APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Lipoperoxidation affects ochratoxin A biosynthesisin Aspergillus ochraceus and its interaction with wheat seeds

Massimo Reverberi & Federico Punelli & Marzia Scarpari & Emanuela Camera &

Slaven Zjalic & Alessandra Ricelli & Corrado Fanelli & Anna Adele Fabbri

Received: 24 February 2009 /Revised: 25 August 2009 /Accepted: 25 August 2009 /Published online: 26 September 2009# Springer-Verlag 2009

Abstract In Aspergillus nidulans, Aspergillus flavus, andAspergillus parasiticus, lipoperoxidative signalling is cru-cial for the regulation of mycotoxin biosynthesis, conidio-genesis, and sclerotia formation. Resveratrol, which is alipoxygenase (LOX) and cyclooxygenase inhibitor, down-modulates the biosynthesis of ochratoxin A (OTA) inAspergillus ochraceus. In the genome of A. ochraceus, alox-like sequence (AoloxA; National Center for Biotech-nology Information (NCBI) accession number: DQ087531)for a lipoxygenase-like enzyme has been found, whichpresents high homology (100 identities, 100 positives %,score 555) with a lox gene of Aspergillus fumigatus (NCBIaccession number: XM741370). To study how inhibition ofoxylipins formation may affect the A. ochraceus metabo-lism, we have used a ΔAoloxA strain. This mutant displaysa different colony morphology, a delayed conidia forma-tion, and a high sclerotia production. When compared to thewild type, theΔAoloxA strain showed a lower basal activityof LOX and diminished levels of 13-hydroperoxylinoleicacid (HPODE) and other oxylipins derived from linoleic

acid. The limited oxylipins formation corresponded to aremarkable inhibition of OTA biosynthesis in the ΔAoloxAstrain. Also, wheat seeds (Triticum durum cv Ciccio)inoculated with the ΔAoloxA mutant did not accumulate9-HPODE, which is a crucial element in the host defencesystem. Similarly, the expression of the pathogenesis-related protein 1 (PR1) gene in wheat seeds was notenhanced. The results obtained contribute to the currentknowledge on the role of lipid peroxidation governed bythe AoloxA gene in the morphogenesis, OTA biosynthesis,and in host–pathogen interaction between wheat seeds andA. ochraceus.

Keywords Lipoperoxidation . Ochratoxin A .

Lipoxygenase .Wheat seeds

Introduction

Ochratoxin A (OTA) represents a severe health hazard forhumans and animals (WHO 2001) due to its toxicity andpotential carcinogenicity. Recently, the amount of OTA infood has been regulated by the Commission of theEuropean Communities (2006). Among the OTA producingfungi, Aspergillus ochraceus is a widespread coloniser ofdried foods such as nuts and cereals in temperate countries(Van der Merwe et al. 1965). A. ochraceus is a mitosporicascomycete which reproduces asexually by forming ochreconidia, and about 16% of the isolated strains are reportedto produce OTA (Pardo et al. 2004).

In mammals, the toxicity of OTA is due to interferencewith transfer RNA and inhibition of protein synthesis whichleads mainly to kidney malfunction and pathology (Cheeke1998; Creppy et al. 1990; Stoev 1998). A genotoxic effectof OTA has been demonstrated in animals, and a similar

M. Reverberi (*) : F. Punelli :M. Scarpari : S. Zjalic :C. Fanelli :A. A. FabbriDipartimento di Biologia Vegetale, Università “Sapienza”,L.go Cristina di Svezia 24,00165 Roma, Italye-mail: massimo.reverberi@uniroma1.it

A. RicelliIstituto di Chimica Biomolecolare,CNR, P.le Aldo Moro 5,00185 Roma, Italy

E. CameraCentro Integrato di Ricerca Metabolomica, IFO- S. Gallicano(IRCCS),Via Elio Chianesi 53,00144 Roma, Italy

Appl Microbiol Biotechnol (2010) 85:1935–1946DOI 10.1007/s00253-009-2220-4

risk could potentially affect humans (IARC 1993). OTAbelongs to the isocoumarins family of compounds whosepentaketide skeleton is synthesised from acetate and fourmalonate molecules in the polyketide pathway (Van derMerwe et al. 1965). However, the OTA biosyntheticpathway and the modulating factors involved have not yetbeen fully characterised. The genes pks for a polyketidesynthase and p450-B03 which encodes for a P450 mon-oxygenase are coregulated during OTA biosynthesis andare likely to be engaged in a cluster which presides amultistep enzymatic reaction (O’Callaghan et al. 2003;O’Callaghan et al. 2006).

Metabolic and molecular factors involved in the biosyn-thesis of other mycotoxins, e.g., aflatoxins, have been betterclarified. Among these, oxidative stress has been demon-strated to play a key role (Fabbri et al. 1983; Jayashree andSubramanyam 2000; Reverberi et al. 2006; Reverberi et al.2008). Oxidative stressors such as hydrogen and lipidhydroperoxides induce the accumulation of deoxynivalenolby Fusarium graminearum (Ponts et al. 2006), of aflatoxinsby Aspergillus parasiticus and Aspergillus flavus (Fanelli etal. 1984; Burow et al. 1997), and of sterigmatocystin byAspergillus nidulans (Calvo et al. 2001). Antioxidantmolecules, e.g., butylated hydroxyanisole (BHA), caffeicacid, and resveratrol, which prevent the formation ofoxidised by-products, have a significant inhibiting effecton the formation of aflatoxins, fumonisins, and OTA(Fanelli et al. 1985; Kim et al. 2004; Ricelli et al. 2005;Kim et al. 2008).

Beside their scavenging properties exerted towardsreactive oxygen species and free radicals, antioxidantsshow specific inhibition of oxidative enzymes. BHA,caffeic acid, and resveratrol are inhibitors of lipoxygenases(LOX) and dioxygenases (DOX). In addition, resveratrolhas a relevant cyclooxygenase (COX) inhibitory activity(Pinto et al. 1999; Freemont 2000).

By-products of LOX (Oliw 2002) and DOX (Tsitsigianniset al. 2004a) enzymatic activities play a relevant role inmodulating morphogenetic events and secondary metabolites(e.g., mycotoxins biosynthesis) in fungi (Tsitsigiannis andKeller 2007). Nevertheless, the significance of theseenzymes in A. ochraceus, as well as the interfering effectsof antioxidants, is still elusive.

In this study, we have demonstrated that A. ochraceusexpresses a lox-like gene (AoloxA) whose activity leads to theformation of lipoperoxides of linoleic acid (mainly13-hydroperoxyoctadecadienoic (13-HPODE)). By-productsof enzymatic lipid oxidation were investigated in relation tochanges in morphogenesis and biosynthesis of OTA. The roleof LOX in the host–pathogen interaction was investigated bycomparing oxylipins and OTA formation by a wild type strain(WT) and by a ΔAoloxA knockout mutant on wheat seeds(Triticum durum cv Ciccio).

Materials and methods

Fungal strains

The wild type A. ochraceus (Wilhelm) 1035 was kindlysupplied by Prof. P. Battilani, Università Cattolica diPiacenza, Italy. The ΔAoloxA mutant strain was obtainedas described below.

