A R T I C L E S

In cortical regions of the CNS, large output neurons, such as thepyramidal cells of the neocortex and hippocampus and the two princi-pal neurons of the cerebellar cortex, use glial guidance systems fordirected migration to establish the neuronal laminae1. The movementof neurons along glial fibers was first proposed by Rakic2,3 and was sup-ported by high-resolution video microscopy studies of purified granuleneurons migrating along Bergmann glial fibers in vitro4. These time-lapse experiments showed that migrating neurons extend a thin leadingprocess in the direction of migration, that the nucleus remains in therear of the neuronal soma during migration, that an extensive intersti-tial adhesion junction forms between glial cell and neuron2,3,5, and thatmovement occurs in a saltatory series of steps that are accompanied bythe release of the adhesion site followed by forward movement of thesoma4. Each step along the glial guide occurs in 3–5 min. In addition,video microscopy also showed the transport of vesicles in the directionof locomotion that halted at the cessation of migration. Subsequentstudies have shown that the dynamics of movement of all neuronsalong glial fibers are nearly identical, with the cardinal features of theposterior localization of the nucleus, a leading process in the directionof migration and a saltatory movement of the cell soma rather thansimple transport of the nucleus6–8. Conservation of the mechanismsfor glial-guided migration is also illustrated by studies demonstratingthat neurons migrate identically along radial glia derived from differentregions of the brain9.

The neuronal cytoskeleton has emerged as an attractive target forunraveling the molecular mechanisms governing glial-guided migra-tion. Migrating neurons possess an intricate lattice of microtubulesthat surrounds the neuronal nucleus and a thick band of cortical actinthat lines the soma10,11. Pharmacologic disruption of these cytoskele-tal structures potently inhibits migration10. Genetic analyses also highlight the importance of the neuronal cytoskeleton for migration.Genes responsible for human migration disorders, including those

underlying Miller-Dieker syndrome (LIS1), X-linked lissencephaly(DCX), and periventricular heterotopias (FLNA), all encode proteinsthat interact with the cytoskeleton of the migrating neuron12–15.

Although the mechanisms of migration are beginning to be eluci-dated, there are still many unanswered questions. What is thedynamic nature of cytoskeletal structures in living neurons duringlocomotion and what is their contribution towards migration? Whydo neurons migrate with a saltatory cadence? Are cytoskeletal struc-tures the basis for neuronal polarity? To address these questions indetail, we have developed a system to visualize the cytoskeleton of liv-ing migrating neurons that uses the cerebellar granule cell, a well-studied system for glial-guided migration16. Our imaging studieshave uncovered a new mechanism of locomotion that involves thecoordinated movement of the centrosome and nucleus during neu-ronal migration along the glial guide. Our studies also identifymPar6α as a component of the centrosome and reveal, for the firsttime, a central role for mPar6α-mediated signaling in controlling theneuronal cytoskeleton and migration.

RESULTSThe microtubule cytoskeleton of migrating neuronsFreshly purified P6 granule cells were infected with a retroviral vectorcontaining α-tubulin tagged with the Venus variant of yellow fluores-cent protein17 and then cocultured with cerebellar astroglial cells.Using retroviral infection, only one copy of the gene is introduced,avoiding problems associated with transfection of high levels oflabeled cytoskeletal components. Labeled cells were subsequentlyimaged with a spinning disk confocal microscope to acquire high-speed, high-resolution images. Cells infected with retroviral constructsused in these studies (encoding α-tubulin, mPar6α, p50 dynactin andcentrin2; see Supplementary Fig. 1 for schematics) extended axonsand migrated in a manner indistinguishable from that of unlabeled

1Laboratory of Developmental Neurobiology and 2Laboratory of Chemistry and Cell Biology, The Rockefeller University, New York, New York 10021, USA.Correspondence should be addressed to M.E.H. (hatten@rockefeller.edu).

Published online 10 October 2004; corrected online 17 October 2004 (details online); doi:10.1038/nn1332

Par6α signaling controls glial-guided neuronalmigrationDavid J Solecki1, Lynn Model1, Jedidiah Gaetz2, Tarun M Kapoor2 & Mary E Hatten1

Neuronal migrations along glial fibers provide a primary pathway for the formation of cortical laminae. To examine themechanisms underlying glial-guided migration, we analyzed the dynamics of cytoskeletal and signaling components in livingneurons. Migration involves the coordinated two-stroke movement of a perinuclear tubulin ‘cage’ and the centrosome, with thecentrosome moving forward before nuclear translocation. Overexpression of mPar6α disrupts the perinuclear tubulin cage,retargets PKCζ and γ-tubulin away from the centrosome, and inhibits centrosomal motion and neuronal migration. Thus, wepropose that during neuronal migration the centrosome acts to coordinate cytoskeletal dynamics in response to mPar6α-mediated signaling.

NATURE NEUROSCIENCE VOLUME 7 | NUMBER 11 | NOVEMBER 2004 1195

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

cells. Although elegant studies of cytoskeletal dynamics have been car-ried out in extending neuronal growth cones18, these studies are thefirst examples of the use of fluorescent probes to examine cytoskeletaldynamics of living CNS neurons migrating along glial fibers.

Consistent with our previous observations with anti–α-tubulin antibodies10 (Fig. 1a), imaging of Venus-tagged α-tubulin in living cells(Fig. 1b,c) showed both a perinuclear cage-like structure, which appearsto surround the nucleus in the rear of the cell, and a system of micro-tubules extending into the leading process. During forward movement

Figure 1 The structure of the microtubulecytoskeleton of purified cerebellar granulecells. (a) Tubulin immunocytochemistry revealsthe microtubule cage of cerebellar granule cellscultured in vitro. Purified cerebellar granuleneurons were fixed after 24 h of culture in vitroand immunostained with an anti–α-tubulinantibody. A cage-like lattice of microtubules is present within the soma of all neurons. (b) Microtubule cytoskeleton of an activelymigrating neuron. Freshly purified cerebellargranule neurons were labeled with theVenus–α-tubulin retrovirus and cocultured with cerebellar glia for 48 h. Migrating neuronswere imaged with a spinning disk confocalmicroscope with a z-stack acquired once per minute. The three panels depicting the structural changes that occur as the neuron migrates forwardalong a glial process are maximum projections of the respective z-stack for each time point. (c) The microtubule cytoskeleton within a stationaryneuron. Freshly purified cerebellar granule neurons were labeled with the Venus–α-tubulin retrovirus and plated on Matrigel-coated wells for 48 hand were imaged as described above. Dynamic rearrangement of microtubules is observed in the growth cone (see inset), whereas the shape of thesoma remains unchanged.

of the neuron, the perinuclear microtubules undergo dynamic alter-ations in shape, but continue to enwrap the nucleus as the cage-nucleuscomplex moves forward as a single unit (Fig. 1b; also see SupplementaryVideo 1). Just before somal translocation, the cage elongates. As translo-cation occurs, the cage and nucleus move forward together and micro-tubules in the cage are compressed owing to the forward nuclearmovement. When a new interstitial adhesion site is established beneaththe cell soma2,3,5, the tubulin cage resumes a compact form. Thesemovements are reminiscent of the saltatory motions of migrating neu-

rons we observed in earlier high-resolutionvideo microscopy studies4,9. The dynamics oftubulin organization in neurons on glia werequite different from those of stationary neu-rons plated on laminin-coated culture surface.Although stationary cells also had a perinu-clear tubulin cage, the cage remained compactand did not undergo the dynamic architecturalchanges observed in migrating cells (Fig. 1cand Supplementary Video 2).

