1 23

EuphyticaInternational Journal of Plant Breeding ISSN 0014-2336 EuphyticaDOI 10.1007/s10681-012-0659-3

Isolation and characterization ofViviparous-1 haplotypes in wheat relatedspecies

Y. W. Sun, Y. Yang, P. R. Shewry,H. D. Jones & L. Q. Xia

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer

Science+Business Media B.V.. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you

wish to self-archive your work, please use the

accepted author’s version for posting to your

own website or your institution’s repository.

You may further deposit the accepted author’s

version on a funder’s repository at a funder’s

request, provided it is not made publicly

available until 12 months after publication.

Isolation and characterization of Viviparous-1 haplotypesin wheat related species

Y. W. Sun • Y. Yang • P. R. Shewry •

H. D. Jones • L. Q. Xia

Received: 22 July 2011 / Accepted: 6 March 2012

� Springer Science+Business Media B.V. 2012

Abstract Pre-harvest sprouting (PHS) resistance is

one of the most important traits in wheat breeding.

Characterization of Viviparous-1 (Vp-1) haplotypes in

wheat related species will further our understanding of

the role of Vp-1 in PHS resistance of bread wheats.

The present paper reported Vp-1 haplotype analyzes of

77 accessions of wheat related species including T.

monococcum and T. boeoticum (AmAm), T. durum

(AABB), T. dicoccoides (AABB) and Ae. tauschii

(DD). A total of 11 novel Vp-1 haplotypes were

identified in these species including three in

T. monococcum which were designated as TmVp-

1A1, TmVp-1A2, TmVp-1A3, three in T. boeoticum,

designated as TbVp-1A1, TbVp-1A2 and TbVp-1A3,

two in T. durum, designated as TduVp-1B1 and TduVp-

1B2, and three in Ae. tauschii designated as AetVp-

1D1, AetVp-1D2 and AetVp-1D3, respectively.

Among these haplotypes explored, TduVp-1B1 was

identical to TaVp-1Be which was detected in a

PHS resistant Chinese landrace. Semi-quantitative

RT-PCR analysis demonstrated that the presence of

alternatively spliced transcripts of the Vp-1 homo-

logues in these wheat related species. The level of

correctly spliced transcripts varies among the haplo-

types, and was correlated with the degree of ABA

responsiveness during seed germination. It appeared

that Vp-1 mis-splicing and some indel variations in

bread wheats originated from its progenitors and were

retained during polyploidization. Moreover, haplo-

types with better Vp-1 splicing such as TbVp-1A2 of T.

boeoticum and TduVp-1B1 of T. durum species might

be valuable in breeding PHS tolerant wheat.

Keywords Bread wheat (Triticum aestivum L) �Wheat related species � Vp-1 � Haplotype � Pre-harvest

sprouting � ABA sensitivity

Abbreviations

PHS Pre-harvest sprouting

Vp-1 Viviparous-1

ABA Abscisic acid

GI Germination index

Y. W. Sun, Y. Yang contributed equally to the work.

Y. W. Sun � L. Q. Xia (&)

Institute of Crop Science/The National Key Facility for

Crop Gene Resources and Genetic Improvement, Chinese

Academy of Agricultural Sciences (CAAS), 12

Zhongguancun South Street, Beijing 100081, China

e-mail: xialq@mail.caas.net.cn

Y. Yang

Colleges of Life Science, Inner Mongolia Agricultural

University, 306 Zhaowuda Road, Hohhot 010018,

Inner Mongolia, China

P. R. Shewry � H. D. Jones

Rothamsted Research, Harpenden, Hertfordshire

AL5 2JQ, UK

123

Euphytica

DOI 10.1007/s10681-012-0659-3

Author's personal copy

Introduction

Pre-harvest sprouting (PHS) of grains is a severe

problem all over the world. PHS reduces the quality

and economic value of wheat. Several factors can

contribute to increased resistance to PHS: reduced

levels of a-amylase activity in the grain, the presence

of inhibitors of germination, reduced water absorption

by the grains and altered responses to hormones (Gale

1989; King 1993; Flintham 2000; Groos et al. 2002;

Himi et al. 2002; Mares et al. 2005). The Viviparous-1

(Vp-1) gene is an important regulator of late embryo-

genesis in maize (McCarty et al. 1991). Maize Vp-1

mutant seeds germinate precociously due to the

reduced sensitivity to ABA in developing embryos

(McCarty et al. 1989). Vp-1 performs two distinct

functions: one is to promote embryo maturation, and

the second is to advance embryo dormancy and repress

germination (McCarty et al. 1991). Orthologs of Vp-1

have been identified in a number of species including

OsVp-1 from rice (Hattori et al. 1994), PvAlf from

Phaseolus vulgaris (Bobb et al. 1995), AfVP-1 from

wild oats (Jones et al. 1997), ABI3 from Arabidopsis

(Giraudat et al. 1992) and PtABI3 from poplar (Rohde

et al. 1998). Vp-1 and all orthologous proteins have

four highly conserved amino acid domains: A1, which

is an acidic region at the N-terminus of the protein, and

three basic domains designated B1, B2, and B3, which

bind to DNA and activate the target promoter

(McCarty et al. 1991; Giraudat et al. 1992; Hattori

et al. 1994; Bobb et al. 1995; Jones et al. 1997; Shiota

et al. 1998).

Three orthologous Vp-1 genes are present in bread

wheat, which are located on the long arms of

chromosomes 3A, 3B and 3D, respectively (Bailey

et al. 1999). The structure and expression of the three

Vp-1 homologues (TaVp-1) in bread wheat have been

determined, showing that each has the potential to

encode a full-length functional protein (McKibbin

et al. 2002). However, incorrect splicing of pre-mRNA

leads to a diverse RNA population that in most cases

encodes aberrant translation products. The transcript

structures in ancestral and closely related species were

also analyzed and it was suggested that mis-splicing of

TaVp-1 genes originated before the evolution and

domestication of bread wheat and contributed to

susceptibility to PHS in modern hexaploid wheat

varieties (McKibbin et al. 2002). However, the level of

correctly spliced TaVp-1 was determined in mature

embryos of dormant and non-dormant cultivars,

indicating a positive correlation between TaVp-1

expression level, seed dormancy and embryo sensi-

tivity to ABA (Nakamura and Toyama 2001, Yang

et al. 2007a). In wild oats (Avena fatua), the expres-

sion of AfVp-1 is controlled by the interaction between

the environment and genotype, with a close correlation

between AfVp-1 mRNA levels and seed dormancy

being observed (Jones et al. 1997). Transgenic wheat

seeds expressing the AfVp-1 cDNA showed increased

dormancy and resistance to PHS (McKibbin et al.

2002).

Bread wheat (Triticum aestivum L.) is an allohex-

aploid species with A, B and D genomes. Its origination

and evolution have been investigated extensively, and

it is generally accepted that two evolutionary events

contributed to the formation of hexaploid wheat

(Feuillet et al. 2001; Huang et al. 2002; Gu et al.

