E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

ava i l ab l e a t www.sc i enced i r ec t . com

www.e l sev i e r. com/ loca te /yexc r

Research Article

Nucleation and growth of cadherin adhesions

Mireille Lamberta,b, Olivier Thouminec, Julien Brevierd, Daniel Choquetc,Daniel Rivelined, René-Marc Mègea,b,⁎aINSERM, U839, Paris, F-75005, FrancebUniversité Pierre et Marie Curie-Paris6, Paris, Institut du Fer à Moulin, UMR-S0839, Paris, F-75005, FrancecUniversité Bordeaux 2, CNRS, UMR5091, Institut François Magendie de Neurosciences, Bordeaux, F-33077, FrancedUniversité Joseph Fourier, CNRS, UMR5588, Saint-Martin d'Hères, F-38402, France

A R T I C L E I N F O R M A T I O N

⁎ Corresponding author. Institut du Fer à MouE-mail address: mege@fer-a-moulin.inserAbbreviations: RICM, reflection interferen

fluorescence recovery after photobleaching;

0014-4827/$ ­ see front matter © 2007 Elsevidoi:10.1016/j.yexcr.2007.07.035

A B S T R A C T

Article Chronology:Received 27 April 2007Revised version received6 July 2007Accepted 19 July 2007Available online 8 August 2007

Cell–cell contact formation relies on the recruitment of cadherin molecules and theiranchoring to actin. However, the precise chronology of events from initial cadherin trans-interactions to adhesion strengthening is unclear, in part due to the lack of access to thedistribution of cadherins within adhesion zones. Using N-cadherin expressing cellsinteracting with N-cadherin coated surfaces, we characterized the formation of cadherinadhesions at the ventral cell surface. TIRF and RIC microscopies revealed streak-likeaccumulations of cadherin along actin fibers. FRAP analysis indicated that engagedcadherins display a slow turnover at equilibrium, compatible with a continuous additionand removal of cadherin molecules within the adhesive contact. Association of cadherincytoplasmic tail to actin as well as actin cables and myosin II activity are required for theformation and maintenance of cadherin adhesions. Using time lapse microscopy wedeciphered how cadherin adhesions form and grow. As lamellipodia protrude, cadherin focistochastically formed a few microns away from the cell margin. Neo-formed foci coalescedaligned and coalesced with preformed foci either by rearward sliding or gap filling to formcadherin adhesions. Foci experienced collapse at the rear of cadherin adhesions. Based onthese results, we present a model for the nucleation, directional growth and shrinkage ofcadherin adhesions.

© 2007 Elsevier Inc. All rights reserved.

Keywords:Actin filamentsCell adhesionCateninN-cadherinFocal adhesionBiomimetic surfaceTIRF microscopyRICM microscopyFRAPTime lapse microscopy

Introduction

Cadherins mediate cell–cell adhesion through homophilicinteractions of their extracellular domain and anchoring oftheir intracellular domain to the actin cytoskeleton viacatenins α, β and p120 [1,2]. They are key components of cell–cell contacts and intercellular junctions contributing to cell'scohesion within tissues [3,4]. During development, cadherins

lin, 17 Rue du Fer à Moulm.fr (R.-M. Mège).ce contrast microscopy;ECM, extracellular matrix

er Inc. All rights reserved

contribute to a large set of regulations in tissuemorphogenesissuch as mesenchymal–epithelial transition, cell sorting andtissue rearrangement through convergence-extension, neuriteelongation and synaptogenesis [1,5,6]. Having a comprehen-sive view of cadherin recruitment and dynamics at cell–cellcontacts and its regulation is of major importance for theunderstanding of the control of cell fate in normal as well aspathological situations such as carcinogenesis [7].

in, Paris, F-75005 France. Fax: +33 1 45 87 61 32.

TIRFM, total internal reflection fluorescence microscopy; FRAP,

.

Fig. 1 – Design and expression of dDsRed and GFP-taggedfusion proteins. (A) Schematic representation ofNcad-dDsRed, Ncad-GFP full length constructs and deletionmutants. The full length cDNA encoding chicken N-cadherinwas fused in frame to a tandem repeat of the dsRed sequence(DsRed x2 [44]). Ncad-GFP, Ncad-Δβcat-GFP and NcadΔcyto-GFP mutants were described in Thoumine et al. [25].Pp: leader peptide and propeptide of the chicken N-cadherin;ext: extracellular domain; TM: transmembrane domain; cyto:cytoplasmic domain. (B) Cell extracts prepared from C2 cellsinduced to express Ncad-dDsRed for 36 h wereimmunoprecipitated with a polyclonal anti-β-cateninantibody, then immunoprecipitates were blotted withanti-αE-catenin and anti-N-cadherin antibodies.(C) The Ncad-dDsRed signal was concentrated at contact sitesbetween transfected C2 cells, with however variousmorphologies. The dDsRed signal appeared as puncta:arrowheads in i, ii; dashed lines orthogonal to the contact:arrows in ii, iii, iv, v; or as a continuous straight line:vi. Scale bar, 10 μm.

4026 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

The formation of E-cadherin mediated cell contacts wasstudied in details in epithelial cells by Adams et al. [11] andkeratinocytes by Vasioukhin et al. [8]. Both contributions,despite differences, describe ordered events leading to theextension and maturation of cell contacts. In keratinocytes, E-cadherin concentrate together with associated proteins at thetip of filopodia protruding towards the neighboring cell [8].These contacts thenmaturewith thedisappearanceof filopodialeading to the formation of straight contacts. This process isunder the control of the actin dynamic regulator Mena, and theactin polymerizing protein formin-1, both recruited through α-catenin [9]. In contrast, in MDCK cells, contacts initiate andextendmainly through lamellipodial extensions [10]. However,puncta of E-cadherin were observed as intermediate structuresduring the contact growth prior to massive actin filamentrecruitment and coalescence of E-cadherin puncta in moreextended structures [11]. Similar observationswere extended tovarious non-epithelial cells expressing either E-cadherin or N-cadherin [12,13]. Very recently, Kametani et al. [14], described inA431 epidermoid carcinoma cells similar VE-cadherin punctamigrating apically toward adherens junctions. However in thelatter, VE-cadherin spontaneously clustered, and thus theinitial formation of puncta was not accessible and related tofurther recruitment in apical junctions.

Recent investigations unveiled a complex crosstalk be-tween cadherin engagement and regulation of the actin cyto-skeleton during contact extension and strengthening(reviewed in [15]). Local lamellipodia protrusion was identifiedas a pivotal early event induced by E- or N-cadherin engage-ment, and under the dependence of a PI3 kinase-Rac1 depen-dent pathway [10,12,13]. The stimulation of actin polymerizationthrough activation of the Arp 2/3 complex was further shown tobe essential for contact extension in these cells [16,17]. Cortactinand Mena (Ena-VASP activity) were proposed as importantregulator of this process [18–20]. In parallel, we observed thatonce engaged, cadherins anchor to the cytoskeleton in a processregulated by Rac1 [21]. This anchoring may be essential forfurther recruitment of cadherins and actin filaments in maturecell contacts. Although well described, all these morphologicaland signaling observations could not be integrated in a singlecellular model recapitulating all the steps of cell contact for-mation, from initial cadherin engagement to contact extensionand maturation of actin associated adherens junctions.

Using cadherin covered surfaces to force cadherin mediatedcell contacts, we and others have shown that, when presentedto cadherin-coatedplanar substrates,N-cadherin, E-cadherin orcadherin-11 expressing cells respond by extending a largelamellipodium. Cells organize, within this lamellipodial exten-sion, cadherin/catenin complexes together with actin cables inadhesion plaques named cadherin adhesions [13,22] or macro-clusters [23]. We further showed that these adhesion plaquesare distinct and form independently of integrin complexes [13].These two cell responses reflecting contact extension andmaturation observed at actual cell–cell contacts [10], theirstudy may be extremely useful to unravel the molecular andcellular aspects of cadherin contact formation.

This approach applied in particular to N-cadherin expres-singC2 cells [13] presentsmajor advantages for the studyof thedynamics of cadherin recruitment at cell contacts. The two-dimensional mimicked cell contact is easily accessible to

conventional microscopies as well as to those specificallydevoted to the observation of the cell–substratum interface atthe ventral side of the cell. In addition, due to the existence ofa large lamellum and a relatively small lamellipodium in C2cells (both as defined by Ponti et al. [24]), the formation ofcadherin adhesions is spatially distinct from nascent contactsat the margin of the cell. This approach allows unambigu-ously imaging the initial recruitment of cadherin moleculesas well as their dynamics during contact maturation leadingto the formation of adherens junctions. Using a combinationof fluorescence imaging techniques, we precisely determined

4027E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

the topography and dynamics of these structures andanalyzed the involvement of actomyosin on their formationand stability. Based on these results we present a model forcadherin contact formation involving phases of nucleation,oriented growth and shrinkage.