The dynamic alteration in the structure ofthe perinuclear tubulin that occurs inmigrating neurons, but not stationary cells,led us to examine the turnover of Venus–α-tubulin in the cage via fluorescence recoveryafter photobleaching (FRAP) (Fig 2a–c; alsosee Supplementary Video 3). In these assaysa single cell could survive multiple bleach-recovery cycles, indicating that our bleachparameters were not damaging. We rou-tinely observed ∼ 80% recovery of tubulinfluorescence in the cage. The average time ofmaximal recovery in the cage was 194 ± 5.6 s(n = 8 cells), comparable to the turnovertimes of microtubules in interphase ormitotic fibroblasts19,20. Notably, the tubulinturnover rate of migrating and stationarycells was nearly identical (Fig. 2c).Differences in the dynamics of tubulinturnover within the cage are thereforeunlikely to explain the disparity in motilitybetween migrating and stationary neurons.

Figure 2 FRAP analysis of Venus–α-tubulin turnover within the cage. (a) Example of FRAP in cerebellargranule neurons. Freshly purified cerebellar granule neurons were labeled with the Venus–α-tubulinretrovirus, cultured for 48 h and subjected to FRAP analysis to examine the turnover of labeled tubulin.The soma of the bleached neuron (indicated by arrow) was subjected to 100 iterations of a 541-nmlaser line and an image was acquired at 15-s intervals after bleaching. The image on the far left wastaken before bleaching, whereas the last image on the right was taken when the fluorescence reachedfull recovery. (b) Quantification of FRAP from a. Fluorescence was plotted as a function of time toexamine the time frame for full recovery. Full recovery occurred at ∼ 200 s after bleaching. (c) Comparison of the recovery times determined for migrating and stationary neurons. Labeled tubulinturnover was examined within the soma of eight neurons (three migrating and five stationary). Averagemaximal recovery time was calculated all the cells pooled together and for the migrating and stationarycells individually. Recovery time was nearly identical for both migrating and stationary cells.

A R T I C L E S

1196 VOLUME 7 | NUMBER 11 | NOVEMBER 2004 NATURE NEUROSCIENCE

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

mPar6α labels the neuronal centrosomeRecently a variety of studies have suggested that mPar6α and proteinkinase Cζ (PKCζ) form a highly conserved cell polarity complex thatfunctions in a variety of systems (for review see refs. 21,22). We there-fore reasoned that the highly polarized form of neurons migratingalong glial fibers might involve mPar6α. Venus-tagged mPar6α wasintroduced into purified granule neurons by retroviral infection andthe migration of labeled cells on astroglia was imaged using a spinningdisk confocal microscope. Venus-mPar6α was predominantly local-ized in a single punctate organelle in the soma of granule neurons justforward of the nucleus (Fig. 3a). Immunolabeling with anti–γ-tubulinantibody, a centrosomal marker, revealed colocalization with bothVenus-mPar6α in retrovirally labeled cells and mPar6α immunoreac-tivity in uninfected cells stained with mPar6α antibody (Fig. 3b,c).Similar localization to the centrosome was seen in purified astroglialcells (Supplementary Fig. 2). Par6α was also detected by western blot-ting of purified centrosomal fractions prepared from the CHO cell line(data not shown), in support of our immunocytochemical findings.Moreover, immunolabeling with antibodies against PKCζ, themPar6α-associated kinase, revealed concentration of this protein nearcentrosomes (see Fig. 3d). Taken together, these results indicate thatmPar6α is a previously unidentified centrosomal component and thatmPar6α-mediated signaling may occur at the centrosome.

Coordinated movement of centrosome and nucleusWe next imaged centrosomal motion in cells expressing Venus-taggedmPar6α. In migrating granule neurons, the Venus-Par6α–labeledcentrosome remained just forward of the nucleus in the direction ofmigration (Fig. 4a). This result is consistent with previous correlatedvideo microscopy and electron microscopy of migrating granule

neurons, which showed that the centrosome is just forward of thenucleus3,5. Live imaging showed that movement of the Venus-labeledcentrosome occurred before forward movement of the nucleus, in the direction of movement along the glial guide (Fig 4a; also seeSupplementary Video 4).

Cytoplasmic dynein, and its cofactor dynactin, are key regulatorsof centrosomal positioning in interphase cells23–25. To examine thespatial localization of dynein activity, we generated a retroviralconstruct expressing Venus–p50 dynactin, an essential subunit ofthe dynactin complex. Venus–p50 dynactin and immunostainingwith antibodies against p50 dynactin and dynein intermediatechain both brightly labeled the centrosome (Fig. 3a,e; seeSupplementary Fig. 3 for dynein intermediate chain), as was previ-ously seen in non-neuronal cells26,27. In migrating neurons, thedynactin-labeled centrosomes also initiated forward movementjust before translocation of the nucleus and soma (seeSupplementary Video 5). These results place the cytoplasmicdynein motor complex at the neuronal centrosome and confirm thecoordinated profile of movement of centrosome and nucleus thatwe observed in mPar6α-expressing cells.

Quantification of data sets pooled from both mPar6α- and p50-dynactin–labeled neurons showed that forward movement of thecentrosome preceded nuclear translocation in 90% of the forward‘steps’ (n = 28, from a total of 7 neurons) we imaged. We observedsimultaeous movement in the remaining steps, although mostoccurred at the beginning of an imaging sequence where centroso-mal movement could have occurred before we started imaging. Theaverage delay between centrosomal movement and somal movementwas 55 ± 5 s (mPar6α average 56 ± 7 s; p50 average 54 ± 7 s) and theaverage distance traversed by the centrosome and soma for each

Figure 3 mPar6α and p50 dynactin label theneuronal centrosome. (a) Localization of Venus-mPar6α and p50 dynactin within live cerebellargranule neurons. Freshly purified cerebellargranule neurons were labeled with either Venus-mPar6α or p50 dynactin retrovirus. In liveneurons, Venus-mPar6α and p50 dynactin bothstrongly labeled a single punctate organelle justforward of the nucleus. Each image is amaximum projection of a z-stack. (b) Venus-mPar6α is concentrated near the centrosome.Cerebellar granule neurons expressing Venus-mPar6α were immunostained with anti-GFP andanti-γ−tubulin antibodies. The mPar6α-labeledstructure colocalizes with γ-tubulinimmunoreactivity at the centrosome. (c) Endogenous mPar6α immunoreactivity alsocolocalizes with γ-tubulin, indicating that thelocalization of Venus-mPar6α mimics that of theendogenous protein. (d) Purified granuleneurons were immunostained with anti-PKCζand anti–γ-tubulin antibodies. PKCζimmunoreactivity is concentrated near γ-tubulin,a marker of the centrosome. (e) Cerebellargranule neurons were immunostained with anti-p50 dynactin and anti–α-tubulin antibodies.The predominant p50 dynactin–labeledstructure appears at points where themicrotubule cytoskeleton is nucleated,indicating that the structure labeled in a is likelyto be the centrosome. Substantial nuclearimmunoreactivity was also observed. Arrowheads indicate the spindle poles of a mitotic granule neuron precursor and full arrows indicate the centrosomal p50 dynactin. Scale bars, 10 µm. The mPar6α and p50 dynactin images share the same scale.