2004; Petersen et al. 2006). The first one was the

hybridization between Triticum (T) urartu Thum (A

genome donor) and Aegilops (Ae) speltoides Tausch or

a closely related species (B genome donor), resulting in

the formation of the tetraploid T. dicoccoides (Korn. ex

Asch. et Graeb) Schweinf (wild emmer wheat, AABB

genome). Subsequently, T. dicoccon Schrank (emmer,

a domesticated form of T. dicoccoides) hybridized with

Ae. tauschii Cosson (the D genome donor), resulting in

hexaploid bread wheat (AABBDD). Durum wheat

(T. durum Desf., AABB genome), an important cereal

used for making pasta, is another domesticated form of

T. dicoccoides, and is closely related to T. dicoccon

(Salamini et al. 2002; Ozkan et al. 2005; Luo et al.

2007; Jauhar 2007). T. boeoticum Boiss (wild einkorn

wheat, AmAm) is a wild diploid wheat species closely

related to T. urartu, and its domesticated form

T. monococcum L. is still cultivated to a limited extent

(Gill and Friebe 2002; Salamini et al. 2002).

Our previous studies have explored the occurrence

of five TaVp-1B (TaVp-1Ba, TaVp-1Bb, TaVp-1Bc,

TaVp-1Bd, and TaVp-1Be) alleles on chromosome 3B

in Chinese and European wheat germplasm, with

TaVp-1Ba, TaVp-1Bb and TaVp-1Bc being found to be

particularly widespread in cultivars which differ in

PHS tolerance and ABA responsiveness (Yang et al.

2007a, b; Xia et al. 2008, 2009). Functional analysis of

these three TaVp-1B alleles in Arabidopsis and wheat

elucidated that although wheat TaVp-1 exhibited mis-

splicing phenomenon (McKibbin et al. 2002; Yang

et al. 2007a), the correctly spliced transcripts still

Euphytica

123

Author's personal copy

retained the conserved function of their counterparts in

maize and Arabidopsis and play important roles in

determining wheat seed germination, dormancy and

PHS tolerance (unpublished data). Furthermore, anal-

ysis of a set of 168 CIMMYT wheat elite germplasm

lines identified five new alleles of TaVp-1Aa (the wild-

type allele) on chromosome 3A (TaVp-1Ab, TaVp-

1Ac, TaVp-1Ad, TaVp-1Ae and TaVp-1Af), which

showed different responsiveness upon ABA exposure

(Sun et al. 2011). The diverse range of TaVp-1 alleles

or haplotypes presented in bread wheats indicated that

the variations may either be derived from its progen-

itor or have arisen during evolution, speciation and/or

domestication.

Taken together, it has been suggested that mis-

splicing of TaVp-1 is a major cause of low dormancy

and PHS susceptibility of bread wheats (McKibbin

et al. 2002) and the expression level of correctly

spliced TaVp-1 transcripts is positively correlated with

wheat seed dormancy and PHS tolerance (Nakamura

and Toyama 2001; Yang et al. 2007a). Here in this

study, we investigated the Vp-1 haplotypes in 77

accessions of wheat related species including

T. monococcum (genome Am), T. boeoticum (genome

Am), T. durum (genomes A and B), T. dicoccoides

(genomes A and B) and Ae. tauschii (genome D). Our

purpose was to discover new alleles or haplotypes of

Vp-1 in wheat related species with less mis-splicing.

Such alleles should lead to higher expression of

correctly spliced transcripts, and thus be useful in

breeding against PHS problem in bread wheat. More-

over, exploring the Vp-1 haplotypes in Triticum

species may provide information on the origin and

evolution of the diversity of TaVp-1 in bread wheats

and facilitate the utilization of Triticum species in

development of synthetic wheat and improvement of

PHS resistance of bread wheats as well.

Materials and methods

Plant materials

A total of 77 accessions of wheat related species,

including 34 accessions of T. monococcum, five of

T. boeoticum, 16 of T. durum, five of T. dicoccoides

and 17 of Ae. tauschii, with germplasm accession

number as indicated in Table 1 were used to detect

haplotypes of the Vp-1A, Vp-1B and Vp-1D genes. At

the same time, three bread wheat (T. aestivum L)

cultivars, Wanxian white wheat (a typical PHS

tolerant landrace), Xinong 979 (a PHS tolerant

cultivar) and Zhongyou 9507 (a PHS susceptible

cultivar), were used as controls to determine the

expression level. All accessions were provided by the

Chinese National Crop Germplasm and Genebank

Centre, Institute of Crop Science, Chinese Academy

of Agricultural Sciences (CAAS), China. They were

planted at the CAAS experimental station in late

September 2008 and 2009. All plants were grown side

by side and each plot consisted of ten 2 m rows and

was grown under normal field management.

ABA sensitivity tests

Seeds of Ae34, Ae42 and Ae43 at 50 days after

pollination (DAP) and other accessions at 35 DAP

were harvested, hand-threshed and sterilized with

0.1 % HgCl2, and then cut with a blade to break the

dormancy (Kawakami et al. 1997). The half-grains

with embryos were incubated on filter paper with

water or 50 lM ABA solutions at room temperature

(22–25 �C) for at least 10 days. The experiment was

repeated three times by using 50 seeds of each

accession, and the percentage of germination was

determined by dividing the number of germinated

seeds by the total number of seeds. Caryopses were

counted as germinated when the radical was 1–2 mm

or greater in length. Results were presented as the

means of three replicates.

DNA extraction and PCR amplification

Genomic DNA was isolated from dry kernels as

described by Gale et al. (2001). The sequences of

gene-specific primers were all listed in Table 2. PCR

reactions were performed in an MJ Research PTC-200

thermal cycler in a total volume of 50 ll including

5 ll 10 PCR buffer, 125 lM of each dNTPs, 8 pmol of

each primer, 2.0 units of rTaq polymerase and 100 ng

of template DNA. The following conditions for PCR

amplification were 94 �C for 5 min, followed by 36

cycles of 94 �C for 1 min, 53–68 �C for 1 min and

72 �C for 1 min, with a final extension of 72 �C for

10 min. Amplified PCR fragments were separated on a

1.5 % agarose gel, stained with ethidium bromide, and

visualized using UV light.

Euphytica

123

Author's personal copy

Table 1 Plant materials

used in this studyT. monococcumAm genome

T. boeoticumAm genome

T. durumAB genome

T. dicoccoidesAB genome

Ae. tauschiiD genome

M01 MDR035 B01 Dr1 Ds3 Ae34

M02 MDR036 B03 Dr2 Ds4 Ae35

M04 MDR037 B05 Dr3 Ds6 Ae37

M05 MDR038 B08 Dr4 Ds7 Ae38

MDR001 MDR039 B09 Dr8 Ds8 Ae39

MDR002 MDR040 Dr10 Ae42

MDR024 MDR041 Dr11 Ae43

MDR025 MDR042 Dr12 Ae46

MDR026 MDR043 Dr13 Y57

MDR027 MDR044 Dr14 Y59

MDR028 MDR045 Dr17 Y60

MDR029 MDR046 Dr18 Y92

MDR030 MDR047 Dr22 Y93

MDR031 MDR048 Dr24 Y95

MDR032 MDR049 Dr28 Y96

MDR033 MDR050 Langdon Y98

MDR034 MDR308 Y99

Table 2 Primer sets used for cloning Vp-1 gene and semi-quantitative RT-PCR analysis of Vp-1A, Vp-1B and Vp-1D homologues in

wheat related species

Primer sets Upstream (50—30) Downstream (50—30) Annealing

(�C)

