HUMANMUTATION 29(10),1237^1246,2008

RESEARCH ARTICLE

Mutational Spectrum of the Oral-Facial-DigitalType I Syndrome: A Study on a Large Collectionof Patients

Clelia Prattichizzo,1 Marina Macca,1,2 Valeria Novelli,1 Giovanna Giorgio,1 Adriano Barra,1

and Brunella Franco,1,2� the Oral-Facial-Digital Type I (OFDI) Collaborative Group1Telethon Institute of Genetics and Medicine (TIGEM), Naples, Italy; 2Department of Pediatrics, Medical Genetics Services, Federico IIUniversity of Naples, Naples, Italy

Communicated by Iain McIntosh

Oral-facial-digital type I (OFDI) syndrome is a male-lethal X-linked dominant developmental disorderbelonging to the heterogeneous group of oral-facial-digital syndromes (OFDS). OFDI is characterized bymalformations of the face, oral cavity, and digits. Central nervous system (CNS) abnormalities and cystic kidneydisease can also be part of this condition. This rare genetic disorder is due to mutations in the OFD1 gene thatencodes a centrosome/basal body protein necessary for primary cilium assembly and for left-right axisdetermination, thus ascribing OFDI to the growing number of disorders associated to ciliary dysfunction. Wenow report a mutation analysis study in a cohort of 100 unrelated affected individuals collected worldwide.Putative disease-causing mutations were identified in 81 patients (81%). We describe 67 different mutations, 64of which represent novel mutations, including 36 frameshift, nine missense, 11 splice-site, and 11 nonsensemutations. Most of them concentrate in exons 3, 8, 9, 12, 13, and 16, suggesting that these exons may representmutational hotspots. Phenotypic characterization of the patients provided a better definition of the clinicalfeatures of OFDI syndrome. Our results indicate that renal cystic disease is present in 60% of cases 418 yearsof age. Genotype-phenotype correlation did not reveal significant associations apart for the high-arched/cleftpalate most frequently associated to missense and splice-site mutations. Our results contribute to furtherexpand our knowledge on the molecular basis of OFDI syndrome. Hum Mutat 29(10), 1237–1246, 2008.rr 2008 Wiley-Liss, Inc.

KEY WORDS: OFDI; OFD1; primary ciliary dysfunction; X-linked dominant male lethal; mutation analysis

INTRODUCTION

Oral-facial-digital type I (OFDI; MIM] 311200) syndrome wasreported by Papillon-Leage and Psaume [1954] and further definedby Gorlin and Psaume [1962]. It belongs to the heterogeneousgroup of developmental disorders known as oral-facial-digitalsyndromes (OFDS) [Toriello, 1993; Gurrier, et al., 2007]. OFDIhas an estimated incidence of 1:50,000 live births [Wahrmanet al., 1966] and it has been described in different ethnicbackgrounds [Salinas et al., 1991]. This syndrome is transmitted asan X-linked dominant condition with embryonic male lethality,which usually occurs in the first and/or second trimester ofpregnancy [Doege et al., 1964; Wettke Schafer and Kantner,1983]. However, 75% of the cases are apparently sporadic. Only afew exceptional OFDI male cases have been described to date: apatient with Klinefelter syndrome [Wahrman et al., 1966]; a 34-week live born male (who, however, developed cardiac failure anddied 21 hr after delivery) from a family displaying a clear X-linkeddominant inheritance of the disease [Goodship et al., 1991]; and anewborn male born at term who died 4 hr after birth with signs ofOFDI, including cystic kidneys, although a different ciliopathycannot be excluded [Gillerot et al., 1993].

OFDI, similar to all other OFDS, is characterized by malforma-tions of the face, oral cavity, and digits, with a high degree of

phenotypic variability. The central nervous system (CNS) isfrequently involved. These clinical features overlap with thosereported in the other forms of OFDS [Toriello, 1993, Gurrieriet al., 2007]; although, among these, OFDI can be easilydistinguished for the X-linked dominant inheritance pattern andfor the presence of cystic kidneys that is specific to OFDI.

In recent years it has become evident that cystic kidney diseaseis commonly associated with this disorder [Connacher et al.,1987]. The renal impairment can be present at birth or develop

Published online 10 June 2008 in Wiley InterScience (www.interscience.wiley.com).

DOI10.1002/humu.20792

The Supplementary Material referred to in this article can beaccessed at http://www.interscience.wiley.com/jpages/1059-7794/suppmat.

Received 13 December 2007; accepted revised manuscript 25February 2008.

Grant sponsor: ItalianTelethon Foundation.Clelia Prattichizzo, Marina Macca, and Valeria Novelli contributed

equally to this work.

�Correspondence to: Dr. Brunella Franco, Telethon Institute ofGenetics, and Medicine (TIGEM), Via Pietro Castellino 111, 80131Naples, Italy. E-mail: franco@tigem.it

rr 2008 WILEY-LISS, INC.

later on, with reports of patients in which the renal involvementcompletely dominates the clinical course of the disease [Coll et al.,1997; Feather et al., 1997a]. Phenotypic variability is often seen inaffected females even within the same family [Feather et al.,1997b; Salinas et al., 1991; Toriello, 1988], possibly due to thedifferent degrees of somatic mosaicism resulting from random Xinactivation [Thauvin-Robinet et al., 2006].

We demonstrated that OFDI is due to mutations in OFD1(MIM] 300170), previously known as 71-7A or Cxorf5 [Ferranteet al., 2001], which encodes a protein displaying five predictedcoiled-coil domains and a LIS1 homology (LisH) motif [deConciliis et al., 1998].

Previous studies have shown that OFD1 is a centrosomalprotein [Romio et al., 2003] and we and others have shown thatOFD1 is located at the basal bodies at the origin of primary cilia infully differentiated renal epithelial cells [Romio et al., 2004;Giorgio et al., 2007]. More recent data also revealed a nuclearlocalization for this protein [Giorgio et al., 2007].

We have generated a mouse model for OFDI syndrome thatreproduces the main features of the human condition, albeit withincreased severity, possibly due to differences of X-inactivationpatterns between human and mouse [Ferrante et al., 2003].Characterization of Ofd1 mutant animals revealed lack of cilia inthe embryonic node of mutant male embryos, which displayedfailure of left-right axis specification and defective cilia formationin cystic kidneys from heterozygous females, thus including OFDIin the growing number of disorders ascribed to primary ciliarydysfunction [Ferrante et al., 2006].

We now report an extensive mutation analysis study in a cohortof 100 unrelated patients collected worldwide. Our results expandthe knowledge on the molecular basis of OFDI and allow a betterdefinition of the clinical features observed in OFDI syndrome witha consequential improvement of the clinical management of thesepatients.

MATERIALSANDMETHODSCollection of Patients

A cohort of 120 subjects (100 probands and 20 affectedrelatives) clinically diagnosed with OFDI syndrome was collectedthrough an international collaborative effort. All patients wereassessed by one or more clinical dysmorphologists at clinicalgenetics centers worldwide and referred to our laboratory formutation analysis of the OFD1 gene. DNA or peripheral bloodsamples were accompanied by clinical data and informed consentand ethical approval was obtained by the universities and researchinstitutes involved in this study.