A R T I C L E S

NATURE NEUROSCIENCE VOLUME 7 | NUMBER 11 | NOVEMBER 2004 1197

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

Figure 5 Perturbation of mPar6α signaling ordynein activity inhibits granule neuron axon-extension and disrupts the perinuclearmicrotubule cage. (a) Purified P6 cerebellargranule neurons were transfected with Venus,Venus-mPar6α or p50 dynactin–EGFPexpression vectors, cultured for 48 h and thenstained with anti-GFP antibody to allowvisualization of granule neuron axons.Overexpression of Venus-mPar6α or p50dynactin reduced the number of cellselaborating long axons (percentage of axonsover 100 µm: control, 41%; Venus-mPar6α,6%; p50 dynactin, 17.5%) and resulted in anaccumulation of neuron with short processes(percentage of axons under 30 µm: control,14%; Venus-mPar6α, 65%; p50 dynactin,42%). Axon length was measured for ∼ 300cells for each condition tested. Scale bar, 20µm. (b) Purified granule neurons transfectedwith Venus-mPar6α were stained with anti-GFP,anti–β-tubulin and anti–γ-tubulin antibodies.Disintegration of the cage and a reduction of γ-tubulin recruitment to the centrosome wereseen in Venus-mPar6α–expressing cells, but notin the surrounding nontransfected cells.Moreover, Venus-mPar6α diffusely labeled theentire neuronal soma. (c) Purified granuleneurons transfected with Venus-mPar6α were stained with anti-GFP and anti-PKCζ antibodies. Dispersal of the PKCζ immunoreactivity concentratednear the centrosome was seen in a Venus-mPar6α expressing cell. (d) Purified granule neurons were transfected with p50 dynactin–EGFP and werestained with anti-GFP and anti–β-tubulin antibodies. Perturbation of the perinuclear microtubule cage is evident in p50 dynactin expressing cells, butnot in the surrounding nontransfected cells. The images in b and c share the same scale (10 µm). Scale bar in d, 5 µm.

(Supplementary Video 7). Thus, the coordinated forward movementof the centrosome and nucleus seemed to be a specific feature ofmigrating neurons. These results also indicate that the coordinatedmovement of these two organelles may be necessary for migration.

Disrupted mPar6α signaling perturbs the cytoskeletonTo examine the functional role of mPar6α at the centrosome duringglial-guided migration, we overexpressed mPar6α in purified cerebel-lar granule neurons in vitro by transfection. With this method,the transfected granule cells expressed approximately six times

movement cycle was 1.4 ± 0.16 µm and 1.3 ± 0.14 µm, respectively(mPar6α averages 1.3 ± 0.19 µm and 1.3 ± 0.17 µm; p50 averages 1.5± 0.26 µm and 1.2 ± 0.22 µm).

We next compared the highly orchestrated movement of the cen-trosome within migrating cells to centrosomal movement in station-ary neurons. Two distinct patterns of centrosomal movement wereobserved in stationary cells. When the neuron depicted in Figure 4apaused along the glial fiber, the forward movement of the centro-some stopped (Fig. 4b and Supplementary Video 6). Second, centro-somes moved randomly within the soma of stationary cells

A R T I C L E S

1198 VOLUME 7 | NUMBER 11 | NOVEMBER 2004 NATURE NEUROSCIENCE

Figure 4 Movement of the centrosome andnucleus are tightly coordinated in migratingneurons. (a) Centrosomal movement precedesnuclear movement in migrating neurons. Freshlypurified cerebellar granule neurons were labeledwith Venus-mPar6α and cocultured for 48 h withglial cells. Migrating cells were then imaged usinga spinning disk microscope and a z-stack takenevery 15 s. Each panel is a maximum projectionof a z-stack. The Venus-mPar6α–labeledcentrosome migrated into the base of the leadingprocess and its movement was followed by that ofthe nucleus. Quantification of the forwardmovement (in microns) of the centrosome andnucleus over time reveals a 1-min delay betweenthe time when the centrosome first begins tomove and when the nucleus follows. Blue linestrack centrosomal movement; red lines tracknuclear movement. (b) The centrosome ceasesforward movement in a stationary cell. The cell depicted in a ceased migrating ∼ 20 min after it was imaged. The same cell was imaged again to determinethe motion of the centrosome in a stationary cell. The centrosome and nucleus ceased forward motion and instead oscillated randomly as illustrated by thequantification of forward motion. Blue lines track centrosomal movement; red lines track nuclear movement.

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

A R T I C L E S

the endogenous level of mPar6α (Supplementary Fig. 1). Granule neurons overexpressing mPar6α did not extend parallel fibers and remained stationary, with a rounded profile28 (Fig. 5a).Immunolabeling with antibodies against α-tubulin and γ-tubulinshowed that overexpression of mPar6α was associated with disinte-gration of the cage of microtubules surrounding the neuronal nucleusand a decrease in γ-tubulin recruitment at the centrosome (Fig. 5b;for three-dimensional reconstruction, see Supplementary Video 8).Centrosomal pericentrin immunoreactivity was also greatly reducedby overexpression of Venus-mPar6α (Supplementary Fig. 2), indicat-ing a general centrosomal defect. Intense Venus-mPar6α signal wasseen throughout the soma of transfected cells, indicating that overex-pression causes a redistribution of mPar6α protein. Immunolabelingwith antibodies against PKCζ revealed a dispersal of centrosomalimmunoreactivity, further indicating that the mPar6α signaling path-way was disrupted (see Fig. 5c).