Culture conditions

A conidia suspension (1×106 in 0.2 ml of sterile distilledwater), for the WT strain or ΔAoloxA mutant, wasinoculated and cultured in static condition in PotatoDextrose Broth (PDB) or on Potato Dextrose Agar(PDA), with (selective medium) or without hygromycinB (Hyg B—Calbiochem) 150 ppm and incubated at 25°Cin dark conditions. In different experiments, a mixture of9- and 13-HPODE (together accounting for a finalconcentration of 100 μM) was added in different ratios(9:1 or 1:9) to PDB. Fungal growth was determined bylyophilisation of mycelial mats and weighting (dry weight( d.w.)). The same quantity of conidia for the two strainswas inoculated on 30 g of durum wheat seeds, cv Cicciomoistened at aw 0.95 and incubated for 30 days at 25°C inthe dark. The seeds were previously sterilised with γ-rays(8 Kgy, irradiation speed 2,602 Gy/h for wheat seeds, seedgermination about 97%).

Nucleic acid extraction and lox-like gene sequence analysis

Aliquots of 100 and 10 mg of lyophilised mycelium werepowdered in liquid nitrogen and treated for DNA and for RNAextraction, respectively. Three different cetyl trimethylammo-nium bromide buffers (2, 10, and 1% w/v) were used toextract DNA from both strains of A. ochraceus followed bypurification passages in organic solvents. RNA extractionwas performed with the TRI REAGENT method (Sigma-Aldrich) modified by adding a purification step withchlorophorm:isoamylic alcohol (24:1) followed by RNAprecipitation overnight with 8 M LiCl. The same protocolswere used to extract nucleic acids from wheat seeds.

Since no lox-like gene sequence of A. ochraceus isreported in the National Center for Biotechnology Infor-mation (NCBI) GenBank, the primers used for amplifica-tion were designed on the basis of the consensus sequencesderived from the alignment of several fungal lox-like geneloci. Alignments were performed employing TBLASTX2.2.13 software of the NCBI website (www.ncbi.nlm.nih.gov/BLAST), and the conserved regions were selected assuitable oligonucleotide primer sites. Degenerate oligonu-cleotide loxf1 primers were synthesised (Table 1). Afteramplification, the expected band at 750 bp (AoloxA) was

1936 Appl Microbiol Biotechnol (2010) 85:1935–1946

sequenced and compared with other fungal lox genes. Somelox-like primers with higher specificity (AoloxA-f; AoloxA-r;AoloxA-r2; AoloxAXbaI-f) were synthesised (Table 1) andused for amplifying A. ochraceus DNA and complementaryDNA (cDNA).

Plasmids and transformation

The genomic DNA of A. ochraceus was amplified withAoloxEco91I-for and AoloxStuI-rev to obtain an AoloxAfragment of 203 bp (AoloxA203) and with AoloxAXbaI-forand AoloxA-rev to obtain an AoloxA fragment of 160 bp(AoloxA160). The polymerase chain reaction (PCR) frag-ments were cloned into pGEM-T easy (Promega), andsubsequently, the plasmids pGEM-T::AoloxA203 andpGEM-T::AoloxA160 were digested with Eco91I-StuIand XbaI-HindIII, respectively. The fragments obtainedwere cloned into the vector pAN7.1 (6.7 Kb) previouslydigested with Eco91I–StuI at 5′ and HindIII–XbaI to 3′alongside the hygromycin cassette (hph box). A. ochraceusWTwas transformed with the resulting vector pAN7.1::lox-like (∼7.3 Kb), which was undigested or linearised.Protoplast transformations of A. ochraceus were performedby the polyethyleneglycol method as described elsewhere(Woo et al. 1999).

Selection of transformants

Putative transformants were selected on PDA containing HygB 150 ppm, transferred to fresh selective medium, and

allowed to sporulate. Single spores were isolated from eachof the selected transformants and transferred to fresh selectivemedium in three consecutive passages. Finally, 20 colonieswere selected and further subcultured. The stability of thesetransformants was tested by two additional single-sporetransfers on nonselective and then again on selective media.

Transformants selection was performed as follows: (1) PCRwith selective primers designed on the hph box and on theAoloxA gene sequence, (2) check for presence of thehygromycin B resistance cassette in the fungal genomewhich was tested by Southern blot hybridisation with aspecific probe obtained by using primers HPF and TrR(Table 1). The presence of the expected fragment was verifiedby Southern blot analysis of EcoRI-restricted DNA (whichdid not restrict the lox-like fragment but cut the hph sequenceonce at +240), and (3) the ability of the mutants to grow andsporulate on PDA with or without HygB was confirmed.

Southern hybridisation

Genomic DNA (10 μg), extracted from A. ochraceus WT andΔAoloxA strains, was digested with EcoRI (10 U) at 37°Cfor 4 h (Fermentas). EcoRI-restricted DNA fragments wereseparated by electrophoresis and then blotted onto Hybond-N+ nylon membrane (Roche). Fluorescent DNA probes(AoloxA and hph) were prepared according to the PCRdigoxigenin (DIG)-labelling method (Roche). The mem-branes were hybridised for 12–16 h in DIG easy hybrid-isation buffer (Roche) containing 250 ng of DIG-labelledAoloxA or hph probes at 58°C or 65°C.

Table 1 Sequences of the primers used for DNA and cDNA amplification in A. ochraceus (Ao) and wheat seeds (Td)