Results

N-cadherin contact formation in C2 cells

To study the dynamics of N-cadherin molecules, a plasmidencoding the chickenN-cadherin fused to the tandemdimmerof DsRed was generated (Ncad-dDsRed, Fig. 1A). We also usedthe full length N-cadherin and cytoplasmic deletion mutantsΔβcat and Δcyto fused in C-terminal to GFP describedpreviously [25]. To evaluate its functionality, the Ncad-dDsRedconstruct was expressed into myogenic C2 cells, and itscapability to associate in cadherin/catenin complexes and toaccumulate at cell contacts was addressed. Ncad-dDsRed co-immunoprecipitated with β-catenin as endogenous N-cad-herin and αE-catenin (Fig. 1B). Moreover, Ncad-dDsRedstrongly accumulated at cell contacts (Fig. 1C) as did endo-genousN-cadherin andNcad-GFP [25,26]. C2 cell contactswerevery pleiomorphic, as reported previously [27]. N-cadherindistributed either as puncta, dashed lines orthogonal to thecontact, or as a continuous and straight line parallel to the

Fig. 2 – Dynamics of N-cadherin recruitment at C2 cell–cell contaforming contact with each other were observed by time lapse mipoints toward a homogeneous GFP signal near the cell edge. Thefrom a dashed to a more continuous line. Scale bar: 10 μm. (B) Linfunction of the position between the arrow and the arrowhead depother by valleys of low signal correspond to three puncta of Ncad-during the maturation of the contact (0 min and 45 min followinsmoothened to a nearly flat one. Control of focus was done by fo

contact (Fig. 1C). Presence of puncta or short orthogonal linesoccurred when lamellipodia of the two interacting cells wereoverlapping. This latter aspect (see in particular Fig. 1C, iii) washighly reminiscent of the morphology of cadherin adhesionsobserved when plating C2 cells on Ncad-Fc planar substrates[13]. These patterns were also documented for VE-cadherinexpressing cell contacts [14,28].

When observed by time lapse fluorescence microscopy,contacts betweenNcad-GFP expressing cells displayed differenttopographies depending on their location (Fig. 2A). Near the celledge where new contacts likely form the N-cadherin-GFP signalwas mainly organized into puncta. In contrast to previousobservations at cell contacts between VE-cadherin expressingA431 cells [14], this puncta appeared de novo from a low andhomogeneous N-cadherin signal (arrowhead in Fig. 2A). Thistopographywasmodified in the center of the contact leading toan elongated straight GFP signal. Accordingly, nascent contactsdisplayed high variations in fluorescence intensity along theaxis of the cell–cell boundary (Fig. 2B). In contrast, a smoothen-ing of theN-cadherin signalwas observed inmore central, likelyolder, regions of the contact (Fig. 2C), suggesting that cadherincontacts are subject to evolution with time.

Topographic characterization of cadherin adhesions

To further study the dynamics of cadherin receptors at cellcontacts, we took advantage of the peculiar morphology of

cts. (A) A cluster of three N-cadherin-GFP expressing cellscroscopy to follow the fluorescent GFP signal. The arrowheadarrow highlights a contact zone where the GFP signal evolvese scan analysis of the N-cadherin-GFP signal (gray levels) as aicted in panel A. The three peaks clearly separated from eachGFP (ratio peak/valley=4). (C) Two line scans were performedg the beginning of the time lapse). Contrasting signalllowing the intersection formed by the three cells.

4028 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

cadherin contacts formed by cells spreading on Ncad-Fc planarsubstrates [13]. We applied TIRFM (total internal reflectionfluorescence microscopy) and RICM (reflection interferencecontrast microscopy) to specifically analyze the signal emittedin close vicinity of the cadherin-coated substratum, and thetopography of the ventral cell membrane, respectively. TIRFMrevealed bright accumulations of β-catenin (data not shown)and p120 immunostaining in radial structures located in thelamella (Fig. 3A), very similar to cadherin adhesions previouslyobserved using wide field fluorescence microscopy or confocalmicroscopy [13]. Yet, these radial structures appeared consti-tuted of discrete fluorescent spots, designated thereafter foci.Thedottedappearanceof cadherinadhesionswasalsoobservedwith wide field microscopy combined to deconvolution (datanot shown). Notice however the presence in the lamella ofnumerous foci with no evident sign of alignment. Phalloidin-

Fig. 3 – Characterization of cadherin adhesion topography. C2 ceabsence of serum to avoid growth factor receptors and integrins(C, D) and observed by TIRFM (A, C) and RICM (B, D). p120 cateninratio in radial structures similar to cadherin adhesions detectedsuggesting that cadherin adhesions indeed localized in close conof black (membrane apposed to the substrate) and light gray (meperiphery. Cadherin adhesions correspond to streaks of strong mareas zoomed 3 times.

stained actin filaments were also observed by TIRF microscopyin cadherin adhesions with however no perfect colocalizationwith catenin staining (Fig. 3C and data not shown). Theseobservationsconfirmthat cadherinadhesionsare formedby theaccumulation of cadherin/catenin complexes at the ventral cellmembrane and that actin filaments reach these structures. Asshown previously no integrin or integrin-associated proteinscould be detected in these structures [13].

RICM on the same preparations allowed to identify extensiveareas of membrane closely apposed to the cadherin-coatedsubstratum (dark areas) that were also radially oriented (Figs. 3B,D). Comparisonwith TIRFM images revealed a goodmatching ofthese areas with cadherin adhesions. Thus, cadherin adhesionscan be defined as elongated adhesion plaques formed of foci ofcadherin/catenins complexes aligned along actin filaments inareasof tight appositionof the cellmembranewith the cadherin-

lls were plated on Ncad-Fc-coated coverslips for 2 h in theactivation, fixed and immunostained for p120 (A, B) or actinand F-actin were detected with a high signal/noise

by wide field conventional fluorescence microscopy [13],tact to the substrate. RICM images show an alternationmbrane away from the substrate) signals all around the cellembrane apposition (black signals). Scale bar: 5 μm. Insert:

Fig. 4 – N-cadherin molecules show a slow turnover withincadherin adhesions. C2 cells were plated on laminin (LN),Ncad-Fc (N-cad) or anti-N-cadherin antibody (GC4) coatedcoverslips for 2 h and subjected to photobleaching in thelamella. (A) Representative FRAP sequences for the threetypes of substrates, where time zero is defined as the laserflash (scale bar: 5 μm). Area (1) corresponds to the bleachedarea. Area (2) was used as a non-bleached reference and area(3) as background reference. On cells seeded on Ncad-Fc, thebleached area (area 1) was centered on cadherin adhesions.(B) Fluorescence was normalized between 0 and 1 asdescribed in Materials and methods and plotted over time.Fluorescence recovery was rapid and complete for cellsseeded on laminin, highly impaired for cells on immobilizedGC4 and intermediary for the ones seeded on Ncad-Fc,revealing a slow turnover for N-cadherin molecules trappedin cadherin adhesions. Experimental data (open symbols)were fitted by a diffusion-reaction model as explained inMaterials and methods (curves), which yields the proportion(ϕ) and diffusion rate (kdiff) for free receptors and the turnoverrate for trapped receptors (kreac).

4029E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

coated substratum. These data led us to propose these foci as theelementary detectable units/protein scaffolds which would bealigned by the actin cables to form cadherin adhesions.

N-cadherin turnover in cadherin adhesions

To characterize the dynamics of mature cadherin adhesions,we used fluorescence recovery after photobleaching (FRAP,Fig. 4A). For control cells spread on laminin, fluorescence cameback to its pre-bleach value within a fewminutes, as expectedfor cadherin molecules not engaged in homophilic interac-tions [21,25]. The data were well fitted by a model assumingfree diffusion, giving the instantaneous diffusion coefficient ofN-cadherin receptors (0.28±0.05 μm2/s, n=6, Fig. 4B). Thisvaluewas slightly higher than the diffusion coefficient that weand others measured previously using Ncad-Fc-coated beadsand single particle tracking (0.07 μm2/s) [21,28,29], probablyowing to a fraction of fast-diffusing intracellular receptors.

