monoamine transporter 2 knock-out mice. J. Neuro-

sci. 19, 2424–2431.

Gainetdinov, R. R., and Caron, M. G. (2003). Monoamine transporters: From

genes to behavior. Annu. Rev. Pharmacol. Toxicol. 43, 261–284.

Giros, B., and Caron, M. G. (1993). Molecular characterization of the dopamine

transporter. Trends Pharmacol. Sci. 14, 43–49.

Giros, B., Jaber, M., Jones, S. R., Wightman, R. M., and Caron, M. G. (1996).

Hyperlocomotion and indifference to cocaine and amphetamine in mice

lacking the dopamine transporter. Nature 379, 606–612.

Harju, M., Berman, A., Olsson, M., Roos, A., and Haglund, P. (2003).

Determination of atropisomeric and planar polychlorinated biphenyls, their

enantiomeric fractions and tissue distribution in grey seals using compre-

hensive 2D gas chromatography. J. Chromatogr. A. 1019, 127–142.

Hastings, T. G., Lewis, D. A., and Zigmond, M. J. (1996). Role of oxidation in

the neurotoxic effects of intrastriatal dopamine injections. Proc. Natl. Acad.

Sci. U.S.A. 93, 1956–1961.

Jones, S. R., Gainetdinov, R. R., Jaber, M., Giros, B., Wightman, R. M.,

and Caron, M. G. (1998). Profound neuronal plasticity in response to

inactivation of the dopamine transporter. Proc. Natl. Acad. Sci. U.S.A. 95,

4029–4034.

Kamrin, M. A., and Ringer, R. K. (1994). PCB residues in mammals: A review.

Toxicol. Environ. Chem. 41, 63–84.

Kodavanti, P. R., Ward, T. R., Derr-Yellin, E. C., Mundy, W. R., Casey, A. C.,

Bush, B., and Tilson, H. A. (1998). Congener-specific distribution of

polychlorinated biphenyls in brain regions, blood, liver, and fat of adult rats

following repeated exposure to aroclor 1254. Toxicol. Appl. Pharmacol. 153,

199–210.

Lee, D. W., and Opanashuk, L. A. (2004). Polychlorinated biphenyl mixture

aroclor 1254-induced oxidative stress plays a role in dopaminergic cell

injury. Neurotoxicology 25, 925–939.

Lehre, K. P., Levy, L. M., Ottersen, O. P., Storm-Mathisen, J., and Danbolt,

N. C. (1995). Differential expression of two glial glutamate transporters in the

rat brain: Quantitative and immunocytochemical observations. J. Neurosci.

15, 1835–1853.

Liu, Y., and Edwards, R. H. (1997). The role of vesicular transport proteins in

synaptic transmission and neural degeneration. Annu. Rev. Neurosci. 20,

125–156.

Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression

data using real-time PCR and the 2(�Delta Delta C(T)) Method. Methods 25,

402–408.

Mariussen, E., and Fonnum, F. (2001). The effect of polychlorinated biphenyls

on the high affinity uptake of the neurotransmitters, dopamine, serotonin,

glutamate, and GABA, into rat brain synaptosomes. Toxicology 159, 11–21.

Mariussen, E., Morch Andersen, J., and Fonnum, F. (1999). The effect of

polychlorinated biphenyls on the uptake of dopamine and other neuro-

transmitters into rat brain synaptic vesicles. Toxicol. Appl. Pharmacol. 161,

274–282.

Mellerup, E. T., Plenge, P., and Engelstoft, M. (1983). High affinity binding of

[3H]paroxetine and [3H]imipramine to human platelet membranes. Eur. J.

Pharmacol. 96, 303–309.

Miller, G. W., Erickson, J. D., Perez, J. T., Penland, S. N., Mash, D. C., Rye,

D. B., and Levey, A. I. (1999a). Immunochemical analysis of vesicular

monoamine transporter (VMAT2) protein in Parkinson’s disease. Exp.

Neurol. 156, 138–148.

Miller, G. W., Gainetdinov, R. R., Levey, A. I., and Caron, M. G.

(1999b). Dopamine transporters and neuronal injury. Trends Pharmacol.

Sci. 20, 424–429.

Miller, G. W., Staley, J. K., Heilman, C. J., Perez, J. T., Mash, D. C., Rye, D. B.,

and Levey, A. I. (1997). Immunochemical analysis of dopamine transporter

protein in Parkinson’s disease. Ann. Neurol. 41, 530–539.

Mooslehner, K. A., Chan, P. M., Xu, W., Liu, L., Smadja, C., Humby, T., Allen,

N. D., Wilkinson, L. S., and Emson, P. C. (2001). Mice with very low

expression of the vesicular monoamine transporter 2 gene survive into

adulthood: Potential mouse model for parkinsonism. Mol. Cell. Biol. 21,

5321–5331.

498 CAUDLE ET AL.


Dow

nloaded from


Priyadarshi, A., Khuder, S. A., Schaub, E. A., and Shrivastava, S. (2000). A

meta-analysis of Parkinson’s disease and exposure to pesticides. Neuro-

toxicology 21, 435–440.