Primer Sequence Primer length (bp) Annealing temperature

Loxf1-f GAYTGGCCYTGGMGATAC 18 55°C

Loxf1-r RGCKGTGTGGATGCACAT 18 55°C

AoloxA-f TTGGAGATACGGTGAAGGTC 20 58°C

AoloxA-r ATTGTCACGCAGTCAACCAG 20 58°C

AoloxA-r2 GGTACCATTGTCACGCAGTCAACC 24 62°C

AoloxAXbaI-f TTGGCCTTGGAGATACGGTGAAGGT 25 58°C

AoloxAEco91I-for GGTNACCTTGGAGATACGGTGAAGGTCC 28 62°C

AoloxAStuI-rev AGGCCTTCAATGGGTGATTAGGGTCA 25 59°C

Aopks_for AGCGGTCAAAACGTGGATAC 20 62°C

Aopks_rev AGGATCGGATTGGTGTGTTC 20 61.5°C

Ao18S_for ATGGCCGTTCTTAGTTGGTG 20 60°C

Ao18S_rev GTACAAAGGGCAGGGACGTA 20 60°C

TrR AGGTACCGTCTAGAAAGAAGGATTAACC 28 63.7°C

HPF CATGGATGCGATCGCTGCG 19 61°C

TdPR1_for CAACAATAACCTCGGCGTCT 20 60°C

TdPR1_rev TCGGTCCCTCTGGCTAGTTA 20 59°C

Td18S_for ATGGCCGTTCTTAGTTGGTG 20 60.5°C

Td18S_rev GTACAAAGGGCAGGGACGTA 20 60°C

Appl Microbiol Biotechnol (2010) 85:1935–1946 1937

Real-time PCR amplification

Total RNA from WT strain and AoloxA-disrupted mutantmycelia was extracted after 5, 10, and 15 days for the PDBcultures and after 7, 14, and 21 days for the wheat seedcultures and was used to develop an AoloxA and Aopksreal-time PCR (RT-PCR) assay in A. ochraceus. A polyke-tide synthase Aopks gene sequence (NCBI accessionnumber: AY320070) of A. ochraceus, involved in theOTA biosynthesis (O’Callaghan et al. 2003), was used todesign specific primers. Mycelia and conidia of the WT andΔAoloxA strains were harvested by washing the inoculatedwheat seeds three times with Milli-Q sterilised water for30 min while stirring. The solutions were then filteredthrough Miracloth (0.2 μm), and the mycelia were used forfurther RNA extraction. A reverse transcriptase reactionwas performed using 1 μg of total RNA treated withRNAse-free Dnase I (Sigma-Aldrich) and 200 U ofSuperScript reverse transcriptase (Invitrogen) according tothe manufacturer's instructions. The RT reaction mixture(1 µl) was used for a AoloxA and Aopks-specific RT-PCRamplification together with 10 pmol of AoloxA-specific orAopks-specific primers (Table 1). SYBR green amplifica-tion was performed in a Line GeneK thermocycler (Bioer)with one cycle of 95°C for 10 min followed by 30 cycles ofdenaturation (15 s at 94°C), annealing (15 s at 58°C), andextension (30 sec at 72°C), with a final elongation of 72°Cfor 1 min. The amplification was also performed on cDNAderived from wheat seeds using the same primers and inthe same amplification conditions in order to avoid falseamplicons derived from plant messenger RNA (mRNA).18S ribosomal RNA was used as housekeeping gene tonormalise differences in total RNA target input andquality and in RT efficiency using specific primers asAo18S (Table 1). In other experiments, total RNA wasextracted from wheat seeds (Td) after 1, 4, 7, and 10 daysafter fungal infection and used to develop a SYBR Greenreal-time PCR assay with the PR1 gene encoding thepathogenesis-related protein PR1. The expression levels ofthe different mRNAs were evaluated by comparing Ctvalues obtained in WT with those of the ΔAoloxA mutant.Moreover, gene expression in the WT strain and theΔAoloxA mutant were also measured by comparingmRNA levels in the different time intervals with theirown basal expressions at the baseline, i.e., after conidiagermination.

Lipoxygenase assay

The LOX activity in the WT strain and in the ΔAoloxAmutant grown in PDB medium was assayed after 5, 10, and15 days using a Beckman DU 530 spectrophotometer byfollowing up the formation of conjugate dienes at 234 nm

as previously reported (Reverberi et al. 2008). In order toexclude the possible interference of laccase activity, KCN1 mM was added to the reaction mixture before thespectrophotometric assay (Gülçin et al. 2005).

9-HODE and 13-HODE detection by LC–MS analysis

The mycelia (10 mg d.w.) of WT strain and ΔAoloxAmutant incubated for 5, 10, and 15 days in PDB werehomogenised under liquid nitrogen in order to avoid theformation of peroxides during the analysis. The powderedmycelia were extracted with chloroform:methanol (2:1 v/v)three times in the presence of 200 μg of butylatedhydroxytoluene (BHT) to prevent autoxidation. Hydro-peroxides were reduced to hydroxides with NaBH4, and theregioisomers (9-hydroxyoctadecadienoic acid (HODE) and13-HODE) have been analysed by high-performance liquidchromatography–atmospheric pressure chemical ionisation–mass spectrometry (HPLC–APCI–MS) as previouslyreported (Reverberi et al. 2008).

Linoleic acid-derived oxylipins LC/MS/MS analysis

HPLC/MS/MS detections were performed using a 1200HPLC system coupled to a triple quadrupole massspectrometer with an electrospray ionization (ESI) interface(Agilent technologies, Santa Clara). Chromatographic sep-aration was performed with a zorbax SB-C8 (50×2.1 mm,1.8 μm) column and water—5 mM ammonium formate(solvent A) and methanol—5% isopropanol (solvent B) at aflow rate 0.4 ml/min as the elution system. The gradientstarted at 60% B followed by a linear increase to 98% B at20 min. Solvent composition was held at this level for30 min then returned to the initial condition at 40 min. Inthe ESI interface, 4 l/min nitrogen, set at the temperature of300°C, was used as the nebulizer and the desolvation gas.Mass spectra and transitions were acquired in the negativeion mode over the mass range 100–400 m/z in order todetect the most abundant ion which coincided with the[M-H]− for all the investigated oxidative derivatives oflinoleic acid. For the MS/MS experiments, nitrogen at1.0 mTorr was used as the collisional gas; the fragmentorwas set at 220, and the collision energy was 20. Q1/Q3(MS/MS) product ion scan mode was used to locate themost abundant products ions, which were in agreementwith previous studies (Garscha et al. 2007; Garscha andOliw 2007). Quantification of the analytes was performedusing selected reaction monitoring. The following tran-sitions of the ion m/z 295.2 to the respective fragmentwere acquired for 11-HODE (→151.3), 8-HODE(→157.2), 9-HODE (→171.2), 10-HODE (→183.2), and13-HODE (→195.1). Transitions of the ion m/z 311.3 tothe respective fragment were acquired for 8-HPODE

1938 Appl Microbiol Biotechnol (2010) 85:1935–1946

(→171.4), 9-HPODE (→185.3), 10-HPODE (183.3),11-HPODE (197.3), 13-HPODE (→195.3), 5,8-dihydrox-yoctadecadienoic acid (DiHODE; →173.1), 7,8-DiHODE(177.3), 8,11-DiHODE (213.3), and 8,13-DiHODE(→157.3).

Ergosterol and OTA analyses

Wheat seeds were extracted with 25 ml chloroform:methanol (2:1 v/v) for 1 h in the dark in the presence of100 μg of BHT as an antioxidant. The extracts weredehydrated on sodium sulphate and then collected, and thevolume was concentrated under nitrogen. Ergosterol wasanalysed by HPLC using a Supelco LC-18, 5 μm (25 cm×4.6 mm) column and as mobile phase methanol:H2O (98:2v/v) as previously reported (Fabbri et al. 1997). OTAanalyses were carried out by HPLC as previously reported(Solfrizzo et al. 1998), with slight modifications (Eskola etal. 2002).

Statistical analysis

All of the experiments and relative detections wereperformed in triplicate. Values reported represent theaverage ± standard deviations and resulted from a total ofsix measurements. To assess significance, p values werecalculated with the Student's t test.

Results

Characterisation of a AoloxA gene in A. ochraceus

Degenerated primers based on lox genes of Gaeumanno-myces graminis (XP958177) and other fungi (Neurosporacrassa CAD37061.1, Aspergillus fumigatus EAL84806.1)present in the NCBI gene bank (at www.ncbi.nlm.nih.gov)were designed. The theoretical translation of the single750-bp fragment obtained is similar (identities 100%,positives 100%, score 555) to an arachidonate 15-LOX ofA. fumigatus (XM741370), whose main product is repre-sented by 13-HPODE with linoleic acid as substrate(Nierman et al. 2005). This fragment (AoloxA) was usedto further characterise its genomic organisation and to studyits mRNA expression.

The combination of the primers Hph_for and Aolox-A_rev was positive for PCR amplification (1.6 Kb) in theΔAoloxA mutant only (Fig. 1a). The EcoRI-restrictedgenomic DNA of A. ochraceus WT indicated the presenceof two putative copies or alleles (at ∼4.3 and 3.0 Kb,respectively) of AoloxA in the genome of this fungus(Fig. 1b). The genomic organisation of the AoloxA gene inthe mutant was markedly different from that of the WT

(Fig. 1b). The deletion cassette had probably been insertedonly in the ∼3.0-Kb copy/allele of AoloxA (lower band asindicated by the arrows). In fact, the ΔAoloxA strainpresented positive hybridisation for three fragments at ∼4.3,∼2.5, and ∼1.8 Kb when the AoloxA probe was used(Fig. 1b). This indicates that only the ∼3.0-Kb copy/alleleof the AoloxA gene in the ΔAoloxA mutant was replacedby the deletion cassette (whereas the 4.3-Kb fragmentremained unaffected) which contains two EcoRI restrictionsites absent in the AoloxA sequence of WT. To confirm theinsertion of gene replacement cassette, the EcoRI-restrictedgenomes of WT and ΔAoloxA strains were hybridised witha probe designed on the hygromycin B resistance cassette(hph). Figure 1b (right side) shows a single fragment in themutant (at ∼2.5 Kb). No hybridisation signal was presentfor the hph probe in the WT strain (Fig. 1b). This singlehybridisation and the size of the hph fragment furtherconfirm the insertion of the disruption cassette in the sole∼3.0-Kb copy/allele.

