Embed Size (px)
Citation preview
Gene 423 (2008) 160–171
Contents lists available at ScienceDirect
Gene
j ourna l homepage: www.e lsev ie r.com/ locate /gene
Nuclear localization of a novel human syntaxin 1B isoform
Sandrine Pereira a, Annick Massacrier a, Patrice Roll a,b, Alain Vérine c, Marie-Christine Etienne-Grimaldi d,Yannick Poitelon a, Andrée Robaglia-Schlupp a,b, Sarah Jamali a, Nathalie Roeckel-Trevisiol a, Barbara Royer a,Pierre Pontarotti e, Christian Lévêque f, Michael Seagar f, Nicolas Lévy a,g, Pierre Cau a,b,⁎, Pierre Szepetowski a,⁎a INSERM UMR 910, Université de la Méditerranée, Faculté de Médecine, 13385 Marseille Cedex 5, Franceb Laboratoire de Biologie Cellulaire, Hôpital de la Conception, Marseille, Francec INSERM UMR777, Université de la Méditerranée, 13385 Marseille Cedex 5, Franced Laboratoire d'Oncopharmacologie, Centre Antoine Lacassagne, 06189 Nice Cedex 2, Francee EA378. Université de Provence, 13331 Marseille Cedex 3, Francef INSERM UMR641, Université de la Méditerranée, 13916 Marseille Cedex 20, Franceg Département de Génétique Médicale, Hôpital de la Timone, Marseille, France
Abbreviations: BAC, Bacterial Artificial Chromosomtoxin C1; DAPI, 4′,6-diamidino-2-phenylindole; EGF, Enormal goat serum; NLS, Nuclear Localization Signal; Nuprotein; RACE, Rapid Amplification of cDNA Ends; SNAsensitive factor Attachment Protein; SNARE, SNAP Recdomain; VAMPs, vesicle-associated membrane proteins⁎ Corresponding authors. INSERMUMR 910, GEIA (Gén
Associées) Group, Faculté de Médecine de la Timone, 2Cedex 5, France. Tel.: +33 491 324 386; fax: +33 491 804
E-mail addresses: [email protected] (P. Cau), pi(P. Szepetowski).
0378-1119/$ – see front matter © 2008 Elsevier B.V. Alldoi:10.1016/j.gene.2008.07.010
a b s t r a c t
a r t i c l e i n f oArticle history:
The syntaxins are proteins Received 17 March 2008Received in revised form 20 June 2008Accepted 7 July 2008Available online 17 July 2008Received by Stefan Mueller
Keywords:SyntaxinAlternative splicingNucleusNuclear localization signalBrain tumor
associated with various intracellular membrane compartments. They are majorparticipants in a large variety of physiological processes where membrane fusion occurs, includingexocytosis. We have identified a novel syntaxin isoform generated by alternative splicing of the human STX1Bgene. In contrast with the canonical syntaxins, this isoform (STX1B-ΔTMD) lacked the classical C-terminaltransmembrane domain and localized to the nucleus of various tumoral and non-tumoral cell types includinghuman brain cortical neurons in vivo. The reversible blockade of STX1B-ΔTMD nuclear import demonstratedthat nuclear import occurred via a Ran-dependent pathway. A specific and glycine-rich C-terminus of 15amino acids served as an unconventional nuclear localization signal. STX1B-ΔTMD colocalized with Lamin A/C and NuMA (NUclear Mitotic Apparatus protein) in interphasic nuclei, and with NuMA and γ-tubulin in thepericentrosomal region of the mitotic spindle in dividing cells. In a series of 37 human primary brain tumors,the ratio of STX1B-ΔTMD to Lamin A/C transcripts was a significant prognostic marker of survival,independent of tumor staging. The characterization of STX1B-ΔTMD as the first nucleoplasmic syntaxin withno transmembrane domain, illustrates the importance of alternative splicing in the emergence ofunsuspected properties of the syntaxins in human cells, in both physiological and pathological conditions.
© 2008 Elsevier B.V. All rights reserved.
1. Introduction
Members of the SNARE (SNAP REceptors; SNAP: Soluble N-ethylmaleimide-sensitive factor Attachment Protein) protein familywere initially identified through their role in vesicle fusion-mediatedneurotransmitter release and are generally involved in most intracel-lular trafficking pathways (Ungar and Hughson, 2003). The SNAREproteins are composed of three families: VAMPs (vesicle-associatedmembrane proteins), SNAP-25 homologues, and syntaxins. The
e; BoNT/C1, botulinum neuro-pidermal Growth Factor; NGS,MA, NUclear Mitotic ApparatusP, Soluble N-ethylmaleimide-eptors; TMD, transmembrane
étique des Epilepsies Isolées et7 Bd J Moulin, 13385 Marseille319.
rights reserved.
syntaxin family is a large group of proteins which all have a coiled-coil helix domain thatmediates interactionwith other SNARE proteins.Syntaxins are usually associated with specific intracellular compart-ments by virtue of their carboxyl-terminal hydrophobic transmem-brane domain (TMD). Many different syntaxin proteins have beenidentified in a large number of organisms and are expressed in varioustissues andmembrane compartments (Teng et al., 2001; Besteiro et al.,2006; Kissmehl et al., 2007). For example, syntaxins 1A and 1B areplasmamembrane proteins implicated in synaptic vesicle docking andfusion during neurotransmitter release (Bennett et al., 1992).
In addition to their well-known role in exocytosis, the syntaxinshave been implicated in various physiological processes such asaxonal growth (Igarashi et al., 1996) and cell division (Conner andWessel, 1999; Jantsch-Plunger and Glotzer, 1999; Xu et al., 2002;Müller et al., 2003). In Drosophila melanogaster, syntaxin 1 isessential for proper cellularisation in embryos (Burgess et al.,1997). As members of the SNARE machinery, syntaxins may beinvolved in several pathological conditions (Mukaetova-Ladinska etal., 2002; Selkoe, 2002; Garcia et al., 2004; Zur Stadt et al., 2005).Moreover, the importance of the syntaxins as potential targets for
Table 1List of PCR primers
Primer name Primer sequence
2 F 5′-GAGATTGAGACGAGGCACAATGesroh 9–10 5′-ATTTTCTTCCTCCGGGCCTTI9-L 5′-GGAGGCCTTATCTCTGGCTCGAPDH-F 5′-CACAGTCCATGCCATCACTGGAPDH-R 5′-CAGGAAATGAGCTTGACAAA1 F 5′-GGATCTCACTGCAGACATCAA2R 5′-CAGACACAGCTCGCTCCACGTA5′1 5′-AGCAGAGGCAGGAGGACTAG5R 5′-TCCGCGGAGGAACGGTTCA10a 5′-AAGCCCAGCGTCCCCCCAAT10 F 5′-GGGGGTATTGCTCCCGATGT10R1 5′-GTATTGCTCCCGATGTGGTG10R2 5′-GTGCATCACACACATCACACG10R3 5′-CACAGATCTGTGGTCTCACG10R4 5′-GGCTCTATCTGAGAAGACCTATCAP1 5′-CCATCCTAATACGACTCACTATAGGGCStx-Race1 5′-TGAGATCCTCCAGCTCCTGTTTGGTCTAP2 5′-ACTCACTATAGGGCTCGAGCGGCStx-Race2 5′-GTGCGGCCAGGATGGCGCTATGCTGTT1/2-R 5′-CTGTTCAAAGAACTCATCCA9/10-F 5′-CGGAGGAAGAAAATCATGAT9/10-R 5′-TTGGGAGTGAGCCTGGAGCAIn9-F 5′-CGAGTACAACGTGGAACATTSTXfull-F 5′-AAAAAGAATTCGATGAAGGATCGGACTCAAGAGCTGCGGTMfull-R 5′-AAAAACCCGGGCAAGCCCAGCGTCCCCCCAAΔTMDfull-R 5′-AAAAACCCGGGGCCTTGGGCTCCCCCGCCTΔ1-F 5′-AAAAAGAATTCGATGAAGGATCGGACTCAAGAGCTGCGGAΔ1-R 5′-AAAAACCCGGGAGCCCCTCCTCCTGTTCAATΔ2-F 5′-AAAAAGAATTCGAACCGTTCCTCCGCGGACCΔ2-R 5′-AAAAACCCGGGCGGTCAATCATCTCTCCCTGΔ3-F 5′-AAAAAGAATTCCATCGAGTACAACGTGGAACΔ3-R 5′-AAAAACCCGGGGCCTTGGGCTCCCCCGCCT
161S. Pereira et al. / Gene 423 (2008) 160–171
drugs is being increasingly recognized (Van Swinderen et al., 1999;Okada et al., 2002). They also represent the natural and specifictarget for botulinum neurotoxins type C (Schiavo et al., 2000).