When similar FRAP experiments were performed on C2 cellsspread on Ncad-Fc, centering the beam on a cadherin adhesion(Fig. 4), a very different behavior of N-cadherin-GFP moleculeswas observed. The signal recovery followed a biphasic curve, inwhich a first regime exhibiting unrestricted diffusion wasfollowed by a second regime characteristic of a diffusion-uncoupled recovery [30]. The data were fit by a diffusion-reactionmodel [25] which uses three parameters:ϕ the fractionof free receptors (40%), kdiff the diffusion rate taken from freelymovingN-cadherin receptors on the laminin substrate, andkreacthe rate of N-cadherin ligand–receptor exchange which appliedto the fraction of receptors (1−ϕ=60 %) engaged in homophilicinteractions. Although the frapped area around the adhesionplaque may account for part of the free receptors, these dataindicate that N-cadherin molecules in cadherin adhesions aresubjected toa slowturnoverwitha characteristic ratekreac=3.9±0.8 h−1 (n=17), confirming recent observations for N-cadherinmolecules engaged in neuronal cell contacts [25].

Remarkably, the kinetics of fluorescence recovery for cellsspread on an anti-N-cadherin-coated substrate also showed abiphasic curve with 30% of the molecules freely diffusing and70% molecules exchanging very slowly, with a turnover ratekreac=0.6±0.2 h−1 (n=4) (Fig. 4). The formation of high affinitycomplexes between cellular N-cadherin and the coatedspecific antibody allows only a few molecular exchanges inthis time range. Interestingly, in this situation, cadherinadhesions did not form as reported previously [13], suggestingthat the exchange regime observed in cells spread on Ncad-Fcis necessary for cadherin adhesion formation.

Dependence of cadherin adhesion formation upon actincytoskeleton

Previous studies as well as our present observations indicate amajor role for actin in cadherin contact formation anddynamics (Fig. 3 [13,15]). To address the potential relationshipbetween cadherin adhesions and actin organization we usedvideomicroscopy to follow N-cadherin (N-cad-dDsRed) andactin (actin-GFP) during the spreading of C2 cells on the Ncad-Fc substrate (Fig. 5). Cadherin adhesions formed in lamellipo-dial extensions concomitantly to radial actin cable formationand thickening.

Fig. 5 – N-cadherin and actin dynamics during cadherin adhesions formation. C2 cells were cotransfected with dDsRed-tagged N-cadherin and GFP-tagged actin and plated on Ncad-Fc for 1 h. Time lapse sequences were acquired at a frequencyof 2 Hz. Times on the sequence refer to the beginning of the acquisition. Cadherin adhesions and actin filaments weredetected simultaneously. Scale bars: 10 μm.

4030 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

Toprogress inourunderstandingof the role of actin filamentsin cadherin adhesion dynamics we submitted cells spread onNcad-Fc to cytochalasin D treatments (Figs. 6A–B). Few minutesafter cytochalasin D addition, cadherin adhesions disappeared,stressing out the requirement of actin filaments for cadherinadhesionsstability.Disappearanceof cadherinadhesions led toagradual homogenization of the N-cadherin signal. Altogetherthese data strongly suggest an important role of actin filamentsin the formation and stability of cadherin adhesions.

To further investigate the roleof theN-cadherinanchoring tothe actin cytoskeleton in cadherin adhesion organization, weexpressed N-cadherin molecules mutated in their cytoplasmicdomain in mouse L cells which do not express endogenouscadherins. L cells were plated on Ncad-Fc substrates and theformation of cadherin adhesions was followed. Although theexpressionofN-cadAAA-YFP,missing thep120bindingsite [31],allowed the formation of cadherin adhesions as efficiently thanwild type N-cadherin, we never observed such a formationwhen Ncad Δβcat or Ncad Δcyto mutants were expressed (datanot shown). Thesemutants were not either recruited in foci. Tosearch for functional cis-interactions between wild type andmutant molecules potentially involved in their co-recruitmentinto cadherin adhesions, the full length form of N-cadherintagged to dDsRed (Ncad-dDsRed) was expressed together withGFP-tagged mutants (Fig. 7A). Ncad-dDsRed failed to recruitΔβcat and Δcyto mutants in cadherin adhesions. In contrast,Ncad-dDsRed recruitment in cadherin adhesionswas altered ina fraction of the cells co-expressing Ncad-dDsRed and the Δcytomutant. The cells distributed into two series on the basis on theformation, or not, of cadherin adhesions by full length mole-cules. Statistical analysis revealed that cadherin adhesion for-

ming cells exhibited a low expression level of Δcytomutant (ratioGFP signal/dDsRed signal=6±1 (n=21 cells)), while cells that didnot form cadherin adhesions displayed a much higher level ofGFP-tagged Δcyto mutant expression (GFP/dDsRed=22.4±2.8;n=13 cells; bilateral Mann–Whitney–Wilcoxon rank test, Z=4.44;pb0.0001). These observations suggest that the Δcyto mutantcan behave as a dominant negative mutant for full lengthmolecules, as reported for similar truncation of E-cadherin inother cellular models [32]. Conversely, expression of the N-cadAAA-YFP mutant together with full length Ncad-GFP led tocolocalization of both molecules into cadherin adhesionswithout any apparent competition effect. Thus, the p120binding domain of N-cadherin is dispensable for the forma-tion of cadherin adhesions. In contrast, the recruitment ofN-cadherin in cadherin adhesions requires the presence ofthe β-catenin binding domain.

Dependence of cadherin adhesion formation upon myosin II

Shewan and collaborators [23] recently showed that myosin IIwas required for the concentration of E-cadherin at cell–cellcontacts in MCF-7 and CHO cells. These results are in apparentcontradiction with previous reports using BDM [13,28], raisingquestions about the specificity of the latter towardmyosins [33].To address the implication of myosin II in the formation andstability of cadherin adhesions we used blebbistatin. Blebbista-tin, which inhibits myosin II ATPase activity, prevented theformation of cadherin adhesions in C2 cells when added beforeplating. In place of cadherin adhesions, β-catenin stainingappeared concentrated in foci without any sign of alignment(data not shown).

Fig. 6 – Effect of cytochalasin D treatment on cadherin adhesions. C2 cells were transfected with dDsRed-tagged N-cadherin (A) orcotransfectedwithdDsRed-taggedN-cadherin andGFP-tagged actin (B) andplated onNcad-Fc. Time lapse sequenceswere acquiredat a frequencyof2Hzat one (A) or both (B)wavelengths corresponding toeach fluorescentmarker. Timeson thesequence refer to thebeginning of the acquisition. “CD” and “wash-out” refer to addition or removal of the drug (10μM). Cytochalasin D addition leads tocomplete cadherin adhesiondisruption after a fewminutes (12 cells observed). A recovery of cadherin adhesionswas observed afterwash-outof thedrug innewlyspreadareas (A).Asa control the samevolumeofDMSOcontainingvehiclewasadded (not shownandsee Fig. 8B). In the latter case, cells conserved cadherin adhesions even after 30 min of treatment. Scale bars: 10 μm.

4031E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

To further dissect the effect of myosin II inhibition during alarge period of time we combined two approaches. First, wefollowed the disruption of preformed cadherin adhesions byvideomicroscopy for a short period of treatment (Fig. 8A). Thedestruction of cadherin adhesions occurred concomitantly withlamellipodium retraction. Second, in order to overcome theproblem of sensitivity of cells and blebbistatin itself to illumina-tion, C2 cells were treated for various periods of time (15 to120 min) with blebbistatin or vehicle alone then fixed andanalyzed for cadherin adhesions by immunofluorescent staining(Fig. 8B). These conditions allowed also for a much better visua-lization of both cadherin adhesions and actin filaments. Disrup-tionof cadherinadhesions in individual fociwasobservedshortlyafter blebbistatin treatment, with some residual organizationin cadherin adhesions at 15–30 min and total redistributionof cadherin/catenins complexes in individual foci by 45 min(Fig. 8B). Concomitantly, blebbistatin induced a profound remo-deling of actin filamentswith the disappearance of straight actincables and shrinkage of the cell border as previously noticed forcells spread on fibronectin [34].