Fungal growth, Aopks mRNA expression, and OTAbiosynthesis in WT and ΔAoloxA strains grownin synthetic media

A comparison of fungal growth and OTA biosynthesisbetween WT and ΔAoloxA strains is presented in Fig. 2a–c.The two strains did not show any significant difference inthe growth indicating that the knockout of AoloxA did notsignificantly affect the vegetative growth of the mutant(Fig. 2a). Aopks mRNA expression was clearly upregulatedin WT in comparison with the ΔAoloxA mutant. In fact,this was slightly detectable in the ΔAoloxA strain with foldinduction values of 0.15, 0.5, and 1.2 after 5, 10, and15 days, respectively. The expression of Aopks mRNA inWT and in the ΔAoloxA mutant was related to the trend ofOTA biosynthesis of the two strains. OTA biosynthesis wassignificantly higher in WT than in the ΔAoloxA strain, onlya low amount of OTA in the ΔAoloxA mutant after 15 daysof incubation was seen (Fig. 2c; WT 80 ng/ml; ΔAoloxA3 ng/ml).

LOX activity, lipoperoxide formation, and AoloxA geneexpression in WT and ΔAoloxA strains

AoloxA mRNA was faintly expressed in the ΔAoloxAstrain whereas its expression in the WT (Fig. 3a) washigher and in accordance with the trend shown by LOXactivity after 5, 10, and 15 days of incubation. The LOXactivity of the ΔAoloxA mutant was significantly lower incomparison with WT during the entire time course(Fig. 3b). The residual LOX activity detected in theΔAoloxA strain was probably due to the presence of otherlipoxygenase isoforms from another gene as documented

Appl Microbiol Biotechnol (2010) 85:1935–1946 1939

in Fig. 1b. A very small quantity of lipoperoxides(LOOH), identified as 9- and 13-HODE, was observed inΔAoloxA mycelium compared to WT (Fig. 3c). TheLOOH production was detectable in the ΔAoloxA mutantmainly after 5 days of incubation (Fig. 3c), however, theycould have been formed by nonenzymatic reactions whichcan occur in the first days of incubation as previouslyevidenced in A. parasiticus (Reverberi et al. 2008). In WT,a different trend in the formation of 9- and 13-HODE wasshown during the growth, notably their formation was inaccordance with the lowering of LOX activity during time.

In order to verify if the AoloxA gene deletion hasperturbed the linoleic acid-derived oxylipins profile, anLC–MS/MS analysis was carried out (Table 2). Presum-ably, as in A. nidulans, also in A. ochraceus, oxylipins-forming enzymes other than lipoxygenases are present(Tsitsigiannis et al. 2004b). Several products, such as 8-,10-, and 11-HODE; 5,8-, 7,8-, 8, and 13-DiHODE; and 8-,10-, and 11-HPODE, were detected in addition to 9- and13-HPODE described above. From the results obtained, itwas evident that 13-HPODE levels were tenfold lower inthe ΔAoloxA strain than WT, whereas some diols such as

1 2 3 4 5 6 7

9.4 Kb

6.5 Kb

4.3 Kb

2.3 Kb2.0 Kb

A

B

probe: AoloxA probe: hph

1 2 3 4 5 6 7 8 9 10 11

a

b

Fig. 1 a PCR analysis of genomic DNA of the A. ochraceus WT anddifferent putative ΔAoloxA mycelia using primers designed fromsequences inside the hph box (see Materials and methods section).Lane 1100-bp molecular marker (Invitrogen), lanes 2–5 unsuccessfultransformants (clones number 1 to 4), lane 6 a successful knockoutmutant (ΔAoloxA—clone number 5), lane 7 A. ochraceus WT. b DNAgel blot analysis of AoloxA gene replacement mutants. Genomic DNAwas isolated from the WT strain and gene replacement transformants(ΔAoloxA). The blot was hybridised at 58°C and 65°C with a 0.7-KbAoloxA DIG-labelled probe (probe: AoloxA) and with the 1.2-Kb hphDIG-labelled probe (probe: hph) derived from the hygromycin Bresistance cassette. The arrows (A, B) indicate the two main copies/alleles of AoloxA gene. Lane 1 EcoRI-restricted genomic DNA of A.ochraceus WT strain hybridised at 58°C with the AoloxA DIG-

labelled probe, lane 2 EcoRI-restricted genomic DNA of A. ochraceusWT strain hybridised at 65°C with the AoloxA DIG-labelled probe,lane 3 HindIII-restricted genomic DNA of A. ochraceus WT strainhybridised at 65°C with the AoloxA DIG-labelled probe, lane 4BamHI-restricted genomic DNA of A. ochraceus WT strain hybridisedat 65°C with the AoloxA DIG-labelled probe, lane 5 EcoRI-restrictedgenomic DNA of the ΔAoloxA strain (clone number 5 out of a set of20 transformants screened) hybridised at 65°C with the AoloxA DIG-labelled probe, lane 6 DIG-labelled λhindIII (Roche) used as molecularweight marker, lane 7 EcoRI-restricted genomic DNA of A. ochraceusWT strain hybridised at 65°C with the hph DIG-labelled probe, lanes8–11 EcoRI-restricted genomic DNA of ΔAoloxA strains (clonesnumber 5, 8, 13, and 17 out of a set of 20 transformants screened)hybridised at 65°C with the hph DIG-labelled probe

1940 Appl Microbiol Biotechnol (2010) 85:1935–1946

7,8- and 8,13-DiHODE were produced in higher quantityin the mutant (18.5- and 5.1-fold, respectively; Table 2).

The deletion of AoloxA in A. ochraceus affects conidia andsclerotia formation

As reported, oxylipin formation affects the development ofdifferent fungi (Tsitsigiannis and Keller 2007); however,this has not been studied in A. ochraceus. The deletion ofthe AoloxA gene and the consequent oxylipin alterationinfluenced conidiogenesis and sclerotia formation in A.ochraceus. Conidia formation was delayed and highlyreduced (43,750 conidia per millilitre) in the ΔAoloxAstrain in comparison with WT (856,250 conidia permillilitre) in all culture conditions examined after 7 daysof incubation at 25°C; moreover, an abundant sclerotiaformation occurred in the mutant (data not shown).

Exogenous lipoperoxides differently affected OTAbiosynthesis by WT and ΔAoloxA strains

The results obtained (Figs. 2 and 3) suggested that theoccurrence of the lipoperoxidation in the fungal cell canaffect OTA biosynthesis. To support this correlation,HPODE have been added to culture media inoculated withWT and ΔAoloxA strains, and OTA biosynthesis wasquantified. The addition of HPODE to the media produceda significant OTA stimulation in the WT strain incomparison with the ΔAoloxA mutant (Fig. 4). Notably,9-HPODE stimulated toxin biosynthesis after 10 and14 days in comparison with the untreated sample, andalthough not significantly, with 13-HPODE treatment.Moreover, the mutant strain produced less OTA than WT(∼8-fold), and the addition of 9- and 13-HPODE to theculture media did not affect OTA biosynthesis in this strain(Fig. 4). The presence of a residual LOX activity (Fig. 3b)in the ΔAoloxA strain, as evidenced by the low concentra-tion of LOOH produced (Fig. 3c), can partly explain theformation of OTA by this strain even though at a low level.