Additional diversity within the syntaxin family of proteins may besustained by alternative splicing. In fact, alternatively spliced isoformshave been described in different species (Ibaraki et al., 1995; Hui et al.,1997; Tang et al., 1998; Jantsch-Plunger and Glotzer, 1999; Quinoneset al., 1999). These splice isoforms are differentially expressed duringdevelopment and in different tissues in adult life, and may thus havesubstantially different roles. Splice modifications involving the regionrequired for SNARE complex assembly have been described (Ibarakiet al.,1995; Simonsen et al.,1998).Moreover, several syntaxin isoformslacking a TMD have been identified (Hui et al., 1997; Tang et al., 1998).Some like syntaxin 11 may anchor to the membrane via acylation ordomains capable of binding lipid head groups (Valdez et al., 1999). Itwas also shown that syntaxin 1C, an alternative splice variant ofsyntaxin 1A with no TMD, is expressed as a soluble protein inastroglioma cells and may regulate the intracellular trafficking of theglucose transporter GLUT1 (Nakayama et al., 2004). However, theactual existence and the possible functions of most syntaxins with noTMD remain elusive.
Genome-wide analyses of alternative splicing have emphasizedthe importance of discovering and characterizing new splice formsthat may contribute to the functional complexity of the humangenome (Modrek and Lee, 2002). In this study, we have studied thehuman syntaxin gene STX1B and showed that it encodes twoalternatively spliced transcripts. One of these transcripts correspondsto a protein lacking the classical C-terminal TMD of the syntaxins. Thisisoform (STX1B-ΔTMD) is targeted to the nucleus of various cell types,both in vitro and in vivo.
2. Materials and methods
2.1. Analyses in silico
The RP11-440G8 BAC sequence (Genbank accession no. AC021142)was analyzed using the Nix program at HGMP (http://www.hgmp.mrc.ac.uk). BLAST searches were performed at NCBI (http://www.ncbi.nlm.nih.gov/). Protein domains were predicted using ConservedDomain database at NCBI (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml), PSORT II (http://psort.ims.u-tokyo.ac.jp/form2.html)and the NLS database (http://cubic.bioc.columbia.edu/cgi/var/nair/resonline.pl). The phylogenetic tree for the syntaxin family memberswas obtained using the CLUSTAL 1.8 program (Thompson et al., 1994)at ExPAsy (http://www.expasy.org/tools/). Branch lengths werecalculated using the neighbour-joining method (Saitou and Nei,1987). Confidence values of tree topology were estimated with thebootstrap method (Felsenstein, 1992) using 1000 strap replicates.Phylogenies were viewed with TREEVIEW.
2.2. cDNA synthesis and analysis
Total RNAs from normal human tissues were obtained commer-cially (Clontech). The expression pattern of the STX1B transcripts wasdetermined by RT-PCR amplification from 1 μg of RNA, using oligo(dT)primer and the SuperScript II Rnase H− Reverse Transcriptase(Invitrogen), according to the manufacturer's protocol. For eachprimer pair, 30 cycles of PCR were performed with an annealingtemperature at 61 °C. STX1B-TM was detected with primers 2F andesroh 9–10 (Table 1) and STX1B-ΔTMD with primers I9-L and 10a(Table 1), giving rise to fragments of 252 bp and 222 bp respectively.Primers for GAPDH control were GAPDH-F and GAPDH-R (Table 1). Todetermine the STX1B-ΔTMD cDNA sequence, RT-PCRs were performedfrom human whole-brain total RNA (1 μg) as described above. One-twentieth of the reaction product was used for PCR amplification of 30cycles with specific primers (1F, 2R, 2F, 5′1, 5R, 10a, 10F, 10R1, 10R2,
10R3, 10R4; Table 1) in different combinations, using a 9700 DNAthermocycler (Applera). 5′-RACE experiments were performedaccording to the manufacturer's instructions (Clontech) using thefollowing primers: AP1 (adaptor primer 1) and Stx-Race1 for the firstPCR, and AP2 (adaptor primer 2) and Stx-Race2 for the nested PCR(Table 1). Nested PCR products were ligated into pGEM-T vector(Promega) and analyzed by automated sequencing on a CEQ-8000™Sequencer (Beckman-Coulter).
2.3. In situ hybridization
Human autopsy samples from non-tumoral, non-neurodegenerativebrain cortices and obtained from the Netherlands Brain Bankwere used.Three probes used for in situ hybridization experiments were generatedby PCR amplification from three different regions of the human STX1BcDNA sequences. Probe Ex1/2 was obtained with primers 5′1 and 1/2-R,probe Ex9/10 with primers 9/10-F and 9/10-R and probe In9 withprimers In9-F and 10a respectively (Table 1). For each primer set, eitherof the two primers included a 22 bp-T7 tail at the 5′ end for thegeneration of sense or antisense probes. Antisense and sense cRNAprobeswere produced and labelledwith digoxigenin-11-UTP (Roche) byin vitro transcription using T7 RNA polymerase (Promega). In situhybridization experiments were performed on serial sections (14 μmwith a Microm cryostat) as already described (Roll et al., 2006). In eachexperiment, controls included slides hybridized with sense probes andslides without any probe (control for nonspecific binding of antibodies).Sections were observed with a microscope (Leica, DMR) and CoolSnapcamera.
2.4. Generation of constructs
Full-length coding sequences of human STX1B-TM and STX1B-ΔTMD were amplified by RT-PCR from whole-brain total RNA(Clontech) using the forward primer STXfull-F and the reverse
162 S. Pereira et al. / Gene 423 (2008) 160–171
primer TMfull-R (for STX1B-TM) or ΔTMDfull-R (for STX1B-ΔTMD)(Table 1). Truncations of STX1B-ΔTMD were generated by PCR usingthe following primers (Table 1): STX1B1–130 (amino acids 1 to 130):Δ1-F and Δ1-R; STX1B130–262 (amino acids 130 to 262): Δ2-F and Δ2-R; STX1B63–277 (amino acids 263 to 277): Δ3-F and Δ3-R; STX1B1–262(amino acids 1 to 262): Δ1-F and Δ2-R; STX1B130–277 (amino acids130 to 277): Δ2-F and Δ3-R. All PCR fragments were subcloned intopEGFP-C1 or into pDsRed2-C1 (Clontech) in order to produce fusionproteins with the corresponding tags (eGFP: 29 kDa; DsRed2:31 kDa) at the N-terminal end. Insert sequences and orientationswere confirmed by automated sequencing on a CEQ-8000™Sequencer (Beckman-Coulter).
2.5. Cell cultures and transfection
M3DAU (a human melanoma cell line) and MHN (human non-tumoral melanocytes) cells were grown in 5% CO2 at 37 °C inMCDB153medium (Sigma-Aldrich) supplemented with 10 ng/ml PMA (Sigma-Aldrich), 5 μg/ml insulin, 0.5 μg/ml hydrocortisone, 30 μg/ml bovinepituitary extract and 0.01 mg/ml CaCl2. Cal127 cells (a humanastrocytoma cell line) were grown in 5% CO2 at 37 °C in DMEMnutrient mixture (Life Technologies) supplemented with 200 mMglutamine, 100 mM sodium pyruvate, 5 μg/ml plasmocyn, 1 μg/ml EGF(Epidermal Growth Factor) and 10% fetal calf serum (FCS). CHO cellswere grown in 5% CO2 at 37 °C in Ham's F-12 nutrient mixture (LifeTechnologies) supplemented with 2 mM glutamine, 100 U/mlpenicillin, 100 μg/ml streptomycin and 10% fetal calf serum. Whencells reached 70–80% confluence, they were transfected or harvestedwith 0.25% trypsin and 0.05% EDTA in 10 mM sodium phosphate,0.15 M NaCl, pH 7.4 buffer (PBS). After centrifugation, aliquots ofdissociated cells were plated again on 100 mm diameter Petri dishes.Cells were transiently transfected with various recombinant or non-recombinant vectors using the Lipofectamine Plus™ reagent (LifeTechnologies) and according to the manufacturer's protocol.
2.6. Antisera and affinity purification
Computer prediction programs were used to identify potentialantigenic sites within the STX1B protein isoforms. Peptides specific toeither both isoforms ([M1–V21], to produce the anti-1B-Nter antibody)or to STX1B-ΔTMD only ([R261–G277], to produce the anti-1B-Cterantibody), were generated (Millegen, Toulouse) and used to immunizetwo rabbits each. Analysis of the serum from these hosts by Enzyme-Linked Immunosorbent Assay demonstrated that they identified therespective peptides used for immunization. The antibodies werepurified from crude rabbit sera first with a Protein A-Sepharosecolumn (Amersham) according to the manufacturer's protocol andthen by affinity chromatography against their respective immobilized-antigens on Sepharose-CNBr columns (Sigma).
