Interaction of the Type IIa Na/Pi Cotransporter with PDZ Proteins

University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2001

Interaction of the type IIa Na/Pi cotransporter with PDZ proteins

Gisler, S M; Stagljar, I; Traebert, M; Bacic, D; Biber, J; Murer, H

Gisler, S M; Stagljar, I; Traebert, M; Bacic, D; Biber, J; Murer, H. Interaction of the type IIa Na/Pi cotransporterwith PDZ proteins. J. Biol. Chem. 2001, 276(12):9206-13.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:J. Biol. Chem. 2001, 276(12):9206-13.

Gisler, S M; Stagljar, I; Traebert, M; Bacic, D; Biber, J; Murer, H. Interaction of the type IIa Na/Pi cotransporterwith PDZ proteins. J. Biol. Chem. 2001, 276(12):9206-13.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:J. Biol. Chem. 2001, 276(12):9206-13.

Interaction of the type IIa Na/Pi cotransporter with PDZ proteins

Abstract

The type IIa Na(+)-dependent inorganic phosphate (Na/P(i)) cotransporter is localized in the apicalmembrane of proximal tubular cells and is regulated by an endocytotic pathway. Because molecularprocesses such as apical sorting, internalization, or subsequent degradation might be assisted byassociated proteins, a yeast two-hybrid screen against the C-terminal, cytosolic tail of type IIacotransporter was designed. Most of the potential proteins found belonged to proteins with multiplePDZ modules and were either identical/related to PDZK1 or identical to NHERF-1. Yeast traptruncation assays confined the peptide-protein association to the C-terminal amino acid residues TRL oftype IIa cotransporter and to single PDZ domains of each identified protein, respectively. The specificityof these interactions were confirmed in yeast by testing other apical localized transmembraneousproteins. Moreover, the type IIa protein was recovered in vitro by glutathione S-transferase-fused PDZproteins from isolated renal brush border membranes or from type IIa-expressing oocytes. Further, thesePDZ proteins are immunohistochemically detected either in the microvilli or in the subapicalcompartment of proximal tubular cells. Our results suggest that the type IIa Na/P(i) cotransporterinteracts with various PDZ proteins that might be responsible for the apical sorting, parathyroidhormone controlled endocytosis or the lysosomal sorting of internalized type IIa cotransporter.

Interaction of the type IIa Na/Pi-cotransporter with

PDZ proteins*

Serge M. Gisler !, Igor Stagljar §, Martin Traebert ¶, Desa Bacic ¶, Jürg Biber !Q, and

Heini Murer !

From the Institute of !Physiology, §Veterinary Biochemistry and ¶Anatomy, University

of Zürich-Irchel, CH-8057-Zürich, Switzerland

Running title :

Regulation of renal transporters by PDZ interactions

Address for correspondence

Dr. J. Biber

Institute of Physiology

University Zürich

Winterthurerstrasse 190

1

Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on November 30, 2000 as Manuscript M008745200 at H

auptbibliothek Universitaet Z

uerich Irchel. Bereich F

orschung, on February 8, 2010

ww

w.jbc.org

Dow

nloaded from

http://www.jbc.org/

CH-8057 Zürich

Tel. ++41 1 635 50 32

Fax: ++41 1 635 57 15

e-mail: [email protected]

SUMMARY

The type IIa Na/Pi-cotransporter is localized in the apical membrane of proximal

tubular cells and is regulated by an endocytotic pathway. Because molecular

processes such as apical sorting, internalization, or subsequent degradation might be

assisted by associated proteins, a yeast two-hybrid screen against the C-terminal,

cytosolic tail of type IIa cotransporter was designed.

Most of the potential proteins found belonged to proteins with multiple PDZ modules

and were either identical/related to PDZK1 or identical to NHERF-1. Yeast trap

truncation assays confined the peptide-protein association to the C-terminal amino

acid residues TRL of type IIa cotransporter and to single PDZ domains of each

identified protein, respectively. The specificity of these interactions were confirmed in

yeast by testing other apical localized transmembraneous proteins. Moreover, the

type IIa protein was recovered in vitro by GST-fused PDZ proteins from isolated

renal brush border membranes or from type IIa expressing oocytes. Further, these

PDZ proteins are immunohistochemically detected either in the microvilli or in the

subapical compartment of proximal tubular cells.

2

at Hauptbibliothek U

niversitaet Zuerich Irchel. B

ereich Forschung, on F

ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

Our results suggest that the type IIa Na/Pi-cotransporter interacts with various PDZ

proteins that might be responsible for the apical sorting, parathyroid hormone

controlled endocytosis or the lysosomal sorting of internalized type IIa cotransporter.

Key words:

Renal transport of phosphate, PDZ proteins, yeast two-hybrid.

3




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

INTRODUCTION

In kidney, reabsorption of filtered inorganic phosphate (Pi) takes place along the

proximal tubules and is controlled by a variety of hormones (e.g. parathyroid

hormone, PTH1) and other factors (e.g. dietary intake of Pi) (1, 2). Three structurally

unrelated sodium-dependent phosphate (Na/Pi1) cotransporter families have been

identified (1, 3). By immunohistochemistry, it was apparent that members of the type I

and the type IIa Na/Pi-cotransporters are located in the apical membrane of proximal

tubular cells (4, 5). Targeted inactivation of the type IIa Na/Pi-cotransporter gene

(Npt2) provided strong evidence that approximately 70% of Na-dependent Pi-

transport across the brush border membrane is mediated by the type IIa Na/Pi-

cotransporter (6). Furthermore, the type IIa cotransporter represents the major target

for the many factors described to regulate proximal tubular Pi-reabsorption (2). Also,

reduced proximal Pi-reabsorption, as observed in X-linked hypophosphatemia, is

due to a decreased abundance of the type IIa Na/Pi-cotransporter (7).