Mutation Analysis

Primers and conditions used for mutation analysis are as describedand are available upon request [Ferrante et al., 2001]. PCRs werecarried out on genomic DNA extracted from peripheral bloodleukocytes using the Generation Capture Column Kit (GentraSystems, Inc., Minneapolis, MN). PCR products from patients andnormal controls were checked on agarose gel and then analyzed bydenaturing high-performance liquid chromatography (DHPLC) usingthe Wave DNA fragment analysis system (Transgenomic, Inc.,Omaha, NE) according to the manufacturer’s instructions. Themelting characteristics of each PCR fragment for DHPLC analysiswere predicted using the Navigator software from Transgenomics.Abnormally-migrating fragments were then sequenced on bothstrands using the ABI Prism BigDye Terminator v3.1 CycleSequencing Kit (Applied Biosystems, Foster City, CA) and an ABI

377 automated DNA sequencer (Applied Biosystems, Foster City,CA). The resulting sequences were aligned and compared with thoseavailable in public databases (GenBank NM_003611.1). Asreference, the A of the ATG translation initiation codon of thecoding sequence of OFD1 is referred to as nucleotide 11. Whennecessary, PCR amplification products were cloned using the TOPOTA cloning kit (Invitrogen Corporation, Carlsbad, CA), to separatethe mutant and wild-type alleles. For all missense and splicingmutations, 200 normal X chromosomes from ethnically-matchedindividuals were analyzed by DHPLC. For Case 35, RT-PCR wasperformed on RNA isolated from lymphoblasts to validate splice-sitemutations. Primers were designed to amplify the aberrant band incase of use of the aberrant splicing site (Int11: CAGCTTTTTCT-GAAAAAACAGCC; R3: TAACTGAGGCACTTAGGAGACAG).PCR products were separated on a 4% polyacrylamide gel, the DNAextracted and sequenced using Dye Terminator chemistry (AppliedBiosystems). Mutation description follows standard nomenclature[Antonarakis, 1998; den Dunnen and Paalman, 2003].

Genotype-Phenotype Correlation Study

Possible genotype-phenotype correlations between major clin-ical features, type, and position of mutations were assessed usingcontingency table analysis. The analysis for each phenotypicparameter was performed separately. The resulting data wereanalyzed by Fisher’s exact test to overcome the problem of smallsample sizes. To increase the potency of the statistical analysis, wecombined the data obtained from the present study with thosecontained in published reports [Ferrante et al., 2001; Rakkolainenet al., 2002; Romio et al., 2003; Thauvin-Robinet et al., 2006].

Bioinformatic Resources

Sequence variant descriptions were checked using the Mutalyzerprogram (www.LOVD.nl/mutalyzer) [Wildeman et al., 2008].Nucleotide changes affecting splice donor/acceptor sites and flankingsequences were tested with the splice site prediction software atwww.fruitfly.org/seq_tools/splice.html. Nucleotide changes were ver-ified on the University of California Santa Cruz (UCSC) GenomeBrowser website (http://genome.ucsc.edu/cgi-bin/hgGateway) and atthe single-nucleotide polymorphism database at the NCBI (www.ncbi.nlm.nih.gov/projects/SNP). Alignment of sequences in differentspecies was performed using the ClustalW multiple sequencealignment program (version 1.83) provided by the EuropeanMolecular Biology Laboratory–European Bioinformatics Institute(EMBL-EBI) (www.ebi.ac.uk/Tools/clustalw/index.html).

RESULTSPatient’s Collection

Our cohort of cases consisted of 120 individuals (100 unrelatedaffected individuals and 20 affected relatives) clinically diagnosedwith OFDI syndrome, including 80 sporadic (80%) and 20 familial(20%) index cases. Informed consent was obtained from all thepatients analyzed and the research presented in this work wasprospectively reviewed and approved by a duly constituted ethicscommittee. Most of the probands come from Europe (65%) andNorth America (21%), the remaining from Australia (6%), theMiddle East (5%), and Asia (3%). The majority of cases (69%) areyounger than 18 years.

Spectrum of Mutations Detected in OFDI Patients

Mutation analysis was performed by DHPLC analysis for thecoding exons 1 to 23, the alternative exon 10a [de Conciliis et al.,1998], and the intron-exon junctions of the OFD1 transcript. The

1238 HUMANMUTATION 29(10),1237^1246,2008

entire coding region was analyzed and all samples displayingabnormal migration profiles were sequenced bidirectionally.

Putative disease-causing mutations were identified in 81patients out of the 100 index cases (81%), including 19 familial(23.5%) and 62 (76.5%) sporadic cases. A total of 67 differentmutations, 64 of which were novel, were identified, comprising 36frameshift (53.7%), nine missense (13.4%), 11 splice-site (16.4%),and 11 nonsense mutations (16.4%). Table 1 summarizes all themutations identified in this study. Few nucleotide changes wereobserved also in controls and correspond to neutral polymorphisms(Supplementary Table S1; available online at http://www.interscience.wiley.com/jpages/1059-7794/suppmat).

To investigate the possible pathogenetic effect of missensemutations, we evaluated the degree of conservation of the alteredamino acids during evolution. As shown in Figure 1A, this analysisrevealed that most of the affected amino acids were highlyconserved among different species (p.N75, p.H81, p.Y87, p.S92,and p.E97) and the corresponding nucleotide changes result in thesubstitution with amino acids with different features. Thus, allmissense mutations are likely to result in a dramatic change in thestructure of the protein. Interestingly, most of the missensemutations fall within the Lis-H domain in the N-terminal partof the protein, which is highly conserved throughout evolution(Fig. 1A). This domain is shared by several proteins and Figure 1Bshows an alignment of a subset of these proteins and the positionof the missense mutations within the LisH domain.

All splice-site mutations were analyzed for the possiblegeneration of alternative splice sites using bioinformatics predic-tion tools. This analysis showed the presence of several crypticsplice donor/acceptor sites (data not shown). For Case 35, RT-PCRexperiments were performed and demonstrated the presence of anaberrant band. Sequence analysis demonstrated the presence of analternatively spliced transcript due to a 4-bp deletion of intron 11(c.1130-20_1130-17delAATT) with the generation of a novelsplice site 13 bp upstream from the normal one (data not shown).

Mutations in the OFD1 transcript are located in 14 differentexons with the majority of the mutations occurring in exons 3(16.4%), 9 (8.9%), and 13 (10.4%). If we also consider mutationsidentified in more than one case, the mutations most frequentlyfound are c.710dupA and c.1193_1196delAATC, whichwere identified in 7 out of 81 and 4 out of 81 patients, respectively(Table 1). Intriguingly, no mutations were identified beyondexon 16.

For 53 out of the 100 cases analyzed parental samples wereavailable. Analysis of parental samples demonstrated that 41 cases(77.4%) are de novo mutations (Table 1).

Mutations are distributed along the entire length of the proteinup to exon 16. A schematic representation of all the mutationsreported in this work and those already described [Ferrante et al.,2001; Rakkolainen et al., 2002; Romio et al., 2003; Thauvin-Robinet et al., 2006] is reported in Figure 2.

Spectrum of the Clinical Signs Observed in OFDIPatients

All patients included in this study have been previouslydiagnosed with OFDI syndrome by clinical geneticists throughoutthe world and referred to us for molecular diagnosis.