2.7. Immunocyto- and immunohistochemistry assays
Cal127, M3DAU, and MHN cells cultured on coverslips (LabTek I,Dutscher) were fixed with 4% paraformaldehyde in PBS buffer for 15–30 min at room temperature. Nonspecific binding was blocked in PBSsupplemented with 10% NGS (normal goat serum). Following apermeabilization step in a 0.1 M phosphate buffer pH 7.4, 0.5% TritonX-100, the cells were incubated with anti-1B-Cter antibody (1:100).The secondary antibodies were anti-rabbit antibodies conjugated toAlexa 488 (1:400; Molecular Probes). Coverslips were mounted inVectashield (Vector). Whenever needed, cells were also counter-stained with DAPI (4′,6-diamidino-2-phenylindole). Cal127 cellscultured on coverslips (LabTek I, Dutscher) were cytospun at 91 gfor 3 min on polylysine glass (In vitro Diagnostics) and fixed in 4%paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 30 min,dehydrated in ethanol and stored at −80 °C. The following primary
antibodies were used: rabbit anti-1B-Cter antibody (1:100), mouseanti-NuMA antibody (1:100; Invitrogen) or mouse anti-lamin A/Cantibody (1:50; DakoCytomation) or mouse anti-γ-tubulin antibody(1:250; Sigma). Anti-1B-Cter antibody was labeled with Alexa Fluor594 rabbit IgG labeling reagent and anti-NuMA or anti-lamin A/Cantibodies were labeled with Zenon Alexa Fluor 488 mouse IgGlabeling reagent, according to the manufacturer's instructions. Cellswere observed by confocal laser microscopy (Leica TCS SP2 micro-scope equipped with a ArKr and a HeNe lasers and a ×63planAPOchroma oil immersion objective lens). 3D-stacks of confocalimages were acquired using a 0.16 μm step. In some cases, the averageintensity projection of a number of slices from a 3D-confocal stack hasbeen computed, in order to improve the visualisation. DAPI fluores-cence was obtained by multiphoton-excitation at 780 nm, with pulsesin the 100–200 fentosecond range, using a Mira tuneable pulsedtitanium sapphire laser (Coherent Laser Group, USA).
Immunohistochemistry experiments were performed on serialsections of human adult brain samples. The following antibodies wereused as primary antibodies: rabbit anti-1B-Cter antibody (1:100),rabbit anti-1B-Nter antibody (1:100), mouse anti-MAP2 (microtubule-associated protein type 2) antibody (1:100; Sigma), mouse anti-calretinin antibody (AbCam), mouse anti-syntaxin 1A antibody(mAb10H5; 1:100), mouse anti-SNAP25 antibody (Yoshida et al.,1992). Secondary antibodies were anti-rabbit biotin-SP-conjugatedantibodies (1:200; Jackson Lab) used with enzyme-conjugatedstreptavidin (Vector) and anti-mouse antibodies conjugated to Alexa488 (1:400; Molecular Probes). In each experiment, non-immune IgG(from rabbit or mouse, obtained from Jackson Lab) were used asnegative controls (not shown). Tissues were observed with afluorescent microscope (Leica DMR fitted with a CoolSNap camera)and by confocal laser microscopy.
2.8. Cell and tissue extracts
Total proteins from human cortex were extracted as follows: 1 g oftissue was immersed in 5 ml of cold Tris–HCl buffer (5 mM, sucrose0.25 M, pH 7.4) supplemented with Complete Protease Inhibitors(Roche, Mannhein, Germany) and homogenized (15 s at 4 °C) with aPolytron (Kriens; Luzern, Switzerland). After centrifugation (10000 g,15 min), the supernatants were stored at −20 °C before use. Cellextracts were obtained as already published (Navarro et al., 2005).Briefly, Cal127 cells were grown to about 80% confluence and thenwashed twice with incomplete PBS buffer (10 mM sodium phosphatebuffer at pH 7.4 with 0.15 M NaCl and without Mg2+ and Ca2+) andscraped with a rubber policeman. Cells were recovered in this latterbuffer and pelleted by low speed centrifugation. The supernatant wasremoved and the sedimented cell pellet was homogenized bysonication (15 s, 4 W, 4 °C) in 1 ml of cold Tris–HCl buffer (5 mM,sucrose 0.25 M, pH 7.4) supplemented with Complete ProteaseInhibitors (Roche, Mannhein, Germany). After centrifugation(10000 g, 15 min), the supernatants were used for SDS-PAGE analysis.
2.9. SDS-PAGE and western blotting
Proteins were separated by 15% SDS-PAGE with 8 M urea. Proteinswere then transferred to nitrocellulose membranes for Western blotanalysis. Nitrocellulose membranes were blocked by incubation with5% defatted milk in TBS (10 mM Tris, 150 mM NaCl, pH 8.0) for 1 h atroom temperature. Polyclonal anti-1B-Cter and anti-1B-Nter anti-bodies were used at 1:1000 dilution. Anti-GAPDH (ABCam) and anti-GFP (Clontech) antibodies were used at 1:1000 and 1:500 dilutions,respectively. After 1 h at room temperature, the membranes werewashed three times with TBS and incubated for 1 h with anti-rabbitHRP-conjugated secondary antibody (1:5000; Amersham). The mem-branes were then treated by enhanced chemiluminescence (ECL+,Amersham) according to the manufacturer's instructions.
163S. Pereira et al. / Gene 423 (2008) 160–171
2.10. Nuclear import assay
Nuclear import reactions were performed as described (Takizawaet al., 1999). Cal127 cells were grown on glass coverslips for 24 to 48 h.
Fig. 1. Expression of STX1B, a newmember of the syntaxin family. (A) Structure of the STX1B gintron 9 is indicated. (B) RT-PCR experiments. Left panel: schematic representation of theDashed rectangle indicates intron 9. The arrows indicate the respective locations and orientaRT-PCRs on total RNA from various human tissues. Top 222 bp-STX1B-ΔTMD fragment; midcontrols for both panels were RT reactions performedwithout the reverse transcriptase (datapresented here was observed. PhiX 174 DNA/Hae III fragments were used as molecular weighrepresentation of the alternative splicing event with retention of intron 9. For conveniencepredicted alternative proteins. The syntaxin, SNARE (coiled-coil) and transmembrane (TMD;STX1B-ΔTMD (V263–G277; dashed box) is indicated. N-ter and C-ter black bars indicate the loantibodies, respectively. (D) to (F) Detection of STX1B-TM (D), STX1B-ΔTMD (E) and both STXhybridization. The position of the specific riboprobes with respect to the corresponding tra
Cells were washed twice in transport buffer (20 mM Hepes–KOH, pH7.3/110 mM KOAc/2 mM Mg(OAc)2/1 mM EGTA/2 mM DTT/aprotinin(1 μg/ml)/pepstatin A (1 μg/ml)) and then treated with digitonin(40 μg/ml) for 6 min on ice. After permeabilization, cells were washed
ene. The lengths of each exon and intron are indicated in base pairs (bp). The position oftwo alternative 3′ ends of the STX1B-ΔTMD (top) and STX1B-TM (bottom) transcripts.tions of the specific primers that were used to amplify each PCR fragment. Right panel:dle: 252 bp-STX1B-TM fragment; bottom: 450 bp-GAPDH (control) fragment. Negativenot shown). Each PCR reactionwas repeated twice and the same pattern of expression ast markers. (C) Alternative splicing leads to two isoforms of STX1B. Left panel: schematic, only the first and last exons are represented. Right panel: schematic view of the twoblack box) domains are indicated. The amino acid sequence of the specific C-terminus ofcation of the antigenic sites chosen for the generation of the anti-1B-Nter anti-1B-Cter1B-TM and STX1B-ΔTMD (F) transcripts in neurons of the human brain cortex by in situnscripts is schematically indicated at the top of each figure. Bar: 100 μm.
164 S. Pereira et al. / Gene 423 (2008) 160–171
twice with transport buffer and inverted on top of 15 μl of importreaction in transport buffer containing 300 nM of import substrate,2 μM of RanQ69L and an ATP-regenerating system (1 mM ATP/5 mMcreatine phosphate/creatine kinase 10 U/ml) and incubated at 30 °Cfor 30 min. For RanQ69L wash-out experiments, cells were rinsedtwice in PBS, then cultured for 3 h. Cells were washed twice intransport buffer fixed with 4% paraformaldehyde for 30 min at roomtemperature and then permeabilized with 0.5% Triton X-100/10%normal goat serum/5% human serum in PBS for 30 min. Cells wereincubated with polyclonal anti-1B-Cter antibody (1:100) for 1 h atroom temperature. Secondary antibody (1:400 dilution of 488 Alexaconjugated anti-rabbit, Molecular Probes) was added and incubatedfor 1 h at room temperature. After incubation, secondary antibodywasremoved, cells were washed with PBS, stained with DAPI (25 ng/ml),mounted in Vectashield. Labeled cells were visualized by confocalmicroscopy.