For longer applications of blebbistatin, cells remainedadhesive, became flatter and highly branched and presentedonly scattered foci and poor actin filament organization,indicating that despite the loss of organized cadherin ad-hesions, adhesive function of cadherins was conserved.Hence, myosin II activity is required for the alignment offoci on actin cables giving rise to the maturity of cadherinadhesions but not the formation and maintenance of focithemselves.

Nucleation and directional growth of cadherin adhesions

To follow the dynamics of cadherin adhesions, the spreadingof C2 cells on cadherin-coated surfaces was analyzed by widefield videomicroscopy. Tagged full length N-cadherins (eitherNcad-GFP or Ncad-dDsRed) were transfected 1 day beforeplating cells on the Ncad-Fc substrate. Epifluorescence timelapse sequences were acquired during cell spreading or onspread cells showing a dynamic activity of the lamellipodium,characterizedby rounds of protrusion-retractionandmembrane

Fig. 7 – Role of intracellular domains andmyosin II activity inthe formation of foci and cadherin adhesions. (A) L cells werecotransfected with GFP-tagged wild type N-cadherin (FL),GFP-tagged N-cadherin Δβ-cat (Δβ), Δcyto (ΔC) orN-cad-AAA-YFP (AAA) mutants together with wild typeN-cadherin dDsRed (FL dsRed). Thirty-six hours aftertransfection cells were plated on Ncad-Fc coverslips for 2 h.Although full length and AAA N-cadherins co-organized incadherin adhesions, Δcyto and Δβ-cat mutants were notrecruited into cadherin adhesions. Moreover, whenoverexpressed, Δcyto (inserts) behave as a dominantnegative mutant preventing the recruitment of the wild typemoiety in cadherin adhesions. This property was notobserved with Δβcat mutant likely due to the reducedmembrane accumulation of this mutant. Scale bars: 10 μm.(B) C2 cells plated for 2 h on Ncad-Fc substrates were doublestained for β-catenin and cortactin. Cortactin localized at thecell border, in the lamellipodium, but did not colocalize withβ-catenin in cadherin adhesions. Scale bar: 25 μm. Insert:areas zoomed 3 times.

4032 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

ruffling. The appearance and behavior of cadherin adhesionswere heterogeneous but at least three characteristic propertiesof cadherin adhesions could be defined (Figs. 9–11): (1) their

nucleation and growth was oriented, (2) they were subject torearward sliding and (3) they disassembled at the rear of thelamella.

The formation of cadherin adhesions was initiated by theappearance of primary foci, defined as hot spots of fluorescenceemerging from a previously homogeneous distribution of cad-herin molecules (Fig. 9A). These foci appeared stochasticallyalthough at a rather constant distance from the cell margin (2.5±0.25 μm, n=8). Cadherin adhesions further grew by the appear-ance of secondary foci (Fig. 9B). These secondary foci formeddistally to primary foci or pre-existing cadherin adhesions as thecell margin progresses forward. As the former, these foci formedde novo by local increase in fluorescence signal at a constantdistance from the cell margin. To identify this position, we per-formed immunostaing on fixed preparations for cortactin whichis known to preferentially bind dynamic actin filaments andregulate the Arp2/3 complex in the lamellipodia [35]. Cortactinstaining localized distally from cadherin adhesions (Fig. 7B),suggesting that foci appear at the boundary between thelamellipodium and the lamella as defined in [24].

Very often, soon after their formation, secondary foci mergedto pre-existing ones or apparently stable cadherin adhesionsbackwards in the lamella. In some cases, this merging wasachievedbyamere increase in fluorescence intensityof thevalleybetween foci (Fig. 9B). Interestingly, the fluorescence intensity inprimary and secondary foci increased with time following a firstorder kinetics, with a characteristic half time τ of about 1 min(Fig. 9C).Moreover,whensignal intensities intonewly formed fociwere compared to each other and to signal intensity in moremature structures, it was obvious that they reached comparabledensities. Thus, these observations suggest that cadherin adhe-sions are initiated at the lamellipodia–lamella boundary by denovo accumulation of cadherin receptors in foci. As the cell edgeprogress, cadherin adhesions elongate by further incorporationfrom the cell margin to the interior of neoformed foci.

Cadherin adhesions are often subject to rearward sliding andeventually collapse

Looking at more examples of cadherin adhesion growth toaddress how N-cadherin molecules were recruited, we identi-fied a different scenario. This involved an apparent slidingof secondary foci toward pre-existing cadherin adhesions(Fig. 10A) or more distal foci backwards in the lamella(Fig. 10B). In Fig. 10B, the newly formed focus apparently slidovermore than 10 μmto fuse to a preformedone contributing toits growth. The evaluated apparent sliding speed was around2 μm/min, in the range measured previously for the actintreadmillingdriven rearward transport ofNcad-Fc-coatedbeadsat the surface of the lamella of C2 cells (2.8 μm/min [21]),indicating that cadherin adhesions are subject to an apparentrearward movement also likely dependent on actin cytoskele-ton treadmilling. In addition, foci appeared constrained to alignalong a radial axis reminiscent of the orientation of the actincytoskeleton, strengthening theconcept that cadherinadhesiongrowth is under the direct dependence of actomyosin.

As observed previously, in most of the cells, cadherinadhesions were restricted to the lamella [13]. However, weobserved a few cells initially presenting cadherin adhesionsdistributed under the whole cell with no predominant radial

Fig. 8 – Effect of blebbistatin on cadherin adhesions. (A) C2 cells were cotransfected with dDsRed-tagged N-cadherin and platedon Ncad-Fc and time lapse sequences were acquired at a frequency of 2 Hz. Times on the sequence refer to the beginning of theacquisition. “Blebbist.” refers to addition of the drug (20 μM). (B) C2 cells were plated on Ncad-Fc for 2 h to allow cadherinadhesion formation then treated for indicated times with 20 μM blebbistatin. After fixation, β-catenin immunostaining wasperformed together with F-actin labeling. Blebbistatin addition led with some delay to disruption of cadherin adhesions andperturbation of actin filaments. Inset: 120 min DMSO treatment. Scale bars: 10 μm.

4033E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

orientation. These cells evolved with the disappearance ofnon-radially oriented cadherin adhesions and concomitantappearance of radially oriented cadherin adhesions in thelamella (Fig. 11A) suggesting that foci appearance anddisappearance depend on the cell area properties. In most ofthe cells, the collapse of cadherin adhesions was observed atthe rear of the lamella. For example in Fig. 11B, one couldfollow foci primarily sliding from the distal end of a cadherinadhesions towards the rear of the lamella then subject tosudden collapse. Another example of collapse is illustrated inFig. 11C. The focus slightly moved to the rear while wideningthen totally disappeared over a few minutes.

Discussion

The coordinated recruitment of adhesion receptors and actinfilaments in adhesion plaques is a common property of cell–celland cell–extracellularmatrix contacts. However, the dynamics ofcadherin adhesion receptors at cell–cell contacts is far to beelucidated. In the present work, the study of the precise topo-graphy and dynamics of adhesion plaques formed between thecell membrane and a biomimetic cadherin-coated surface, also

named cadherin adhesions [13,23], allowed us to elucidateoriginal aspects of actomyosin dependent recruitment of cad-herin receptors, enabling to propose a model for the formationand extension of actual cell–cell contacts (Fig. 12).

Careful analysis of cadherin adhesion topography byTIRFM and RICM revealed an original organization of theseadhesion plaques. Indeed, although TIRFM revealed typicalradial actin filaments in the vicinity of the cell membrane, p120or β-catenin appeared as dotted lines composed of aligned foci.The analysis of the ventral cell topography by RICM indicatedthat cadherin adhesions correspond to areas of very closeproximity of theplasmamembranewith theglass coated surface(typically less than 30 nm [36]), in agreement with the observeddistance between the plasma membranes of adjacent cells atadherens junctions (15–30 nm). The dark RICM signal (closemembraneapposition) appearedas radially oriented streaks thatweremore extended and continuous than the areas of cadherin/catenins complexes accumulation. These observations suggestthat strong cadherin-mediated adhesion is restricted to radialstreaks within the lamella. However, in contrast to focaladhesions forming elongated plaques [37], cadherin adhesionsare formedof a successionof foci alignedalongactin filamentsasa string of pearls. Their lateral periodicity (1±0.1 μm) was very

4034 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

homogeneous and comparable to the lateral periodicity of per-pendicular streaks, or fingers, of cadherin observed at contactsbetween VE-cadherin expressing cells [28], suggesting that therecruitment of cadherin into foci is under physical constraintsuch as receptor diffusion and homophilic ligand association/dissociation rates.