We next determined the consequence of mPar6α overexpression oncentrosomal positioning. For theses studies, purified cerebellar granuleneurons were infected with a retrovirus encoding Venus-tagged centrin2(ref. 29), a protein constitutively associated within the lumen of centri-oles30, and then forced to overexpress a dsRed-tagged version of mPar6αthrough electroporation. Centrin2-Venus localization in mPar6α-over-expressing granule neurons was diffuse as compared to control cells,consistent with the results of our γ-tubulin and pericentrin immunos-taining experiments (see Fig. 6, Supplementary Videos 9 and 10).Whereas centrosomes underwent rapid movements in control cells, the

NATURE NEUROSCIENCE VOLUME 7 | NUMBER 11 | NOVEMBER 2004 1199

Figure 6 mPar6α overexpression inhibits centrosomal movement. (a) Purified cerebellar granule neurons were infected with a centrin2-Venus retrovirus and then were electroporated with pRK5 dsRed-mPar6α.After 48 h, labeled cells were imaged using a spinning disk microscope.The field of cells displayed contained numerous centrin2-Venus–labeledcells (colored green) but only the cell in the top left also expressed dsRed-mPar6α (colored red, marked by arrow). The other two red cells were notlabeled with centrin2-Venus. (b) Time-lapse sequence of the mPar6α-overexpressing cell marked by the arrow in a. Labeled cells were imagedusing a spinning disk microscope and a z-stack taken every 20 s. Eachpanel is a maximum-projection z-stack. Centrin2-Venus was diffuselylocalized in the cell and the labeled structures did not significantly moveduring the course of imaging, indicating that mPar6α overexpressioninhibits centrosomal positioning events. (c) Time-lapse sequence ofcentrin2-Venus–labeled cells marked by stars in a. This time-lapsesequence depicts centrosomal motion in two nonelectroporated cells froma. Although these cells did not undergo directed migration, centrin2-labeled centrosomes were motile and rapidly changed position. An arrow ortwo arrowheads indicate the position of centrin2-Venus–labeled structureswithin each cell.

Figure 7 shRNA-mediated knockdown of mPar6α perturbs centrosomalorganization and positioning. (a) Schematic of the pScarlet_Par6 shRNAvector and experimental rationale for experiments detailed in b and c. The target sequence, GCTGCTGGCGGTCAGTGATGAGATCCTTG, residesfrom 679 to 707 bp downstream of the initiating methionine within theopen reading frame of the mouse mPar6α mRNA. (b) Validation of thepScarlet_Par6 shRNA vector. 293T cells were cotransfected with a Venus-mPar6α expression vector and pScarlet_Par6 shRNA vector. At 48 h after transfection, Venus and Scarlet fluorescence were imaged in live cells. Venus-mPar6α fluorescence was markedly reduced when the Venus-mPar6α vector was cotransfected with the mPar6 shRNA but not with acontrol. (c) Time-lapse sequence of centrin2-Venus–expressing cells labeled with high or low amounts of the mPar6 shRNA. The first panel in each series shows a merged image of Scarlet and centrin2-Venusfluorescence to highlight the morphology of the cells and indicate thestrength of the Scarlet signal. Centrosomes appeared normal andunderwent rapid movement in cells that had taken up low levels of themPar6α shRNA, as indicated by the low levels of red fluorescence (bottomrow). In contrast, individual centrioles could not be distinguished andcentrosomes were motionless in cells that had taken up high levels of themPar6α shRNA (top row). An arrow or an arrowhead indicates the positionof centrin2-Venus–labeled structures within each cell.

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

A R T I C L E S

centrin2-labeled structures within mPar6α-overexpressing cells weremotionless (see Supplementary Videos 9 and 10: lack of motion isclearly evident in Supplementary Video 9).

We next examined the dynamics of centrosomal motion within aloss-of-function model using shRNA-mediated knockdown ofmPar6α. We constructed an expression vector that independentlyexpresses a short hairpin shRNA (targeting nucleotides 679–707 of themPar6α mRNA, 620 bp downstream of the initiating methioninecodon) under the control of the U6 RNA polymerase III promoter31

along with a form of dsRed under control of the SV40 promoter (forschematic, see Fig. 7a); cells expressing a shRNA against the mPar6αmRNA would therefore express the dsRed reporter. Cotransfection of aVenus-mPar6α expression vector with the mPar6α shRNA expressionvector, but not an irrelevant control, led to a marked reduction in theintensity of Venus-mPar6α fluorescence, indicating efficient knock-down of mPar6α protein (Fig. 7b). We then imaged the dynamics ofcentrosomal motion after coelectroporation of the shRNA againstmPar6α and a centrin2-Venus expression vector into P6 cerebellargranule neurons. In cells that had low red fluorescence, indicating lowlevels of mPar6α shRNA, the centrosomes appeared normal andunderwent rapid movement (Fig. 7c; see Supplementary Video 11). Incontrast, in cells that had taken up high levels of the mPar6α shRNA,individual centrioles could not be distinguished and centrosomes weremotionless (Fig. 7c; see Supplementary Video 12). In addition, uptakeof high levels of the mPar6α shRNA also disrupted axon extension.These results indicate that loss of mPar6α function perturbs centroso-mal organization and repositioning. Moreover, the marked similarity ofthe phenotypes resulting from loss of function and overexpressionindicates that overexpression of mPar6α may dominantly inhibitmPar6α-mediated signaling.

Perturbation of mPar6α signaling inhibits glial-guided migrationTo examine the role of mPar6α in the development of neuronalpolarity required for glial-guided migration, we turned to cerebellarslice cultures. In this culture system granule neurons migrate alongglial fibers from the external germinal layer (EGL) into the internalgranular layer (IGL), recapitulating migration as it occurs in vivo.Venus-mPar6α was overexpressed in granule cells through transfec-tion of slices of cerebellar cortex. Whereas control granule cells

transfected with a Venus construct alone migrated from the EGL intothe IGL (Fig. 8a,d) and extended long parallel fibers (>200 µm inlength), granule cells transfected with Venus-mPar6α had shorterneurites and failed to migrate inward along Bergmann glial fibers(Fig. 8b,d). These results point to a crucial role for mPar6α in regu-lating cytoskeletal dynamics during both neuronal migration andaxon extension in situ.

Inhibition of dynein perturbs axon extension and migrationInhibition of cytoplasmic dynein and dynactin function by microinjec-tion of function-blocking antibodies or p50 dynactin overexpressionhas been shown to result in axonal retraction32, impaired centrosomalpositioning24,25,33,34 and impaired cell migration35. To compare inhibi-tion of dynein and dynactin activity to mPar6α overexpression withinthe context of axon extension, we overexpressed p50 dynactin in puri-fied cerebellar granule neurons. Granule neurons overexpressing p50dynactin extended shorter parallel fibers than did control cells (Fig. 5a)and showed microtubule cage defects that were less severe than those ofmPar6α-overexpressing cells (Fig. 5d). The frequencies of severelytruncated cells (65% for mPar6α versus 42% for p50 dynactin) andcells with microtubule defects (64% for mPar6α versus 35% for p50dynactin) were significantly lower in dynactin-overexpressing cells,indicating that mPar6α overexpression was more potent in perturbinggranule neuron morphology than dynein inhibition. Immunostainingof p50 dynactin–overexpressing cells with γ-tubulin or pericentrinantibodies revealed centrosomal abnormalities in truncated cells simi-lar to those observed with mPar6α, but these defects were less frequent,consistent with the lower percentage of truncated cells in the p50 dyn-actin overexpression experiments (data not shown).

To examine the role of dynein and dynactin activity in glial-guidedmigration, we transfected cerebellar slice cultures with a p50 dynactinexpression vector. Granule cells overexpressing p50 dynactin hadshorter neurites and many failed to migrate inward along Bergmannglial fibers (Fig. 8c,d). The frequency of neurons that failed to migrateand extend axons was higher when mPar6α was overexpressed (Fig. 8d). Taken together, these results indicate that inhibition ofdynein activity perturbs granule neuron axon extension, microtubulearchitecture and glial-guided migration. Although the phenotypeselicited by p50 dynactin and mPar6α overexpression were similar,granule neurons overexpressing mPar6α had a higher frequency ofdefects in each of the assays.