2.11. Real-time quantitative RT-PCR analyses on brain tumors
Total RNAs from 37 brain tumor biopsies were frozen in liquidnitrogen immediately after recovery, stored at –80 °C, and thenextracted using the TRIZOL reagent according to the manufacturer'sinstructions (Gibco BRL Life Technologies, USA). For each tumor, 1 μgof total RNA was reverse-transcribed using random hexamers andthe Superscript® II RNase H−reverse transcriptase (Invitrogen, UK),according to the manufacturer's instructions. Quantitative PCR wascarried out using TaqMan® probe-based chemistry (Applied Biosys-tems). Predesigned PCR primers and the corresponding TaqMan®probes were purchased (Applied Biosystems) for the LMNA (LaminA/C) gene (ref. Hs00153462_m1) and for the control gene GAPDH(Glyceraldehyde-3-Phosphate Deshydrogenase) (ref. 4326317E). PCRprimers and TaqMan® probe for STX1B-TM (Forward: TCTGACAC-CAAGAAAGCAGTGAAAT, Reverse: GCACCACACAGCAAATGATGATC,Internal probe: CCGGAGGAAGAAAAT) and STX1B-ΔTMD (Forward:AGGCCTTATCTCTGGCTCTGA, Reverse:GGGTGGCAGGGAGAAGAG,Internal probe:CTTCCTGTTTCTGTTTTCTC) were designed using theFile Builder program (Applied Biosystems). Standard curves were setup for all. The amplification reactions contained 50 ng cDNAequivalents, 1× TaqMan® universal PCR master mix, 1× Primers andProbe, in a final volume of 25 μl per well. Real-time PCR data wereanalyzed using the 7500 System SDS software v 1.2.3. Allexperiments were done in triplicate. The fluorescence intensity isrelated to the initial number of RNA copies, which can be assessedby determining the threshold cycle (Ct). The higher the startingcopy number of the nucleic acid target, the lower the thresholdcycle (Ct). Results were expressed as the difference (DCt) betweenthe Ct of the transcript of interest and the Ct of the referencetranscript (GAPDH). As a consequence, the lower the DCt, the higherthe transcript expression.
A total of 37 brain tumor biopsies obtained according to theappropriate ethical rules, at the time of diagnosis (between 1991 and1995) and prior to any treatment, was analyzed (19 men, 18 women,aged 33 to 88 years, mean age 59.6). Twenty-seven tumors
Fig. 2. In vitro and in vivo nuclear localization of STX1B-ΔTMD in various cell types. (A) Subceexpected, no nucleoplasmic fluorescence was detected. Confocal microscopy slices. (B) SubceTransfected Cal127 cells displayed nucleoplasmic fluorescence, in contrast with Cal127 cellsnative STX1B-ΔTMD protein in the nucleoplasm of various cell lines with anti-1B-Cter antib(C) Cal127 cells (D) M3Dau cells (E) MHN cells. (F) to (G) Expression of STX1B-ΔTMD byWesCal127 cells (50 μg). (F) Anti-GFP antibody recognizes the full-length STX1B-ΔTMD (lane 1–2well as the non chimaeric GFP protein (lane peGFP-C1). (G) Left panel. Anti-1B-Cter antibodyΔTMD (lane 263–277) eGFP fusion proteins, as well as the STX1B-ΔTMD native protein as a 3ΔTMD as a 31-kDa band in protein extracts from human brain cortex. (H) to (K) Detection ofCter antibody. (I) anti-MAP2 antibody. (J) Overlay of (H) and (I). (K) DAPI staining. (Conventiocortical neurons. (L) Anti-1B-Cter antibody (M) Anti-STX1A antibody (N) Overlay of (L) andautofluorescent background signals that appeared as yellow dots in overlay picture. (Convenfigure legend, the reader is referred to the web version of this article.)
(oligodendroglioma: G1, G3; oligoastrocytoma: G2; astrocytoma:G3) were classified as “low-grade” and ten (glioblastoma; astro-cytoma: G4) as “high-grade”. Survival was calculated from the dateof initial diagnosis. The end point was cancer death. Median follow-up was 11.9 months. The influence of the analyzed transcripts (takenas continuous variables), tumor staging (“high” versus “low” grade),patient age and treatment (surgery, radiotherapy or chemotherapy,each considered as a binary variable) on specific survival wereassessed by means of Cox regression analyses. Correlations weretested by means of the non-parametric Spearman rank test. Two-tailed non-parametric tests were used for testing the influence ofgender and tumor staging on the analyzed transcripts. Statistics wereperformed on SPSS software, version 13.1 (USA).
3. Results
3.1. Alternative splicing leads to a predicted STX1B syntaxin isoformlacking the TMD
In the course of a positional cloning project on the infantileconvulsions with paroxysmal dyskinesia (ICCA) syndrome that mapsat human chromosome 16p12–q12 (Szepetowski et al., 1997), a BACclone (RP11-440G8; Genbank accession no. AC021142) had beenscreened in silico by the NIX program at HGMP (http://www.hgmp.mrc.ac.uk). A member of the syntaxin family had been predicted.Confirmation of the actual cDNA sequence was then obtained by acombination of RT-PCR and 5′-RACE experiments. The cDNAsequence (Genbank accession no. AY028792) actually correspondedto the human STX1B gene (Genbank accession no. NM_052874) thathad been previously mapped at chromosome 16p11.2 (Smirnova etal., 1996); it is composed of ten coding exons and spans a genomicarea of about 18 kb (Fig. 1A; see also the human genome sequence:http://genome.ucsc.edu/). The entire coding sequence (864 bp) ofSTX1B corresponds to a predicted protein of 288 amino acids sharinghigh identity with several members of the syntaxin superfamily.Phylogenetic analysis of the syntaxin family members from differentspecies pointed out some very strong nodes (Supplementary Fig. 1),and especially one that defined a peculiar subfamily composed oftwo groups: one protostomian and one deuterostomian. The latter iscomposed of the STX1A group and the STX1B group. Computationalanalysis showed that the predicted STX1B protein possesses themembrane-proximal coiled-coil SNARE domain (Fig. 1C) that ischaracteristic of and conserved in all syntaxins (Weimbs et al., 1997).The TMD that is common to most syntaxins and the cleavage site forbotulinum neurotoxin C1 (BoNT/C1) were present in the C-terminalpart of the predicted protein.
In addition to the classical STX1B transcript (thereafter renamedSTX1B-TM), RT-PCR experiments (Fig. 1B) revealed the existence ofan alternatively spliced form of STX1B. Retention of intron 9introduced a premature stop codon within the coding sequence.The predicted alternative protein of 277 amino acids (STX1B-ΔTMD;Genbank accession no. AY995211) lacked the carboxyl-terminalhydrophobic TMD of the classical syntaxins (Fig. 1C; Supplementary
llular localization of the STX1B2-TM fusion protein tagged at its N-terminus (DsRed). Asllular localization of the STX1B-ΔTMD fusion protein tagged at its N-terminus (DsRed2).transfected with non-recombinant plasmid pDsRed2-C1 (Fig. 4L). (C) to (E) Detection ofody. Confocal microscopy, average intensity projection of a 0.16-μm thick confocal stacktern blot analysis of total protein from human brain cortex (25 μg) and from transfected77) and the C-terminus part of STX1B-ΔTMD (lane 263–277) as eGFP fusion proteins, asrecognizes the full-length STX1B-ΔTMD (lane 1–277) and the C-terminus part of STX1B-1-kDa band (lane 1–277). Right panel. Anti-1B-Cter antibody recognizes native STX1B-native STX1B-ΔTMD protein in the nucleoplasm of human cortical neurons. (H) anti-1B-nal microscopy). (L) to (O) Lack of co-localization of STX1B-ΔTMD and STX1A in human(M). (O) DAPI staining. (L) to (N) Lipofuscin pigments (see arrows) gave green and redtional microscopy). All bars: 10 μm. (For interpretation of the references to colour in this
165S. Pereira et al. / Gene 423 (2008) 160–171
166 S. Pereira et al. / Gene 423 (2008) 160–171
Fig. 2). The expression pattern of both STX1B transcripts in varioushuman tissues was determined by RT-PCR experiments (Fig. 1B).Overall, the two STX1B transcripts were expressed at similar ordifferent levels in the adult and fetal brain as well as in spinal cord,placenta, testis and thymus. Weaker expression was detected inkidney, skeletal muscle, liver and lung. As modifications inalternative splicing patterns are associated with neoplasia formany genes (Faustino and Cooper, 2003), the expression of bothtranscripts was also tested in a series of cell lines derived fromhuman brain tumors. Expression of both STX1B-TM and STX1B-ΔTMD was detected in all nine tumor cell lines of glial origin thatwere tested (data not shown).
The expression pattern of both types of transcripts generated bythe STX1B gene was more precisely determined by in situhybridization on human brain samples. Riboprobes were designedin order to specifically detect either the STX1B-TM transcripts (Fig.1D) or the STX1B-ΔTMD transcripts (Fig. 1E). Both transcripts weredetected in a subset of cortical neurons of the grey matter while nolabelling was obtained in the corresponding white matter or in theneuropil. The Ex1/2 riboprobe that is common to both types oftranscripts confirmed the neuronal pattern of expression of STX1B(Fig. 1F).