Interestingly, the formation of E-cadherin foci was alsoobserved transiently during the biogenesis of actual cell–cellcontacts [8,11]. These foci likely result from the recruitment ofcadherins in the plane of the membrane at the interface ofoverlapping lamellipodial extensions [10]. Alternatively, focicould result from the accumulation of cadherin at the tip of

filopodia sent by neighboring cells and sliding along each other(as described in keratinocytes by [8]) or from a combined process(Brevier et al. submitted). Whatever the geometry of the contact,membrane sliding is a general process of primary importance forcell contact biogenesis,mediating further recruitment of cadher-ins and extension of the contact area (reviewed in [15,38]). C2cells are likely to extend both filopodia and lamellipodia whenforming cell–cell contacts (this work and Lambert et al. [26]).However, we used here a simplified experimental situationrendering more accessible the identification of key steps in theformation of actual cell–cell contacts.

Live cell imaging offered us the opportunity to identifynucleation of foci by isotropic recruitment of cadherinreceptor, directional growth by further incorporation of fociand shrinkage by foci collapse as key steps of cadherinadhesion formation and dynamics (Fig. 12). We further showthat these processes are governed extracellularly by theconstant exchange of adhesive bonds and intracellularly bythe coupling of cadherin cytoplasmic tail to actomyosin.

Nucleation

We show here that cadherin adhesions nucleate and grow inlamellipodial extensions through the recruitmentofN-cadherinmolecules in foci (Fig. 12A). It is of importance to notice that thisset-up allowed to image and characterize for the first time thedynamics of this initial step in cadherin contact formation. Focinucleate at a few micrometers from the cell edge out of ahomogeneous distribution of unengaged diffusive molecules.We confirmed here by FRAP that unengaged N-cadherins arefreely diffusive in the plane of the membrane. The homophilicengagement of a few receptors may initiate the recruitment offurther N-cadherin molecules up to a saturation level likelyreflecting equilibrium between receptor–ligand association/dissociation and diffusion of free receptors. Indeed, both ahighly and slowlymobile fraction of N-cadherinwere identifiedin cadherin adhesions at equilibrium, by FRAP analysis. Whilethe highly mobile fraction was attributed to molecules

Fig. 9 –Nucleation and directional growth of cadherinadhesion. (A) Formation of primary foci: time lapsesequences were acquired on Ncad-GFP expressing C2 cellsplated on Ncad-Fc. On the graph are reported line scans offluorescence intensity (gray level) as a function of thedistance along the line shown on the inset. Times on thesequence and graph refer to the beginning of the acquisition.The left side of the graph is oriented toward the cell marginwhile the right side is oriented toward the cell's center. Notede novo apparition of the primary focus during membraneextension (Focus 1 on the graph and arrow on the time lapsesequence). Scale bar: 10 μm. (B) Formation of a secondaryfocus (Focus 2, open arrowhead) and its fusion with apreviously formed primary focus (Focus 1, filled arrow). Scalebar: 10 μm. (C) Accumulation of N-cadherin-GFP during fociformation. The ratio of fluorescence accumulation in newfoci versus fluorescence in mature foci was plotted as afunction of elapsed time (mean values±SEM, n=14). Thecurve was fitted (dashed line) using the function: ratio new/old=1−exp−t/τ, where t is time and τ a characteristic time.

Fig. 10 – Cadherin adhesions are often subjected to rearwardsliding. Two examples of time lapse videomicroscopyperformed on Ncad-GFP expressing C2 cells plated onNcad-Fc were analyzed as described in the legend of Fig. 9.Secondary foci (Focus 2, open arrowheads) displaying anapparent sliding towardspreformed cadherin adhesions (filledarrows in A) or a primary focus (Focus 1, filled arrows in B)located backwards in the lamella, respectively. Scale bars:10 μm.

4035E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

unengaged in homophilic interactions, the slow fraction wasattributed to receptors limited in their diffusion by the rate ofassociation/dissociation of homophilic cadherin bondswhich isin the order of 4 h−1, in agreement with previous results [25].This constant exchange of cadherin bonds is an intrinsic part ofthis process of cadherin recruitment in foci and thereafter ofcadherinadhesion formation. Indeed,whencadherinmoleculeswere engaged in stable interactions with surfaces coated with aspecific antibody no cadherin adhesions were observed [13].Thus, foci formation may be explained by a simple diffusion/trapping model.

However, this recruitment or stabilization of cadherins infoci was strongly dependent on the underneath actin organi-zation. The interaction of N-cadherin cytoplasmic tail with

actin is required for this early step of cadherin adhesionnucleation since mutants unable to assume this function(Ncad Δβ-cat and Ncad Δ-cyto) were not recruited in foci.Conversely, treatment of cells with cytochalasin D confirmedthe tight dependence of foci formation or stability upon actinpolymerization. Interestingly, nucleation of foci appeared at arather constant distance of the leading edge, which maycorrespond to the lamellipodium/lamella interface whereactin network undergoes a fundamental transition in struc-ture and dynamics [24]. The highly dynamic actin treadmillingof the lamellipodium may convey adhesion complexes in foci(Fig. 12A). Interestingly, blebbistatin which prevents cadherinadhesion formation did not prevent accumulation of cadherinin foci, indicating that this nucleation step is independent ofmyosin II activity. In contrast to cadherin adhesions, thestability of these foci did not depend on the activity of myosinII as well as on the presence of well organized stress fibers.p120 binding, previously proposed to play a role in cadherinclustering [39], appeared dispensable for the recruitment of N-cadherin in foci and cadherin adhesions. Thus, these foci maybe stabilized by a specific state of actin at the lamellipodium/lamella transition, independent of stress fibers. The molecu-lar basis of these observations is unknown at the moment butα-catenin, which has been proposed recently to play a role inactin transition from branched at nascent contacts to bundledin older cadherin contacts, may be implicated [40].

Directional growth

The second major finding of the present work is that cadherinadhesions expend by asymmetric growth in the oppositedirection of focal adhesions [37,41]. Indeed, the addition of newadhesion complexes was asymmetric and occurred at the distalextremity of pre-existing cadherin adhesions leading to anapparent directional growth. Cadherin adhesion growth mayhave resulted from a gradual incorporation of individual N-cadherin molecules to preformed cadherin adhesions as ob-served for focal adhesions [37]. However, proximo-distal cad-herin adhesion growth occurs mainly by the mobilization ofneoformed foci that appear distally as the lamellipodiumprogresses, suggesting an overall mechanism very different tothe one underlying focal adhesion growth. The incorporation offoci in cadherin adhesions followed two different scenarios.Either the gap between two successive foci was filled thanks tofurther incorporation of cadherin/catenins complexes (arrows inFigs. 12B–C) or the more distal focus underwent a rearwardsliding to fuse with more proximal ones.

The actin cytoskeleton was evidently required since thisdirectional growth was oriented on actin filaments. In addi-tion, foci alignment and incorporation in cadherin adhesionsrequire myosin II activity, suggesting that contractile actinbundles may literally drag cadherin molecules along theirlength as suggested for integrins during focal adhesiongrowth [41]. Theoretical models were recently proposedwhere actin fiber forces influence the behavior of focaladhesions in terms of growth or shrinking [41]. Interestingly,cadherin contacts can transduce forces that are of the sameorder of magnitude than those measured for focal adhe-sions demonstrating that cadherins, as integrins, behave asmechanotransducers [42].

4036 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

During growth by gap filling, the ventral cell membranemay be maintained under tension in close vicinity of the glasssubstratum by radial actomyosin bundles, as suggested byRICM observations, allowing the recruitment of previouslyunengaged, freely diffusive, cadherin receptors in betweenfoci [43]. This unidirectional sliding of N-cadherin complexestowards the rear of the lamella, at a speed similar to the onemeasured for the actin treadmilling, also reveals an essential

role of actin bundles. Thus, actomyosin controls the formationof cadherin adhesions by exerting a constraint leading to focialignment and rearrangement. Since at least some of theseprocesses involve an apparent movement of foci relative tothe substratum, they also require the constant exchange ofhomophilic bonds as discussed above.