DISCUSSIONThe results presented here show that the neuronal cytoskeletonundergoes complex structural changes during the course of migra-tion along a glial fiber. A two-stroke motion characterizes the salta-tory movement of the neuron, whereby the centrosome initiatesforward motion before the perinuclear microtubule cage and nucleus.The mPar6α/PKCζ cell polarity complex is a component of the neu-ronal centrosome, and overexpression studies show that this signaling

1200 VOLUME 7 | NUMBER 11 | NOVEMBER 2004 NATURE NEUROSCIENCE

Figure 8 Overexpression of mPar6α or p50 dynactin inhibits glial-guidedmigration. P6 cerebellar slices were transfected with either a Venus, Venus-mPar6α or p50 dynactin-EGFP expression vector. (a) After 48 h in vitro,many Venus-expressing neurons migrated away from the pial surface (dashedline; arrows indicate direction towards the IGL). (b,c) Neurons transfectedwith Venus-mPar6α (b) or p50 dynactin (c) remained in the EGL, indicatingperturbation of mPar6α signaling or inhibition of dynein activity hinderedglial-guided migration. Scale bar, 100 µm. (d) Distance migrated away fromthe pial surface was measured for roughly 300 cells in two independentexperiments for each construct transfected, along with a migration index.

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

A R T I C L E S

complex is required for the organization of the microtubulecytoskeleton and the coordinated motion of the centrosome duringglial-guided migration. Thus, during CNS neuronal migration alongglial substrates, the centrosome seems to coordinate cytoskeletaldynamics in response to mPar6α-mediated signaling.

Video microscopic studies on the dynamics of granule cell migra-tion in real time provide evidence that the mode of migration ofpurified granule cells along glial substrates in vitro4 closely parallelsthat of cells undergoing migration in situ2,3. Migration occurs as aseries of saltatory movements4, during which the cell forms andreleases an ‘interstitial junction’ at the site of attachment with theglial fiber5. Real-time imaging has shown that migrating granuleneurons maintain the nucleus in the rear of the soma and extend aspecialized leading process in the direction of migration thatenwraps the glial process via lamellopodial and filopodial extensions,some of which form punctae adherentia with the glial fiber5,10.Extension of the tip of the leading process to the movement of thecell coma does not correlate with somal translocation, a fact thatargues against the leading tip of the neuron ‘pulling’ the cell somaalong the glial fiber4. A system of longitudinal microtubules in theleading process supports the flow of vesicles, a flow that halts whenmigration ceases4,10.

The present study extends our basic understanding of the organiza-tion and polarity of migrating neurons by examining the dynamicorganization of fluorescently labeled cytoskeletal and signaling compo-nents as purified neurons migrate along glial fiber in vitro. Our imagingstudies reveal new insights into the structure of the microtubulecytoskeleton and the movement of the centrosome and nucleus inmigrating neurons. As a neuron migrates along a glial fiber, the perinu-clear microtubule cage that enwraps the nucleus undergoes complexchanges in shape. Initially the cage has a compact, rounded form. Justbefore nuclear movement, the cage elongates, and as the nucleus movesforward, the cage deforms. The centrosome moves forward before thenucleus, and thus both organelles advance in a two-stroke motion.Several models could explain the two-stroke motion. FRAP analysis ofthe tubulin in the nuclear cage argues against a central role for tubulinturnover dynamics because turnover is identical in migrating and sta-tionary cells. Alternatively, forces on the microtubule cytoskeleton inthe leading portion of the soma could pull the centrosome forward,then minus end–directed motors such as cytoplasmic dynein associatedwith the nuclear envelope (refs. 36,37; also see Fig. 3e) could pull thenucleus towards the centrosome.

Imaging of centrosomal motion during migration has uncoveredunappreciated aspects of the internal polarity of migrating neurons.Electron microscopic examination of migrating neurons in situ and invitro has previously shown that centrosomes were located on the side ofthe neuronal soma where migration occurs3,5. Unexpectedly, our time-lapse studies show that during glial-guided migration centrosomes initi-ated forward movement before the neuronal nucleus and always movedin the direction of locomotion. A previous report indicated that centro-somes are also located at the base of newly emerging axons of cerebellargranule neurons38. Taken together, this indicates that centrosomal posi-tioning may reflect mobilization of the granule neuron cytoskeleton toparticipate in actions such as migration or axon extension.

We show here, for the first time, that mPar6α and cytoplasmic dyneinare components of the migrating neuron’s centrosome and thatmPar6α/PKCζ-mediated signaling regulates the dynamics of the micro-tubule cytoskeleton. These findings are consistent with proposed func-tions of Caenorhabditis elegans PAR genes in regulating theorientation39–41 and microtubule dynamics42,43 of the mitotic spindle inthe worm zygote.Overexpression of Ven-mPar6α disrupts the perinuclear

microtubule cage and retargets mPar6α, PKCζ and γ-tubulin away fromthe neuronal centrosome. Disintegration of the perinuclear cage couldresult from reduced targeting of γ-tubulin to centrosomes, as γ-tubulin isthe main microtubule-nucleating activity associated with the centro-some44. Both mPar6α overexpression and knockdown of mPar6α proteininhibit the motion of centrin2-Venus–labeled structures. This indicatesthat mPar6α-mediated signaling is required for centrosomal motion andorganization. The most notable phenotype elicited by mPar6α overex-pression was the inhibition of glial-guided migration in cerebellar slicecultures. Given the precisely coordinated motion of centrosomes duringmigration, these results indicate that centrosomal motion is necessary forneuronal migration and that mPar6α-mediated signaling is required forproper centrosomal positioning.

A variety of cytoskeletal events, such as microtubule reorganiza-tion, actin-myosin contractility and cytoplasmic dynein motoractivity, have been shown to have important centrosomal position-ing roles in non-neuronal cells24,25,29,33,34,45,46. In future studies itwill be of great interest to determine how mPar6α signaling inter-faces with cytoskeletal and motor components to regulate centro-some positioning during neuronal migration. In a preliminaryattempt to correlate the roles of mPar6α signaling and dynein activ-ity, we have compared the effects of p50 dynactin and mPar6α over-expression on axon extension and migration. Although inhibition ofcytoplasmic dynein activity resulted in similar axon extension andmigration phenotypes to perturbation of mPar6α signaling, the fre-quency of these defects was more prevalent in our mPar6α overex-pression experiments. This indicates that although cytoplasmicdynein and mPar6α may function in the same or parallel pathways,mPar6α signaling may have a greater role in organizing thecytoskeletal structures required for migration.

The current models of centrosomal movements in cells thatundergo crawling migrations, such as fibroblasts and astroglia, sug-gest that mPar6α signaling and dynein-mediated pulling of micro-tubules at the leading edge of cells mediate centrosome and nuclearpositioning events24,33–35. We propose a new model of neuronalmigration whereby mPar6α signaling at the neuronal centrosomefunctions to maintain the integrity of the tubulin cage around thenucleus, and drives nuclear translocation along the glial fiber (seeSupplementary Fig. 4). Understanding the interface between neu-ronal motility along glial fibers and the signaling pathways that influ-ence cytoskeletal dynamics in migrating neurons will point the way tothe discovery of new mechanisms regulating the establishment of thelaminar organization of the brain.