3.2. The STX1B-ΔTMD protein localizes to the nuclei of human cells
The lack of the TMD in the STX1B-ΔTMD protein raised thequestion of its cellular localization. Human Cal127 glial tumor cellswere transfected with plasmids to transiently express STX1B fusionproteins. As shown for other type 1 syntaxin proteins (Murthy and DeCamilli, 2003), DsRed-tagged STX1B-TM fusion proteins were detectedin the cytoplasm but not in the nucleus (Fig. 2A). In contrast, DsRed-(Fig. 2B) as well as eGFP- (Fig. 4E) tagged STX1B-ΔTMD proteinsdisplayed unambiguous nucleoplasmic localization, while diffusecytoplasmic fluorescence was obtained after transfection of thecorresponding non-recombinant pDsRed2-C1 plasmid (Fig. 4L).
To confirm the nucleoplasmic localization of STX1B-ΔTMD,polyclonal antibodies (anti-1B-Cter) targeted towards the specificC-terminal part of STX1B-ΔTMD were produced (Fig. 1C). BLASTsearch at NCBI showed that this specific C-terminus of 15 aminoacids (VSGAGGLGVGGGAQG; thereafter designated as [V263–G277])did not display significant homology with any other human aminoacid sequence. In protein extracts from transfected Cal127 cells, theanti-1B-Cter antibody detected eGFP fusion proteins correspondingto full-length STX1B-ΔTMD ([1–277]) and to the specific C-terminusof STX1B-ΔTMD ([263–277]), as expected (Fig. 2F to G). Proteinextracts from total human cortex were also analyzed by immuno-blotting (Fig. 2G). In the brain, the anti-1B-Cter antibody detectedthe native STX1B-ΔTMD protein at the expected molecular weightof 31 kDa. Native STX1B-ΔTMD protein was detected by immuno-cytochemistry in the nucleoplasm of various tumoral or non-tumoral cell lines (Fig. 2C to E). To further demonstrate the nuclearlocalization of STX1B-ΔTMD in vivo, immunohistochemistry experi-ments were performed on brain samples with anti-1B-Cter andanti-MAP2 antibodies and showed expression of the human STX1B-ΔTMD protein in the nucleoplasm of a subset of cortical neuronsbut not in normal glial cells in vivo (Fig. 2H to K). In contrast, noco-localization of STX1B-ΔTMD with the plasma membrane proteinsyntaxin 1A was observed (Fig. 2L to O). In order to further confirmthese data, another antibody (anti-1B-Nter) that recognizes a N-terminal epitope common to both isoforms of STX1B (Fig. 1C), wasused. In the brain, the anti-1B-Nter antibody specifically detectedtwo proteins of 33 kDa and 31 kDa by western blot analysis,corresponding to the expected molecular weights of STX1B-TM andSTX1B-ΔTMD respectively (Supplementary Fig. 3). Immunohisto-chemistry experiments performed on brain samples with anti-1B-Nter also confirmed the nuclear detection of STX1B-ΔTMD in
neuronal cells while, as expected, STX1B-TM colocalized with themembrane proteins syntaxin 1A and SNAP25 (Supplementary Fig. 3).Altogether, these data demonstrated the actual existence of theSTX1B-ΔTMD protein in vivo and confirmed the nuclear localizationshown in transfected cells. Our data thus demonstrated that thehuman STX1B-ΔTMD syntaxin protein localizes in the nucleus ofvarious cultured cells and of cortical neurons, both in vitro and invivo.
The nuclear distribution of STX1B-ΔTMD was then determined byimmunocytochemistry experiments on Cal127 cells. During theinterphase, STX1B-ΔTMD displayed a diffuse nucleoplasmic stainingwith exclusion of nucleoli, as well as a nuclear lamina staining (Fig. 3Ato H) that was confirmed with anti-Lamin A/C (Fig. 3B, C) and anti-NuMA (Fig. 3F, G) antibodies. During mitosis, STX1B-ΔTMD localizedin the cytoplasm and to the centrosomes (Fig. 3I to T), as furtherconfirmed by its co-localization with NuMA (Fig. 3N, O) and γ-tubulin(Fig. 3R, S).
3.3. STX1B-ΔTMD is targeted to the nucleus via a Ran-dependentpathway by virtue of its 15-aminoacid, specific C-terminal end
The transport of the importin–substrate complex into the nucleusis regulated by the small GTPase Ran and import of most nuclear cargois blocked in a reversible and competitive manner by the addition ofRan Q69L, a version of Ran that is unable to hydrolyze GTP (Takizawaet al., 1999). To test the possible involvement of Ran in STX1B-ΔTMDimport, we analyzed the subcellular localization of STX1B-ΔTMD inpermeabilized Cal 127 cells in the absence or presence of Ran Q69L.STX1B-ΔTMD was detected in the nucleus in the absence of Ran Q69L(Fig. 4A). In the presence of Ran Q69L, STX1B-ΔTMD accumulated inthe perinuclear area (Fig. 4B), showing that its nuclear importationwas inhibited when the Ran GTPase activity was blocked. After a 3 hwash-out of Ran Q69L, the nuclear distribution of STX1B-ΔTMD wasrecovered, thus demonstrating the reversibility of the inhibition (Fig.4C). The nuclear import of STX1B-ΔTMD is thus mediated via a Ran-dependent pathway in Cal127 cells.
STX1B-ΔTMD was characterized by the lack of the TMD and by thepresence of the [V263–G277] specific C-terminal domain of 15 aminoacids. This latter sequence was analyzed in silico with the PSORT IIprogram as well as at the NLS (Nuclear Localization Signal) databasebut neither a classical NLS (Hanover, 1992) nor a M9 signal (Pollard etal., 1996) was predicted. To assess whether the [V263–G277] motif candirect nuclear targeting, various truncated forms of STX1B-ΔTMDproteins lacking [V263–G277] or not, were constructed (Fig. 4D). Whenexpressed in Cal127 cells, only the proteins with [V263–G277] at the C-terminus were efficiently targeted to the nucleus (Figs. 2B, 4E, I). Incontrast, the constructs lacking [V263–G277] remained in the cytosol(Fig. 4F to H, J). [V263–G277] was also inserted at the C-terminus of theDsRed fluorescent protein. When a DsRed-[V263–G277] fusion proteinwas expressed, a fluorescent nuclear signal was obtained (Fig. 4K),while a diffuse fluorescent pattern was visible in the cytosol with thenon-recombinant DsRed protein (Fig. 4L). This confirmed that [V263–
G277] actually worked as a NLS. Altogether, our data demonstrated that[V263–G277] was sufficient and necessary for nuclear targeting ofSTX1B-ΔTMD.
3.4. The ratio of STX1B-ΔTMD to Lamin A/C transcripts may represent anindependent prognostic marker of survival in human primary braintumors
STX1B-ΔTMD and Lamin A/C colocalized in the nuclear matrixand the nuclear lamina (Fig. 3). Alterations in the nucleararchitecture may occur in cancer cells and Lamin A/C itself maybe involved in tumoral processes (Zink et al., 2004). As mentionedabove, STX1B-TM and STX1B-ΔTMD transcripts were detected byRT-PCR in all nine tumor cell lines of glial origin that were tested
Fig. 3. STX1B-ΔTMD localizes to the nuclear matrix and to the centrosomes. (A) to (D) STX1B-ΔTMD co-localizes with lamin A/C in interphasic nuclei of Cal127 cells. Confocalmicroscopy, average projection of 50 (B), 40 (C) and 15 (D) slices. (A) Anti-1B-Cter antibody. STX1B-ΔTMD locates to the lamina and to the nuclear matrix with exclusion of thenucleoli (B) Anti-lamin A/C antibody (C) Overlay of (A) and (B) shows co-localization of STX1B-ΔTMD and lamin A/C (D) DAPI. White bar: 5 μm. (E) to (H) STX1B-ΔTMD co-localizeswith NuMA in interphasic nuclei of Cal127 cells (E) Anti-1B-Cter antibody (F) Anti-NuMA antibody (G) Overlay of (E) and (F) shows co-localization of STX1B-ΔTMD and NuMA (H)DAPI. (I) to (L) STX1B-ΔTMD co-localizes with lamin A/C in Cal127 cells duringmitosis (I) Anti-1B-Cter antibody. STX1B-ΔTMD locates in the cytoplasm (J) Anti-lamin A/C antibody (K)Overlay of (I) and (J) shows co-localization of STX1B-ΔTMD and lamin A/C (L) DAPI. (M) to (P) STX1B-ΔTMD co-localizes with NuMA in Cal127 cells during mitosis (M). Anti-1B-Cterantibody (N) Anti-NuMA antibody (O) Overlay of (M) and (N) shows co-localization of STX1B-ΔTMD and NuMA (P) DAPI staining. (Q) to (T) STX1B-ΔTMD co-localizes with γ-tubulinin Cal127 cells during mitosis (Q) Anti-1B-Cter antibody (R) Anti-γ-tubulin antibody (S). Overlay of (Q) and (R) showing co-localization of STX1B-ΔTMD and γ-tubulin. (T) DAPI.Arrowheads indicate the centrosomes (M) to (S). Confocal microscopy, average intensity projection of 7 (Q, R, T), 14 (M, N, P), 17 (E, F, H) and 22 (I, J, L) Confocal slices were 0.16 μmthick.