They all show the typical oral, facial, and digital abnormalitiesreported for this genetic disorder (see the clinical featuressummarized in Table 2).

Within the 81 patients carrying a mutation in OFD1 gene, facialdysmorphism (frontal bossing, facial asymmetry, epicanthus,

hypertelorism/telecanthus, downslanting palpebral fissures, broadnasal bridge, flattened nasal tip, hypoplasia of the nasal alae,abnormal ears, flat midfacial region, and microretrognathia), is aprominent feature (65.4%). A history of facial milia is reported in30.9% of cases. Scalp abnormalities with sparse/dry/brittle/coarsehair and/or areas of alopecia are also common (24.7%). Tongueanomalies (bifid/lobulated tongue, tongue lump(s)/hamartoma(s)/lipoma(s) and ankyloglossia) are present in 90.1%. Hyperplasticoral frenula (65.4%) are often associated with notching of thealveolar ridge (23.5%), cleft palate and/or high arched palate(48.1%), and abnormal teeth (42%), including missing/super-numerary teeth, malposition of teeth, and enamel hypoplasia, arealso a consistent finding. Cleft lip/pseudocleft of the upper lip wasfound in 22.2% of cases.

Limb abnormalities are present in 90.1% of cases (Table 3).Forelimbs (87.7%) are more frequently affected than the hindlimbs(40.7%), with predominant brachydactyly (54.3%). Other handmalformations are clinodactyly of the V finger (44.4%), completeor partial syndactyly of fingers (38.3%), ulnar/radial deviation offingers (9.9%), broad thumb(s) (2.5%), duplicated/bifid thumb(preaxial polydactyly of hands) (4.9%), and postaxial polydactylyof hands (2.5%). Metacarpal shortening was reported in one case(1.2%). Hindlimb anomalies include brachydactyly (11.1%),syndactyly (14.8%), hallucal anomalies—mainly represented byunilateral duplicated/bifid hallux—(9.9%), mesoaxial polydactylyreported in 1/81 patients (1.2%), and metatarsal shortening andclinodactyly described in one case each (1.2%). Figure 3 illustratessome of the typical oral-facial-digital findings observed in OFDIpatients. Short stature is present in 7.4% of cases.

The presence of cystic kidney disease was demonstrated througha renal scan in 24 out of 81 cases (29.6%). However, it should benoted that only 40 out of 81 patients had a renal scan performed.As illustrated in Table 1, if we analyze these results by dividing ourcohort of patients in those of age o18 years and those of age Z18years, it becomes evident that 60% of patients of the latter groupdisplay cystic kidney.

CNS involvement (i.e., mental retardation [MR]/selectivecognitive impairment and/or CNS malformations) is reported in39 out of 81 cases (448%).

Additional findings are reported in Table 4 and include hearingproblems (conductive/sensorineural/central hearing loss) in 7.4%of cases; pancreatic, hepatic, and/or ovarian cysts in 4 out of 81cases; and retinal atrophy/thin optic nerves in 2 out of 81 cases.

Genotype-Phenotype Correlation

Genotype-phenotype correlation was performed and our dataindicate a significant association between high arched/cleft palateand missense and splice-site mutations (P 5 0.0389). Cleft lip wasassociated with mutations located in exon 3 (P 5 0.0688) whiletongue anomalies were more frequent in patients showing amutation in exon 12 (P 5 0.0611). Renal cystic disease appearedto be linked to mutations located in exons 9 and 12 (P 5 0.0672).No correlation was noted between the clinical features observed inOFDI cases and any protein domain.

DISCUSSION

We describe a cohort of 100 unrelated subjects with a clinicaldiagnosis of OFDI, a developmental syndrome due to ciliarydysfunction.

Mutation analysis led to the identification of putativepathogenic mutations in 81 out of 100 patients with a mutation-detection rate of 81%, which is higher than previously reported

HUMAN MUTATION 29(10),1237^1246,2008 1239

TABLE 1. Summary of Mutations Identi¢ed in the Present Study�

Exon/intron Nucleotide change Type of mutation Predicted protein Case Mutation origin Patient (ID no.)

Exon 2 c.43_44delAG Frameshift p.Q16RfsX17 Sporadic De novo 134c.65dupA Frameshift p.L23AfsX28 Sporadic De novo 81c.111G4A Splice site Sporadic De novo 100c.111G4C Splice site Sporadic De novo 101

Intron 2 c.11112T4C Splice site Sporadic De novo 53Exon 3 c.121C4T Nonsense p.R41X Familial Possiblemosaicism 10a

c.162_166delTGGAG Frameshift p.S54RfsX73 Familial NA 121c.221C4T Missense p.S74F Sporadic De novo 17a

c.224A4C Missense p.N75T Sporadic NA 94c.241C4G Missense p.H81D Sporadic De novo 74c.243C4G Missense p.H81Q Sporadic De novo 28c.247C4T Nonsense p.Q83X Sporadic De novo 13c.260A4G Missense p.Y87C Familial NA 83c.274T4C Missense p.S92P Sporadic NA 111c.290A4G Missense p.E97G Sporadic De novo 39c.313dupG Frameshift p.V105GfsX116 Familial NA 38

Exon 4 c.337C4T Nonsense p.Q113X Familial Inherited 50c.372C4G Nonsense p.Y124X Sporadic De novo 65

Intron 4 c.382^3C4G Splice site Sporadic De novo 64c.382^2A4G Splice site Sporadic NA 133

Exon 5 c.400_403delGAAA Frameshift p.E134IfsX143 Sporadic NA 14Sporadic NA 118

c.411delA Frameshift p.G138VfsX144 Sporadic De novo 117Intron 5 c.41212delT Splice site Sporadic De novo 15Exon 6 c.431dupT Frameshift p.L144FfsX154 Sporadic NA 16

c.454C4T Nonsense p.Q152X Sporadic De novo 68Exon 7 c.594_598delAAAGC Frameshift p.L200X Familial Inherited 113

c.602delA Frameshift p.N201MfsX207 Sporadic De novo 69c.616_617delGA Frameshift p.E206NfsX222 Sporadic De novo 79c.628C4T Nonsense p.Q210X Sporadic De novo 135c.653delA Frameshift p.K218SfsX219 Familial NA 88

Intron 7 c.65412_65414delTA Splice site Sporadic NA 61Exon 8 c.709_710delAA Frameshift p.K237VfsX238 Sporadic De novo 89

c.710delA Frameshift p.K237SfsX242 Sporadic De novo 32Sporadic NA 110

c.710dupA Frameshift p.Y238VfsX239 Familial Possiblemosaicism 7Inherited

Familial De novo 21Sporadic Inherited 34Familial De novo 70Sporadic De novo 76Sporadic NA 95Familial 116

c.790dupG Frameshift p.E264GfsX269 Sporadic NA 11c.823C4T Nonsense p.Q275X Sporadic De novo 46

Exon 9 c.837_838delAA Frameshift p.K280RfsX307 Familial Inherited 6a

c.837_841del AAAAG Frameshift p.K280NfsX306 Sporadic NA 90c.839_840delAA Frameshift p.K280RfsX307 Sporadic De novo 98c.858delG Frameshift p.R286SfsX290 Sporadic NA 8c.871A4T Nonsense p.K291X Sporadic NA 43c.877_878delAT Frameshift p.M293GfsX307 Sporadic De novo 18