METHODSConstruction of retroviral vectors, expression vectors and shRNA vector. Thefull-length mPar6α cDNA was amplified from purified P6 cerebellar granuleneurons first strand cDNA using the following primers:

mPar6α Nde-ATG: 5′-cctcatatggcaggccgcagaggactccg-3′

mPar6α-TGA-Not: 5′-cccgcggccgctcagaggctgaatccgctaacatcacctgc-3′.The insert was subcloned into NdeI- and NotI-digested pBS Venus N-term

vector to fuse the Venus cDNA onto the N terminus of mPar6α. The Venus-mPar6α cDNA was then subcloned into the EcoRI and NotI sites of the pCX-I-BSR retroviral vector or the pRK5 expression vector. The full-length humanα-tubulin cDNA was amplified with the following primers:

hTub 5′-Sal: 5′-gatctcgagtcgacgcgtgagtgcatctccat-3′

hTub 3′-Hind: 5′-cccaagcttagtattcctctccttctt-3′.

The insert was subcloned into the pMSCXβ Venus-fusion retroviral vectorto fuse the Venus cDNA to the N terminus of human α-tubulin.

NATURE NEUROSCIENCE VOLUME 7 | NUMBER 11 | NOVEMBER 2004 1201

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

A R T I C L E S

The full-length human p50 dynactin cDNA was amplified using the follow-ing primers:

p50 5′-Nco: 5′-ggggaattcccatggcggaccctaaatacgcc-3′

p50 3′-Nde: 5′-ccccatatgtttcccagcttcttcatccgt-3′.

The insert was subcloned into EcoRI- and NdeI-digested pBS Venus C-termvector to fuse the Venus cDNA to the C terminus of p50 dynactin. The p50dynactin–Venus cDNA was then subcloned into the pMSCXβ Venus fusionretroviral vector.

The full-length centrin2 cDNA was amplified from amplified from purifiedP6 cerebellar granule neurons first-strand cDNA using the following primers:

Centrin2 5′ EcoRI: 5′-ggggaattcaccatggcctctaattttaagaagacaa-3′

Centrin2 3′ NotIL: 5′-ggggcggccgcttaatagaggctggtctt-3′.

The Venus cDNA was fused in frame with the 3′ end of the centrin2 codingsequence (to produce a C-terminal fusion) by joining PCR. The resulting cen-trin2-Venus cDNA was digested with EcoRI and NotI and subcloned into thepCX-I-BSR retroviral expression vector.

The mPar6α shRNA expression cassette (based on refs. 31,47) was gener-ated by amplifying the human U6 snRNP promoter and leader sequence withthe following primers:

5′ U6 EcoRI: 5′-ggggaattcccgagtccaacacccgtgggaatcccatg-3′

Par6 HP3: 5′-gggaagcttaaaaacaaagatctcatcactgaccgccagcagcccaagctgctggcg-gtcagtgatgagatccttggtcgactagtatatgtgctgcc-3′.

The target sequence, gctgctggcggtcagtgatgagatccttg, resides 620 bp down-stream of the initiating methionine within the mPar6α open reading frame.The PCR-amplified mPar6α shRNA expression cassette was digested withEcoRI and HindIII restriction enzymes and subcloned into the appropriaterestriction sites of pScarlet.

Retrovirus production. Recombinant ecotropic replication-incompetentretroviruses were produced as previously described48. Briefly, 293 cells werecotransfected with a retroviral construct and pCL-Eco, an ecotropic packagingconstruct. At 24 h after transfection, medium was replaced with granule cellmedium49 and the culture supernatant containing the retroviruses was har-vested 24 and 48 h later and filtered though a 0.45-µm pore. Virus was titeredby infecting primary granule neurons and observing the amounts of infectedcells. The amounts of cell culture supernatant used for subsequent infectionswere then adjusted to achieve roughly equal levels of infected cells.

Preparation of granule cells, retroviral infection and imaging. Granule cellswere prepared as described previously49. Briefly, cerebella were dissected awayfrom the brains of P6 mice. After the pial layer was peeled away, the tissue wastreated with trypsin and triturated into a single cell suspension using fine-borePasteur pipettes. The suspension was layered onto a discontinuous Percoll gradi-ent and separated by centrifugation. The small-cell fraction was then isolated;the resulting cultures routinely contain 90% granule cells and 10% glia.Retroviral supernatants were then added to the purified cells. Migration cultureswere prepared according to a published procedure4. and plated in movie dishes(Mattek) coated with low concentrations of poly-D-lysine or poly-L-ornithine tofacilitate attachment of neurons to glial processes. The cultures were incubatedfor 48–72 h and then imaged. For experiments where centrosomal motion wasimaged in neurons overexpressing mPar6α, cerebellar granule neurons wereinfected with a centrin2-Venus virus and preplated for 2 h. The media contain-ing retroviral supernatants were then washed away and the infected cerebellargranule neurons were electroporated with 15 µg of pRK5-dsRed-mPar6α usingan Amaxa Mouse Neuron Nucleofector kit. Cells were then plated as describedabove and imaged 48 h after electroporation. For experiments where centroso-mal motion was imaged in neurons expressing a mPar6α shRNA, cerebellargranule neurons were electroporated with 1.5 µg of centrin2-Venus and 20 µg ofpScarlet_Par6 shRNA using an Amaxa Mouse Neuron Nucleofector kit. Cellswere then plated as described above and imaged 48 h after electroporation.

Cerebellar granule neuron cultures were imaged with a Carl Zeiss Axiovert200M equipped with a 63×, 1.4-NA, Plan Apochromat objective. APerkinElmer Wallac UltraView confocal head with 514-nm excitation filter andOrca ER cooled CCD camera (Hamamatsu) were used to for high-resolutionimaging at near real-times speeds. z-stacks were collected (2–3-µm z-stacks,4–5 sections per stack) every 15 s during imaging. Images were processed and analyzed using MetaMorph (Universal Imaging Corp.). Cells were usuallyimaged for 45–60 min. Cells that did not migrate during image acquisitionwere termed stationary neurons, whereas cells that moved were termed migrat-ing neurons. Imaging of FRAP experiments were carried out on a Carl ZeissAxiovert 200M equipped with a 40×, 1.0-NA, Plan Apochromat objective and aZeiss LSM 510 confocal scanning system. Regions of interest were bleached by100 iterations of a 541-nm laser line and an image acquired at 15-s intervalsafter bleaching. All image processing and measurements were carried out usingZeiss LSM 510 software.

For overexpression experiments, purified cerebellar granule neurons wereplated into Lab-Tek 16 well slides coated with poly-D-lysine and Matrigel.Transfection mixtures (containing a pRK5 Venus–mPar6α or pEGFPN1–p50dynactin expression vector) were prepared using Lipofectamine 2000(Invitrogen) as per the manufacturer’s instructions and then added to theplated cells. Cultures were incubated for 36–48 h to allow for neurite exten-sion and neuron migration and then fixed and processed for immunocyto-chemistry. Fixed specimens were imaged with a Radiance 2000 confocallaser-scanning microscope.