Fragment

size

(-bp)

Vp-1AF1/R1 ATCCAAACCGGCGGCTTCCCTCAAGA CAAAATCGATCGATGGGAGTACTA G 56 1,108

Vp-1AF2/R2 AGGACATCGGCACATCTCA CTGGTCAGTTTGCAACATGCAAC 53 912

Vp-1AF3/R3 TGGAGATCCGGCAGGGAG AG CCAGAGGCCTCCCCAGCCA 67 1,253

Vp-1AF4/R4 GAATGAGCTGCAGGAGGGTGA GCAATGCATGACTAACTAGG 58 1,207

Vp-1BF1/R1 ATCCAAACCGGCGGCTTCCCTCAAGA CTTACCGGTACCGCATGCTCCAG 60 1,031

Vp-1BF2/R2 AGGACATCGGCACATCTCA CAAAATGGCAGCAACTGATCAGTTC 55 960

Vp-1BF3/R3 ATGGACGCCTCCGCCGGCTC CTGCTGCTGCAGGCACGACAA 65 1,227

Vp-1BF4/R4 CAATGAGCTGCAGGAGGGTGA ATCATCCCTAACTAGGGCTACG 66 911

Vp-1DF1/R1 ATCCAAACCGGCGGCTTCCCTCAAGA GAACGTGCGTGTCCCACACAC 60 1,214

Vp-1DF2/R2 AGGACATCGGCACATCTC A CCGCCTTATATTTTGATACGC 60 1,025

Vp-1DF3/R3 TGGAGATCCGGCAGGGAG AG CTGGCCCTGGACGGCATGC 67 1,282

Vp-1DF4/R4 GAATGGCTGCAGGAGGG TGA CCGATAGCTACTTTAGTATCAC 58 1,033

RTVp-1AF/R ATCCAAACCGGCGGCTTCCCTCAAGA GCTTGGCTAGATCCTGTTGCGCTCTC 68 672

RTVp-1BF/R ATCCAAACCGGCGGCTTCCCTCAAGA CTTGTGCTTGGCTAGATCCTGTTGA 60 672

RTVp-1DF/R ATCCAAACCGGCGGCTTCCCTCAAGA CTTCTCTTTGCAACCACCGTCTTG 62 672

Actin up/down GTTTCCTGGAATTGCTGATCGCAT CATTATTTCATACAGCAGGCAAGC 62 410

Euphytica

123

Author's personal copy

RNA isolation and semi-quantitative RT-PCR

analysis

Total RNA was extracted from the embryos of 50 DAP

seeds for Ae. tauschii species and 35 DAP for the rest

of the tested species as described by Chang et al.

(1993). The concentration and quality of RNA were

determined spectrophotometrically by the absorbance

at 260 nm and by the A260/A280 ratio, respectively.

RNA integrity was assessed by comparing the relative

intensities of the 28S and 18S rRNA bands in 1.2 %

(w/v) agarose gels containing 2.2 M formaldehyde.

cDNA was synthesized from 5 lg of the total RNA

using M-MLV reverse transcriptase (Transgen) with

random hexamer primer oligo d(T)18 according to the

manufacturer’s instructions. RT-PCR primers for each

target genes and primers for the wheat actin gene

which was included as an internal control in each

reaction in order to normalize the expression level of

Vp-1 genes (Yang et al. 2007a) were listed in Table 2.

Semi-quantitative RT-PCR reactions were performed

in an MJ Research PTC-200 thermal cycler in a total

volume of 25 ll, using the protocol in the instruction

manual of the GC PCR kit (Clontech), including 500 ng

of above cDNA template. The reaction conditions were

94 �C for 5 min, followed by 36 cycles of 94 �C for

1 min, 60–68 �C for 1 min and 72 �C for 1 min, with a

final extension of 72 �C for 10 min. The RT-PCR

products were separated on a 2.0 % agarose gel. Values

were normalized with the amplification rate of the actin

gene as a constitutively expressed internal control. Three

replicates were performed for each sample.

DNA sequencing and analysis

The PCR and cloned products were sequenced from

both strands by Shanghai Sangon Biological Technol-

ogy Co. Ltd. (http://www.sangon.com). Sequence

analysis and characterization were performed using

software DNAMAN (http://www.lynon.com).

Results

Isolation and sequence analysis of the haplotypes

of Vp-1 orthologs in wheat related species

A total of 77 accessions of wheat related species were

used to detect variation by using the genome-specific

primer sets listed in Table 2. Firstly, we detected the

Vp-1 polymorphisms in each domain by PCR using

genome-specific primers, for example, the polymor-

phisms located in the B3 domain of Vp-1 orthologs

were determined with the primer sets Vp-1AF2/R2, Vp-

1BF2/R2 and Vp-1DF2/R2, respectively (Fig. 1), no

polymorphism of PCR product was detected in other

domains except for these primer sets. Based on this

screening, eleven accessions, B01, B03, B05,

MDR034, MDR035, MDR037, Dr18, Dr24, Ae34,

Ae42 and Ae43 (Table 1), were selected as represen-

tatives of each polymorphism type to isolate the full-

length sequences using genome-specific primers

(Table 2). Sequence analyzes showed that compared

with TaVp-1Aa, TaVp-1Ba and TaVp-1Da in bread

wheat (Genbank accession no. AJ400712, AJ400713

and AJ400714), a total of 11 novel Vp-1 haplotypes

were identified, including six novel Vp-1A haplotypes

in T. boeoticum and T. monococcum designated as

TbVp-1A1 (from B01), TbVp-1A2 (from B03), TbVp-

1A3 (from B05), TmVp-1A1 (from MDR034), TmVp-

1A2 (from MDR035) and TmVp-1A3 (from M037),

respectively. Two new Vp-1B haplotypes were iden-

tified in T. durum which were designated as TduVp-

1B1 (from Dr18) and TduVp-1B2 (from Dr24), while

three Vp-1D haplotypes were identified in Ae. tauschii

and designated as AetVp-1D1 (from Ae34), AetVp-1D2

(from Ae42) and AetVp-1D3 (from Ae43), respectively

(Table 3). The sequences of these haplotypes were

deposited in the GenBank under the accession numbers

of JN398146–JN398156, respectively.

As shown in Table 3, many more variations were

detected in species with the AmAm genome. Compared

with TaVp-1Aa in bread wheat, all six haplotypes from

T. boeoticum and T. monococcum had a 41 bp deletion

at position 1,952–1,992 bp located in the second

intron region of B3 domain, and a 31 bp deletion at

3,605–3,635 bp, 4 bp and 3 bp deletions at

2,182–2,185 bp and 3,207–3,209 bp and a 2 bp

insertion at 2,098–2,099 bp, which all were located

in the third intron region of the B3 domain (Fig. 2). In

addition, one haplotype (TbVp-1A2) from T. boeoti-

cum had an additional 46 bp deletion (TCTTCTTCT

TCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC

TTCT) at 2,720–2,765 bp, whereas other two hap-

lotypes TbVp-1A2 and TbVp-1A3 both had an

additional 25 bp deletion (TCCTTCTTCTTCT

TCTTCTTCTTCT) at 2,720–2,724 bp, except that

a 36 bp deletion was also found in TbVp-1A2

Euphytica

123

Author's personal copy

(Fig. 2). For the three haplotypes from T. monococ-

cum, all of them had an additional 49 bp deletion

(TCTTCTTCTTCCTTCTTCTTCTTCTTCTTCTT

CTTCTTCTTCTTCTTCT) at 2,759–2,807 bp

except for TmVp-1A2 from MDR035 which also

had a 43 bp insertion at 2,373–2,415 bp (Fig. 2).