In wheat seeds, the ΔAoloxA mutant produced less OTAthan WT

The role played by the lox gene and by the by-products ofLOX activity on OTA biosynthesis has been studied byinoculating the ΔAoloxA strain onto wheat seed. Thegrowth of WT and ΔAoloxA strains, monitored asergosterol content, did not present a significant difference(p>0.05) during the time course (WT: 226.2±40 and theΔAoloxA strain: 192.0±31 μg/g wheat seeds) confirmingthe results obtained in vitro (Fig. 2a). The Aopks mRNAexpression was evident in WT at 14 (up to eightfoldinduction in comparison with the mutant) and 21 days of

a

b

c

0

1

2

3

4

5

6

1 5 10 15

1 5 10 15

1 5 10 15

Time (days)

Fung

al g

row

th m

g/m

l

WT

1

6

11

16

21

26

Time (days)

Aop

ks m

RN

A r

el.e

xpr.

WT

0

10

20

30

40

50

60

70

80

90

100

Time (days)

OT

A n

g/m

l

WT

∆AoloxA

∆AoloxA

∆AoloxA

Fig. 2 a Fungal growth (dry weight, milligram per millilitre) of WTand ΔAoloxA after 5, 10, and 15 days at 25°C in PDB medium bAopks mRNA RT-PCR analysis of A. ochraceus mycelia of WT andΔAoloxA after 5, 10, and 15 days of incubation in PDB at 25°C. cOchratoxin A (OTA, nanogram per millilitre) produced by the WT andthe ΔAoloxA mutant of A. ochraceus inoculated in PDB. The levels ofOTA were quantified by fluorimetric detection in HPLC. The resultsare the mean ± SD of three determinations from three separateexperiments

Appl Microbiol Biotechnol (2010) 85:1935–1946 1941

incubation, whereas it was faintly present in the ΔAoloxAstrain up to 21 days (up to 1.5-fold induction in comparisonwith Aopks expression at time zero). Consequently, OTAwas synthesised at a very low level in the ΔAoloxA strain

(0.6 μg/g wheat seeds) in comparison with WT (up to35 μg/g wheat seeds).

LOX activity and LOOH formation in vivo

To study whether seed and fungus can communicatethrough an oxylipin interchange, WT and ΔAoloxA strainswere inoculated onto wheat seeds (WS; Fig. 5a–c). TheLOX activity of the wheat inoculated with WT (WS + WT)was higher at 7 days of incubation in comparison with thesamples inoculated with the ΔAoloxA strain (WS +ΔAoloxA) or uncontaminated seeds (WS) suggesting thatthe WT presence on the seed's surface induced defencereactions. After 14 and 21 days of incubation, the LOXactivity of infected seeds did not differ significantly,whereas uncontaminated seeds presented a lower enzymeactivity at 21 days (Fig. 5a). Nevertheless, the extent ofsummoned 9- and 13-HODE produced by the wheat seedsinfected with A. ochraceus WT (WS + WT; 30.2±3.5 ng/mg) or with the ΔAoloxA strain (WS + ΔAoloxA; 29.1±5.2 ng/mg) was similar. In the sample WS + WT, the9-HODE level was higher in comparison with that of13-HODE from 7 to 21 days (Fig. 5b). On the contrary,comparable levels of 9- and 13-HODE in the WS +ΔAoloxA and WS samples were seen; close to 50:50 ratio(Fig. 5b).

The ΔAoloxA mutant produced a lower quantity ofLOOH in comparison with WT (up to eightfold), and theformation of 13-HODE was higher than 9-HODE at all ofthe time intervals (Fig. 5c). Overall, the linoleic acid-derived oxylipins were largely downregulated in theΔAoloxA strain in comparison with WT with the exceptionof 7,8-DiHODE, whose quantity in the mutant was 3.3-foldhigher than in WT (Table 2).

PR1 mRNA expression in wheat seeds contaminatedwith WT and ΔAoloxA strains

In uncontaminated WS, the expression of the pathogenesis-related mRNA of PR1, whose product is involved in theonset of defence to pathogen contamination, increasedduring the entire time of analysis (Fig. 6). Nevertheless,PR1 transcription was severely affected in wheat seedscontaminated with A. ochraceus WT (WS + WT). Inparticular, when WT was inoculated onto wheat seeds,PR1 was initially inhibited (1–7 days of incubation) incomparison with WS, and starting from 14 days ofincubation, its expression was clearly enhanced (up to65-fold after 21 days of incubation). PR1 mRNAexpression was not significantly affected in presence ofthe ΔAoloxA strain in comparison with WS, whereas itwas inhibited in comparison with WS + WT (Fig. 6) after21 days of incubation.

a

b

c

0

1

2

3

4

5

6

7

5 10 15Time (days)

5 10 15

5 10 15

Time (days)

Aol

oxA

mR

NA

rel

. exp

r.

WT

0

2

4

6

8

10

12

14

16

18

20

LO

X U

/ mg

prot

ein

WT

0

20

40

60

80

100

120

140

160

180

Time (days)

LO

OH

ng/

mg

d.w

.

WT 9-HODE

WT 13-HODE

∆AoloxA

∆AoloxA

∆AoloxA 9-HODE

∆AoloxA 13-HODE

Fig. 3 a AoloxA mRNA RT-PCR analysis of A. ochraceus mycelia ofWT and ΔAoloxA strains after 5, 10, and 15 days of incubation inPDB at 25°C. b Spectrophotometric assay of lipoxygenase (LOX,Unit per milligram protein) activity, in mycelia of WT and ΔAoloxAstrains, measured as increase in absorbance at 234 nm due to dieneconjugates formation from linoleic acid. c HPLC–APCI–MS detectionof regioisomers of hydroxyoctadecadienoic acid (9- and 13-HODE)formation from linoleic acid (LOOH, nanogram per milligram, d.w.)in mycelia of WT and ΔAoloxA strains grown for different timeintervals (5–15 days) at 25°C in PDB. The results are the mean ± SDof three determinations from three separate experiments

1942 Appl Microbiol Biotechnol (2010) 85:1935–1946

Discussion

In this study, we demonstrated that a putative lipoxygenaseencoding gene named AoloxA is present in A. ochraceus.The expression of LOX was evidenced by 9- and13-HPODE formation with the latter being most abundant.LOX-derived oxylipins play a key role in the developmen-tal processes of the fungus and in the metabolic pathwayleading to the OTA biosynthesis. The ΔAoloxA mutant, inwhich at least one lox-like gene copy/allele was disrupted,produced OTA to a significantly lesser extent and showedsevere morphological and developmental modifications incomparison with WT in different culture conditions.

The amount and the composition of lipids in seedsprofoundly affect cell development and metabolism ofpostharvest pathogenic fungi (Passi et al. 1984; Fanelliand Fabbri 1989; Burow et al. 1997; Burow et al. 2000;Wilson et al. 2001; Keller et al. 2005; Tsitsigiannis et al.