Preparation and transfection of organotypic cerebellar slices. Organotypiccerebellar slices were prepared according to a published procedure50. To visu-alize parallel fibers within the slices, cerebella isolated from P6 mice werechopped coronally 250–300 µm in thickness by a McIlwain Tissue Chopper(Brinkman) and maintained on a tissue culture insert (Millicell, Millipore)that was submerged in culture medium (Basal Medium Eagle supplementedwith 10 mg/ml bovine serum albumin (Sigma), 2 mM L-glutamine, 0.5% glucose, 1× ITS (insulin-transferrin-selenite; Sigma) and 50 U/ml penicillin-streptomycin). Transfection mixtures (containing a Venus expression vectoras a marker for transfected cells and a pRK5 Myc-mPar6α or pEGFPN1-p50dynactin expression vectors) were prepared using Transfectin reagent (Bio-Rad) as per the manufacturer’s instructions and then added directly onto thecultured slices. At 48 h after transfection, slices were fixed and processed forimmunostaining as described previously48.

Immunocytochemistry of primary cerebellar granule neurons. Granule neu-rons that were cultured in vitro for various times were washed with PHEMbuffer (60 mM PIPES, 25 mM HEPES, 10 mM EGTA, 2mM MgCl2, pH 6.9)warmed to 37° C. The cells were then permeabilized by a 5-min incubationwith warm PHEM plus 0.2% Triton X-100 and then fixed for 20 min withwarm PHEM plus 4% paraformaldehyde. All steps before blocking were car-ried out on a warm plate set to 37° C to insure the integrity of the microtubulecytoskeleton. The cells were then blocked by the addition of PHEM plus 10%normal donkey serum. Primary and secondary antibody staining was carriedout in PHEM plus 1% normal donkey serum. The primary antibodies used forthis study were: anti–β-tubulin (mouse IgG, Sigma), anti–β-tubulin (mouseIgM, Abcam), anti–γ-tubulin (mouse IgG, Sigma), anti-Par6 (goat IgG, SantaCruz), anti-PKCζ (mouse IgG, Santa Cruz) anti-Par6 (rabbit IgG; courtesy ofJ. Fawcett, Mount Sinai Hospital, Toronto, Canada), and anti–dynein interme-diate chain (rabbit IgG; courtesy of R.B. Vallee, Columbia University, NewYork). The anti–p50 dynactin antibody (rabbit IgG) was raised against recom-binant full-length human p50 protein and affinity purified.

Note: Supplementary information is available on the Nature Neuroscience website.

ACKNOWLEDGMENTSWe thank A. Miyawaki (RIKEN Brain Science Institute; Saitama, Japan) forgenerously sharing Venus, C. Waterman-Storer (Scripps Research Institute, LaJolla, California) for insightful discussions and critical reading of the manuscript,Y. Fang for expert technical assistance, N. Didkovsky for three-dimensionalreconstruction of our imaging data sets, K. Zimmerman and J.H. Kim for critical reading of the manuscript, and A. North and the Rockefeller UniversityBioimaging facility for use of the spinning disk confocal microscope and experttechnical advice. Antibodies were generously supplied by J. Fawcett (anti-mPar6α;Mount Sinai Hospital, Toronto, Canada) and R.B. Vallee (anti–dynein intermediate

1202 VOLUME 7 | NUMBER 11 | NOVEMBER 2004 NATURE NEUROSCIENCE

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce

A R T I C L E S

chain; Columbia University, New York). This work was supported by US NationalInstitutes of Health grant RO1 NS15429-24A1 to M.E.H. This paper is dedicated tothe memory of Rodolfo Rivas, who discovered the perinuclear tubulin cage.

COMPETING INTERESTS STATEMENTThe authors declare that they have no competing financial interests.

Received 20 July; accepted 30 August 2004Published online at http://www.nature.com/natureneuroscience/

1. Hatten, M.E. New directions in neuronal migration. Science 297, 1660–1663 (2002).2. Rakic, P. Neuron-glia relationship during granule cell migration in developing cere-

bellar cortex. A Golgi and electronmicroscopic study in Macacus Rhesus. J. Comp.Neurol. 141, 283–312 (1971).

3. Rakic, P. Mode of cell migration to the superficial layers of fetal monkey neocortex.J. Comp. Neurol. 145, 61–83 (1972).

4. Edmondson, J.C. & Hatten, M.E. Glial-guided granule neuron migration in vitro: a high-resolution time-lapse video microscopic study. J. Neurosci. 7, 1928–1934 (1987).

5. Gregory, W.A., Edmondson, J.C., Hatten, M.E. & Mason, C.A. Cytology and neuron-glial apposition of migrating cerebellar granule cells in vitro. J. Neurosci. 8,1728–1738 (1988).

6. O’Rourke, N.A., Dailey, M.E., Smith, S.J. & McConnell, S.K. Diverse migratory path-ways in the developing cerebral cortex. Science 258, 299–302 (1992).

7. Komuro, H. & Rakic, P. Distinct modes of neuronal migration in different domains ofdeveloping cerebellar cortex. J. Neurosci. 18, 1478–1490 (1998).

8. Nadarajah, B., Brunstrom, J.E., Grutzendler, J., Wong, R.O. & Pearlman, A.L. Twomodes of radial migration in early development of the cerebral cortex. Nat. Neurosci.4, 143–150 (2001).

9. Gasser, U.E. & Hatten, M.E. Central nervous system neurons migrate on astroglialfibers from heterotypic brain regions in vitro. Proc. Natl Acad. Sci. USA 87,4543–4547 (1990).

10. Rivas, R. & Hatten, M. Motility and cytoskeletal organization of migrating cerebellargranule neurons. J. Neurosci. 15, 981–989 (1995).

11. Rakic, P., Knyihar-Csillik, E. & Csillik, B. Polarity of microtubule assemblies duringneuronal cell migration. Proc. Natl Acad. Sci. USA 93, 9218–9222 (1996).

12. Hirotsune, S. et al. Graded reduction of Pafah1b1 (Lis1) activity results in neuronalmigration defects and early embryonic lethality. Nat. Genet. 19, 333–339 (1998).

13. Gleeson, J.G., Lin, P.T., Flanagan, L.A. & Walsh, C.A. Doublecortin is a microtubule-associated protein and is expressed widely by migrating neurons. Neuron 23,257–271 (1999).

14. Smith, D.S. et al. Regulation of cytoplasmic dynein behaviour and microtubuleorganization by mammalian Lis1. Nat. Cell Biol. 2, 767–775 (2000).

15. Sheen, V.L. et al. Mutations in the X-linked filamin 1 gene cause periventricularnodular heterotopia in males as well as in females. Hum. Mol. Genet. 10,1775–1783 (2001).