According to the current mechanistic view, inhibition of proximal tubular Pi-

reabsorption, such as by PTH or by a diet of high Pi-content (acutely given), is

achieved by a removal of type IIa cotransporters (2) from the apical membrane.

Results obtained from in-vivo (rats) and in-vitro (OK1-cells) studies indicated that

internalized type IIa Na/Pi-cotransporters are subjected to degradation in the

4




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

lysosomes (8, 9). Besides Na/Pi-cotransport, the activity of the brush-border Na/H

exchanger, NHE-3, is regulated by PTH as well, yet internalization of NHE-3 seems

to occur after a delay and not immediately after binding of PTH to its receptor (10).

This kinetic difference of PTH action on the type IIa protein and on the NHE-3

exchanger, respectively, points to a regulatory mechanism specific for the type IIa

Na/Pi-cotransporter. Not much is known about the molecular reactions which

underlie the internalization of the type IIa cotransporter. Although protein kinases are

activated upon the binding of PTH to its receptor (2), the target(s) for activated

kinases relevant for the internalization of the type IIa protein has(have) not yet been

identified.

The microvillar localization of the type IIa protein and its physiologically controlled

abundance in the apical membrane suggest specific interactions of the type IIa

protein with other microvillar/subapical proteins. Such interactions may be necessary

for the correct apical positioning or may be involved in the signaling pathway which

leads to internalization. In order to identify such candidate proteins, a yeast two-

hybrid screen was performed. As a bait, we used the C-terminal 75 amino acid

residues (563-637) of the type IIa Na/Pi-cotransporter for the following reasons: a)

based on the current model of the secondary structure, the C-terminus is located at

the cytoplasmic surface (11); b) by truncation studies, evidence was obtained that the

C-terminus is important for apical expression of the type IIa protein (N. Hernando et

5




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

al., unpublished).

We found that the C-terminus of the type IIa Na/Pi-cotransporter is a strong

interactor to various PDZ proteins. Some of these PDZ proteins were localized in the

brush border or in the subapical compartment of proximal tubular cells and thus may

be of importance for the polar distribution and/or regulation of the type IIa Na/Pi-

cotransporter.

6




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

EXPERIMENTAL PROCEDURES

Bait DNA Constructs - EcoRI and SalI restriction sites were introduced by PCR into

cDNA fragments encoding the N- or C-terminal tails of the following proteins: mouse

type IIa Na/Pi-cotransporter (aa 1-109 and 563-637, Acc.No. AAC52361); mouse

type I Na/Pi-cotransporter (aa 1-23 and 443-465, Acc.No. CAA54459); rat Na/H

exchanger NHE-3 (aa 1-53 and 447-831, Acc.No. AAA41702); mouse glycoprotein-

associated amino acid transporter bo,+AT (aa 1-34 and 451-487, Acc.No.

AJ249198); rat sulfate/oxalate/bicarbonate anion exchanger Sat-1 (aa 1-73 and

628-703, Acc.No. AAA17545); rabbit Na/glucose cotransporter SGLT-1 (aa 1-31

and 545-662, Acc.No. CAA29727); rat Na/sulfate cotransporter NaSi-1 (aa 1-17 and

569-595, Acc.No. AAA41677); mouse peptide transporter Pept-2 (aa 1-51 and

705–740, Acc.No. AAF42470) and rat calcium receptor CaR (aa 861-1079, Acc.No.

AAC52149).

To generate LexA DNA binding domain (DNA-BD1) fusions, the fragments were

inserted in-frame into the vector pBTM116 carrying the TRP1 selection marker (12).

All cDNA fragments encoding for N-termini were subcloned into the vector pFBL23

(13), where the inserts had reverted orientation relative to LexA. Site-directed

mutagenesis (Quick change, Stratagene) was applied to generate truncations (-3; -

46; -56 and -67) of the C-terminus from the type IIa Na/Pi-cotransporter by

7




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

introducing stop codons at the respective positions. As a control bait, the subunit of

the reverse transcriptase from HIV (1RTp51) in pBTM116 was used (generously

provided by Prof. U. Hübscher, see Ref. 14).

All bait constructs were verified by sequencing with lower and upper primers

annealing to either the LexA DNA-BD (pBTM116: lexA_upper = 5’-

CCAATTGTCGTTGACTTCGTC-3’; pFBL23: lex-N_lower = 5‘-

CGCGTCGGCGGCATACCTG) or to the ADH1 promoter (pBTM116: ADH_lower =

5’-GCATGCCGGTAGAGGTGT-3’; pFBL23: ADH-Pro-LV_upper = 5‘-

TCGTCATTGTTCTCGTTCCC) from the plasmids.