167S. Pereira et al. / Gene 423 (2008) 160–171
(data not shown), while no expression could be detected by in situhybridization in non-tumoral human glial cells in vivo, at least inthe brain areas that were examined (Fig. 1D to F). This prompted usto analyze the expression status of the STX1B-TM, STX1B-ΔTMD andLamin A/C genes in a series of 37 human glial tumors by real-timequantitative RT-PCR. The expression of STX1B-TM, STX1B-ΔTMD andLamin A/C transcripts relative to GAPDH was detected in 36 out ofthe 37 tumors. STX1B-TM, STX1B-ΔTMD and Lamin A/C expressionsfitted a Gaussian distribution. The description of the differenttranscript expression is given in Table 2. The expression of theSTX1B-TM and STX1B-ΔTMD transcripts was not linked to patientage, gender, or tumor staging. Interestingly, the greater the
expression of STX1B-ΔTMD, the higher the expression of STX1B-TM (p=0.007, r=0.44, N=36). No correlation was observed betweeneither STX1B-TM or STX1B-ΔTMD, and Lamin A/C expression. At thetime of analysis, 26 patients had died from cancer. Median specificsurvival was 12.5 months. Univariate Cox analyses showed that inaddition to the classical prognostic factors (tumor staging:p=0.031; patient age: p=0.039), the ratio of STX1B-ΔTMD to La-min A/C transcripts was the only other significant predictor ofspecific survival (p=0.002) (Table 2). Survival was improved intumors displaying low levels of STX1B-ΔTMD transcripts relative tothe Lamin A/C transcripts. Importantly, a multivariate Cox analysisrevealed that the tumor staging (p=0.035) and the ratio of STX1B-
Fig. 4.Mechanisms of STX1B-ΔTMD nuclear import. (A to C). Nuclear import of STX1B-ΔTMD is inhibited by a GTPase-deficient Ran mutant (Q69L). STX1B-ΔTMD was detected withthe anti-1B-Cter antibody. Confocal microscopy sections. The experiment was repeated twice and gave similar results. (A) Control Cal127 cells in the absence of Ran Q69L. (B) Cal127cells in the presence of 2 μMRan Q69L for 30min. (C) Cal127 cells after a 3 hwash-out of Ran Q69L. (D) Structural organization of STX1B-ΔTMD constructs and summary of the results.The syntaxin and SNARE domains are indicated. Dashed box indicates the [V263–G277] C-terminal domain of STX1B-ΔTMD. (E) to (M) Cal127 cells were transfected with thecorresponding constructs described in (D). Confocal microscopy sections. All bars: 10 μm.
168 S. Pereira et al. / Gene 423 (2008) 160–171
Table 2Transcript expression in 37 glial tumors and influence on specific survival
Analyzed expressiona DCtb UnivariateCox analysisc
on specificsurvival
Mean±SD Assessable extremevalues
p eβ
STX1B-TM 5.8±3.3 0.4–10.0 0.85 0.99STX1B-ΔTMD 8.1±2.6 4.8–11.2 0.14 0.86LMNA (Lamin A/C) 5.2±1.8 1.1–8.7 0.079 1.25STX1B-ΔTMD relativeto STX1B-TM
2.4±5.2 −2.4–8.0 0.32 0.97
STX1B-ΔTMD relative to LMNA 2.4±5.4 −3.9–9.3 0.002 0.87STX1B-TM relative to LMNA 0.2±5.6 −5.7–7.9 0.093 0.92
a STX1B-TM, STX1B-ΔTMD and LMNA are expressed relative to the GAPDH control.b Each DCt value represents the average from triplicate measurements. DCt was not
computable in 3 tumors that did not express STX1B-TM, STX1B-ΔTMD and LMNA,respectively.
c The expression of each transcript was analyzed as a continuous variable. Sinceresults were expressed as the difference between threshold cycles (DCt), the greater thevariable, the lower the expression. eβ (relative risk of death) represents the risk of deathof a patient presenting the value xi divided by the risk of death of a patient presentingthe value xi−1. When eβb1, the risk of death decreases when the variable increases, andconversely.
169S. Pereira et al. / Gene 423 (2008) 160–171
ΔTMD to Lamin A/C transcripts (p=0.002) were independentpredictors of survival.
4. Discussion
STX1B is a human gene that belongs to the syntaxin family andencodes two alternatively spliced isoforms, STX1B-TM and STX1B-ΔTMD, this latter lacking the classical C-terminal TMD. STX1B-ΔTMDis generated by retention of intron 9 in the corresponding STX1Btranscript. Among the four major types of alternative splicing, intronretention occurs at least once in about 15% of human genes (Galante etal., 2004). Our data confirm that a non-negligible proportion of intronretention events is probably not spurious and might have biologicalsignificance. Alternative splicing has also been associated withincreased evolutionary changes (Modrek and Lee, 2003). It isnoteworthy that no retention of the corresponding intron 9 of STX1Bwas detected in silico or by RT-PCR in the embryonic or adult brain ofRattus norvegicus (unpublished data). This may indicate that theSTX1B-ΔTMD isoform has appeared recently during evolution. STX1B-TM and STX1B-ΔTMD show structural features conserved among allsyntaxin members, including a coiled-coil domain that usuallymediates the interaction with other members of the SNARE machin-ery. Another usual feature of the syntaxin family of proteins is thecarboxyl-terminal transmembrane anchor. However, several syntaxinisoforms lacking a TMD have been described in different organisms.While some like syntaxin 11 may still play the classical role ofsyntaxins in membrane fusion (Tang et al., 1998), others may havedivergent functions. For instance, STX1C, an alternative variant ofSTX1A with no TMD, is a soluble protein and may be involved inregulating intracellular trafficking of glucose transporters (Nakayamaet al., 2004). Such variants may thus contribute to the functionaldiversity of the syntaxin proteins.
The STX1B-ΔTMD isoform was targeted to the nucleus of variouscell types. Nuclear localizationwas demonstrated both by transfectionassays for STX1B-ΔTMD fusion proteins, and by immunocyto- andimmunohistochemistry experiments for STX1B-ΔTMD native proteinin various non-tumoral and tumoral cell lines as well as in corticalneurons in vivo. Interestingly, syntaxins with TMD have already beendetected by substractive proteomics in rat salt- and detergent-extracted nuclear envelopes (Schirmer et al., 2003) and a nucleoplas-mic localization has indeed been reported for syntaxin 17 (Zhang et al.,2005). Whether the nuclear syntaxin 17 actually corresponds to the
canonical protein (Genbank accession no. NP_060389) or (as in thecase of STX1B) represents an alternatively spliced isoform lacking itsTMD remains undetermined, but at least one syntaxin 17 transcriptputatively corresponding to such an alternative isoform does exist(Genbank accession no. BC051790). Generally, alternative splicingmaylead to dramatic modifications in the cellular localization and hence inthe function of various proteins (Francesconi and Duvoisin, 2002;Bogdanov et al., 2003; Augustin et al., 2004; Nakayama et al., 2004).Similarly, the trafficking of proteins with TMD may be modified inpathological conditions (Cobbold et al., 2003) but also in physiologicalconditions, particularly by alternative splicing (Fukuda andMikoshiba,1999; Nakayama et al., 2004; Bogdanov et al., 2003). Shuttlingbetween the cytoplasm and nucleus of proteins with predominantmembrane localization has already been reported (Behrens et al.,1996; Nix and Beckerle, 1997; Hyman et al., 2000; Poupon et al., 2002;Benmerah et al., 2003; Olsnes et al. 2003), including a member of theSNARE family (Nakanishi et al., 2004). In the case of the endocyticproteins Eps15 and Eps15R, translocation may partly rely onalternative splicing events (Poupon et al., 2002). From this viewpoint,the identification and characterization of STX1B-ΔTMD as the firstnucleoplasmic syntaxin with no TMD, illustrates the importance ofalternative splicing in the emergence of new and sometimesunsuspected functions.