Familial Inherited 63Intron10 c.1051^2A4G Splice site Sporadic De novo 126Exon10a c.1056C4G Missense p.N352K Familial Inherited 25Exon11 c.1099C4T Nonsense p.R367X Sporadic De novo 140

c.1100G4A Missense p.R367Q Sporadic NA 30Intron11 c.1130-20_1130-17delAATT Splice site Familial Inherited 35Exon12 c.1178dupA Frameshift p.E394GfsX407 Sporadic NA 49

c.1185delA Frameshift p.E395DfsX400 Sporadic NA 114c.1193_1196del AATC Frameshift p.Q398LfsX400 Familial Inherited 41

Familial NA 55Sporadic De novo 91Sporadic NA 107

c.1220_122111del AGG Frameshift p.E407AfsX408 Sporadic NA 56Intron12 c.122111delG Splice site Sporadic De novo 138Exon13 c.1268_1272delAAAAC Frameshift p.Q423PfsX428 Sporadic De novo 20

Sporadic De novo 44c.1318delC Frameshift p.L440X Sporadic NA 33c.1319delT Frameshift p.L440QfsX469 Sporadic De novo 60c.1322_1326del AAGAA Frameshift p.K441RfsX450 Sporadic De novo 128c.1323_1326delAGAA Frameshift p.E442RfsX468 Sporadic NA 112c.1334_1335delTG Frameshift p.L445RfsX451 Sporadic De novo 124c.1358T4A Nonsense p.L453X Sporadic NA 77

Exon14 c.1420C4T Nonsense p.Q474X Sporadic De novo 51c.1445_1446delTT Frameshift p.F482SfsX495 Sporadic NA 45c.1452_1458delAGAACTA Frameshift p.K484NfsX491 Sporadic NA 27

Exon16 c.1979_1980delCT Frameshift p.S660CfsX699 Sporadic De novo 57Sporadic De novo 106

c.2044dupA Frameshift p.I682NfsX700 Familial Inherited 5c.2056delT Frameshift p.S686PfsX717 Sporadic De novo 37c.2176delC Frameshift p.R726AfsX516 Sporadic De novo 19

Intron16 c.2261-1G4T Splice site Sporadic De novo 82

�As reference, theA of theATG translation initiation start site of the coding sequence forOFD1 (Entrez nucleotide accession numberNM_003611) is referred to as nucleotide 11.aAlso described in Romio et al. [2003] and Ferrante et al. [2001].NA, not ascertained.

1240 HUMANMUTATION 29(10),1237^1246,2008

[Thauvin-Robinet et al., 2006]. Different factors that may accountfor the missed mutations include variations in sequence beyondthe immediate intron/exon boundaries and intragenic deletionsthat could not be identified due to the approach we used. Furtherquantitative approaches would help detect intronic mutations orlarge rearrangements and should thus complete the study.

OFDI shares some of the clinical features with the other form ofOFDS and it is also conceivable that some of the patients weanalyzed belong to the other forms of OFDS. The observation thatthe detection rate observed for familial cases is higher (95%) thanwhat observed for sporadic cases (77.5%) supports this possibility.

To date, a total of 28 different mutations have been reported[Ferrante et al., 2001; Rakkolainen et al., 2002; Romio et al.,2003; Thauvin-Robinet et al., 2006]. In this study we describefurther 64 mutations for a total of 92 different mutations describedfor this disorder. Most of them concentrate in exons 3, 8, 9, 12, 13,and 16, suggesting that these exons may represent mutationalhotspots. Interestingly, no mutations or polymorphisms were founddownstream of exon 17. This raises the question of the functionalimportance of this region, which is less conserved than the N-terminal part of the protein among vertebrates. It is noteworthythat a duplication of four nucleotides in exon 16 of the OFD1 gene

was recently identified in a novel X-linked recessive MR syndromecomprising macrocephaly and ciliary dysfunction [Budny et al.,2006].

The OFD1 protein displays five predicted coiled-coil domains[de Conciliis et al., 1998], which are important for protein-proteininteraction, and a LIS1 homology (LisH) motif possibly involved inmicrotubule regulation and cell migration in its N-terminal region[Emes and Ponting, 2001].

The vast majority of OFD1 mutations (81/92; 88%) concentratein the first half of the gene: most of them are frameshift, nonsense,and splice-site mutations predicted to result in prematurelytruncated protein if mRNA from the mutant allele is stable.Therefore, a loss-of-function mechanism is likely the cause of thedisease. Missense mutations concentrate within the LisH motif(8/13) and account for 8 out of the 10 mutations occurring in thisdomain. The structural disruption and the consequent functionalimpairment derived from amino acid substitution, together withthe high degree of evolutionary conservation of the domain,suggest an important functional role of LisH within the OFD1protein. This sequence motif has also been identified in theproducts of genes mutated in other human diseases, such as Miller-Dieker lissencephaly (MDLS), Treacher Collins syndrome (TCS),

FIGURE 1. A:Alignmentof theOFD1protein aminoacid (aa) sequence (aa1^399) betweenH. sapiens,M.musculus,X. tropicalis, andD. rerio at theN-terminal region.The position of missensemutations is indicated by arrowheads.The Lis-H domain at theN-terminalof the OFD1protein is boxed. Shading of aa follows the percentage of identity according to ClustalW. B: Multiple alignments of se-quences displaying a LisH motif (from Emes and Ponting [2001]).The position of missense mutations within the LisH motif is indi-cated by arrowheads. Involved aa have been displayed in bold. OFD1, protein product of the gene mutated in OFDI syndrome; LIS1,protein product of the gene mutated in MDLS;TBL1, protein product of the gene mutated in contiguous syndrome ocular albinismwith late OASD syndrome; NudF, LIS1 ortholog in A. nidulans; Ebi,TBL1 ortholog in D. melanogaster; treacle, protein product ofthe genemutated inTCS syndrome.

HUMANMUTATION 29(10),1237^1246,2008 1241

and contiguous ocular albinism with late-onset sensorineuraldeafness (OASD) syndrome [Emes and Ponting, 2001], allcharacterized by defective cell migration. It is temping to speculatethat abnormal cell migration/differentiation may underlie thespectrum of malformations (e.g., CNS abnormalities) observed inOFDI patients.

Intriguingly, 10 of the mutations described fall within a stretchof nine A at the 50 end of exon 8, suggesting the possibility thatDNA replication errors may be causing these mutations [Kroutilet al., 1996; Kunkel and Alexander, 1986].

As already reported in the literature, most of the cases collectedare sporadic and our study demonstrated that over 80% of casesare de novo mutations. In two of the familial cases the mutationcould not be detected from DNA extracted from peripheral bloodsamples of the affected mothers, suggesting the possibility thatmosaicism may occur in OFDI syndrome.