Prey DNA Constructs - Deletion constructs in pACT2 used for PDZ interaction trap

assays in yeast were produced by PCR. cDNA fragments encoding single or multiple

PDZ domains (listed below) were obtained by either site-directed mutagenesis

(Stratagene) inserting stop codons downstream of PDZ domain 1, 2 and 3, or by

standard amplification, using primers harboring NcoI or XhoI restriction sites: mouse

NaPi-Cap1 (Acc.No. AF220100, aa 1-110 for PDZ1, aa 108-240 for PDZ2, aa 217-

359 for PDZ3, aa 348-472 for PDZ4, aa 1-229 for PDZ1-2, aa 1-350 for PDZ1-3);

mouse NaPi-Cap2 (Acc.No. xxxxx, aa 1-145 for PDZ1, aa 125-270 for PDZ2, aa

243-377 for PDZ3, aa 370-498 for PDZ4, aa 1-254 for PDZ1-2 and aa 1-373

PDZ1-3); mouse NHERF-1 (Acc.No. U74079, aa 1-129 for PDZ1). cDNA

fragments, corresponding to the cytosolic N- (aa 1-107) or C-terminus (aa 563-637)

8




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

of type IIa mouse Na/Pi-cotransporter, were also PCR amplified by means of adapter

oligonucleotides carrying EcoRI as well as XhoI restriction sites and a stop codon in

the N-terminal prey for proper termination.

All fragments were ligated to the C-terminus of the GAL4 activation domain (AD1) in

vector pACT2, which delivers the LEU2 nutritional gene for complementation. All

constructs were confirmed by sequencing using an upper primer GAL855 (5’-

TGTTTAATACCACTACAATG-3’).

Yeast Transformation and Growth Selection - Bait vectors were transformed into S.

cerevisiae (strain L40) containing the genotype MATa trp1 leu2 his3 LYS2::lexA-

HIS3 URA3::LexA-LacZ (15). Yeast cells were grown in YPDA medium (1% yeast

extract, 2% Difco peptone, 2% glucose, 0.003% adenine hemisulfate) or the synthetic

minimal Trp dropout medium (SD-Trp1) complemented with 0.003% adenine

hemisulfate (16). For transformation, an YPDA culture from L40 (20 ml) grown to

OD600 of approximately 1 (18 h) was centrifuged at 1200xg for 3 min, washed with 40 ml

dH2O and resuspended in 1 ml dH2O. Aliquots of 50 µl were treated with 240 µl PEG

(50% w/v), 36 µl 1 M LiAc, 25 µl SS-DNA (2.0 mg/ml), 50 µl dH20 and 1 µg plasmid,

according to Gietz and Schiestl (17). Proper expression of the baits was confirmed by

Western blotting of total cell lysates (18) with antibodies raised against the C- and

N-terminal part of type IIa Na/Pi-cotransporter (5) or against LexA. In control

9




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

experiments (data not shown), an autonomously activation of the L40 reporter genes

by the baits was verified.

Library Screening - A cDNA library of whole adult mouse kidneys (MATCHMAKER,

Clontech) was used. A 100 ml culture in SD-Trp medium was set up with four single

colonies, grown to OD546 > 2 (∼ 36 h) at 30°C (260 rpm) and used to inoculate 1 l of

YPDA to 0.2 OD600. The culture was propagated to ~ 0.8 OD600, splitted up in

quarters and washed with totally 400 ml of sterile dH2O after centrifugation at 4200xg

(4°C) for 15 min. The pellets were resuspended in totally 160 ml dH2O, transferred to

50 ml tubes and repelleted at 1300xg for 10 min at 4°C. Each pellet was transfected

separately according to Gietz and Schiestl (17), using a reaction mixture with a

scaling-up of 50 times from above and with 50 µl cDNA (1 µg/µl). After an incubation

at 30°C followed by a heat-shock at 42°C (30 min at 220 rpm), cells were harvested

at 1900xg for 3 min, washed with 80 ml dH2O, recombined in 20 ml dH2O and plated

onto 100 14-cm petri dishes. After 5 days, 4.4 x 106 Trp/Leu/His prototrophies were

tested for LacZ expression by a colony-lift assay (19, 20), where the permeabilized

cells transferred onto Whatman filters were overlaid with 0.2 mg/ml X-Gal (Alexis),

150 mM NaCl, 50 mM Tris-HCl (pH 7.4) and 0.8% agarose. Putative positive

colonies were restreaked on selective medium and rescreened by colony-lift assay.

Yeast DNA of true positives was isolated (21) and prey plasmids were rescued by

transformation into KC8 cells, which carries trpC, leuB and hisB mutations (22).

10




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

Protein-protein interactions of purified prey plasmids were reconfirmed in yeast.

Insert sizes were checked by BglII digestion and subjected to dideoxy-sequencing

(Microsynth, Switzerland). Identical sequences were grouped via ClustalW at Pôle

Bio-Informatique (Lyonnais) or via Pileup from Genetics Computer Group (Oxford)

and overlaps connected (Contig assembly program; Baylor College of Medicine).

Searches for protein relationships were performed at the National Center for

Biotechnology Information at the National Institutes of Health (Bethesda, MD) using

BLAST (23). The modular architecture of proteins was determined by SMART (24).

Liquid β-galactosidase Assays - Interactions of single proteins and constructs

thereof were determined by a liquid assay for β-galactosidase from permeabilized

cells in the presence of o-nitrophenyl-β-D-galactopyranoside (ONPG, Sigma) (25,

26). The activity of β-galactosidase (OD420) was normalized to 1.0x107 cells

assayed (1 OD600 = 1.0x107 cells/ml).