However, although many insertions, deletions and

SNPs were detected, all were located in the intron

regions and did not result in the change of the amino

acid sequence. In addition, some SNPs were

detected in both the intron and exon regions, which

also not altered the coding sequence of amino acids

(Fig. 2). BLAST analysis against the TIGR plant

repeat database (http://plantrepeats.plantbiology.

msu.edu/index.html) revealed that the 43 bp inser-

tion corresponded to the partial coding sequence of

TbABI3 for the B3 transcription factor in T. mono-

coccum, and the 41 bp deletion was the partial

coding sequence of the Vp-1 protein in bread wheat.

Another three deletions of 25, 46 and 49 bp in

length, corresponded to repeated microsatellite

sequences, which were CTT, TCT and TTC repeats,

respectively.

By contrast, little variation was observed in the

tested accessions of T. durum with the AABB

genomes. Two Vp-1B haplotypes were identified from

T. durum. One, TduVp-1B1, had one 4 bp insertion at

position 2,654–2,657 bp and one 83 bp deletion at

2,713–2,795 bp located in the third intron region

within the B3 domain, except for several SNPs located

in the intron region of B3 domain or upstream of this

region (Fig. 2). Actually, this haplotype was exactly

the same as the TaVp-1Be haplotype identified in the

PHS resistant Chinese landrace Hongheshangtou

(Yang et al. 2009). The second haplotype, TduVp-

1B2, was almost identical to TaVp-1Ba, except that

several SNPs were detected at upstream of the B3

domain. Since these SNPs did not result in amino acid

substitutions, we presumed that TduVp-1B2 was the

same as Vp-1Ba in bread wheat. These results

demonstrated that T. durum has a close relationship

with bread wheat with the donor B genome being

retained the same during wheat speciation process.

In addition, three haplotypes were identified in Ae.

tauschii (the D genome donor of bread wheat). All

these haplotypes contained a 17 bp deletion

(1,703–1,720 bp) located upstream of B3 doamin

(Fig. 2). In addition, the AetVp-1D1 from Ae34 and

AetVp-1D3 from Ae43 also had a 160 bp deletion at

position 2,813–2,972 bp and a 9 bp insertion at

2,734–2,742 bp, while AetVp-1D2 from Ae42 had

only 2 bp deletion. And these deletions and insertion

occurred in the third intron region of the B3 domain

(Fig. 2). BLAST analysis against the TIGR plant

repeat database (http://plantrepeats.plantbiology.msu.

edu/index.html) revealed that this 160 bp deletion was

homologous with a rice retrotransposon factor

(LOC_Os08g38690) with 99.38 % homology. Since

TaVp-1D (Genbank accession no. AJ400714) was

used as a control for Vp-1 haplotypes analysis, this

deletion in AetVp-1D3 suggests that this retrotranspo-

son might insert into wheat genome during evolution.

Phylogenetic trees were generated based on differ-

ent algorithms. These generated trees were highly

Fig. 1 PCR fragments amplified with specific primers (Vp-

1AF2/R2, Vp-1BF2/R2 and Vp-1DF2/R2) in B3 domain in some

wheat related species. a Some haplotypes from T. boeoticum and

T. monococcum were listed from left to right. B05, B03, B01,

B09, MDR040, MDR041, MDR042, MDR043, MDR044,

MDR045, MDR046, MDR047, MDR048, MDR049,

MDR050. b The haplotypes from T. dicoccoides and T. durum

were listed from left to right. Ds8, Ds7, Ds6, Ds4, Ds3, Chinese

Spring, Dr28, Langdon, Dr1, Dr2, Dr3, Dr4, Zhongyou 9507,

DL 2000 marker, Dr8, Dr10, Dr11, Dr12, Dr13, Dr14, Dr17,

Dr18, Dr22, Dr24. c The haplotypes from Ae. tauschii were

listed from left to right. Chinese Spring, Y99, Y98, Y96, Y95,

Y93, Y92, Y60, DL 2000 marker, Y59, Y57, Zhongyou 9507,

Ae46, Ae43, Ae42, Ae39, Ae38, Ae37, Ae35, Ae34

Euphytica

123

Author's personal copy

similar to each other, implying the validity of the

phylogenetic relationship analysis. The results of

phylogenetic analysis indicated that the Vp-1 haplo-

types from the genomes Am, B and D were clustered in

three different trees. The genome tribe for A, B and D

genomes were further divided into two clusters, with

one cluster comprised of the Vp-1 homologues from

bread wheat, and the other the haplotypes from wheat

related species (Fig. 3).

Expression characterization of the Vp-1 haplotypes

in wheat related species

In order to see the possible impact of the haplotype

differences characterized by sequencing on the

expression patterns of the three Vp-1 homologues in

wheat related species, semi-quantitative RT-PCR

analysis was carried out by using the actin gene as

an internal control. Consistent with the phenomena

Table 3 The indels and SNPs in 11 Vp-1 haplotypes detected in wheat related species

Species Genomes Accessions Haplotypes The indels and SNPs of different Vp-1 haplotypes from wheat related

species and homology with their orthologs from common wheat (compared

with AJ400712, AJ400713 and AJ400714 in Genbank)

Upstream of B3

domain

B3 domain Homology

(%)

T. boeoticum AmAm B01 TbVp-1A1 19 SNPs 46 bp, 41 bp, 31 bp, 4 bp, 3 bp and

three 1 bp deletions, 2 bp insertion

and 45 SNPs

95.47

B03 TbVp-1A2 14 SNPs 41 bp, 36 bp, 31 bp, 25 bp, 4 bp, 3 bp

and three 1 bp deletions, 2 bp

insertion and 41SNPs)

94.92

B05 TbVp-1A3 22 SNPs 41 bp, 31 bp, 25 bp, 4 bp, 3 bp and

three 1 bp deletions, 2 bp insertion

and 45 SNPs

95.91

T.monococcum

MDR034 TmVp-1A1 22 SNPs,1 bp

deletion

(downstream of B2

domain)

49 bp, 41 bp, 31 bp, 4 bp, 3 bp and

six 1 bp deletions, 2 bp insertion and

45 SNPs

95.11

MDR035 TmVp-1A2 19 SNPs, two 1 bp

deletion

(downstream of B2

domain)

49 bp, 41 bp, 31 bp, two 4 bp and one

3 bp deletion and three 1 bp

deletion, 2 bp and 43 bp insertion,

and 51 SNPs

94.44

MDR037 TmVp-1A3 22 SNPs 49 bp, 41 bp, 31 bp, two 4 bp and one

3 bp deletion, three 1 bp deletions,

2 bp insertion and 52 SNPs

95.17

T. durum AABB Dr18 TduVp-

1B13 SNPs 83 bp deletion, 4 bp insertion and 5

SNPs

97.65

Dr24 TduVp-

1B25 SNPs No variation 99.88

Ae. tauschii DD Ae34 AetVp-1D1 25 SNPs, 17 bp

deletion (1703 bp,

downstream of B2

domain)