2005). During the storage of wheat seeds, A. ochraceusinitially colonises the germ and then differentiates conidia.Similarly to the observations concerning A. flavus (Burowet al. 1997) and Ustilago maydis (Klose et al. 2004), germ'slipids can play a role in the conidiogenesis of A. ochraceus.By-products of lipid oxidation deriving from either nonen-zymatic or enzymatic reactions involving dioxygenases andlipoxygenases can drive the mito- and meiospore differen-tiation and the toxin biosynthesis in A. parasiticus, A.nidulans, A. fumigatus, and A. flavus (Tsitsigiannis andKeller 2007; Horowitz Brown et al. 2008). Our resultsdemonstrated that a similar mechanism is involved in thedifferentiation of A. ochraceus. We have observed thatdeletion of a copy/allele of AoloxA alters the oxylipinprofile to a significant extent and results in a partialinhibition of oxylipin formation. It is likely that more thanone lox-like gene and genes for other oxylipin-formingenzymes, such as fatty acid dioxygenases, are present in thegenome of A. ochraceus. This is suggested both by thecomplex hybridisation profile of the AoloxA gene and bythe detection of other oxylipins, such as 8-HPODE and 7,8-DiHODE, inter alia.

The ΔAoloxA mutant behaves both in vitro and in wheatseeds in different way compared with the WT strain. TheΔAoloxA strain presents delayed conidia formation, copi-ous sclerotia production, and hyphae distribution patternsthat involve the whole seed's surface, i.e., it is not limited tothe germ. In vitro, the ΔAoloxA strain shows oxylipinbiosynthetic pathways switching from 13-HPODE to aprevalent formation of 7,8- and 8,13-DiHODE. It has beenshown that in the fungi Magnaporthe grisea and someAspergilli (i.e., A. fumigatus), 7,8-DiHODE and 5,8-DiHODE, which are derived from the fatty acid dioxy-genase enzyme PpoA (Cristea et al. 2003; Garscha et al.2007), regulated the ratio between asexual to sexual sporesor sclerotia formation (Champe et al. 1987; Champe and el-Zayat 1989; Tsitsigiannis et al. 2004b; Tsitsigiannis andKeller 2007; Horowitz Brown et al. 2008). A large number

0

20

40

60

80

100

120

4d 5d 6d 7d 10d 14d 4d 5d 6d 7d 10d 14d

WT

Time (days)& treatments

OT

A n

g/m

l

Control

9-HPODE

13-HPODE

∆AoloxA

Fig. 4 Ochratoxin A (OTA, nanogram per millilitre) produced by WTand the ΔAoloxA mutant of A. ochraceus inoculated in PDB inpresence or absence of hydroperoxyoctadecadienoic acid (9-HPODEor 13-HPODE) after 4–14 days. The levels of OTAwere quantified byfluorimetric detection in HPLC. The results are the mean ± SD ofthree determinations from three separate experiments

Oxylipin species Transition ΔAoloxA/WT_(PDB) ΔAoloxA/WT_(wheat)

8-HODE 295→157 0.50±0.04 0.008±0.001

10-HODE 295→183 2.0±0.3 0.012±0.002

11-HODE 295→151 0.67±0.03 0.21±0.04

8-HPODE 311→171 0.21±0.02 0.014±0.002

9-HPODE 311→185 0.95±0.11 0.87±0.14

10-HPODE 311→183 0.17±0.02 0.16±0.03

11-HPODE 311→197 ND 0.008±0.002

13-HPODE 311→195 0.1±0.01 0.0016±0.0003

5,8-DiHODE 311→173 0.05±0.01 0.0045±0.0004

7,8-DiHODE 311→177 18.5±1.5 3.33±0.22

8,13-DiHODE 311→157 5.1±1.2 0.014±0.004

Table 2 Profile of differentlinoleic acid-related oxylipinsproduced by A. ochraceus indifferent culture conditions. Theoxylipins are expressed as ratioof their levels in ΔAoloxArespect to WTa

ND no determinationa Both strains were inoculated inPDB and on wheat seeds andincubated at 25°C for 15 and21 days, respectively. Theresults are the mean ± SD ofthree determinations from threeindependent experiments

Appl Microbiol Biotechnol (2010) 85:1935–1946 1943

of sclerotia, which are considered to be vestigial sexualcleistothecia (Yager 1992; Geiser et al. 1996), are formed invitro by the ΔAoloxA mutant, possibly due to an increaseof diol formation. Similarly, oxylipins, which are producedin seeds in response to fungal contamination, are able tomodulate toxin synthesis in some mycotoxigenic fungi. Infact, hydroperoxides deriving from linoleic acid (HPODE),by the action of maize LOX, are able to differentiallyinfluence toxin biosynthesis (e.g., aflatoxins and sterigma-tocystin) in A. flavus and A. nidulans, i.e., 9S-HPODEstimulates whereas 13S-HPODE inhibits their biosynthesis(Burow et al. 1997; Burow et al. 2000; Wilson et al. 2001;Brodhagen et al. 2008). Additionally, an oxylipin-mediatedcross-talk was demonstrated to occur in the interactionbetween A. nidulans and maize. In this scenario, themycotoxigenic fungus secretes oxylipins that are able toelicit a defence response by the seed based on the activationof LOX pathway (Gao et al. 2009). In turn, the lipidhydroperoxides released by the seed, probably mimickingfungal oxylipins, induced several responses in the patho-genic fungus including activation of secondary metabolismand changes in morphogenesis (Brodhagen et al. 2008).

We have shown how LOX activity of wheat seeds isstimulated after 7 days of incubation with the A. ochraceusWT during which a steady increase of 9-/13-HODE ratiowas detected. This reaction occurs in response to A.ochraceus contamination and is similar to that observed inthe A. nidulans–maize interaction, which is likely to bemediated by fungal oxylipins. In fact, in both noninfectedor ΔAoloxA strain-inoculated seeds, a lower LOX activityis seen after 7 days. The ratio between 9- and 13-HODEwas maintained constantly around the unitary value overthe observation time in both treatments. In wheat seeds, theexpression of PR1 mRNA, which is an index of the onset ofplant defence responses (Dixon et al. 1994), is enhanced bycontamination with the WT and not with the ΔAoloxA

0

10

20

30

40

50

60

70

80

1 7 14 21Time (days)

TdP

R1

mR

NA

rel

. exp

r.

WS

WS+WT

WS+∆AoloxA

Fig. 6 Triticum durum pathogenesis-related protein 1 (TdPR1)mRNA RT-PCR analysis in wheat seeds infected with WT (WS +WT), with ΔAoloxA (WS + ΔAoloxA), or uncontaminated (WS) afterdifferent time intervals (1–21 days). The results are the mean ± SD ofthree determinations from three separate experiments

0

500

1000

1500

2000

2500

3000

3500

4000

7 14 21

Time (days)

LO

X U

/mg

prot

ein

WS+WT

WS+∆AoloxA

WS

0

10

20

30

40

50

60

70

80

90

100

7d 14d 21d

7d 14d 21d 7d 14d 21d

7d 14d 21d 7d 14d 21d

WS+WT WS+∆AoloxA WS

Time (days) & treatments

9- a

nd 1

3-H

OD

E r

atio

9-HODE 13-HODE

0

10

20

30

40

50

60

70

80

90

100

WT

Time (days) & treatments

9- a

nd 1

3-H

OD

E r

atio

9-HODE 13-HODE

∆AoloxA

a

b

c

Fig. 5 a Spectrophotometric assay of wheat seeds lipoxygenase(LOX, Unit per milligram protein) infected with WT (WS + WT),with ΔAoloxA (WS + ΔAoloxA), or uncontaminated (WS) afterdifferent time intervals (7–21 days). b HPLC–APCI–MS detection oflipoperoxide formation from linoleic acid expressed as the relativeratio of the regioisomers of 9-HODE and 13-HODE in wheat seedsinoculated with WT or ΔAoloxA after different time intervals (7–21 days). c HPLC–APCI–MS detection of lipoperoxide formationfrom linoleic acid 9- and 13-HODE expressed as the relative ratio ofthe regioisomers of 9-HODE and 13-HODE in mycelia of WT andΔAoloxA strains grown for different periods (7–21 days) on wheatseeds at 25°C. The results are the mean ± SD of three determinationsfrom three separate experiments

1944 Appl Microbiol Biotechnol (2010) 85:1935–1946

mutant. In fact, 9-HPODE and PR1 can exert an antimi-crobial effect against A. ochraceus as suggested by theresults obtained in other OTA-producing fungi such asAspergillus carbonarius (Mita et al. 2007).