GST-Fusion Constructs and Protein Expression - The following GST1-fusion

constructs were made in vector pGEX-6P-2 (Amersham Pharmacia Biotech) using

EcoRI/XhoI or BamHI/XhoI restriction sites: mouse NaPi-Cap1 (aa 1-519), mouse

NaPi-Cap2 (aa 1-498), mouse NHERF-1 (aa 1-355), mouse C2PA (aa 195-375 of

C2PA plus 17 N-terminal and 19 C-terminal nonannealing aa), mouse zetin 1 (262

aa), mouse FHL-2 (aa 6-279) and mouse 54TMp (aa 1-281). Mouse NHERF-2 was

11




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

digested with EcoRI/XhoI and the fragment corresponding to aa 1-289 directly

cloned in pGEX-6P-1. Since the full length mouse MAST205 (1734 aa) was not

expressed in E. coli, a known interacting fragment enclosed by SmaI/XhoI restriction

sites (aa 905-1830) was subcloned in pGEX-6P-1. Finally, the C-terminal

SmaI/XhoI fragment of mouse HSP84 (aa 394-724) was also in pGEX-6P-1. All constructs

were checked by sequencing using primers Gex5‘ (5‘-

CCAGCAAGTATATAGCATGG-3‘) and Gex3‘rev (5‘-

GCTTACAGACAAGCTGTGAC).

Plasmids were transformed in XL1-Blue cells (Stratagene). 50 ml overnight cultures

were diluted 1:10 in 500 ml LB/Amp and grown to 0.8 OD600 at 37°C. Protein

expression was induced by adding 0.2 mM isopropyl-1-thio-β-D-galactoside (IPTG,

Axon Lab), and the incubation was continued for 5 h at 28°C. Cells were pelleted at

5000xg for 10 min at 4°C, resuspended in 4 ml of lysis buffer (50 mM Tris-HCl/pH 8,

120 mM NaCl, 0.5% Igepal (Sigma CA-630), 5 mM DTT, 1 mM EDTA, 1 mM PMSF,

1 µg/ml leupeptin, 2 mg/ml lysozyme) and immersed on ice for 15 min. The cells were

subjected three times to pulsed sonication for 30 sec on ice. Aliquots were cleared at

12‘000 rpm in a tabletop microfuge for 15 min (4°C) and frozen at -80°C.

Lysates were thawed at 37°C and spun for 3 min as above to remove insoluble

debris. Equal amounts of GST-fusion proteins (approximately 2 µg) were incubated

with 25 µl preequilibrated glutathione-agarose beads (Sigma; 50% slurry) in a total

12




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

volume of 500 µl binding buffer (50 mM Tris-HCl/pH 8, 120 mM NaCl, 0.5% Igepal

CA-630, 5 mM DTT) by rocking at 4°C for 30 min. After absorption, beads were

collected by brief centrifugation at 12000 rpm for 10 sec (4°C) and gently washed

three times with 500 µl binding buffer containing 0.075% SDS.

Pull-down Experiments Pull-down experiments were performed either with isolated

proximal tubular brush border membranes (BBMV1) from mice or with Xenopus

laevis oocytes injected with type IIa cRNA. Purified BBMv’s (27) were solubilized in

binding buffer (see above) for 5 min at 4°C and centrifuged at 16‘000xg for 3 min.

Extracts of oocytes injected with IIa cRNA (for details see Ref. 28) were obtained as

described (29). GST-fusion protein loaded beads were incubated for 1 hour at 4°C

with solubilisates corresponding to 0.05 mg of BBMV protein or 1 to 2 oocytes,

washed three times with binding buffer and used for gel-electrophoresis. Western

blotting was performed with a polyclonal anti-IIa-cotransporter antibody directed

against the N-terminus (5), and immunoreactive bands were detected by ECL using

a secondary HRP-coupled IgG (Amersham).

Northern Blotting - Tissue distribution of mRNA expression of identified gene

products was studied by Northern blotting using poly(A)+RNA’s of adult mice either

purchased from Clontech (USA) or isolated by standard procedures. Full length

inserts were randomly labeled with 32P-dCTP (Oligolabelling kit, Pharmacia) and

13




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

used as probes. After hybridization, all blots were washed sequentially with 2xSSC,

1xSSC and 0.5xSSC (containing 0.1% SDS) at temperatures up to 55°C.

Immunofluorescence and Immunogold Electronmicroscopy - Immunohistochemical

distribution of NaPi-Cap1 and NaPi-Cap2 in mouse kidney was essentially

performed as described (30). Polyclonal antisera were raised against synthetic

peptides derived from the N-termini of mouse NaPi-Cap1 and mouse NaPi-Cap2,

respectively. β-actin was visualized by phalloidin-texas red. Anti MAST205 antibody

was kindly provided by P. Walden (31) and an anti-HSP86 antibody was purchased

from Affinity Purified Reagents (USA).

14




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

RESULTS

Identification of Type IIa Na/Pi-Cotransporter Associated Proteins - An adult mouse

kidney cDNA library was screened in yeast against the C-terminal tail (aa 563-637)

of the murine type IIa Na/Pi-cotransporter. Initially, based on selection for growth on

synthetic media and on LacZ expression, 138 positive colonies were obtained from

4.4 x 106 Leu/Trp/His prototrophs. To confirm the initial positives, plasmids from 104

clones were isolated and used for retransformation of L40 cells harboring the

following bait constructs: a) the C-terminus or b) the N-terminus of the type IIa

Na/Pi-cotransporter; and as controls, c) a subunit of the reverse transcriptase from HIV

(1RTp51) or d) the empty vector pBTM116. 93 prey plasmids reappeared blue when

cotransformed with the original C-terminal bait, but did not show any interactions with

the other baits used; notably no interaction occurred with the N-terminus of the IIa

Na/Pi-cotransporter which has been predicted to be located intracellularly as well

(11). Inserts (on average around 2 Kb) from all clones were partially sequenced,

grouped according to their alignments and compared to GenBank entries (see Table

I).