Experiments performed in somatic cell hybrids indicate thatOFD1 escapes X chromosome inactivation (XCI) in humans[Carrel and Willard, 2005; de Conciliis et al., 1998]. In affectedfemales, one normal copy seems to be insufficient to protect

TABLE 2. Clinical Features Observed inOFDI Patients

Clinical featuresGorlin et al.[2001] (%)

Published cases withmutations in % (n)a

Patients with mutation (thisstudy) in % (n)

Patients without mutation (thisstudy) in % (n)

CraniofacialAbnormal hair/alopecia 15^65 13.6 (6/44) 24.7 (20/81) 26.3 (5/19)Milia 10^35 25 (11/44) 30.9 (25/81) 26.3 (5/19)Facial dysmorphism 25^75 75 (33/44) 65.4 (53/81) 42.1 (8/19)Cleft lip/pseudocleft of the

upper lip35^45 52.3 (23/44) 22.2 (18/81) 15.8 (3/19)

OralTongue anomalies 75 72.7 (32/44) 90.1 (73/81) 73.7 (14/19)Oral frenula 75^80 63.6 (28/44) 65.4 (53/81) 68.4 (13/19)Alveolar ridge clefting 20 20.4 (9/44) 23.5 (19/81) 15.8 (3/19)Cleft palate/high arched

palate35^80 45.4 (20/44) 48.1 (39/81) 42.1 (8/19)

Teeth abnormalities 20^50 40.9 (18/44) 42 (34/81) 47.4 (9/19)SkeletalShort stature - 6.8 (3/44) 7.4 (6/81) -Limb anomalies 25^75 84.1 (37/44) 90.1 (73/81) 94.7 (18/19)

KidneysCystic kidney disease 15^50 43.2 (19/44)o18 years 16.1 (9/56) 15.4 (2/13)Z18 years 60 (15/25) 0/6

NeurologicCentral nervous system (CNS)

involvementb50 50 (22/44) 48.1 (39/81) 47.4 (9/19)

aDescribed in Ferrante et al. [2001], Rakkolainen et al. [2002], Romio et al. [2003], andThauvin-Robinet et al. [2006].bIncludesmental retardation (MR)/selective cognitive impairment and/or CNSmalformations.^, not described.

FIGURE 2. A: Schematic representation ofOFD1a gene. Exons are not drawn in scale. Above: novel mutations detected in the currentstudy. Below: mutations alreadydescribed [Ferrante et al.,2001; Rakkolainenet al.,2002; Romioet al.,2003;Thauvin-Robinet et al.,2006]. Square, frameshift mutation; triangle, splice-site mutation; cross, nonsense mutation; circle, missense mutation. B:The dia-gram shows the structure of OFD1a protein. Oval, LisH motif (LisH); Rectangles, coiled-coil domains (Cc). Protein domains havebeen placed below the corresponding exons.

1242 HUMAN MUTATION 29(10),1237^1246,2008

from the disorder, while normal males who have only one Xchromosome do not develop the features of the syndrome.One possible explanation could be a higher expression levelof the transcript of the single active X chromosome innormal males or, alternatively, selective XCI occurring in theaffected tissues during development. We also hypothesize thatthe evidence obtained in somatic cell hybrids demonstrating

that OFD1 escapes XCI might not reflect the situation of allother tissues, in which OFD1 might, at least partially, undergo XCI[Franco and Ballabio, 2006]. Skewed XCI due to either positive ornegative cell selection mechanisms and responsible for pheno-typic heterogeneity among females has also been demonstrated[Thauvin-Robinet et al., 2006] and (B.F., unpublished results).Another possible explanation for the inter- and intrafamilialvariability observed in OFDI patients could be ascribed tomodifier genes.

We investigated the presence of a possible genotype-phenotypecorrelation. A significant association between high arched/cleftpalate and missense and splice-site mutations was found. Cystickidney was more frequently associated with mutations occurring inexons 9 and 12. In a previous work, it has been postulated that theshorter isoform of the protein (OFD1b, terminating at thebeginning of exon 11) could be responsible for normal kidneygrowth [Romio et al., 2003]. Our data argue against thishypothesis. In addition, six of the patients analyzed displayingcystic kidneys show mutations occurring within or downstreamexon 11. Moreover, our results do not support the observation thatcystic kidney disease is more frequently associated with splicemutations compared with other mutations [Thauvin-Robinetet al., 2006]. However, it should be pointed out that the patients

TABLE 3. Summary of LimbAbnormalities Observed onOFDI Patients

Limb abnormalities Gorlin et al.[2001] (%)

Published cases with mutationin % (n)a

Patients with mutation (thisstudy) in % (n)

Patients without mutation (thisstudy)in % (n)

Forelimb 50^75 75 (33/44) 87.7 (71/81) 89.5 (17/19)Short hands/

brachydactyly^ 50 (22/44) 54.3 (44/81) 47.4 (9/19)

Clinodactyly ^ 31.8 (14/44) 44.4 (36/81) 31.6 (6/19)Ulnar/radial deviation ^ ^ 9.9 (8/81) 10.5 (2/19)Syndactyly ^ 31.8 (14/44) 38.3 (31/81) 36.8 (7/19)Broad thumb(s) ^ ^ 2.5 (2/81) ^Preaxial polydactyly 1^2 2.3 (1/44) 4.9 (4/81) 5.3 (1/19)Duplicated/bi¢d thumb ^ ^ 4.9 (4/81) ^Mesoaxial polydactyly ^ ^ ^ 5.3 (1/19)Postaxial polydactyly 1^2 2.3 (1/44) 2.5 (2/81) 10.5 (2/19)

Hindlimb 25 52.3 (23/44) 40.7 (33/81) 57.9 (11/19)Brachydactyly ^ 27.3 (12/44) 11.1 (9/81) 15.8 (3/19)Syndactyly ^ 6.8 (3/44) 14.8 (12/81) 21 (4/19)Hallux valgus/broad

hallux^ 2.3 (1/44) 6.2 (5/81) 15.8 (3/19)

Preaxial polydactyly ^ 13.6 (6/44) 17.3 (14/81) 15.8 (3/19)Unilateral duplicated/

bi¢d hallux25 9.1 (4/44) 9.9 (8/81) 5.3 (1/19)

Bilateral duplicated/bi¢d hallux

^ ^ 3.7 (3/81) 5.3 (1/19)

Mesoaxial polydactyly ^ ^ 1.2 (1/81) ^

aDescribed in Ferrante et al. [2001], Rakkolainen et al. [2002], Romio et al. [2003], andThauvin-Robinet et al. [2006].^, not described.

FIGURE 3. Examples of the oral-facial-digital ¢ndings observedinOFDI patients. A: Facial dysmorphisms. B:Cleft palate.C: Bi-¢d and lobulated tongue. Limb abnormalities are also a frequent¢nding and include brachydactyly and clinodactyly (D) and du-plication of the allux (E). [Color ¢gure can be viewed in the on-line issue,which is available at www.interscience.wiley.com.]

TABLE 4. Additional Findings Observed inOFDI Patients

Additional ¢ndings

Publishedcaseswith

mutationin % (n)a

Patientswith

mutation(this study)in % (n)

Patients withoutmutation(this study)

Hearingproblems

4.5 (2/44) 7.4 (6/81) ^

Cysts in otherorgans

4.5 (2/44) 4.9 (4/81) ^

Retinalatrophy/thin opticnerves

^ 2.5 (2/81) ^

aDescribed inFerranteet al. [2001], Rakkolainenet al. [2002], Romioet al. [2003], andThauvin-Robinet et al. [2006].^, not described.