Shrinkage

At the rear of the lamella, N-cadherin foci often disappearedthrough a uniform breakdown, suggesting that N-cadherinmolecules were either simply rendered free to diffuse over theplasmamembrane,degradedor recycled leading to theresorptionandremodelingof cadherinadhesions (Fig. 12D).Thisobservationis consistent with the fact that cadherin adhesions are restrictedto the lamellawheremyosin IIA is localized [34]. At the rear of thelamella, these adhesion plaques may loose their association tocontractile actin bundles,whichmay induce their destabilization.Accordingly, actin filaments were only occasionally detected byTIRF in thecenterof thecells.A similarmechanismcouldaccountfor the observed instability of non-radially oriented cadherinaccumulations. The local disassembly at the rear of the lamellalikely contributes to the restricted distribution of cadherinadhesions. Thus, cadherin adhesions appear as dynamic struc-turessubject to remodelinganddisassembly.At cell–cell contacts,this remodeling along actin bundles of neighboring cells maycontribute to the coordinated reorganization of adhesion com-plexesandactincytoskeleton to formmatureadherens junctions.

In conclusion, the amazing accessibility of cadherin adhe-sions allowed us to unravel a totally unexpected growth ofcadherin contacts by nucleation and actomyosin dependentdirectional growth of adhesion plaques. Altogether, these resultsshow that cadherin adhesions present topographic and dynamicproperties similar, albeit distinct, from integrin-associated focaladhesions. In addition, they are enough resemblance betweencadherin adhesions and adherens junctions to believe thatsimilar processes are involved in the formation of theseintercellular junctions at actual cell–cell contacts.

Fig. 11 – Collapse of cadherin adhesions at the rear of thelamella. (A) A Ncad-dDsRed expressing C2 cell spread onNcad-Fc collapsed tangentially oriented cadherin adhesions(open arrowhead) and build new ones in neo-formedmembranes extensions (filled arrow). An opposite evolutionof cadherin adhesions could be observed in closely adjacentareas (graph). Four areas were defined as drawn on the inset.Integrated gray levels measured in areas 2 and 4 weresubtracted to those of areas 1 and 3 (collapsing andneo-formed cadherin adhesions, respectively) and plotted asintegrated gray level versus time. The fluorescent spot incircle 1 collapses while a new spot is appearing at a fewmicrometer distance (circle 3). (B, C) Cadherin adhesioncollapse in Ncad-GFP expressing cells spread on Ncad-Fc.(B) A focus (open arrowheads) displayed an apparent shifttowards the rear of the lamella duringmore than 2min,whileit increased in width maintaining to a roughly constantcumulated gray level, and then suddenly collapsed(time 4 min 40 s). (C) Resorption following a slow rate offluorescence decrease (12 min). Scale bars A: 10 μm; B, C:10 μm.

4037E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

Materials and methods

Plasmid construction

To construct the plasmid expressing full length chicken N-cadherin fused to DsRed, a 1400 bp BamHI–HindIII DNA fragment

Fig. 12 – Nucleation, directional growth and shrinkage ofcadherin adhesions. Panel A illustrates the nucleation ofprimary foci by isotropic recruitment of cadherin complexesat the lamellipodia/lamella boundary, as well as thealignment of a preformed cadherin adhesion on a radialactomyosin cable. Panels B–C illustrate the directionalgrowth of cadherin adhesions, initiated by the nucleation ofsecondary foci following lamellipodium extension (B), thenfollowed by foci sliding or gap filling along contractile actinbundles (C). Panel D illustrates the disappearance of foci atthe rear of the lamella.

encoding a tandemrepeat ofDsRed sequence [44]was subclonedinto pCDNA 3.1 hygro (Invitrogen) to generate pCD dimDsRed. AXbaI–SacI 2500 bp fragment encompassing the 5′ end of thechicken N-cadherin cDNA [45] was amplified by PCR using thefollowing oligonucleotides: 5′ GGAATTAAGAGAGCTCAAGGATC3′and5′CTAGTCTAGATCCATGTGCCGGATAGCGGG3′. AsecondPCR was performed to prepare a SacI–BamHI 100 bp fragmentcorresponding to the 3′ end of the N-cadherin cDNA using theoligonucleotides: 5′ TCCTTGAGCTCTCTTAATTCC 3′ and 5′CGCGGATCCCCGTCATCACCTCCACCGTAC 3′. Each PCR frag-ment was digested to reveal their cohesive ends and clonedinto the XbaI and BamHI sites of pCD dimDsRed. To select theresulting plasmids JM110 E. coli bacteria (dam− dcm−) were usedto avoidmethylation at theXbaI endonuclease site. pNcadΔβcat-GFP and pNcad Δcyto-GFP plasmids were described elsewhere[25]. The actin-GFP plasmidwas a gift of D. Choquet. pNcadAAA-YFP plasmid was a gift from K.J. Green [31].

C2 cell culture, treatments, transfection and immunostainings

Mouse C2 cells were cultured at 37 °C in 5% CO2 in DMEMmedium containing 10% fetal calf serum. For electroporation,5·106 cells were rapidly trypsinized and resuspended in 400 μlDMEM, 10% FCS, 50 mM HEPES pH 7.4. Cells were submitted to260 V, 1500 μF for 35–45 ms in the presence of 15–50 μg plasmid(Easyject, Equibio, Ashford, UK) and seeded in DMEM, 10% FCSand incubated for 1–2 days at 37 °C under 5% CO2. Blebbistatin(Calbiochem)was added at 20 μMeither at the time of plating orafter cells was allowed to form cadherin adhesions for 2 h, andcells were incubated for various periods of time. Alternatively,cells were treated with the vehicle (0.36% DMSO). Cortactin andβ-catenin immunostainings were performed as previouslydescribed [26]. Mouse anti-cortactin (Upstate biotechnology)and rabbit anti-β-catenin antibodieswere incubated for 1 h at 1/200 and 1/500 dilution, respectively. Specific IgGs were revealedwith either TRITC-conjugated antibodies or Alexa 488-conju-gated antibodies. Actin filamentswere revealedwith Alexa 488-conjugated phalloidin (Molecular Probes, Invitrogen).

Immunoprecipitation

Cells cotransfected with the puromycin resistance plasmidpPUR (Clontech Laboratories) were enriched by a puromycintreatment (10 μg/ml) for 24 h then lysed in 50 mM Tris bufferpH 8, 50 mM NaCl, 300 mM sucrose, 1% Triton X-100, plusprotease inhibitors (Complete; Roche Diagnostics) for 20 min at4 °C. Cell lysateswere clearedby centrifugationat 355,000×g, 4 °Cfor 6min. Cleared lysateswere then incubated firstwith proteinA Sepharose beads (Amersham Pharmacia Biotech) loadedwithrabbit nonimmuneserumfor 1hat4 °C. Supernatantswere thenincubated for 4 h at 4 °C with protein A Sepharose beads loadedwith a polyclonal anti-β-catenin antibody. Beads were washedfour times with lysis buffer containing 0.1% Triton X-100without protease inhibitors. Immunoprecipitates were sepa-rated on 7.5% polyacrylamide–SDS gels in reducing conditions,transferred to 0.45 μmnitrocellulosemembranes and immuno-blottedaspreviouslydescribed [26]with eithermonoclonal anti-N-cadherin (1/2000, Transduction Laboratories) or anti-αE-catenin antibodies (1/2000, Santa Cruz). Membranes wereprobed with HRP-conjugated anti-mouse immunoglobulin

4038 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

antibodies (1/5000, Dako) and developed using the ECL method(Amersham, UK).

Cadherin adhesion formation in L cells

Mouse L cellswere cultured at 37 °C in 5%CO2 inDMEMmediumcontaining 10% fetal calf serum. They were transiently cotrans-fectedwith theN-cad-AAA-YFPmutant, GFP-taggedN-cadherinΔβ-cat, Δcyto mutants or wild type molecule together with wildtype N-cadherin dimeric dsRed (Fig. 1A). Thirty-six hours aftertransfection cells were plated on Ncad-Fc-coated coverslips for2 h in the absence of serum according to Gavard et al. [13], fixedand mounted in Mowiol. Acquisitions were made using aDMIRE2microscope (Leica) equippedwith conventional fluores-cence systems via a ×63 oil objective (N.A. 0.6–1.32). Each imagewas the result of four averaged acquisitions (1 s, intensifier 0 and2660 for dsRed and GFP, respectively) with a Cascade camera(Photometrics) driven with a Metamorph software (UniversalImaging Corporation). To quantify GFP and dsRed expressionlevels four regions inthe lamellipodiaof eachcellwere randomlychosen and measured for their gray level value. Once averaged,the GFP versus dsRed ratio was calculated for each cell. Cellswere scored for the presence or the absence of cadherinadhesions, separating them into two series. The mean ratioand SEM were calculated for each series and a rank test (Mann–Whithney–Wilcoxon) was applied for statistical calculations.