160 bp deletion, 9 bp insertion, 1 bp

insertion and 18 SNPs

94.58

Ae42 AetVp-1D2 23 SNPs, 17 bp

deletion (1703 bp,

downstream of B2

domain)

2 bp deletion and 17 bp SNPs 98.16

Ae43 AetVp-1D3 23 SNPs, 17 bp

deletion (1703 bp,

downstream of B2

domain)

160 bp deletion, 9 bp insertion, 1 bp

insertion and 17 SNPs

94.65

Euphytica

123

Author's personal copy

observed by McKibbin et al. (2002), mis-spliced Vp-1

transcripts were also observed in embryos of haplo-

types from T. monococcum (MDR034, MDR035 and

MDR037), T. boeoticum (B01, B03 and B05),

T. durum (Dr18 and Dr24), and Ae. tauschii (Ae34,

Ae42 and Ae43), with only one of these transcripts

having the capacity to encode the correct protein

product (Fig. 4). However, the three Vp-1A haplotypes

from T. monococcum showed different splicing

patterns from that of T. boeoticum and bread wheat,

with the correctly spliced transcript being more

abundant in TmVp-1A2 from MDR035 than in

TmVp-1A1 and TmVp-1A3 (Fig. 4a). The three haplo-

types from T. boeoticum showed similar mis-splicing

patterns to that of bread wheat with TbVp-1A2 from

B03 having a higher amount of correctly spliced

transcripts than TbVp-1A1 and TbVp-1A3 (Fig. 4a).

This may indicate that the expression and mis-splicing

Fig. 2 Schematic representation of the diverse genetic struc-

tures of Vp-1 haplotypes detected on A, B and D genomes in this

set of wheat related species. ORFs were indicated by boxes and

A1, B1, B2, and B3 domains by shaded squares. Other symbols

representing deletions, insertions and SNPs were indicated as

following, respectively. Black diamond SNPs; single strikedopen inverted triangle 41 bp deletion; open triangle 2 bp

insertion; double striked open inverted triangle 4 bp deletion;

double striked open triangle 4 bp insertion; open inverted

triangle 1 bp deletion; filled triangle 43 bp insertion; filledinverted triangle deletions which were 46 bp in B01, 25 bp in

B03 and B05, and 49 bp in MDR034, MDR035, and MDR037,

respectively; double striked filled inverted triangle 3 bp

deletion; single striked filled inverted triangle 36 bp deletion;

black star 31 bp deletion; open circle 83 bp deletion; filledcircle 17 bp deletion; circle with horizontal bar 9 bp insertion;

white square 160 bp deletion; double striked open square 2 bp

deletion

Euphytica

123

Author's personal copy

pattern of TaVp-1A in modern bread wheat has been

inherited from species related to T. boeoticum rather

than species related to T. monococcum. Furthermore,

the two haplotypes from T. durum showed similar

patterns of mis-splicing transcripts to their TaVp-1B

counterparts in modern bread wheat with TduVp-1B1

from Dr18 having more abundant correctly spliced

transcripts than TduVp-1B2 (Fig. 4b). Moreover, the

three haplotypes of Ae. tauschii possessed the same

transcript patterns as TaVp-1D in bread wheat with

AetVp-1D2 from Ae42 having a slightly higher

amount of correctly spliced transcripts than the other

two. However, much higher expression levels of

correctly spliced transcripts were observed in TaVp-

1D of bread wheat than its homologues in Ae. tauschii

(Fig. 4c).

ABA sensitivity tests of different Vp-1 haplotypes

In order to determine the ABA responsiveness of the

detected different haplotypes, seeds of accessions of T.

boeoticum, T. monococcum and Ae. tauschii with

different haplotypes were stratified with or without 50

uM ABA solution. As shown in Fig. 5a, MDR035

(TmVp-1A2) had high ABA sensitivity while MDR034

(TmVp-1A1) and MDR037 (TmVp-1A3) showed low

ABA sensitivity, while B01 (TbVp-1A1) showed lower

ABA sensitivity compared with B05 (TbVp-1A3) and

B03 (TbVp-1A2) (Fig. 5b). In T. durum, both Dr18

(TduVp-1B1) and Dr24 (TduVp-1B2) showed high

ABA sensitivity (Fig. 5c), especially Dr18 which had

the TduVp-1B1 haplotype identical to the TaVp-1Be

haplotype detected in the PHS tolerant Chinese

landrace Hongheshangtou. Moreover, the Ae. tauschii

accession Ae34 (AetVp-1D1) showed no sensitivity to

the inhibitory action of ABA to germination, while

Ae42 (AetVp-1D2) had higher ABA sensitivity com-

pared with Ae34 (AetVp-1D1) and Ae43 (AetVp-1D3)

(Fig. 5d). It should be noted that the ABA sensitivities

of all haplotypes identified in wheat related species in

this study were closely related to the level of the

correctly spliced Vp-1 transcripts as reported in other

studies (Nakamura and Toyama 2001; Yang et al.

2007a; Utsugi et al. 2008).

Discussion

In this study, two Vp-1B haplotypes, TduVp-1B1and

TduVp-1B2 were identified from T. durum. Sequence

alignment and phytogenetic analysis showed that the

first haplotype, TduVp-1B1, was identical to TaVp-

1Be, while the second, TduVp-1B2, was almost

identical to TaVp-1Ba with only 5 SNPs detected

upstream of the B3 domain. Both of them showed

similar mis-spliced transcripts patterns to their

Subtree B

Subtree D

Subtree A

TaVp-1Bb Wanxian white wheat, T. aestivum

TduVp-1B1 Dr18 T. durum

TmVp-1A2 MDR037 T. monococcum

AetVp-1D3 Ae43 Ae. tauschii

TaVp-1Ba T. aestivum

TaVp-1Bc Xinong979 T. aestivum

TduVp-1B2 Dr24 T. durum

TaVp-1D T. aestivum

AetVp-1D2 Ae42 Ae. tauschii

AetVp-1D1 Ae34 Ae. tauschii

TaVp-1Aa T. aestivum

TbVp-1A2 B03 T. boeoticum

TbVp-1A1 B01 T. boeoticum

TbVp-1A3 B05 T. boeoticum

TmVp-1A1 MDR034 T. monococcum

TmVp-1A3 MDR035 T. monococcum

B genome

D genome

A genome

76

99

100

100

66

72

100

100

100

72

100

94

0.005

Fig. 3 Phylogenetic tree of the Vp-1 gene families in common

wheat and its related species. The tree was constructed by the

software MEGA version 3.1 with neighbour joining algorithm,

including 11 new haplotypes identified in this study and five

haplotypes identified so far in common wheat. Bootstrap values

were shown and the scale bar indicated the number of

nucleotide substitutions per site

Euphytica

123

Author's personal copy

counterpart TaVp-1Be in modern bread wheat with

TduVp-1B1 from Dr18 producing more abundant

correctly spliced transcripts and higher ABA sensitiv-

ity than TduVp-1B2 (Figs. 3b, 4c). This suggested that

the bread wheat genotype with TaVp-1Be or durum

wheat Dr18 may be useful material for utilization in

breeding for PHS resistance of either synthetic wheats

or common bread wheats. At the same time, we might

conclude that the Vp-1 orthologs in T. durum had a

close relationship with bread wheats, not only at the

sequence level but also in the mis-splicing pattern as

indicated in Fig. 4b. However, no TaVp-1B haplo-

types with the 193 bp insertion or the 25 bp deletion

detected in the Chinese PHS tolerant landrace and

European bread wheats (Yang et al. 2007b; Xia et al.