HUMANMUTATION 29(10),1237^1246,2008 1243

described in this report were collected through a multicentricstudy and a bias in the clinical description of these patients cannotbe excluded.

The clinical abnormalities observed in our cohort of patients,which are summarized in Table 2, overlap with what has beendescribed in the literature [Gorlin et al., 2001; Gurrieri et al.,2007; Thauvin-Robinet et al., 2006]. The main differences arereferred to the incidence of cystic kidneys in this condition. Bycombining all the data available, the overall incidence of renalcysts in cases with mutation in the OFD1 gene is about 43%[Ferrante et al., 2001; Rakkolainen et al., 2002; Romio et al.,2003; Thauvin-Robinet et al., 2006]. Our results, combined withthose described in the literature, indicate that renal cystic diseaseis present in over 63% of adult cases (418 years), thus indicatingthat cystic kidney disease is more frequent than previouslyestimated after the second decade of life in this condition. It isnoteworthy that, in our cohort of patients, only 36% of cases o18years had performed a renal scan and 45% of these presented renalcysts. In particular, our group of patients included 10 cases r10years of age, and four of these were younger than 2 years of age.This observation is a strong indication for renal functionmonitoring from early stages in OFDI patients.

Some of the clinical features observed in OFDI patients overlapwith those reported in the other forms of OFDS. This raises thequestion of ‘‘transitional’’ OFD phenotypes defined by thepresence of findings that are considered specific of more thanone OFDS type and of the real number of different OFDS[Gurrieri et al., 2007].

Functional studies allowed us to demonstrate that OFDIsyndrome belongs to the growing number of ciliopathies [Ferranteet al., 2006], which range from organ-specific to broad, pleiotropicphenotypes such as the Bardet-Biedl, Alstrom, Joubert, Meckel-Gruber, and OFDI syndromes [Badano et al., 2006; Bisgrove andYost, 2006]. It is tempting to speculate that the other OFDS mightalso be included in this class of disorders as they show overlappingfeatures with the known ciliopathies, although none of the otherforms present renal cysts. Analysis of candidate genes encodingcomponents of the ciliary proteome will help addressing thisquestion.

Our results will contribute to a better understanding of themechanisms underlying OFDI syndrome with a consequentialimprovement of the clinical management of these patients.

APPENDIX

The OFDI collaborative group: F. Abdulla, Department ofPediatrics, Salmaniya Medical Center, Riyadh, Bahrain; M.Abramowicz, Medical Genetics Service, University of Bruxelles,Bruxelles, Belgium; S. Amy/I. Schafer, Cleveland Clinic Founda-tion, Cleveland, Ohio, USA; A. Bankier/S. White, RoyalChildren’s Hospital Genetics Clinic, Melbourne, Victoria, Aus-tralia; M.G. Barcina, Department of Medical Genetics, Hospital ofBasurto, Bilbao, Spain; L. E. Bartoshesky/K. Jenny, Departmentof Medical Genetics, A. duPont Hospital for Children, Wilming-ton, Delaware, USA; F.A. Beemer, Department of MedicalGenetics, University Medical Center, Utrecht, the Netherlands;P. Benke, Department of Pediatrics, Hollywood Memorial Hospital,Hollywood, Florida, USA; R.C. Betz, Institute of Human Genetics,‘‘Rheinische Friedrich-Wilhelms-Universitat’’, Bonn, Germany;G. Bianchini/L. Garavelli, Department of Pediatrics, ‘‘ArcispedaleS. Maria Nuova,’’ Reggio Emilia, Italy; S. Bigoni, Medical GeneticsUnit, ‘‘Arcispedale Sant’Anna’’, Ferrara, Italy; L. Bird/J. Chibuk/D.Masser-Frye, Department of Medical Genetics, University of

California, San Diego, California, USA; N. Brunetti/A. Scarcella,Department of Pediatrics – Clinical Genetics Unit and Neonatal-Perinatal Medicine Unit, ‘‘Federico II’’ University of Naples,Naples, Italy; H.G. Brunner, Department of Human Genetics,University Hospital Nijmegen, Nijmegen, the Netherlands;J. Burn, Institute of Human Genetics, International Centre forLife, Newcastle upon Tyne, UK; R. Carmi, Institute of HumanGenetics, Ben-Gurion University of the Negev, Beer-Sheva, Israel;C. Castellan, Clinical Genetics Unit, ‘‘Azienda Sanitaria Bolzano,’’Bolzano, Italy; P. Castelluccio, Medical Genetics Unit, ‘‘A.Cardarelli’’ Hospital, Naples, Italy; B. Castle, Wessex ClinicalGenetics Service, Southampton University Hospital Trust, South-ampton, UK; M.A. Chiong/E.M. Cutiongco, Institute of HumanGenetics, University of the Philippines, Manila, Philippines; F.Collins, Department of Clinical Genetics, The Children’s Hospitalat Westmead, Sydney, New South Wales, Australia; E. Couchon/A. Curry/M. Pastore, Human Genetics Department, Children’sHospital, Columbus, Ohio, USA; C. Curry/A. Swenerton/T.Treisman, Children’s Hospital Central California, Madera, Cali-fornia, USA; J. Dean, Department of Medical Genetics, NHSGrampian, Aberdeen, UK; K. Devriendt/G. Matthijs, Center forHuman Genetics, Leuven, Belgium; J.W. Dunlap/V. Shashi,Department of Pediatrics and Genetics, Wake Forest UniversitySchool of Medicine, Winston-Salem, North Carolina, USA;N. Elcioglu, Department of Pediatrics and Genetics, MarmaraUniversity Hospital, Istanbul, Turkey; P. Farndon, RegionalGenetics Service, Birmingham Women’s Hospital, Birmingham,UK; G.B. Ferrero, Department of Pediatrics – Clinical GeneticsUnit, University of Turin, Turin, Italy; R. Ferrier, Department ofMedical Genetics, University of Calgary, Calgary, Alberta, Canada;N. Foulds, Clinical Genetics Service, University Hospitals NHSTrust, Southampton, UK; J.M. Friedman, Department of MedicalGenetics, British Columbia’s Children’s Hospital, Vancouver,British Columbia, Canada; A. Gal/U. Orth, Institute of HumanGenetics, University Hospital Eppendorf, Hamburg, Germany; M.Gardner, Genetics Health Services, Royal Children’s Hospital,Melbourne, Victoria, Australia; O. Gerola, Neonatal-PerinatalMedicine, ‘‘Policlinico S. Matteo,’’ Pavia, Italy; G. Gillessen-Kaesbach, Institute of Human Genetics, UniversitatsklinikumEssen, Essen, Germany; F. Giuliano/C. Turc-Carel, MedicalGenetics Unit, Nice University Hospital, Nice, France; E. Godde,Department of Pediatrics, Witten/Herdecke University, Datteln,Germany; V. Graber, Department of Medical Genetics, Universityof Zurich, Zurich, Switzerland; G.E. Graham, Department ofClinical Genetics, Children’s Hospital of Eastern Ontario, Ottawa,Ontario, Canada; F. Gurrieri, Institute of Medical Genetics,‘‘Cattolica S.Cuore’’ University of Rome, Rome, Italy; L. Harbour,Department of Medical Genetics, Children’s & Women’s HealthCentre of British Columbia, Vancouver, British Columbia, Canada;A. Henderson/E. Jones, Institute of Human Genetics, Interna-tional Centre for Life, Newcastle upon Tyne, UK; H. Heran,Department of Medical Genetics, Children’s and Women’s HealthCenter of British Columbia, Vancouver, British Columbia, Canada;T. Homfray/R. Taylor, Medical Genetics Unit, St. George’sHospital Medical School, London, UK; E. Iwarsson, Departmentof Clinical Genetics, Karolinska University Hospital, Stockholm,Sweden; P. Jensen, Department of Clinical Genetics, UniversityHospital of Aarhus, Aarhus, Denmark; A. Jezela-Stanek, Depart-ment of Medical Genetics, Children’s Memorial Health Institute,Warsaw, Poland; S. Joss/G. Taylor, Clinical Genetics Service,St James’s University Hospital, Leeds, UK; S.L. Keeling, RoyalChildren’s Hospital Genetics Clinic, Melbourne, Victoria,Australia; R. Klatt/A. Teebi, Division of Clinical and Metabolic