It can be inferred that the oxylipins formed by the funguselicit a plant defence response through the formation ofplant oxylipins. The generalised downregulation of oxylipinsynthesis in the ΔAoloxA strain grown on wheat seeds alsoconfirms the existence of a cross-talk between wheat seedsand A. ochraceus mediated by oxylipins. Furthermore, asobserved in A. flavus (Burow et al. 1997), the increase of 9-HPODE seems to positively correlate with OTA biosynthe-sis. In contrast, levels of 13-HPODE comparable or higherthan 9-HPODE abrogated the effects on the OTA forma-tion. How 9-HPODE promotes OTA biosynthetic genes inthis fungus has not yet elucidated even though receptorsexpressed on the fungal membrane respond differently to 9-and 13-HPODE produced by plants (Tsitsigiannis andKeller 2007). In support of this hypothesis, 9-HPODEwas added exogenously and was found to be ineffective inrestoring OTA synthesis in the ΔAoloxA strain. It is likelythat 9-HPODE binds to these putative receptors; however,the deletion of the AoloxA gene impaired the downstreamsignalling leading to OTA biosynthesis.

In conclusion, we suggest that similar to A. nidulans, A.flavus, and A. parasiticus, some of the mechanisms thatdrive toxin biosynthesis and morphogenesis which aremodulated by by-products of fatty acid oxidation are activein A. ochraceus. Understanding the common mechanismsinvolved in the biosynthesis of different mycotoxins wouldallow for the development of suitable strategies to controlthe biosynthesis of several mycotoxins simultaneously. Thiswould offer obvious advantages since seeds are oftencontaminated with different toxigenic fungi at the sametime.

References

Brodhagen M, Tsitsigiannis DI, Hornung E, Goebel C, Feussner I,Keller NP (2008) Reciprocal oxylipin-mediated cross-talk in theAspergillus-seed pathosystem. Mol Microbiol 67(2):378–391

Burow GB, Nesbitt TC, Dunlap J, Keller NP (1997) Seed lip-oxygenase products modulate Aspergillus mycotoxin biosynthe-sis. Mol Plant Microbe Interact 10:380–387

Burow GB, Gardner HW, Keller NP (2000) A peanut seed lip-oxygenase responsive to Aspergillus colonization. Plant Mol Biol42:689–701

Calvo AM, Gardner HW, Keller NP (2001) Genetic connectionbetween fatty acid metabolism and sporulation in Aspergillusnidulans. J Biol Chem 276:25766–25774

Champe SP, El-Zayat AA (1989) Isolation of a sexual sporulationhormone from Aspergillus nidulans. J Bacteriol 171:3982–3988

Champe SP, Rao P, Chang A (1987) An endogenous inducer of sexualdevelopment in Aspergillus nidulans. J Gen Microbiol 133:1383–1387

Cheeke PR (1998) Natural toxicants in feeds, forages and poisonousplants. Interstate Publishers Inc., Danville

Commission of the European Community (2006) Regulation (EC) No1881/2006 of 19 December 2006 setting maximum levels forcertain contaminants in foodstuffs. Official Journal of theEuropean Union, Series L 49:25–31

Creppy EE, Chakor K, Fisher MJ, Dirheimer G (1990) The mycotoxinochratoxin A is a substrate for phenylalanine hydroxylase inisolated rat hepatocytes and in vivo. Arch Toxicol 64:279–284

Cristea M, Osbourn AE, Oliw EH (2003) Linoleate diol synthase of therice blast fungus Magnaporthe grisea. Lipids 38(12):1275–1280

Dixon RA, Harrison MJ, Lamb CJ (1994) Early events in theactivation of plant defense responses. Ann Rev Phytopathol32:479–501

Eskola M, Kokkonen M, Rizzo A (2002) Application of manual andautomated systems for purification of ochratoxin A and zear-alenone in cereals with immunoaffinity columns. J Agric FoodChem 50:41–47

Fabbri AA, Fanelli C, Panfili G, Passi S, Fasella P (1983) Lip-operoxidation and aflatoxin biosynthesis by Aspergillus para-siticus and A. flavus. J Gen Microbiol 129:3447–3452

Fabbri AA, Ricelli A, Brasini S, Fanelli C (1997) Effect of differentantifungals on the control of paper biodeterioration caused byfungi. Intern Biodeter Biodegr 39:61–65

Fanelli C, Fabbri AA (1989) Relationship between lipids and aflatoxinbiosynthesis. Mycopathologia 107:115–120

Fanelli C, Fabbri AA, Finotti E, Fasella P, Passi S (1984) Free radicalsand aflatoxin biosynthesis. Experientia 40:191–193

Fanelli C, Fabbri AA, Pieretti S, Finotti E, Passi S (1985) Effect ofdifferent antioxidants and free radical scavengers on aflatoxinproduction. Mycol Res 1:65–69

Freemont L (2000) Biological effects of resveratrol. Life Sci 66:663–673Gao X, Brodhagen M, Isakeit T, Brown SH, Göbel C, Betran J,

Feussner I, Keller NP, Kolomiets MV (2009) Inactivation of thelipoxygenase ZmLOX3 increases susceptibility of maize toAspergillus spp. Mol Plant Microbe Interact 22(2):222–231

Garscha U, Oliw EH (2007) Steric analysis of 8-hydroxy- and 10-hydroxydecadienoic acids and dihydroxyoctadecadienoic acidformed from 8R-hydroperoxyoctadecadienoic acid by hydroper-oxide isomerases. Anal Chem 367:238–246

Garscha U, Jerneren F, Chung DW, Keller NP, Hamberg M, Oliw EH(2007) Identification of dioxygenases required for Aspergillusdevelopment. J Biol Chem 282:34707–34718

Geiser DM, Timberlake WE, Arnold ML (1996) Loss of meiosis inAspergillus. Mol Biol Evol 13:809–817

Gülçin I, Küfrevioğlu OI, Oktay M (2005) Purification and charac-terization of polyphenol oxidase from nettle (Urtica dioica L.)and inhibitory effects of some chemicals on enzyme activity. JEnzyme Inhib Med Chem 20(3):297–302

Horowitz Brown S, Zarnowski R, Sharpee WC, Keller NP (2008)Morphological transitions governed by density dependence andlipoxygenase activity in Aspergillus flavus. Appl Environ Micro-biol 74(18):5674–5685

IARC (1993) Some naturally occurring substances: food items andconstituents, heterocyclic aromatic amines, and mycotoxins.IARC monographs on the evaluation of carcinogenic risk ofchemicals to humans. International Agency for Research onCancer, Lyon

Jayashree T, Subramanyam C (2000) Oxidative stress as a prerequisitefor aflatoxin production by Aspergillus parasiticus. Free RadicBiol Med 29:981–985

Keller NP, Turner G, Bennet JW (2005) Fungal secondarymetabolism-from biochemistry to genomics. Nat Rev Microbiol3:937–947

Kim JH, Campbell BC, Yu J, Mahoney N, Chan KL, Molyneux RJ,Bhatnagar D, Cleveland TE (2004) Examination of fungal stress