2008) were found in this set of T. durum: this may be

due to the limited number lines analyzed or to the fact

that the variation has arisen only recently in bread

wheat.

Furthermore, many more variations were detected

in species with the AmAm genome with some having

25 bp deletion, a 46 bp deletion and a 49 bp deletion,

which was comprised of CTT, TCT and TTC simple

sequence repeats (SSRs), respectively. These dele-

tions were also detected in CIMMYT wheat germ-

plasm where the association of the number variation of

CTT repeats with PHS resistance and ABA sensitivity

was observed, implying the functional role of these

SSRs inside the target genes in wheat (Sun et al. 2011).

The most likely mechanism for changes in SSRs

length is replication slippage, which occurs during

meiotic replication caused by a temporary separation

of the nascent from the template strand, followed by a

misplaced realignment forming a loop, thereby lead-

ing to a change in the number of motif reiteration

(Tautz and Schlotterer 1994). Inherited length changes

in SSRs are suggested to act as ‘digital’ genetic data,

allowing for gradual changes in physical properties,

Fig. 4 Semi-quantitative RT-PCR analysis of Vp-1 haplotypes

in related species, the 672 bp fragments was the correctly

transcribed one which can encoded the full-length Vp-1 protein.

a Semi-quantitative RT-PCR analysis of Vp-1A in 35 DAP

embryos of three T. monococcum species (1 MDR034; 2MDR035; 3 MDR037), three T. boeoticum species (4 B01; 5B03; 6 B05) and three common wheat cultivars differing in PHS

tolerance (7 Xinong 979; 8 Wangxian white wheat; 9 Zhongyou

9507). b Semi-quantitative RT-PCR analysis of Vp-1B in 35

DAP embryos of two T. durum species (1 Dr24; 2 Dr18) and

three common wheat cultivars differing in PHS tolerance (3Xinong 979; 4 Wangxian white wheat; 5 Zhongyou 9507).

c Semi-quantitative RT-PCR analysis of Vp-1D in 50 DAP

embryos of three common wheat cultivars differing in PHS

tolerance (1 Xinong 979; 2 Wanxian white wheat; 3 Zhongyou

9507) and three Ae. tauschii species (4 Ae43; 5 Ae42; 6 Ae34)

Euphytica

123

Author's personal copy

with reduced risk of drastic mutations that might be

lethal for the organism (King 1997). And therefore the

markers designed based on SSRs often present high

levels of inter- and intra-specific polymorphism,

particularly when tandem repeats number ten or

greater (Sun et al. 2011). As indicated in Fig. 2, these

SSRs deletions indeed happened at the same position,

implying that the occurence of these SSRs deletions

during evolution and speciation. However, none of

these deletions and other deletions such as 41 and

36 bp deletions, and 43 bp insertion detected in these

six haplotypes from T. boeoticum and T. monococcum

(Fig. 2; Table 3) has so far been reported in bread

wheats. Meanwhile, the splicing patterns of the three

Vp-1 haplotypes from T. monococcum were different

from those of T. boeoticum and bread wheat, whereas

the related tetraploid species (Triticum turgidum) and

ancestral diploids contained mis-spliced Vp-1 tran-

scripts structurally similar or identical to those in

modern bread wheat (McKibbin et al. 2002). This may

indicate that the Vp-1A locus in bread wheat was

derived from species related to T. boeoticum rather

than T. monococcum. Moreover, many variations

detected in the T. monococcum genome were not

detected in the common wheat homologue. This

suggests that T. aestivum A genome diverged from

Am genome through either polyploidization or

domestication.

In contrast to T. monococcum, the D genome from

Ae. tauschii has three haplotypes which have not been

detected in bread wheat thus far (Yang et al. 2007a, b;

Xia et al. 2008; Sun et al. 2011). Compared to bread

wheat, all three haplotypes contained a 17 bp deletion

downstream of the B3 domain. Moreover, AetVp-1D1

and AetVp-1D3 have an additional 160 bp deletion in

the B3 domain similar to a homologue of rice

retrotransposon LOC_Os08g38690, providing further

evidence that retrotransposition has played a role in

wheat evolution. The retrotransposon insertion

appears to be associated with higher ABA sensitivity,

Fig. 5 ABA sensitivity assay of wheat related species with

different Vp-1 haplotypes. a The percentages of germination

were indicated by symbols open triangle, open square and opencircle for MDR034, MDR035 and MDR037 in water, respec-

tively, and filled triangle, filled square and filled circle for these

species in ABA, respectively. b The percentages of germination

were indicated by symbols open triangle, open square and opencircle for B03, B01 and B05 in water, respectively, and filledtriangle, filled square, and filled circle for these species in ABA,

respectively. c The percentages of germination were indicated

by symbols open triangle, and open square for Dr18, Dr24 in

water, respectively, filled triangle and filled square for these

species in ABA, respectively. d The percentages of germination

were indicated by symbols open triangle, open square and opencircle for Ae34, Ae42 and Ae43 in water, respectively, and filledtriangle, filled square and filled circle for these species in ABA,

respectively

Euphytica

123

Author's personal copy

since AetVp-1D1 and AetVp-1D3 haplotypes had

lower ABA sensitivity than AetVp-1D2 (Fig. 5d). In

our previous study, an insertion of 193 bp retrotrans-

poson like sequence which is highly homologous with

the maize and barley gypsy/Ty3 retrotransposon

Tekay (AF050455 and AY040832), was identified in

TaVp-1Bb from PHS resistant Chinese landraces with

high ABA sensitivity. This insertion might change the

secondary structure of the Vp-1 mRNA and thus the

amount of correctly spliced transcripts, resulting in

improved ABA sensitivity and PHS resistance at last

(Yang et al. 2007a, b). At the same time, the

contribution of the active movement/insertion of

retrotransposons to the evolution and speciation of

wheat and its related species were further augmented

in this study.

Furthermore, although these three haplotypes from

Ae. tauschii had similar mis-splicing patterns to TaVp-

1D in common wheat (Fig. 4c), they had much lower

ABA sensitivities than the haplotypes from the A and

B genome progenitors (Fig. 5), implying the contri-

bution of Vp-1D from Ae. tauschii to the PHS

susceptibility of bread wheat and at least the acces-

sions listed here were not suitable for synthetic wheat

breeding program. However, considering that only 17

accessions of Ae. tauschii were selected in this study,

the existence of PHS tolerant cultivars in bread wheat

may remind us of the fact that only a small number of

Ae. tauschii genotypes of restricted geographic origin

were involved in the polyploidization process during

the formation of bread wheat, and the genetic diversity

of the D genome in common wheat is therefore

relatively narrow (Yan et al. 2004).

In recent years, it has become clear that introns

participate in gene and genome structure and function

(Erkkila and Ahokas 2001; Fiume et al. 2004; Fu et al.