As listed, most of the clones (71 out of 93) coded for PDZ proteins. The majority of

them were identical or closely related to the formerly identified rat protein diphor-1 or

its human homologue PDZK1 (32-34) and thereafter were referred as mouse NaPi-

Cap1 and mouse NaPi-Cap2, respectively. Other PDZ proteins identified were

15




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

identical/similar to NHERF-1 (35, 36), NHERF-2 (37) and a protein named C2PA

composed of a C2 as well as a PDZ domain (Acc.No. AJ250999). Besides, several

clones were identical to the heat shock proteins HSP84 and HSP86 (38) or to

MAST205, a microtubulin-associated serine/threonine kinase (31). Others were

found only once, such as the mouse protein FHL-2 having four and half LIM domains

(39) or as the mouse homologues of rat zetin 1 (Acc.No. AF245225) and of the

human putative transmembrane protein 54TMp (Acc.No. AF004876). Differences in

the representation of these clones could be explained by either the low abundance of

corresponding mRNA’s or by the presence of diverse truncations of inserts existing in

the library.

Specific Binding of Putative Type IIa Associated Proteins in Yeast - In order to

evaluate the specificity of the identified clones for binding the C-terminus of the type

IIa cotransporter, various baits derived from a number of proximal tubular, apically

localized membrane proteins were constructed and tested in yeast for possible

interactions with some of the proteins obtained by the screen (see Table II). Most of

the baits used did not activate the reporter genes in the presence of the different

proteins exhibiting binding capacity for the type IIa cotransporter. Exceptional was the

C-terminus of the type I Na/Pi-cotransporter (40) which was found to associate with

all the PDZ proteins listed as well as weakly with MAST205. Furthermore, the C-

terminal tail of the Na/H-exchanger, NHE-3, bound NHERF-1, as previously shown

16




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

(35, 41, 42), and additionally NaPi-Cap1, but not NaPi-Cap2.

GST-Precipitations for in vitro Corroboration of Interactions - Some of the

interactions found by the yeast two-hybrid assay were verified by pull-down

experiments using GST-fusion constructs and either solubilized mouse kidney brush

border membrane vesicles (BBMV) (Fig. 1A) or lysates of Xenopus laevis oocytes

expressing the mouse type IIa Na/Pi-cotransporter (Fig. 1B). From solubilized BBMV,

the mature type IIa protein (Mr. approx. 85 kDa; see Ref. 5) was precipitated by the

following GST-fusion constructs (Fig. 1A): GST-NaPi-Cap1, GST fused to the PDZ

domain 3 of NaPi-Cap1 (see below), GST-NaPi-Cap2, GST-NHERF-1, GST-

NHERF-2 and GST fused to the protein similar to NHERF-2. The type IIa

cotransporter was neither pulled down by GST alone nor by GST fused to C2PA,

zetin 1, MAST205 (Fig. 1) and to FHL-2, HSP84 or 54TMp (data not shown).

Additionally, from lysates of Xenopus laevis oocytes, the type IIa cotransporter was

pulled down by GST-MAST205 and to a weak extent by GST-C2PA. Again, GST-

zetin 1 was unable to recover the cotransporter (Fig. 1B). As NaPi-Cap1 is localized

in the microvilli (see below), GST fused to the C-terminus of the type IIa

cotransporter was used to precipitate NaPi-Cap1 from solubilized BBMV’s. However,

no precipitation of NaPi-Cap1 was achieved (data not shown). This could be

explained by the fact that NaPi-Cap1 contains 4 PDZ domains, which may be linked

to cytoskeletal or membrane proteins (43, 44) and thereby may prevent the pull-

17




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

down of NaPi-Cap1.

Tissue Distribution and Immunolocalization of Mouse NaPi-Cap1 and NaPi-Cap2 -

In our further studies, we concentrated on the two proteins NaPi-Cap1 and NaPi-

Cap2, since full length sequences were obtained for both proteins and other proteins,

such as the NHERF‘s, HSP’s and MAST205, have been partially characterized

previously (31, 35, 36, 38, 45, 46). Besides, by immunofluorescence, the heat shock

proteins and MAST205 were found in all cells along the nephron and were present in

the cytoplasm (data not shown). Therefore, HSP’s and MAST205 were assumed not

to be implicated in brush border localization and/or regulation of the type IIa Na/Pi-

cotransporter.

As illustrated in Fig. 2, NaPi-Cap1 mRNA (around 2.5 kB) was detected in liver,

kidney, small intestine (two transcripts) and testis (one transcript), but was not

detected in other organs, such as heart, brain and lung. NaPi-Cap2 mRNA was

expressed only in kidney and intestine and was absent in all other organs looked for.