Nuclear importation of STX1B-ΔTMD via a classical Ran-dependentpathway further demonstrated its subcellular localization. AlthoughSTX1B-ΔTMDwas efficiently targeted to the nucleus, it did not exhibita classical NLS (Kalderon et al., 1984). However, the 15 aminoacid C-terminus of STX1B-ΔTMD, [V263–G277], was both necessary andsufficient for proper nuclear targeting. Interestingly, other plasmamembrane proteins showing nucleocytoplasmic shuttling do notusually contain classical NLS. The [V263–G277] signal thus representsa novel and unconventional, glycine-rich NLS. Indeed, [V263–G277]displayed a high content of glycine residues (8 out of 15). Non-classicalnuclear localization signals with an abundance of both arginine andglycine residues (rg-NLS) have already been described (Dono et al.,1998) but there was no arginine in [V263–G277]. Interestingly, thebinding of the FG-rich nucleoporins to importin-beta relies on glycine-rich repeats such as GLFG and FxFG (Bayliss et al., 2002). [V263–G277]may even bemore reminiscent of the glycine-rich domain of 30 aminoacids that is necessary and sufficient to target the RNA binding proteinhnRNP A1 to the nucleus (Weighardt et al., 1995).
Our data demonstrated that STX1B-ΔTMD localizes in the nuclearmatrix of post-mitotic cells and at the pericentrosomal regionssurrounding both poles of the mitotic spindle in dividing cells. Thenucleoplasmic and centrosomal localizations of STX1B-ΔTMD raisenew and exciting insights into its possible functions in human cells, inboth physiological and pathological conditions. A possible role fornuclear localization in the self-regulation of SNARE molecules cannotbe excluded, as proposed in yeast for Spo20p (Nakanishi et al., 2004).However, the respective plasma membrane and nuclear localizationsof Spo20p concerned one single isoform shuttling from one cellularcompartment to another one. This is clearly not the case in the presentstudy, where two alternatively spliced isoforms display mutuallyexclusive cellular localizations. More probably, the nuclear localizationof STX1B-ΔTMD in human cells must underlie novel physiologicalfunctions, such as spindle assembly or cell cycle control in dividingcells (Doxsey et al., 2005) and/or the spatial arrangement ofchromosomes and other nuclear components during the interphase(Taddei et al., 2004). There is indeed evidence for a dynamic continuityof the nuclear matrix and the mitotic apparatus, as shown for severalproteins including NuMA, CENP-B, CENP-F and Rb (Mancini et al.,1996).
Nuclear functions for proteins associated with plasma membranehad already been proposed (Benmerah et al. 2003), and many of theseproteins have been associated with tumoral processes. STX1B-ΔTMDmay also be associated with pathological processes, of the tumoral
170 S. Pereira et al. / Gene 423 (2008) 160–171
type particularly. Data obtained from 37 patients with primary braintumors showed that the lower the STX1B-ΔTMD transcript relative toLamin A/C, the better the survival, irrespective of tumor staging. Asalterations of the nuclear matrix and lamina have been associatedwith tumoral processes (Zink et al., 2004), we may speculate that theratio between the two corresponding proteins is somewhat altered inthe more aggressive glial tumors. This may also indicate that the twoproteins not only colocalize in the nucleus but also participatetogether in common nuclear pathways. The most reliable prognosticfactors for patients with primary malignant brain tumors arehistology, age and functional status. Additional unfavorable factorshave been proposed at the molecular level (Shiraishi and Tabuchi,2003), such as the absence of combined allelic losses of chromosomes1p and 19q in oligodendrogliomas, the expression of p53 in malignantgliomas and the EGFR (Epidermal Growth Factor Receptor) expressionin glial tumors (Etienne et al., 1998). While larger series of braintumors obviously need to be screened in order to confirm theassociation of low levels of the STX1B-ΔTMD to Lamin A/C ratio withsurvival, it represents a new and promising marker which, togetherwith the aforementioned ones, would lead to more accurate andreliable prognosis as well as to better classification independent oftumor staging.
Acknowledgments
We thank the patients who participated in this study. We aregrateful to P. Verrando for the gift of M3DAU and MHN cells, to C.Mazeau and G. Milano for the glial tumor cell lines, to R Ravid at theNetherlands Brain Bank for the human autopsy brain samples, to M.Gastaldi for her contribution at the initial phase of the study, and to D.Bisogno and E. Bes for their efficient administrative help. Assistancefrom the ‘Genome Variation’ core facilities atMarseille-Nice Génopôle,from IFR Jean Roche, Marseille (confocal microscopy) and from the‘Cell culture and DNA library’ at the Biological Resource Center (CRB),AP-HM, Marseille, was greatly appreciated. PR and SJ have beenrecipients of a LFCE (Ligue Française Contre l'Epilepsie) fellowship.This study was supported by INSERM.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.gene.2008.07.010.
References
Augustin, R., Carayannopoulos, M.O., Dowd, L.O., Phay, J.E., Moley, J.F., Moley, K.H., 2004.Identification and characterization of human glucose transporter-like protein-9(GLUT9): alternative splicing alters trafficking. J. Biol. Chem. 279, 16229–16236.
Bayliss, R., Littlewood, T., Strawn, L.A., Wente, S.R., Stewart, M., 2002. GLFG and FxFGnucleoporins bind to overlapping sites on importin-beta. J. Biol. Chem. 277,50597–50606.
Benmerah, A., Scott, M., Poupon, V., Marullo, S., 2003. Nuclear functions for plasmamembrane-associated proteins? Traffic 4, 503–511.
Bennett, M.K., Calakos, N., Scheller, R.H., 1992. Syntaxin: a synaptic protein implicated indocking of synaptic vesicles at presynaptic active zones. Science 257, 255–259.
Behrens, J., et al., 1996. Functional interaction of beta-catenin with the transcriptionfactor LEF-1. Nature 382, 638–642.
Besteiro, S., Coombs, G.H., Mottram, J.C., 2006. The SNARE protein family of Leishmaniamajor. BMC Genomics 7, 250.
Bogdanov, V.Y., Balasubramanian, V., Hathcock, J., Vele, O., Lieb, M., Nemerson, Y., 2003.Alternatively spliced human tissue factor: a circulating, soluble, thrombogenicprotein. Nature Med. 9, 458–462.
Burgess, R.W., Deitcher, D.L., Schwarz, T.L., 1997. The synaptic protein syntaxin1 isrequired for cellularization of Drosophila embryos. J. Cell. Biol. 138, 861–875.
Cobbold, C., Monaco, A.P., Sivaprasadarao, A., Ponnambalam, S., 2003. Aberranttrafficking of transmembrane proteins in human disease. Trends Cell Biol. 13,639–647.
Conner, S.D., Wessel, G.M., 1999. Syntaxin is required for cell division. Mol. Biol. Cell 10,2735–2743.
Dono, R., James, D., Zeller, R., 1998. A GR-motif functions in nuclear accumulation of thelarge FGF-2 isoforms and interferes with mitogenic signalling. Oncogene 16,2151–2158.
Doxsey, S., McCollum, D., Theurkauf, W., 2005. Centrosomes in cellular regulation.Annu. Rev. Cell Dev. Biol. 21, 411–434.
Etienne, M.C., et al., 1998. Epidermal growth factor receptor and labeling index areindependent prognostic factors in glial tumor outcome. Clin. Cancer Res. 4,2383–2390.
Faustino, N.A., Cooper, T.A., 2003. Pre-mRNA splicing and human disease. Genes Dev. 17,419–437.
Felsenstein, J., 1992. Estimating effective population size from samples of sequences: abootstrap Monte Carlo integration method. Genet. Res. 60, 209–220.
Francesconi, A., Duvoisin, R.M., 2002. Alternative splicing unmasks dendritic andaxonal targeting signals in metabotropic glutamate receptor 1. J. Neurosci. 22,2196–2205.
Fukuda, M., Mikoshiba, K., 1999. A novel alternatively spliced variant of synaptotagminVI lacking a transmembrane domain. Implications for distinct functions of the twoisoforms. J. Biol. Chem. 274, 31428–31434.
Galante, P.A., Sakabe, N.J., Kirschbaum-Slager, N., de Souza, S.J., 2004. Detection andevaluation of intron retention events in the human transcriptome. RNA 10,757–765.
Garcia, C.C., et al., 2004. Identification of a mutation in synapsin I, a synaptic vesicleprotein, in a family with epilepsy. J. Med. Genet. 41, 183–186.
Hanover, J.A., 1992. The nuclear pore: at the crossroads. FASEB J. 6, 2288–2295.Hui, N., Nakamura, N., Sonnichsen, B., Shima, D.T., Nilsson, T., Warren, G., 1997. An
isoform of the Golgi t-SNARE, syntaxin 5, with an endoplasmic reticulum retrievalsignal. Mol. Biol. Cell 8, 1777–1787.
Hyman, J., Chen, H., Di Fiore, P.P., De Camilli, P., Brunger, A.T., 2000. Epsin 1 undergoesnucleocytosolic shuttling and its eps15 interactor NH(2)-terminal homology (ENTH)domain, structurally similar to Armadillo and HEAT repeats, interacts with thetranscription factor promyelocytic leukemia Zn(2)+ finger protein (PLZF). J. Cell Biol.149, 537–546.
Ibaraki, K., et al., 1995. Identification of four different forms of syntaxin 3. Biochem.Biophys. Res. Commun. 211, 997–1005.