Prunier, C., Bezaed, E., Montharu, J., Mantzarides, M., Besnard, J.-C., Baulieu,

J.-L., Gross, C., Guilloteau, D., and Chalon, S. (2003). Presymptomatic

diagnosis of experimental Parkinsonism with 123I-PE2I SPECT. Neuroimage

19, 810–816.

Richardson, J. R., and Miller, G. W. (2004). Acute exposure to aroclor 1016 or

1260 differentially affects dopamine transporter and vesicular monoamine

transporter 2 levels. Toxicol. Lett. 148, 29–40.

Safe, S. (1993). Toxicology, structure-function relationship, and human and

environmental health impacts of polychlorinated biphenyls: Progress and

problems. Environ. Health Perspect. 100, 259–268.

Seegal, R. F. (2003). PCBs and dopamine function. Ann. N.Y. Acad. Sci. 991,

322–325.

Seegal, R. F., Brosch, K. O., and Bush, B. (1986). Polychlorinated biphenyls

produce regional alterations of dopamine metabolism in rat brain. Toxicol.

Lett. 30, 197–202.

Seegal, R. F., Brosch, K. O., Bush, B., Ritz, M., and Shain, W. (1989). Effects of

aroclor 1254 on dopamine and norepinephrine concentrations in pheochro-

mocytoma (PC-12) cells. Neurotoxicology 10, 757–764.

Seegal, R. F., Brosch, K. O., and Shain, W. (1990). Lightly chlorinated

ortho-substituted PCB congeners decrease dopamine in nonhuman pri-

mate brain and in tissue culture. Toxicol. Appl. Pharmacol. 106,

136–144.

Seegal, R. F., Bush, B., and Brosch, K. O. (1991a). Comparison of effects of

aroclors 1016 and 1260 on non-human primate catecholamine function.

Toxicology 66, 145–163.

Seegal, R. F., Bush, B., and Brosch, K. O. (1991b). Sub-chronic exposure of the

adult rat to aroclor 1254 yields regionally-specific changes in central

dopaminergic function. Neurotoxicology 12, 55–65.

Seegal, R. F., Bush, B., and Brosch, K. O. (1994). Decreases in dopamine

concentrations in adult, non-human primate brain persists following removal

from polychlorinated biphenyls. Toxicology 86, 71–87.

Seegal, R. F., Okoniewski, R. J., Brosch, K. O., and Bemis, J. C. (2002).

Polychlorinated biphenyls alter extracellular but not tissue dopamine

concentrations in adult rat striatum: An in vivo microdialysis study. Environ.

Health Perspect. 110, 1113–1117.

Seegal, R. F., Pappas, B. A., and Park, G. A. S. (1998). Neurochemical effects

of consumption of Great Lakes salmon by rats. Regul. Toxicol. Pharmacol.

27, S68–S75.

Shain, W., Bush, B., and Seegal, R. (1991). Neurotoxicity of polychlorinated

biphenyls: Structure-activity relationship of individual congeners. Toxicol.

Appl. Pharmacol. 111, 33–42.

Sivam, S. P. (1995). Dopaminergic modulation of serotonin metabolism in rat

striatum: A study with dopamine uptake inhibitor GBR-12909. Life Sci. 56,

PL467–PL472.

Steenland, K., Hein, M. J., Cassinelli, R. T., II, Prince, M. M., Nilsen, M. B.,

Whelan, E. A., Waters, M. A., Ruder, A. M., and Schorr, T. M. (2006).

Polychlorinated biphenyls and neurodegenerative disease mortality in an

occupational cohort. Epidemiology 17, 8–13.

Tanner, C. W., and Goldman, S. M. (1996). Epidemiology of Parkinson’s

disease. Neurol. Clin. 14, 317–335.

Tanner, C. W., and Langston, J. W. (1990). Do environmental toxins cause

Parkinson’s disease? A critical review. Neurology 40, 17–30.

Tanner, C. W., Ottman, R., Goldman, S. M., Ellenberg, J., Chan, P., Mayeux, R.,

and Langston, J. W. (1999). Parkinson disease in twins: An etiologic study.

JAMA 281, 341–346.

Tejani-Butt, S. M., Brunswick, D. J., and Frazer, A. (1990). [3H]nisoxetine: A

new radioligand for norepinephrine sites in brain. Eur. J. Pharmacol. 191,

239–243.

Wang, Y. M., Gainetdinov, R. R., Fumagalli, F., Xu, F., Jones, S. R., Bock,

C. B., Miller, G. W., Wightman, R. M., and Caron, M. G. (1997). Knockout

of the vesicular monoamine transporter 2 gene results in neonatal death and

supersensitivity to cocaine and amphetamine. Neuron 19, 1285–1296.

Wolff, M. S., Thornton, J., Fischbein, A., Lilis, R., and Selikoff, I. J. (1982).

Disposition of polychlorinated biphenyl congeners in occupationally ex-

posed persons. Toxicol. Appl. Pharmacol. 62, 294–306.



Dow

nloaded from


Documents

Polychlorinated Biphenyl-Induced Reduction of Dopamine Transporter Expression as a Precursor to Parkinson's Disease-Associated Dopamine Toxicity