The renal localization of NaPi-Cap1 and NaPi-Cap2 was assessed by

immunohistochemistry using polyclonal sera raised against synthetic peptides

derived from the corresponding N-termini. Specificity of these antisera was tested on

immunoblots using the GST-fusion constructs (not shown). In mouse kidney

sections, both NaPi-Cap1 and NaPi-Cap2 were detected exclusively in proximal

tubules. Immunostaining was absent in other nephron segments or in glomeruli and

18




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

was not observed in blood vessels or in interstitial cells (Fig. 3A and data not shown).

Immunostaining was uniform along the entire proximal tubules (S1, S2 and S3

segments) and was indistinguishable between the cortical and juxtamedullary

nephrons. Proximal tubular location of NaPi-Cap1 was also confirmed by in situ-

hybridization (not shown).

In proximal tubular cells, both NaPi-Cap1 and NaPi-Cap2 were immunodetected at

the apical side. Whereas NaPi-Cap1 was strictly associated with the microvilli, NaPi-

Cap2 was predominantly located in the subapical compartment, but was not detected

in the microvilli. However, faint immunostaining for NaPi-Cap2 was also found

throughout the cytoplasm (Fig. 3A). By immunogold electronmicroscopy, evidence

was obtained that NaPi-Cap2 was associated with vesicular structures within the

subapical compartment. Again, microvillar localization was observed only for NaPi-

Cap1 (Fig. 3B).

Yeast Trap Truncation Assays to Specify the Interaction of Type IIa Cotransporter

with Mouse NaPi-Cap1, NaPi-Cap2 and NHERF-1 – Both, NaPi-Cap1 and NaPi-

Cap2, encompass four PDZ domains. In order to analyze which of the four PDZ

domains of NaPi-Cap1 or NaPi-Cap2, respectively, was responsible for the

interaction with the C-terminus of the type IIa Na/Pi-cotransporter, each of the four

PDZ domains was tested separately by trap two-hybrids. As depicted in Fig. 4A,

solely PDZ domain 3 of NaPi-Cap1 and NaPi-Cap2 increased significantly the

19




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

activity of β-galactosidase; in accordance with GST-NaPi-Cap1/PDZ3 by which the

type IIa cotransporter was pulled down (see Fig. 1). The PDZ domain 3 of both NaPi-

Cap’s was also found to be mostly important for the interaction with the C-terminus

of the type I Na/Pi-cotransporter (data not shown). Furthermore, our results indicated

that the type IIa cotransporter via its C-terminus is predominantly interacting with the

first PDZ domain of NHERF-1 (Fig. 4B).

The last three C-terminal amino acid residues of the type IIa cotransporter sequence

are TRL and thus may represent a PDZ-binding cassette (41). To refine if this

putative PDZ binding determinant was responsible for the interaction with identified

PDZ proteins, the last three amino acid residues (TRL) of the type IIa cotransporter

were deleted and the respective bait was assayed in yeast in the presence of either

NaPi-Cap1, NaPi-Cap2 or additionally NHERF-1 and C2PA. As illustrated in Fig.

5A, the removal of the three C-terminal amino acid residues TRL completely

abolished the interaction of the C-terminal tail of the IIa Na/Pi-cotransporter with

NaPi-Cap1, NaPi-Cap2, NHERF-1 and C2PA. Similarly, the last three amino acid

residues of the type I Na/Pi-cotransporter are represented by TRL and their deletion

also blunted the interaction with the PDZ proteins mentioned above (data not shown).

On the other hand, the C-terminus, as a ligand for the heat shock proteins HSP84 or

86, did not depend on the last three amino acid residues because complex formation

was disrupted not before 46 amino acid residues were removed (Fig. 5B).

20




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

DISCUSSION

Proximal tubular apical location of the type IIa Na/Pi-cotransporter and its mode of

regulation (endocytosis, lysosomal sorting in the subapical region) (2) suggest a

complex interaction pattern of the type IIa Na/Pi-cotransporter with microvillar

proteins as well as with proteins localized in the subapical compartment. In microvilli,

such interacting proteins may play a role in scaffolding and also may anchor

components involved in the signaling pathways. In the subapical compartment, type

IIa cotransporter associated proteins can be envisaged to play not only a role in

apical sorting of newly synthesized cotransporters, but also to be important for the

initial steps leading to the routing of internalized cotransporters to the lysosomes. A

priori, every domain of the type IIa cotransporter oriented towards the cytoplasm

could represent a possible site for such interactions. Predictions of the secondary

structure and studies on the topology of the type IIa cotransporter suggested eight to

ten transmembrane segments and five intracellular regions including the N- and the

C-termini (11). In this study, we have used the whole C-terminus of the type IIa

cotransporter as a bait to screen a cDNA library of adult mouse kidneys by the yeast

two-hybrid strategy.

Most of the proteins identified (71 out of 93) represented PDZ proteins (see Table I).

Two similar proteins with 4 modular PDZ repeats were identified: NaPi-Cap1, being

identical to the previously described proteins diphor-1 and PDZK1 (3, 32, 33) and

21




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

NaPi-Cap2, being 28% identical to NaPi-Cap1. Other PDZ proteins found belonged

either to the NHERF family (NHERF-1, NHERF-2 and a protein similar to NHERF-2)

(35-37) or were related to the C2PA protein which harbors a PDZ domain and a C2

domain in addition. Further, two large groups of proteins comprised the heat shock

proteins HSP84 and HSP86 (38, 45) and the microtubulin-associated

serine/threonine kinase MAST205 (31). Interaction of above proteins with the C-

terminus of the type IIa cotransporter was specific (with one exception) since both,

the N-terminus of the type IIa cotransporter and the C- or N-termini of various other

proximal tubular, apically localized membrane proteins, failed to stimulate LacZ

expression in yeast. Interestingly, all identified PDZ proteins bound also to the C-

terminus of the type I Na/Pi-cotransporter which has been described to be localized

in the apical membrane as well (4). However, if such an interaction with the type I

cotransporter reflects any physiological significance, it remains to be shown if the C-

terminus of the type I Na/Pi-cotransporter is faced towards the cytoplasm and not to

the extracellular space.