Appl Microbiol Biotechnol (2010) 85:1935–1946 1945

response genes using Saccharomyces cerevisiae as a modelsystem: targeting genes affecting aflatoxin biosynthesis byAspergillus flavus link. Appl Microbiol Biotechnol 67:807–815

Kim JH, Yu J, Mahoney N, Chan KL, Molyneux RJ, Varga J, BhatnagarD, Cleveland TE, NiermanWC,Campbell BC (2008) Elucidation ofthe functional genomics of antioxidant-based inhibition of aflatoxinbiosynthesis. Int J Food Microbiol 122(1–2):49–60

Klose J, Moniz de Sa M, Kronstad JW (2004) Lipid-induced filamentousgrowth in Ustilago maydis. Mol Microbiol 52:823–835

Mita G, Fasano P, De Domenico S, Perrone G, Epifani F, Iannacone R,Casey R, Santino A (2007) 9-lipoxygenase metabolism isinvolved in the almond/Aspergillus carbonarius interaction. JExp Bot 58(7):1803–1811

Nierman WC, Pain A, Anderson MJ, Wortman JR, Kim HS, Arroyo J,Berriman M, Abe K, Archer DB, Bermejo C, Bennett J, BowyerP, Chen D, Collins M, Coulsen R, Davies R, Dyer PS, Farman M,Fedorova N, Fedorova N, Feldblyum TV, Fischer R, Fosker N,Fraser A, García JL, García MJ, Goble A, Goldman GH, GomiK, Griffith-Jones S, Gwilliam R, Haas B, Haas H, Harris D,Horiuchi H, Huang J, Humphray S, Jiménez J, Keller N, KhouriH, Kitamoto K, Kobayashi T, Konzack S, Kulkarni R, KumagaiT, Lafton A, Latgé JP, Li WX, Lord A, Majoros WH, May GS,Miller BL, Mohamoud Y, Molina M, Monod M, Mouyna I,Mulligan S, Murphy L, O'Neil S, Paulsen I, Peñalva MA, PerteaM, Price C, Pritchard BL, Quail MA, Rabbinowitsch E, RawlinsN, Rajandream MA, Reichard U, Renauld H, Robson GD, deCórdoba SR, Rodróguez-Peña JM, Ronning CM, Rutter S,Salzberg SL, Sánchez M, Sanchez-Ferrero JC, Saunders D,Seeger K, Squares R, Squares S, Takeuchi M, Tekaia F, TurnerG, de Aldana CRV, Weidman J, White O, Woodward J, Yu JH,Fraser C, Galagan JE, Asai K, Machida M, Hall N, Barrell B,Denning DW (2005) Genomic sequence of the pathogenic andallergenic filamentous fungus Aspergillus fumigatus. Nature 438(7071):1151–1156

O’Callaghan J, Caddick MX, Dobson ADW (2003) A polyketidesynthase gene required for ochratoxin A biosynthesis inAspergillus ochraceus. Microbiology 149:3485–3491

O’Callaghan J, Stapleton PC, Dobson ADW (2006) Ochratoxin Abiosynthetic genes in Aspergillus ochraceus are differentiallyregulated by pH and nutritional stimuli. Fungal Genet Biol43:213–221

Oliw EH (2002) Plant and fungal lipoxygenases. Prostaglandins OtherLipid Mediat 68–69:313–323

Pardo E, Marin S, Ramos A, Sanchis V (2004) Occurrence ofochratoxigenic fungi and ochratoxin A in green coffee fromdifferent origins. Food Sci Technol Int 10(1):45–49

Passi S, Nazzaro-Porro M, Fanelli C, Fabbri AA, Fasella P (1984)Role of lipoperoxidation in aflatoxin production. Appl MicrobiolBiotechnol 19:186–190

Pinto MC, Garcia-Barrado JA, Macias P (1999) Resveratrol is a potentinhibitor of the dioxygenase activity of lipoxygenase. J AgricFood Chem 47:4842–4846

Ponts N, Pinson-Gadais L, Verdal-Bonnin MN, Barreau C, Richard-Forget F (2006) Accumulation of deoxynivalenol and its 15-acetylated form is significantly modulated by oxidative stress in

liquid cultures of Fusarium graminearum. FEMS Microbiol Lett258:102–107

Reverberi M, Zjalic S, Ricelli A, Fabbri AA, Fanelli C (2006)Oxidant/antioxidant balance in Aspergillus parasiticus affectsaflatoxin biosynthesis. Mycotox Res 22:39–47

Reverberi M, Zjalic S, Ricelli A, Punelli F, Camera E, Fabbri C,Picaro M, Fanelli C, Fabbri AA (2008) Modulation of antiox-idants defence in Aspergillus parasiticus is involved in aflatoxinbiosynthesis: a role for ApyapA gene. Eukaryot Cell 7(6):988–1000

Ricelli A, Reverberi M, Zjalic S, Fabbri AA, Fanelli C (2005)Controllo e prevenzione della produzione di ocratossina A neicereali: risultati del progetto CEE QLK1-CT-199-00433 (1999–2004). In: Miraglia M, Brera C (eds) Le micotossine nella filieraagroalimentare, Proceedings of the 1ST National Conference.Mycotoxins in agri-food chain, ISS, Settore Attività Editoriali,Roma, pp 129–138

Solfrizzo M, Avantaggiato G, Visconti A (1998) Use of various clean-up procedures for the analysis of ochratoxin A in cereals. JChromat 815:67–73

Stoev S (1998) The role of ochratoxin A as a possible cause of Balkanendemic nephropathy and its risk evaluation. Vet Hum Toxicol40:352–360

Tsitsigiannis DI, Keller NP (2007) Oxylipins as developmental andhost–fungal communication signals. Trends Microbiol 15(3):109–118

Tsitsigiannis DI, Kowieski TM, Zarnowski R, Keller NP (2004a)Endogenous lipogenic regulators of spore balance in Aspergillusnidulans. Eukaryot Cell 3:1398–1411

Tsitsigiannis D, Zarnwski R, Keller NP (2004b) The lipid bodyprotein, PpoA, coordinates sexual and asexual sporulation inAspergillus nidulans. J Biol Chem 279(12):11344–11353

Tsitsigiannis DI, Kunze S, Willis DK, Feussner I, Keller NP (2005)Aspergillus infection inhibits the expression of peanut 13 S-HPODE-forming seed lipoxygenases. Mol Plant Microbe Interact18:1081–1089

Van der Merwe KJ, Steyne KJ, Fourie L, Scott DB, Theron JJ (1965)Ochratoxin A, a toxic metabolite produced by Aspergillusochraceus Wilh. Nature 205:1112–1113

WHO (2001) Safety evaluation of certain mycotoxins in food. Fiftysixth report of the joint FAO/WHO expert committee on foodadditives. WHO Food Additives Series 47, World HealthOrganization, Geneva

Wilson RA, Gardner HW, Keller NP (2001) Cultivar-dependentexpression of a maize lipoxygenase responsive to seed infestingfungi. Mol Plant Microbe Interact 14:980–987

Woo SL, Donzelli B, Scala F, Mach R, Harman GE, Kubicek CP,Del Sorbo G, Lorito M (1999) Disruption of the ech42(endochitinase-encoding) gene affects biocontrol activity inTrichoderma harzianum P1. Mol Plant Microbe Interact12:419–429

Yager LN (1992) Early developmental events during asexual andsexual sporulation in Aspergillus nidulans. In: Bennett JW, KlichMA (eds) Aspergillus—biology and industrial applications.Butterworth-Heinemann, Boston, pp 19–41

1946 Appl Microbiol Biotechnol (2010) 85:1935–1946