Igarashi, M., Kozaki, S., Terakawa, S., Kawano, S., Ide, C., Komiya, Y., 1996. Growth conecollapse and inhibition of neurite growth by botulinum neurotoxin C1: a t-SNARE isinvolved in axonal growth. J. Cell Biol. 134, 205–215.
Jantsch-Plunger, V., Glotzer, M., 1999. Depletion of syntaxins in the early Caenorhabditiselegans embryo reveals a role for membrane fusion events in cytokinesis. Curr. Biol.9, 738–745.
Kalderon, D., Roberts, B.L., Richardson, W.D., Smith, A.E., 1984. A short amino acidsequence able to specify nuclear location. Cell 39, 499–509.
Kissmehl, R., et al., 2007. Molecular identification of 26 syntaxin genes and theirassignment to the different trafficking pathways in Paramecium. Traffic 8,523–542.
Mancini, M.A., He, D., Ouspenski, I.L., Brinkley, B.R., 1996. Dynamic continuity of nuclearand mitotic matrix proteins in the cell cycle. J. Cell. Biochem. 62, 158–164.
Modrek, B., Lee, C.A., 2002. A genomic view of alternative splicing. Nature Genet. 30,13–19.
Modrek, B., Lee, C.J., 2003. Alternative splicing in the human, mouse and rat genomes isassociated with an increased frequency of exon creation and/or loss. Nature Genet.34, 177–180.
Mukaetova-Ladinska, E.B., Hurt, J., Honer, W.G., Harrington, C.R., Wischik, C.M., 2002.Loss of synaptic but not cytoskeletal proteins in the cerebellum of chronicschizophrenics. Neurosci. Lett. 317, 161–165.
Müller, I., et al., 2003. Syntaxin specificity of cytokinesis in Arabidopsis. Nat. Cell Biol. 5,531–534.
Murthy, V.N., De Camilli, P., 2003. Cell biology of the presynaptic terminal. Annu. Rev.Neurosci. 26, 701–728.
Nakanishi, H., de los Santos, P., Neiman, A.M., 2004. Positive and negative regulation of aSNARE protein by control of intracellular localization. Mol. Biol. Cell 15, 1802–1815.
Nakayama, T., Mikoshiba, K., Yamamori, T., Akagawa, K., 2004. Activation of syntaxin 1C,an alternative splice variant of HPC-1/syntaxin 1A, by phorbol 12-myristate 13-acetate (PMA) suppresses glucose transport into astroglioma cells via the glucosetransporter-1 (GLUT-1). J. Biol. Chem. 279, 23728–23739.
Navarro, C.L., et al., 2005. Loss of ZMPSTE24 (FACE-1) causes autosomal recessiverestrictive dermopathy and accumulation of Lamin A precursors. Hum. Mol. Genet.14, 1503–1513.
Nix, D.A., Beckerle, M.C., 1997. Nuclear-cytoplasmic shuttling of the focal contactprotein, zyxin: a potential mechanism for communication between sites of celladhesion and the nucleus. J. Cell Biol. 138, 1139–1147.
Okada, M., Zhu, G., Yoshida, S., Kanai, K., Hirose, S., Kaneko, S., 2002. Exocytosismechanism as a new targeting site for mechanisms of action of antiepileptic drugs.Life Sci. 72, 465–473.
Olsnes, S., Klingenberg, O., Wiedlocha, A., 2003. Transport of exogenous growth factorsand cytokines to the cytosol and to the nucleus. Physiol. Rev. 83, 163–182.
Pollard, V.W., Michael, W.M., Nakielny, S., Siomi, M.C., Wang, F., Dreyfuss, G., 1996. Anovel receptor-mediated nuclear protein import pathway. Cell 86, 985–994.
Poupon, V., et al., 2002. Differential nucleocytoplasmic trafficking between the relatedendocytic proteins Eps15 and Eps15R. J. Biol. Chem. 277, 8941–8948.
Quinones, B., Riento, K., Olkkonen, V.M., Hardy, S., Bennett, M.K., 1999. Syntaxin 2 splicevariants exhibit differential expression patterns, biochemical properties andsubcellular localizations. J. Cell Sci. 112, 4291–4304.
Roll, P., et al., 2006. SRPX2 mutations in disorders of language cortex and cognition.Hum. Mol. Genet. 15, 1195–1207.
Saitou, N., Nei, M., 1987. The neighbor-joiningmethod: a newmethod for reconstructingphylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Schiavo, G., Matteoli, M., Montecucco, M.C., 2000. Neurotoxins affecting neuroexocy-tosis. Physiol. Rev. 80, 717–766.
171S. Pereira et al. / Gene 423 (2008) 160–171
Schirmer, E.C., Florens, L., Guan, T., Yates 3rd, J.R., Gerace, L., 2003. Nuclear membraneproteins with potential disease links found by subtractive proteomics. Science 301,1380–1382.
Selkoe, D., 2002. Alzheimer's disease is a synaptic failure. Science 298, 789–791.Shiraishi, T., Tabuchi, K., 2003. Genetic alterations of human brain tumors as molecular
prognostic factors. Neuropathology 23, 95–108.Simonsen, A., Bremnes, B., Ronning, E., Aasland, R., Stenmark, H., 1998. Syntaxin-16, a
putative Golgi t-SNARE. Eur. J. Cell Biol. 75, 223–231.Smirnova, T., Miniou, E., Viegas-Pequignot, J., Mallet, 1996. Assignment of the human
syntaxin 1B gene (STX) to chromosome 16p11.2 by fluorescence in situ hybridiza-tion. Genomics 36, 551–553.
Szepetowski, P., Rochette, J., Berquin, P., Piussan, C., Lathrop, G.M., Monaco, A.P., 1997.Familial infantile convulsions and paroxysmal choreoathetosis: a new neurologicalsyndrome linked to the pericentromeric region of human chromosome 16. Am. J.Hum. Genet. 61, 889–898.
Taddei, A., Hediger, F., Neumann, F.R., Gasser, S.M., 2004. The function of nucleararchitecture: a genetic approach. Annu. Rev. Genet. 38, 305–345.
Takizawa, C.G., Weis, K., Morgan, D.O., 1999. Ran-independent nuclear import of cyclinB1-Cdc2 by importin beta. Proc. Natl. Acad. Sci. U S A 96, 7938–7943.
Tang, B.L., Low, D.Y., Hong, W., 1998. Syntaxin 11: a member of the syntaxin familywithout a carboxyl terminal transmembrane domain. Biochem. Biophys. Res.Commun. 245, 627–632.
Teng, F.Y., Wang, Y., Tang, B.L., 2001. The syntaxins. Genome Biol. 2, 3012.1–3012.7.Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Ungar, D., Hughson, F.M., 2003. SNARE protein structure and function. Annu. Rev. CellDev. Biol. 19, 493–517.
Valdez, A.C., Cabaniols, J.P., Brown, M.J., Roche, P.A., 1999. Syntaxin 11 is associated withSNAP-23 on late endosomes and the trans-Golgi network. J. Cell Sci. 112, 845–854.
Van Swinderen, B., Saifee, O., Shebester, L., Roberson, R., Nonet, M.L., Crowder, C.M.,1999. A neomorphic syntaxin mutation blocks volatile-anesthetic action inCaenorhabditis elegans. Proc. Natl. Acad. Sci. USA 96, 2479–2484.
Weighardt, F., Biamonti, G., Riva, S.,1995. Nucleo-cytoplasmic distribution of human hnRNPproteins: a search for the targeting domains in hnRNP A1. J. Cell Sci. 108, 545–555.
Weimbs, T., Low, S.H., Chapin, S.J., Mostov, K.E., Bucher, P., Hofmann, K., 1997. Aconserved domain is present in different families of vesicular fusion proteins: a newsuperfamily. Proc. Natl. Acad. Sci. USA 94, 3046–3051.
Xu, H., Brill, J.A., Hsien, J., McBride, R., Boulianne, G.L., Trimble, W.S., 2002. Syntaxin 5 isrequired for cytokinesis and spermatid differentiation in Drosophila. Dev. Biol. 251,294–306.
Yoshida, A., Oho, C., Omori, A., Kuwahara, R., Ito, T., Takahashi, M., 1992. HPC-1 isassociated with synaptotagmin and omega-conotoxin receptor. J. Biol. Chem. 267,24925–24928.
Zhang, Q., Li, J., Deavers, M., Abbruzzese, J.L., Ho, L., 2005. The subcellular localization ofsyntaxin 17 varies among different cell types and is altered in somemalignant cells.J. Histochem. Cytochem. 53, 1371–1382.
Zink, D., Fischer, A.H., Nickerson, J.A., 2004. Nuclear structure in cancer cells. Nat. Rev.Cancer 4, 677–687.
Zur Stadt, U., et al., 2005. Linkage of familial hemophagocytic lymphohistiocytosis (FHL)type-4 to chromosome 6q24 and identification of mutations in syntaxin 11. Hum.Mol. Genet. 14, 827–834.