1244 HUMAN MUTATION 29(10),1237^1246,2008

Genetics, The Hospital for Sick Children, Toronto, Ontario,Canada; M. Klehr-Martinelli, Prenatal Medicine - MolecularGenetics Laboratory, Munchen, Germany; D. Kotzot, Instituteof Human Genetics, University of Munich, Munich, Germany;M. Lees/S. Loughlin, Clinical Genetics Unit, Great Ormond StreetHospital for Children NHS Trust, London, UK; K. Lhotta,Department of Clinical Nephrology, Innsbruck University Hospi-tal, Innsbruck, Austria; F. Macdonald, Clinical Genetics, Birming-ham Women’s Hospital, Birmingham, UK; F. Mari/A. Renieri,Medical Genetics Unit, ‘‘Azienda Ospedaliera UniversitariaSenese,’’ Siena, Italy; S. Marlin, Department of Otorhinolaryn-goiatrics, ‘‘Hospital D’Enfants Armand Trousseau,’’ Paris, France;J. McGaughran/F. McKenzie, Queensland Clinical GeneticsService, Royal Children’s Hospital, Herston, Queensland,Australia; D.R. McLeod, Department of Medical Genetics, AlbertaChildren’s Hospital, Calgary, Alberta, Canada; A. Megarbane,Medical Genetics Unit, Saint-Loseph University, Beirut, Lebanon;C.R. Mota, ‘‘D. Jacinto de Magalhaes’’ Institute of MedicalGenetics, Porto, Portugal; J. Mucke/A. Tzschach, Department ofHuman Genetics, Children’s Hospital St. Ingbert, St. Ingbert,Germany; E. Obersztyn, Department.of Genetics, NationalInstitute of Mother and Child, Warsaw, Poland; R. Okhowat/A.Shinzel, Department of Medical Genetics, University of Zurich,Zurich, Switzerland; R. Pfau, Cleft Palate Clinic, The Children’sMedical Center, Dayton, Ohio, USA; B. Pober, Medical GeneticsService, Yale University, New Haven, Connecticut, USA; F.L.Raymond, Medical Genetics Service, Addenbrooke’s Hospital,Cambridge, UK; E. Reich, Department of Pediatrics, New YorkUniversity School of Medicine, New York, New York, USA;T. Reimschisel, Department of Pediatrics, Washington Universityin St. Louis, St Louis, Missouri, USA; J. Robertson, Department ofMedical Genetics, Henry Ford Hospital, Detroit, Michigan, USA;J. Roggenbuck, Department of Clinical Genetics, Children’sHospital of Minnesota, Minneapolis, Minnesota, USA; A. Sabato,Nephrology Unit, ‘‘Borgo Roma’’ Hospital, University of Verona,Verona, Italy; J. Sanchez Del Pozo, Department of MedicalGenetics, University Hospital, Madrid, Spain; C. Schell-Apacik,Medical Genetics Unit, Children’s Center Munich, Munich,Germany; E. Schwaab, Wiesbaden, Germany; A. Selicorni, ChildMedical Genetics, "I Clinica Pediatrica G. e D. De Marchi" -University of Milan, Milan, Italy; S. Sell, Department of Pediatrics,Hershey Medical Center, Hershey, Pennsylvania, USA;S. Smithson, Clinical Genetics Service, St. Michael’s Hospital,Bristol, UK; A. Stray-Pedersen, Department of Medical Genetics,Rikshospitalet, Oslo, Norway; T. Tan, Royal Children’s HospitalGenetics Clinic, Parkville, Victoria, Australia; H. Thiese, Depart-ment of Genetics, Group Health Cooperative, Seattle, Washing-ton, USA; J. Tol, Human Genetics Clinic, University ofRotterdam, Rotterdam, Netherlands; O. Toprak, Department ofNephrology, Ataturk Research and Training Hospital, Izmir,Turkey; D. Trump, Medical Genetics Department, Addenbrooke’sHospital, Cambridge, UK; J. Whittaker, Medical Genetics Service,Addenbooke’s Hospital, Cambridge, UK; D. Williams, ClinicalGenetics Unit, Birmingham Women’s Hospital, Birmingham, UK;L. Zelante, ‘‘Casa Sollievo della Sofferenza,’’ S. Giovanni Rotondo(FG), Italy; B. Zoll, Institute of Human Genetics, Georg-AugustUniversity, Goettingen, Germany.

ACKNOWLEDGMENTS

We thank all the patients participating to this study and theirfamilies. We acknowledge the Telethon Mutation Detectionfacility for technical assistance and Dr. Luisa Cutillo and the

Bioinformatic Core at TIGEM for assistance in statistical analysis.This work was supported by the Italian Telethon Foundation (toB.F.). A list of all clinicians who contributed patients to this studyis reported in the Appendix.

REFERENCES

Antonarakis SE. 1998. Recommendations for a nomenclature system for

human gene mutations. Nomenclature Working Group. Hum Mutat

11:1–3.

Badano JL, Mitsuma N, Beales PL, Katsanis N. 2006. The ciliopathies: an

emerging class of human genetic disorders. Annu Rev Genomics Hum

Genet 7:1228–1230.

Bisgrove BW, Yost HJ. 2006. The roles of cilia in developmental disorders

and disease. Development 133:4131–4143.

Budny B, Chen W, Omran H, Fliegauf M, Tzschach A, Wisniewska M,

Jensen LR, Raynaud M, Shoichet SA, Badura M, Lenzner S, Latos-

Bielenska A, Ropers HH. 2006. A novel X-linked recessive mental

retardation syndrome comprising macrocephaly and ciliary dysfunction is

allelic to oral-facial-digital type I syndrome. Hum Genet 120:171–178.

Carrel L, Willard HF. 2005. X-inactivation profile reveals extensive

variability in X-linked gene expression in females. Nature 434:400–404.

Coll E, Torra R, Pascual J, Botey A, Ara J, Perez L, Ballesta F, Darnell A.