Reflection interference contrast microscopy (RICM) and totalinternal reflection fluorescence microscopy (TIRFM)

C2 cells were spread for 2 h on Ncad-Fc-coated coverslips inthe absence of serum, fixed and processed for staining withphalloidin Alexa Fluo 488 (Molecular Probes) and polyclonalanti-p120 antibodies (a gift fromAl Reynolds) according to [26].Reflection interference contrast microscopy (RICM) imageswere obtained with the Hg lamp by using a 550-nm centeredinterference excitation filter [43]. Interference between lightfrom a membrane and light reflected by a planar substrateproved spatial sensitivity in the few to hundreds of nanometerrange with few-nanometer resolution [36]. For TIRFM (totalinternal reflection fluorescence microscopy) acquisitions,preparations were observed on a home-made set-up [43].Briefly, the optical fiber coupled laser (395 mW, 177-G02,Spectra-Physics) was focused through the lens of the epifluor-escence condenser of the microscope on the back focal planeof an Olympus ×60 Plan Apo TIRFM objective (N.A.=1.45).

Videomicroscopy acquisition and treatment

After detachment by EDTA treatment, cells were seeded onNcad-Fc-coated coverslips in DMEM without phenol red,riboflavin and serum but completed with 50 mM HEPES pH7.2 andmounted for videomicroscopy. Time lapse acquisitionswere made using a DMIRE 2 microscope (Leica) equipped withdifferential interference contrast optics (DIC) and conven-tional epifluorescence via a ×63 oil objective (N.A. 0.6–1.32).The microscope was placed in a temperature controlledchamber. Time lapse sequences were acquired using a 10–30 s delay between frames with a Cascade camera (Photo-metrics) drivenby theMetamorph software (Universal Imaging

Corporation). When necessary, to optimize contrast quality oflow fluorescent signals, four 200 ms acquisitions (gain 2,intensifier 3200) were averaged. Signal/noise ratio wasoptimized using a median filter (kernel size of 3×3) andbleaching due to repeated acquisition was corrected (functionequalize, Metamorph software). To measure gray level forFigs. 2, 6, 7 and 8, the function line scan was used and valueswere transferred to Excel.

Fluorescence recovery after photobleaching (FRAP)

N-cadherin-GFPexpressingC2 cells platedonNcad-Fc, lamininor GC4 (monoclonal anti-chicken N-cadherin antibody; Sigma)coated coverslips in the absenceof serum [13]weremounted inan aluminum chamber for observation, using phenol red freeDMEM. The FRAP set-up consists of an inverted microscope(Olympus IX 70) fed through its epifluorescence port by anArgon laser beam (Innova 300, Coherent) expanded by a 10×telescope to fill the back aperture of a 100×/1.4 oil objective.Laser powerwas 2.5mWat the back of the objective.Wide fieldfluorescence illumination comes from a Xenon lamp deportedat 90° and reflected by a 70/30 beam splitter (Chroma). Both the488 nm laser line andwhite light are controlled by shutters andpass through a GFP illumination filter cube (480/20 nm;495DCLP; 525/50 nm, Chroma). A set of two lenses in a focalconfiguration, with one lens on a 3D translator, were used forfine xy centering of the beam and z adjustment to yield adiffraction-limited spot on the focal plane. Digital imageswereacquired using a cooled CCD camera (HQ Cool Snap, RoperScientific) driven by the Metamorph software (UniversalImaging). Temperature was maintained at 37 °C with an airblower (World Precision Instruments) and an objective heater(Bioptechs). Using a motorized stage (MarzHauser), a region ofinterest on a cell expressing Ncad-GFP was brought to theposition of the laser spot and the FRAP sequence was started:five reference images were acquired first, then the samplewasbleached by the laser for 0.3 s, and fluorescence recovery wasrecorded for 12 min. Images were acquired in full fieldillumination with exposure times of 50–200 ms. The wholesequence was driven by a journal written in the Metamorphsoftware. Three FRAP sequences were run per coverslip,bringing the experiment duration to about 45 min.

For analysis, three areas were taken into account: thebleached area (1); a non-bleached area (2); and a backgroundarea outside the cell (3). To take into account the bleaching effectdue to time lapseacquisition, thegray level ratio between the lastimage before laser bleaching and each image of the stack wascalculated on area 2. The gray levels of areas 1 and 3 of eachimage of the stack were corrected using this bleaching coeffi-cient. The background calculated on area 3 was then subtractedto the value of area 1. Fluorescence values obtained on area 1were then normalized between 0 and 1. Data were plotted asnormalized fluorescence intensity versus time and fitted by theformula ϕ [1−erf(1/2√kdiff t)]+(1−ϕ)[1−exp(−kreac t)], where ϕ isthe fraction of molecules diffusing freely, (1−ϕ) the fraction ofmolecules trapped in adhesive interactions, kdiff (in min−1) is acharacteristic diffusive rate and kreac (inmin−1) the turnover rateof bound N-cadherin molecules (for details, see [25]). kdiff equalsD/r2, where D is the diffusion coefficient and r the radius of thebleached zone measured on fixed cells (2 μm).

4039E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

Acknowledgments

This work was supported by institutional funding fromINSERM, as well as CNRS (DRAB 2003), Association pour laRecherche sur le Cancer (ARC) and Association Françaisecontre les Myopathies (AFM). We thank KJ Green (Northwest-ern University, Chicago, IL, USA) for providing the pNcadAAA-YFP construct. We thank R.E. Campbell and R.Y. Tsien for thegift of DsRed vectors and A. Matus for the actin GFP construct.Image acquisitions were done thanks to the cell imagingfacility of the Institut du Fer à Moulin. We thank André Sobelfor his continual support as head of the Department.

R E F E R E N C E S

[1] B.M. Gumbiner, Regulation of cadherin-mediated adhesion inmorphogenesis, Nat. Rev., Mol. Cell Biol. 6 (2005) 622–634.

[2] M. Takeichi, Cadherins: a molecular family importantin selective cell–cell adhesion, Ann. Rev. Biochem. 59 (1990)237–252.

[3] M. Takeichi, Morphogenic roles of classic cadherinsCurr. Opin. Cell Biol. 7 (1995) 619–627.

[4] A.S. Yap, W.M. Brieher, B.M. Gumbiner, Molecular andfunctional analysis of cadherin-based adherens junctions,Annu. Rev. Cell Dev. Biol. 13 (1997) 119–146.

[5] U. Tepass, K. Truong, D. Godt, M. Ikura, M. Peifer, Cadherins inembryonic and neural morphogenesis, Nat. Rev., Mol. CellBiol. 1 (2000) 91–100.

[6] M. Takeichi, K. Abe, Synaptic contact dynamics controlled bycadherin and catenins, Trends Cell Biol. 15 (2005) 216–221.

[7] P. Cowin, T.M. Rowlands, S.J. Hatsell, Cadherins and cateninsin breast cancer, Curr. Opin. Cell Biol. 17 (2005) 499–508.

[8] V. Vasioukhin, C. Bauer, M. Yin, E. Fuchs, Directed actinpolymerization is the driving force for epithelial cell–celladhesion, Cell 100 (2000) 209–219.

[9] A. Kobielak, H.A. Pasolli, E. Fuchs, Mammalian formin-1participates in adherens junctions and polymerization oflinear actin cables, Nat. Cell Biol. 6 (2004) 21–30.

[10] J.S. Ehrlich, M.D. Hansen, W.J. Nelson, Spatio-temporalregulation of Rac1 localization and lamellipodiadynamics during epithelial cell–cell adhesion, Dev. Cell3 (2002) 259–270.

[11] C.L. Adams, Y.T. Chen, S.J. Smith, W.J. Nelson, Mechanisms ofepithelial cell–cell adhesion and cell compaction revealed byhigh-resolution tracking of E-cadherin-green fluorescentprotein, J. Cell Biol. 142 (1998) 1105–1119.

[12] E.M. Kovacs, R.G. Ali, A.J. McCormack, A.S. Yap, E-cadherinhomophilic ligation directly signals through Rac andPhosphatidyl 3-kinase to regulate adhesive contacts, J. Biol.Chem. 277 (2002) 6708–6718.