16. Hatten, M.E. Central nervous system neuronal migration. Annu. Rev. Neurosci. 22,511–539 (1999).

17. Nagai, T. et al. A variant of yellow fluorescent protein with fast and efficient matura-tion for cell-biological applications. Nat. Biotechnol. 20, 87–90 (2002).

18. Schaefer, A.W., Kabir, N. & Forscher, P. Filopodia and actin arcs guide the assemblyand transport of two populations of microtubules with unique dynamic parameters inneuronal growth cones. J. Cell Biol. 158, 139–152 (2002).

19. Saxton, W.M. et al. Tubulin dynamics in cultured mammalian cells. J. Cell Biol. 99,2175–2186 (1984).

20. Wadsworth, P. & Salmon, E.D. Microtubule dynamics in mitotic spindles of livingcells. Ann. N Y Acad. Sci. 466, 580–592 (1986).

21. Etienne-Manneville, S. & Hall, A. Cell polarity: Par6, aPKC and cytoskeletalcrosstalk. Curr. Opin. Cell Biol. 15, 67–72 (2003).

22. Henrique, D. & Schweisguth, F. Cell polarity: the ups and downs of the Par6/aPKCcomplex. Curr. Opin. Genet. Dev. 13, 341–350 (2003).

23. Koonce, M.P. et al. Dynein motor regulation stabilizes interphase microtubule arraysand determines centrosome position. EMBO J. 18, 6786–6792 (1999).

24. Etienne-Manneville, S. & Hall, A. Integrin-mediated activation of Cdc42 controlscell polarity in migrating astrocytes through PKCzeta. Cell 106, 489–498 (2001).

25. Yvon, A.M. et al. Centrosome reorientation in wound-edge cells is cell type specific.Mol. Biol. Cell 13, 1871–1880 (2002).

26. Steuer, E.R., Wordeman, L., Schroer, T.A. & Sheetz, M.P. Localization of cytoplas-mic dynein to mitotic spindles and kinetochores. Nature 345, 266–268 (1990).

27. Echeverri, C.J., Paschal, B.M., Vaughan, K.T. & Vallee, R.B. Molecular characteriza-tion of the 50-kD subunit of dynactin reveals function for the complex in chromo-some alignment and spindle organization during mitosis. J. Cell Biol. 132,617–633 (1996).

28. Hatten, M.E., Liem, R.K. & Mason, C.A. Weaver mouse cerebellar granule neurons failto migrate on wild-type astroglial processes in vitro. J. Neurosci. 6, 2676–2683 (1986).

29. Piel, M., Nordberg, J., Euteneuer, U. & Bornens, M. Centrosome-dependent exit ofcytokinesis in animal cells. Science 291, 1550–1553 (2001).

30. Paoletti, A., Moudjou, M., Paintrand, M., Salisbury, J.L. & Bornens, M. Most of cen-trin in animal cells is not centrosome-associated and centrosomal centrin is con-fined to the distal lumen of centrioles. J. Cell Sci. 109, 3089–3102 (1996).

31. Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J. & Conklin, D.S. Short hair-pin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. GenesDev. 16, 948–958 (2002).

32. Ahmad, F.J. et al. Motor proteins regulate force interactions between microtubulesand microfilaments in the axon. Nat. Cell Biol. 2, 276–280 (2000).

33. Palazzo, A.F. et al. Cdc42, dynein, and dynactin regulate MTOC reorientation independ-ent of Rho-regulated microtubule stabilization. Curr. Biol. 11, 1536–1541 (2001).

34. Burakov, A., Nadezhdina, E., Slepchenko, B. & Rodionov, V. Centrosome positioningin interphase cells. J. Cell Biol. 162, 963–969 (2003).

35. Dujardin, D.L. et al. A role for cytoplasmic dynein and LIS1 in directed cell move-ment. J. Cell Biol. 163, 1205–1211 (2003).

36. Busson, S., Dujardin, D., Moreau, A., Dompierre, J. & De Mey, J.R. Dynein and dyn-actin are localized to astral microtubules and at cortical sites in mitotic epithelialcells. Curr. Biol. 8, 541–544 (1998).

37. Salina, D. et al. Cytoplasmic dynein as a facilitator of nuclear envelope breakdown.Cell 108, 97–107 (2002).

38. Zmuda, J.F. & Rivas, R.J. The Golgi apparatus and the centrosome are localized tothe sites of newly emerging axons in cerebellar granule neurons in vitro. Cell Motil.Cytoskeleton 41, 18–38 (1998).

39. Etemad-Moghadam, B., Guo, S. & Kemphues, K.J. Asymmetrically distributed PAR-3 protein contributes to cell polarity and spindle alignment in early C. elegansembryos. Cell 83, 743–752 (1995).

40. Grill, S.W., Gonczy, P., Stelzer, E.H. & Hyman, A.A. Polarity controls forces govern-ing asymmetric spindle positioning in the Caenorhabditis elegans embryo. Nature409, 630–633 (2001).

41. Tsou, M.F., Ku, W., Hayashi, A. & Rose, L.S. PAR-dependent and geometry-depend-ent mechanisms of spindle positioning. J. Cell Biol. 160, 845–855 (2003).

42. Kaltschmidt, J.A. & Brand, A.H. Asymmetric cell division: microtubule dynamicsand spindle asymmetry. J. Cell Sci. 115, 2257–2264 (2002).

43. Labbe, J.C., Maddox, P.S., Salmon, E.D. & Goldstein, B. PAR proteins regulatemicrotubule dynamics at the cell cortex in C. elegans. Curr. Biol. 13, 707–714(2003).

44. Moritz, M., Braunfeld, M.B., Sedat, J.W., Alberts, B. & Agard, D.A. Microtubulenucleation by gamma-tubulin-containing rings in the centrosome. Nature 378,638–640 (1995).

45. Severson, A.F. & Bowerman, B. Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis ele-gans. J. Cell Biol. 161, 21–26 (2003).

46. Rosenblatt, J., Cramer, L.P., Baum, B. & McGee, K.M. Myosin II-dependent corticalmovement is required for centrosome separation and positioning during mitoticspindle assembly. Cell 117, 361–372 (2004).

47. Paddison, P.J., Caudy, A.A., Sachidanandam, R. & Hannon, G.J. Short hairpin activated gene silencing in mammalian cells. Methods Mol. Biol. 265, 85–100(2004).

48. Solecki, D.J., Liu, X.L., Tomoda, T., Fang, Y. & Hatten, M.E. Activated Notch2 sig-naling inhibits differentiation of cerebellar granule neuron precursors by maintain-ing proliferation. Neuron 31, 557–568 (2001).

49. Hatten, M.E. Neuronal regulation of astroglial morphology and proliferation in vitro.J. Cell Biol. 100, 384–396 (1985).

50. Stoppini, L., Buchs, P.A. & Muller, D. A simple method for organotypic cultures ofnervous tissue. J. Neurosci. Methods 37, 173–182 (1991).

NATURE NEUROSCIENCE VOLUME 7 | NUMBER 11 | NOVEMBER 2004 1203

©20

04 N

atur

e P

ublis

hing

Gro

up

http

://w

ww

.nat

ure.

com

/nat

uren

euro

scie

nce