Additional evidence for an interaction of the type IIa cotransporter with identified

proteins was obtained from pull-down experiments, demonstrating that at least all

PDZ proteins (NaPi-Cap1/2, C2PA and NHERF isoforms) were (in-vitro) binding

partners for the mature type IIa Na/Pi-cotransporter as present in isolated proximal

tubular brush border membranes or/and in oocytes of Xenopus laevis injected with

22




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

type IIa cRNA.

A first mandatory step to establish the physiological relevance of positive interactions

in yeast was to determine the location of the putative candidate proteins in renal

tissue; i.e. such proteins were required to be expressed in microvilli and/or subapical

compartment of proximal tubular cells. The proteins, NaPi-Cap1 and NaPi-Cap2

showed strict and NHERF-1 mostly proximal tubular location. NaPi-Cap1 (see also

Ref. 44) and NHERF-1 (47) were found exclusively in microvilli whereas NaPi-Cap2

was distributed predominantly in the subapical compartment of proximal cells.

Interestingly, as revealed by immunogold electronmicroscopy, NaPi-Cap2 appeared

to be associated with vesicular structures in the subapical compartment. At present,

the nature of such vesicles is not known and vesicular proteins eventually linked to

NaPi-Cap2 remain to be determined.

Although the type IIa cotransporter was precipitated by both, NHERF-2 and its likely

isoform, a conclusion about this kind of association would be premature since the

renal localization of NHERF-1 isoforms have not yet been verified by morphological

techniques. With respect to C2PA, preliminary immunohistochemical studies

indicated that this protein is barely localized in the proximal tubules (data not shown).

Furthermore, immunofluorescence data disclosed that the heat shock proteins

HSP84/86 and the microtubulin-associated serine/threonine kinase (MAST205) were

localized along the whole nephron and were neither specifically localized in the brush

23




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

border nor in the subapical region (data not shown). Therefore, these proteins are

probably not implicated in either apical sorting or endocytosis of the type IIa

cotransporter. It can, however, not be excluded if HSP84/86 or MAST205 plays a role

in protein synthesis or lysosomal routing of the type IIa cotransporter; the latter has

been shown previously to be dependent on an intact microtubular network (48).

Further studies on other proteins which have emerged from the two hybrid approach

were impossible, due to the lack of suitable antibodies. Based on the criteria

discussed above (positive yeast assay, pull-down and immunolocalization), NaPi-

Cap1/2 and NHERF-1 were supposed to associate with the type IIa cotransporter.

But it remains to be shown if all these interactions also occur under in-vivo

conditions.

PDZ domains are stretches of 80-90 amino acids and have been assigned to an

increasing number of proteins having physical organizer functions in the formation of

protein complexes of various sizes. Such protein complexes may allow a proper

arrangement of components involved in signal transduction pathways and/or may

allow a correct recruitment of membrane-inserted proteins, as has been shown e.g.

for synaptosomal membrane transporters and channels (41, 42, 49). In addition,

evidence for PDZ interactions in the localization of proteins to the apical membrane

has been accumulated (50, 51). The proteins NaPi-Cap1, NaPi-Cap2 and NHERF-

1, on which our studies concentrated, contain two or four PDZ domains. But their

24




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

interactions with the C-terminus of the type IIa cotransporter were confined to only

one of these domains, i.e. PDZ3 of NaPi-Cap1/2 and PDZ1 of NHERF-1. As shown

by others, NaPi-Cap1 also interacts with a small transmembrane, cancer-associated

protein, MAP17 (43), and with the multidrug resistance-associated protein, MRP2

(44). The latter two proteins are supposed to interact with PDZ domains 1 and/or 4 of

NaPi-Cap1. Presumably, other PDZ domains of NaPi-Cap1 and NaPi-Cap2 may be

occupied by cytoskeletal proteins or by members of the ERM family of actin binding

proteins (52). As for NHERF-1, it was initially identified as a protein which binds to

the Na/H-exchanger NHE-3 (35, 36), but interaction of NHERF-1 with other

proteins, such as the β2-adrenergic receptor (53), the cystic fibrosis transmembrane

conductance regulator (50, 54) and the B1 subunit of H-ATP’ase (47), has been

reported as well.

Often, PDZ folds recognize a C-terminal amino acid motif of the DS/TXV type,

however, many variations thereof appeared to anchor PDZ domains as well (41, 42,

49). The last three C-terminal amino acid residues of the type IIa cotransporter, TRL,

resemble a PDZ binding motif. Indeed, deletion of the amino acid residues TRL is

sufficient to completely abrogate the interaction with the PDZ proteins NaPi-Cap1,

Napi-Cap2 and NHERF-1.