2005; Sjakste and Zhuk 2006). Introns encode regu-

latory elements with autocatalytic or alternative

splicing activity, control gene transcription, and

regulate transposon mobility either as endonucleases

or reverse transcriptases (Lewin 2004). For example,

in barley, a 126 bp insertion/deletion event (indel) in

the 50 region of intron III in the b-amylase gene is

associated with allelic variants in the genes encoding

enzymes of low or high thermo-stability (Erkkila and

Ahokas 2001), and deletions in the promoter region

and first intron of the waxy gene similarly result in

decreased gene expression and reduced amylose levels

(Domon et al. 2002; Patron et al. 2002). Our previous

studies have identified five TaVp-1B alleles on chro-

mosome 3B, TaVp-1Ba, TaVp-1Bb, TaVp-1Bc, TaVp-

1Bd, and TaVp-1Be, in Chinese and European wheat

germplasm with TaVp-1Ba, TaVp-1Bb and TaVp-1Bc

being particularly widespread in cultivars with differ-

ent PHS tolerance and ABA responsiveness (Yang

et al. 2007a, b; Xia et al. 2008, 2009). Among them,

TaVp-1Bb and TaVp-1Bc have the insertion and

deletion of a 193 bp retrotransposon and an 83 bp

transposon in the third intron region of B3 domain in

TaVp-1Ba, respectively. Association analysis showed

that most PHS resistant genotypes had either the

TaVp-1Bb or TaVp-1Bc alleles compared with PHS

susceptible genotypes, with the TaVp-1Bb allele

which has the higher accumulation of correctly spliced

transcripts being associated with higher ABA sensi-

tivity and PHS resistance (Yang et al. 2007a, b).

Furthermore, while the TaVp-1Bd detected in Euro-

pean wheats has a 25 bp deletion, the TaVp-1Be

identified in the Chinese landrace Hongheshangtou

with higher PHS resistance has both an 83 bp deletion

(the same as in TaVp-1Bc) and a 4 bp insertion (Xia

et al. 2008; Yang et al. 2009). Moreover, five novel

TaVp-1A alleles (TaVp-1Ab, TaVp-1Ac, TaVp-1Ad,

TaVp-1Ae and TaVp-1Af) which resulted from the

insertion or deletion of the 1–11 CTT SSRs in the third

intron region of B3 domain, were also detected in a set

of CIMMYT elite germplasm, which showed different

responsiveness to ABA (Sun et al. 2011). In this study,

11 haplotypes were identified in this set of wheat

related species, most variations were found in the third

intron region of B3 domain, semi-quantitative RT-

PCR analysis and ABA sensitivity assay confirmed the

co-relationship between the accumulation of correctly

spliced transcripts in these haplotypes and their ABA

sensitivities, suggesting the functional roles of these

deletions or insertions in speciation and evolution of

wheat and its related species (Figs. 4, 5). However, as

mentioned in the introduction section, except for the

functions of TaVp-1Ba, TaVp-1Bb and TaVp-1Bc were

verified by complementary analysis in Arabidopsis

ABI3 mutant lines (unpublished data), the exact

functions of other Vp-1 haplotypes including the

haplotypes identified here in this study need to be

further investigated by association studies in wheats or

complementary analyzes in Arabidopsis.

Nevertheless, the analyzes of the Vp-1 haplotypes

in wheat related species in this study may provide

some evidences for the origin and evolution of Vp-1

Euphytica

123

Author's personal copy

diversity in modern bread wheats and some haplotypes

such as TbVp-1A2 detected in T. boeoticum and

TduVp-1B1 in T. durum species might be valuable in

breeding synthetic wheats against the PHS problem.

And once again, our study indicated that differences in

ABA sensitivity were closely linked to the amount of

correctly spliced Vp-1 transcripts. This may lay a basis

for the utilization of Triticum species in development

of PHS tolerant synthetic wheats and breeding for

improved PHS resistance of bread wheats.

Acknowledgments This project was partly funded by the

China National Basic Research Program (2009CB118300),

National Natural Science Foundation of China (30960177) and

Natural Science Foundation of Inner Mongolia (2009BS0301).

Rothamsted Research receives China Partnering Award (CPA

1604) and grant-aided support from the Biotechnology and

Biological Sciences Research Council (BBSRC) of the UK.

References

Bailey PC, McKibbin RS, Lenton JR (1999) Genetic map

location for orthologous VP-1 genes in wheat and rice.

Theor Appl Genet 98:281–284

Bobb AJ, Eiben HG, Bustos MM (1995) PvAlf, an embryo-

specific acidic transcriptional activator enhances gene

expression from phaseolin and phytohemagglutinin pro-

moters. Plant J 8:331–343

Chang S, Puryear J, Cairney J (1993) A simple and efficient

method for isolating RNA from pine trees. Plant Mol Biol

Rep 11:113–116

Domon E, Fujita M, Ishikawa N (2002) The insertion/deletion

polymorphisms in the waxy gene of barley genetic

resources from east Asia. Theor Appl Genet 104:132–138

Erkkila MJ, Ahokas H (2001) Special barley b-amylase allele in

a Finnish landrace line HA52 with high grain enzyme

activity. Hereditas 134:91–95

Feuillet C, Penger A, Gellner K, Mast A, Keller B (2001)

Molecular evolution of receptor-like kinase genes in

hexaploid wheat. Independent evolution of orthologs after

polyploidization and mechanisms of local rearrangements

at paralogous loci 1. Plant Physiol 125:1304–1313

Fiume E, Christou P, Giani S, Beviarion D (2004) Introns are

key regulatory elements of rice tubulin expression. Planta

218:693–703

Flintham JE (2000) Different genetic components control coat-

imposed and embryo-imposed dormancy in wheat. Seed

Sci Res 10:43–50

Fu D, Szucs P, Yan L, Helguera M, Skinner JS, von Zitzewitz J,

Hayes PM, Dubkovskii J (2005) Large deletions within the

first intron in VRN-1 are associated with spring growth

habit in barley and wheat. Mol Genet Genomics 273:54–65

Gale MD (1989) The genetics of pre-harvest sprouting in

cereals, particularly in wheat. In: Derera NF (ed) Pre-har-

vest weld sprouting in cereals, CRC, Boca Raton,

pp 85–110

Gale KR, Ma W, Zhang W, Rampling L, Hill AS, Appels R,

Morris P, Morrel M (2001) Simple high-throughput DNA

markers for genotyping in wheat. In: Eastwood R et al.

(eds) Proceedings of the 10th Australian wheat breeding

assembly, pp 26–31

Gill BS, Friebe B (2002) Cytogenetics, phylogeny and evolution

of cultivated wheats. In: Curtis BC, Rajaram S, Gomez

Macpherson H (eds) Bread wheat: improvement and pro-

duction. Food and Agriculture Organization of the United

Nations, Rome, pp 71–88

Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman

HM (1992) Isolation of the Arabidopsis ABI3 gene by

positional cloning. Plant Cell 4:1251–1261

Groos C, Gay G, Perretant MR, Gervais L, Bernard M, Dedryver

F, Charmet G (2002) Study of the relationship between pre-

harvest sprouting and grain color by quantitative trait loci

analysis in a white 9 red grain bread wheat cross. Theor

Appl Genet 104:39–47

Gu YQ, Coleman-Derr D, Kong XY, Anderson OD (2004)

Rapid genome evolution revealed by comparative

sequence analysis of orthologous regions from four Triti-ceae genomes. Plant Physiol 135:459–470

Hattori T, Terada T, Hamasuna ST (1994) Sequence and func-

tional analysis of the rice gene homologous to maize Vp-1.