[13] J. Gavard, M. Lambert, I. Grosheva, V. Marthiens,T. Irinopoulou, J.F. Riou, A. Bershadsky, R.M. Mege,Lamellipodium extension and cadherin adhesion: two cellresponses to cadherin activation relying on distinct signallingpathways, J. Cell Sci. 117 (2004) 257–270.

[14] Y. Kametani, M. Takeichi, Basal-to-apical cadherin flow at celljunctions, Nat. Cell Biol. 9 (2007) 92–98.

[15] R.M. Mege, J. Gavard, M. Lambert, Regulation of cell–celljunctions by the cytoskeleton, Curr. Opin. Cell Biol. 18 (2006)541–548.

[16] S. Verma, A.M. Shewan, J.A. Scott, F.M. Helwani, N.R. DenElzen, H. Miki, T. Takenawa, A.S. Yap, Arp2/3 activity isnecessary for efficient formation of E-cadherin adhesivecontacts, J. Biol. Chem. 279 (2004) 34062–34070.

[17] E.M. Kovacs, M. Goodwin, R.G. Ali, A.D. Paterson, A.S. Yap,Cadherin-directed actin assembly: E-cadherin physicallyassociates with the Arp2/3 complex to direct actinassembly in nascent adhesive contacts, Curr. Biol. 12 (2002)379–382.

[18] J.A. Scott, A.M. Shewan, N.R. Den Elzen, J.J. Loureiro, F.B.Gertler, A.S. Yap, Ena/VASP proteins can regulate distinctmodes of actin organization at cadherin-adhesive contacts,Mol. Biol. Cell 17 (2006) 1085–1095.

[19] F.M. Helwani, E.M. Kovacs, A.D. Paterson, S. Verma, R.G. Ali,A.S. Fanning, S.A. Weed, A.S. Yap, Cortactin is necessary forE-cadherin-mediated contact formation and actinreorganization, J. Cell Biol. 164 (2004) 899–910.

[20] T.Y. El Sayegh, P.D. Arora, C.A. Laschinger, W. Lee, C.Morrison, C.M. Overall, A. Kapus, C.A. McCulloch, Cortactinassociates with N-cadherin adhesions and mediatesintercellular adhesion strengthening in fibroblasts, J. Cell Sci.117 (2004) 5117–5131.

[21] M. Lambert, D. Choquet, R.M. Mege, Dynamics of ligandinduced, Rac1-dependent anchoring of cadherins to the actincytoskeleton, J. Cell Biol. 157 (2002) 469–479.

[22] V. Marthiens, J. Gavard, F. Padilla, C. Monnet, V. Castellani,M. Lambert, R.M. Mege, A novel function for cadherin-11in the regulation of motor axon elongation and fasciculation,Mol. Cell. Neurosci. 28 (2005) 715–726.

[23] A.M. Shewan, M. Maddugoda, A. Kraemer, S.J. Stehbens,S. Verma, E.M. Kovacs, A.S. Yap, Myosin 2 is a key Rho kinasetarget necessary for the local concentration of E-cadherin atcell–cell contacts, Mol. Biol. Cell 16 (2005) 4531–4542.

[24] A. Ponti, M. Machacek, S.L. Gupton, C.M. Waterman-Storer,G. Danuser, Two distinct actin networks drive the protrusionof migrating cells, Science 305 (2004) 1782–1786.

[25] O. Thoumine, M. Lambert, R.M. Mege, D. Choquet, Regulationof N-cadherin dynamics at neuronal contacts by ligandbinding and cytoskeletal coupling, Mol. Biol. Cell 17 (2006)862–875.

[26] M. Lambert, F. Padilla, R.M. Mege, Immobilized dimers ofN-cadherin-Fc chimera mimic cadherin-mediated cellcontact formation: contribution of both inside-out andoutside-in signals, J. Cell Sci. 113 (2000) 2207–2219.

[27] M. Causeret, N. Taulet, F. Comunale, C. Favard,C. Gauthier-Rouviere, N-cadherin association with lipid raftsregulates its dynamic assembly at cell–cell junctions inC2C12 myoblasts, Mol. Biol. Cell 16 (2005) 2168–2180.

[28] H. Delanoe-Ayari, P. Lenz, J. Brevier, M. Weidenhaupt, M.Vallade, D. Gulino, J.F. Joanny, D. Riveline, Periodic adhesivefingers between contacting cells, Phys. Rev. Lett. 93 (2004)108102.

[29] Y. Sako, A. Nagafuchi, S. Tsukita, M. Takeichi, A. Kusumi,Cytoplasmic regulation of themovement of E-cadherin on thefree cell surface was studied by optical tweezers and singleparticle tracking: corralling and tethering by the membraneskeleton, J. Cell Biol. 140 (1998) 1227–1240.

[30] B.L. Sprague, J.G. McNally, FRAP analysis of binding: properand fitting, Trends Cell Biol. 15 (2005) 84–91.

[31] X. Chen, S. Kojima, G.G. Borisy, K.J. Green, p120 cateninassociates with kinesin and facilitates the transport ofcadherin–catenin complexes to intercellular junctions, J. CellBiol. 163 (2003) 547–557.

[32] E. Levine, C.H. Lee, C. Kintner, B.M. Gumbiner, Selectivedisruption of E-cadherin function in early Xenopus embryosby a dominant negative mutant, Development 120 (1994)901–909.

[33] J.C. Yarrow, T. Lechler, R. Li, T.J. Mitchison, Rapidde-localization of actin leading edge components with BDMtreatment, BMC Cell Biol. 4 (2003) 5.

[34] Y. Cai, N. Biais, G. Giannone, M. Tanase, G. Jiang, J.M. Hofman,C.H. Wiggins, P. Silberzan, A. Buguin, B. Ladoux, M.P. Sheetz,Nonmuscle myosin IIA-dependent force inhibits cell

4040 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 4 0 2 5 – 4 0 4 0

spreading and drives F-actin flow, Biophys. J. 91 (2006)3907–3920.

[35] N.S. Bryce, E.S. Clark, J.L. Leysath, J.D. Currie, D.J. Webb,A.M. Weaver, Cortactin promotes cell motility by enhancinglamellipodial persistence, Curr. Biol. 15 (2005) 1276–1285.

[36] C.S. Izzard, L.R. Lochner, Cell-to-substrate contacts inliving fibroblasts: an interference reflexion study with anevaluation of the technique, J. Cell Sci. 21 (1976)129–159.

[37] D. Riveline, Nucleation and growth of focal contacts, RecentRes. Dev. Biophys. 3 (2004) 113–123.

[38] A.S. Yap, E.M. Kovacs, Direct cadherin-activated cellsignaling: a view from the plasma membrane, J. Cell Biol.160 (2003) 11–16.

[39] A.S. Yap, C.M. Niessen, B.M. Gumbiner, The juxtamembraneregion of the cadherin cytoplasmic tail supports lateralclustering, adhesive strengthening, and interaction withp120ctn, J. Cell Biol. 141 (1998) 779–789.

[40] F. Drees, S. Pokutta, S. Yamada, W.J. Nelson, W.I. Weis,Alpha-catenin is a molecular switch that binds

E-cadherin-beta-catenin and regulates actin-filamentassembly, Cell 123 (2005) 903–915.

[41] A. Bershadsky, M. Kozlov, B. Geiger, Adhesion-mediatedmechanosensitivity: a time to experiment, and a time totheorize, Curr. Opin. Cell Biol. 18 (2006) 472–481.

[42] A. Ganz, M. Lambert, A. Saez, P. Silberzan, A. Buguin,R.M. Mege, B. Ladoux, Traction forces exerted throughN-cadherin contacts, Biol. Cell 98 (2006) 721–730.

[43] H. Delanoe-Ayari, R. Al Kurdi, M. Vallade, D. Gulino-Debrac,D. Riveline, Membrane and acto-myosin tension promoteclustering of adhesion proteins, Proc. Natl. Acad. Sci.U. S. A. 101 (2004) 2229–2234.

[44] R.E. Campbell, O. Tour, A.E. Palmer, P.A. Steinbach, G.S. Baird,D.A. Zacharias, R.Y. Tsien, A monomeric red fluorescentprotein, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 7877–7882.

[45] F. Matsuzaki, R.M. Mege, S.H. Jaffe, D.R. Friedlander, W.J.Gallin, J.I. Goldberg, B.A. Cunningham, G.M. Edelman,cDNAs of cell adhesion molecules of different specificityinduce changes in cell shape and border formation intransfected S180 cells, J. Cell Biol. 110 (1990) 1239–1252.