1997. Sporadic orofaciodigital syndrome type 1 presenting as end-stage

renal disease. Nephrol Dial Transplant 12:1040–1042.

Connacher AA, Forsyth CC, Stewart WK. 1987. Orofaciodigital syndrome

type 1 associated with polycystic kidneys and agenesis of the corpus

callosum. J Med Genet 24:116–118.

de Conciliis L, Marchitiello A, Wapenaar MC, Borsani G, Giglio S, Mariani

M, Consalez GG, Zuffardi O, Franco B, Ballabio A, Banfi S. 1998.

Characterization of Cxorf5 (71-7A), a novel human cDNA mapping to

Xp22 and encoding a protein containing coiled-coil a-helical domains.

Genomics 51:243–250.

den Dunnen JT, Paalman MH. 2003. Standardizing mutation nomencla-

ture: why bother? Hum Mutat 22:181–182.

Doege T, Thuline H, Priest J, Norby D, Bryant J. 1964. Studies of a family

with the oral-facial-digital syndrome. N Engl J Med 271:1073–1080.

Emes RD, Ponting CP. 2001. A new sequence motif linking lissencephaly,

Treacher Collins and oral- facial-digital type 1 syndromes, microtubule

dynamics and cell migration. Hum Mol Genet 10:2813–2820.

Feather SA, Winyard PJ, Dodd S, Woolf AS. 1997a. Oral-facial-digital

syndrome type 1 is another dominant polycystic kidney disease: clinical,

radiological and histopathological features of a new kindred. Nephrol

Dial Transplant 12:1354–1361.

Feather SA, Woolf AS, Donnai D, Malcolm S, Winter RM. 1997b. The

oral-facial-digital syndrome type 1 (OFD1), a cause of polycystic kidney

disease and associated malformations, maps to Xp22.2-Xp22.3. Hum

Mol Genet 6:1163–1167.

Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M,

Selicorni A, Gammaro L, Scolari F, Woolf AS, Odent S, Le Marec B,

Malcolm S, Winter, R, Ballabio A, Franco B. 2001. Identification of the

gene for oral-facial-digital type I syndrome. Am J Hum Genet

68:569–576.

Ferrante MI, Barra A, Truong JP, Disteche CM, Banfi S, Franco B. 2003.

Characterization of the OFD1/Ofd1 genes on the human and mouse sex

chromosomes and exclusion of Ofd1 for the Xpl mouse mutant.

Genomics 81:560–569.

Ferrante MI, Zullo A, Barra A, Bimonte S, Messaddeq N, Studer M, Dolle

P, Franco B. 2006. Oral-facial-digital type I protein is required for primary

cilia formation and left-right axis specification. Nat Genet 38:112–117.

Franco B, Ballabio A. 2006. X-inactivation and human disease: X-linked

dominant male-lethal disorders. Curr Opin Genet Dev 16:254–259.

Gillerot Y, Heimann M, Fourneau C, Verellen-Dumoulin C, Van

Maldergem L. 1993. Oral-facial-digital syndrome type I in a newborn

male. Am J Med Genet 46:335–338.

Giorgio G, Alfieri M, Prattichizzo C, Zullo A, Cairo S, Franco B. 2007.

Functional characterization of the OFD1 protein reveals a nuclear

localization and physical interaction with subunits of a chromatin

remodeling complex. Mol Biol Cell 18:4397–4404.

HUMANMUTATION 29(10),1237^1246,2008 1245

Goodship J, Platt J, Smith R, Burn J. 1991. A male with type I

orofaciodigital syndrome. J Med Genet 28:691–694.

Gorlin RJ, Psaume J. 1962. Orofaciodigital dysotosis: a new syndrome.

A study of 22 cases. J Pediatr 61:520–530.

Gorlin RJ, Cohen Jr MM, Hennekam RCM. 2001. Oral-facial-digital

syndromes. Syndromes of the head and neck. New York: Oxford

University Press. p 832–843.

Gurrieri F, Franco B, Toriello H, Neri G. 2007. Oral -facial-digital syndromes:

a review and diagnostic guidelines. Am J Med Genet 143A:3314–3323.

Kroutil LC, Register K, Bebenek K, Kunkel TA. 1996. Exonucleolytic

proofreading during replication of repetitive DNA. Biochemistry

35:1046–1053.

Kunkel TA, Alexander PS. 1986. The base substitution fidelity of

eucaryotic DNA polymerases. Mispairing frequencies, site preferences,

insertion preferences, and base substitution by dislocation. J Biol Chem

261:160–166.

Papillon-Leage M, Psaume J. 1954. Une malformation hereditaire de la

muquese buccale: brides et freins anomaux. Revue Stomatol

55:209–227.

Rakkolainen A, Ala-Mello S, Kristo P, Orpana A, Jarvela I. 2002. Four

novel mutations in the OFD1 (Cxorf5) gene in Finnish patients with

oral-facial-digital syndrome 1. J Med Genet 39:292–296.

Romio L, Wright V, Price K, Winyard PJ, Donnai D, Porteous ME, Franco

B, Giorgio G, Malcolm S, Woolf AS, Feather SA. 2003. OFD1, the gene

mutated in oral-facial-digital syndrome type 1, is expressed in the

metanephros and in human embryonic renal mesenchymal cells. J Am

Soc Nephrol 14:680–689.

Romio L, Fry AM, Winyard PJ, Malcolm S, Woolf AS, Feather SA. 2004.

OFD1 is a centrosomal/basal body protein expressed during mesench-

ymal-epithelial transition in human nephrogenesis. J Am Soc Nephrol

15:2556–2568.

Salinas C, Pai G, Vera C, Milutinovich J, Hagerty R, Cooper J, Cagna D.

1991. Variability of expression of the orofaciodigital syndrome type 1 in

black females: six cases. Am J Med Genet 38:574–582.

Thauvin-Robinet C, Cossee M, Cormier-Daire V, Van Maldergem L,

Toutain A, Alembik Y, Bieth E, Layet V, Parent P, David A, Goldenberg

A, Mortier G, Heron D, Sagot P, Bouvier AM, Huet F, Cusin V, Donzel

A, Devys D, Teyssier JR, Faivre L. 2006. Clinical, molecular, and

genotype-phenotype correlation studies from 25 cases of oral-facial-

digital syndrome type 1: a French and Belgian collaborative study. J Med

Genet 43:54–61.

Toriello HV. 1988. Heterogeneity and variability in the oral-facial-digital

syndromes. Am J Med Genet Suppl 4:149–159.

Toriello HV. 1993. Oral-facial-digital syndromes, 1992. Clin Dysmorph

2:95–105.

Wahrman J, Berant M, Jacobs J, Aviad I, Ben-Hur N. 1966. The oral-facial-

digital syndrome: a male-lethal condition in a boy with 47/xxy

chromosomes. Pediatrics 37:812–821.

Wettke Schafer R, Kantner G. 1983. X-linked dominant inherited diseases

with lethality in hemizygous males. Hum Genet 64:1–23.

Wildeman M, van Ophuizen E, den Dunnen JT, Taschner PEM. 2008.

Improving sequence variant descriptions in mutation databases and

literature using the Mutalyzer sequence variation nomenclature checker.

Hum Mutat 29:6–13.

1246 HUMANMUTATION 29(10),1237^1246,2008