Plant Mol Biol 24:805–810

Himi E, Mares DJ, Yanagisawa A, Noda K (2002) Effect of

grain color gene (R) on grain dormancy and sensitivity of

the embryo to abscisic acid (ABA) in wheat. J Exp Bot

53:1569–1574

Huang S, Sirikhachornkit A, Su X, Faris J, Gill B, Haselkorn R

et al (2002) Genes encoding plastid acetyl-CoA carboxy-

lase and 3-phosphoglycerate kinase of the Triticum/Aegi-lops complex and the evolutionary history of polyploidy

wheat. Proc Natl Acad Sci USA 99:8133–8138

Jauhar PP (2007) Meiotic restitution in wheat polyhaploids

(amphihaploids): a potent evolutionary force. J Hered

98(2):188–193

Jones HD, Peters NC, Holdsworth MJ (1997) Genotype and

environment interact to control dormancy and differential

expression of the viviparous 1 homologue in embryos of

Avena fatua. Plant J 12:911–920

Kawakami N, Miyake Y, Noda K (1997) ABA insensitivity and

low ABA levels during seed development of non-dormant

wheat mutants. J Exp Bot 48:1415–1421

King R (1993) Manipulation of grain dormancy in wheat. J Exp

Bot 44:1059–1066

King DG (1997) Evolutionary tuning knobs. Endeavor 21:36–40

Lewin B (2004) Genes VIII. Pearson, Prentice Hall, Upper

Saddle River

Luo MC, Yang ZL, You FM, Kawahara T, Waines JG, Dvorak J

(2007) The structure of wild and domesticated emmer

wheat populations, gene flow between them, and the site of

emmer domestication. Theor Appl Genet 114:947–959

Mares D, Mrva K, Cheong J, Williams K, Watson B, Storlie E,

Sutherland M, Zou Y (2005) A QTL located on chromo-

some 4A associated with dormancy in white- and red

grained wheats of diverse origin. Theor Appl Genet 111:

1357–1364

McCarty DR, Carson CB, Stinard PS, Robertson DS (1989)

Molecular analysis of viviparous-1: an abscisic acid

insensitive mutant of maize. Plant Cell 1:523–532

Euphytica

123

Author's personal copy

McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK

(1991) The viviparous-1 developmental gene of maize

encodes a novel transcriptional activator. Cell 66:895–905

McKibbin RS, Wilkinson MD, Bailey PC, Flintham JE, Andrew

LM, Lazzeri PA, Gale MD, Lenton JR, Holdsworth MJ

(2002) Transcripts of Vp-1 homologues are mis-spliced in

modern wheat and ancestral species. Proc Natl Acad Sci

USA 99:10203–10208

Nakamura S, Toyama T (2001) Isolation of a VP-1 homologue

from wheat and analysis of its expression in embryos of

dormant and non-dormant cultivars. J Exp Bot 52:875–876

Ozkan H, Brandolini A, Pozzi C, Effgen S, Wunder J, Salamini

F (2005) A reconsideration of the domestication geography

of tetraploid wheats. Theor Appl Genet 110:1052–1060

Patron NJ, Smith AM, Fahy BF, Hylton CM, Naldrett MJ,

Rossnagel BG, Denyer K (2002) The altered pattern of

amylose accumulation in the endosperm of low-amylose

barley cultivars is attributable to a single mutant allele of

granule-bound starch synthase I with a deletion in the

5-non-coding region. Plant Physiol 130:190–198

Petersen G, Seberg O, Yde M, Berthelsen K (2006) Phyloge-

netic relationships of Triticum and Aegilops and evidence

for the origin of the A, B, and D genomes of common wheat

(Triticum aestivum). Mol Phylogenet Evol 39:70–82

Rohde A, Ardiles-Diaz W, Van Montagu M, Boerjan W (1998)

Isolation and expression analysis of an abscisic acid-

insensitive 3 (ABI3) homologue from Populus trichocar-pa. J Exp Bot 49:1059–1060

Salamini F, Ozkan H, Brandolini A, Schafer-Pregl R, Martin W

(2002) Genetics and geography of wild cereal domestica-

tion in the near east. Nat Rev Genet 3:429–441

Shiota H, Satoh R, Watabe K, Harada H, Kamada H (1998)

C-ABI3, the carrot homologue of the Arabidopsis ABI3, is

expressed during both zygotic and somatic embryogenesis

and functions in the regulation of embryo-specific ABA-

inducible genes. Plant Cell Physiol 39:1184–1193

Sjakste TG, Zhuk AF (2006) Novel haplotype description and

structural background of the eventual functional

significance of the barley b-amylase gene intron III rear-

rangements. Theor Appl Genet 113:1063–1079

Sun YW, Jones HD, Yang Y, Dreisigacker S, Li SM, Chen XM,

Shewry PR, Xia LQ (2011) Haplotype analysis of vivipa-rous-1 gene in CIMMYT elite bread wheat germplasm.

Euphytica. doi:10.1007/s10681-011-0482-2

Tautz D, Schlotterer C (1994) Simple sequences. Curr Opin

Genet Dev 4:832–837

Utsugi S, Nakamura S, Noda K, Maekawa M (2008) Structural

and functional properties of viviparous 1 genes in dormant

wheat. Gene Genet Syst 83:153–166

Xia LQ, Ganal MW, Shewry PR, He ZH, Yang Y, Roder M

(2008) Evaluation of the viviparous-1 gene alleles in the

European wheat varieties. Euphytica 159:411–417

Xia LQ, Yang Y, Ma YZ, Chen XM, He ZH, Roder MS, Jones

HD, Shewry PR (2009) What can the viviparous-1 gene tell

us about wheat pre-harvest sprouting? Euphytica 168:

385–394

Yan YM, Zheng J, Xiao Y, Yu J, Hu Y, Cai M, Li Y, Hsam SLK,

Zeller FJ (2004) Identification and molecular character-

ization of a novel y-type HMW glutenin subunit gene from

Glu-1Dt locus of Aegilops tauschii. Theor Appl Genet

108:1349–1358

Yang Y, Ma YZ, Xu ZS, Chen XM, He ZH, Yu Z, Wilkinson M,

Jones DH, Shewry RP, Xia LQ (2007a) Isolation and

characterization of Vp-1 genes in wheat varieties with

distinct pre-harvest sprouting tolerance and ABA sensi-

tivity. J Exp Bot 58(11):2863–2871

Yang Y, Zhao XL, Xia LQ, Chen XM, He ZH, Roder MS

(2007b) Development and validation of a Vp-1 STS marker

for pre-harvest sprouting in Chinese wheats. Theor Appl

Genet 115:971–980

Yang Y, Chen XM, He ZH, Roder M, Xia LQ (2009) Distri-

bution of Vp-1 alleles in Chinese white-grained landraces,

historical and current wheat cultivars. Cereal Res Commun

37:169–177

Euphytica

123

Author's personal copy