In summary, a yeast two-hybrid screen with the C-terminus of the type IIa Na/Pi-

cotransporter as a bait revealed several proteins which are likely to be associated

25




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

with the IIa cotransporter. Physiological relevance of the identified proteins is met by

their proximal tubular as well as apical localization. The proteins NaPi-Cap1, NaPi-

Cap2 and NHERF-1 are of particular interest and may mediate apical positioning

and/or endocytosis of the type IIa Na/Pi-cotransporter. These multidomain PDZ

proteins are presumably co-sequestered by type IIa cotransporters at the membrane

and are therefore assumed to build up a complex network consisting of the type IIa

Na/Pi-cotransporter, other membrane proteins, cytoskeletal proteins or components

of signaling pathways (33, 43). It seems of interest that NHERF-1 recruits ezrin, that

in turn functions as a protein kinase A anchoring site for conferring cAMP-mediated

regulation of NHE-3 (41, 46, 55). Thus NHERF-1 seems to serve as an organizer for

signaling complexes necessary for the regulation of a variety of proteins; e.g.

permitting phosphorylation of NHE-3 (35). It has to be determined if NHERF-1 exerts

a similar function in the regulation of the type II cotransporter.

The observation that the C-terminus of the type IIa cotransporter recognizes PDZ

motifs of several proteins (NaPi-Cap1/2 and NHERF-1) suggests that these proteins

may differently affect apical sorting and/or endocytosis. Thus, in the case of the type

IIa Na/Pi-cotransporter, such interactions may not be of static nature but rather may

be dynamically regulated by the activation status of specific signaling pathways.

Acknowledgements - We gratefully acknowledge the professional assistance of C.

26




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

Gasser in preparing the figures for this paper.

27




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

REFERENCES

1. Knox, F. G., and Haramati, A. (1985) Renal regulation of phosphate excretion. In:

Seldin GW, Giebisch G., eds. The Kidney: Physiology and Pathophysiology,

Raven Press New York, 1351-1396.

2. Murer, H., Hernando, N., Forster, I. and Biber, J. (2000) Proximal tubular

phosphate reabsorption: Molecular mechanisms. Physiol. Rev. (in press).

3. Werner, A., Dehmelt, L., and Nalbant, P. (1998) J. Exp. Biology 201, 3135-3142.

4. Biber, J., Custer, M., Werner, A., Kaissling, B., and Murer, H. (1993) Pflügers

Arch. 424, 210-215.

5. Custer, M., Lötscher, M., Biber, J., Murer, H., and Kaissling, B. (1994) Am. J.

Physiol. 266, F767-774.

6. Beck, L., Karaplis, A. C., Amizuka, N., Hewson, A. S., Ozawa, H., and

Tenenhouse, H. S. (1998) Proc. Natl. Acad. Sci. USA 95, 5372-5377.

7. Tenenhouse, H. S. (1999) Nephrology Dialysis Tansplantation 14, 333-341.

8. Keusch, I., Traebert, M., Lötscher, M., Kaissling, B., Murer, H., and Biber, J.

(1998) Kidney Int. 54, 1224-1232.

9. Pfister, M. F., Ruf, I., Stange, G., Ziegler, U., Lederer, E., Biber, J., and Murer, H.

(1998) Proc. Natl. Acad. Sci. USA 45, 1909-1914.

10. Fan, L., Wiederkehr, M. R., Collazo, R., Wang, H., Crowder, L. A., and Moe, O.

28




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

W. (1999) J. Biol. Chem. 274, 11289-11295.

11. Lambert, G., Traebert, M., Hernando, N., Biber, J., and Murer, H. (1999) Pflügers

Arch. 437, 972-978.

12. Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A. (1993) Cell 74, 205-214.

13. Béranger, F., Aresta, S., de Gunzburg, J., and Camonis, J. (1997) Nucleic Acids

Res. 25, 2035-2036.

14. Tasara, T., Amacker, M., and Hübscher, U. (1999) Biochemistry 38, 1633-1642.

15. Ullrich, S. J., Robinson, E. A., Law, L. W., Willingham, M., and Appella, E. (1986)

Proc. Natl. Acad. Sci. USA 83, 3121-3125.

16. Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in yeast genetics. Cold

Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

17. Gietz, R. D., and Schiestl, R. H. (1995) Transforming yeast with DNA: Methods in

Molecular and Cellular Biology 5, 255-269.

18. Printen, J. A., and Sprague, G. F. Jr. (1994) Genetics 138, 609-619.

19. Breeden, L., and Nasmyth, K. (1985) Regulation of the yeast HO gene: Cold

Spring Harbor Symposium Quant. Biol. 50, 643-650.

20. Dalton, S., and Treisman, R. (1992) Cell 68, 597-612.

21. Hoffman, C. S., and Winston, F. (1987) Gene 57, 267-272.

22. Inoue, H., Nojima, H., and Okayama, H. (1990) Gene 96, 23-28.

23. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W.,

29




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402.

24. Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998) Proc. Natl. Acad. Sci.

USA 95, 5857-5864.

25. Guarente, L. (1983) Yeast promoters and lacZ fusions designed to study

expression of cloned genes in yeast: Methods Enzymol. 101, 181-191.

26. Miller, J. H. (1972) Experiments in molecular genetic: Cold Spring Harbor

Laboratory, Cold Spring Harbor, New York.

27. Biber, J., Stieger, B., Haase, W., and Murer, H. (1981) Biochim. Biophys. Acta

647, 169-176.

28. Forster, I., Hernando, N., Biber, J., and Murer, H. (1998) J. Gen. Physiol. 112, 1-

18.

29. Turk, E., Kerner, C. J., Lostao, M. P., and Wright, E. M. (1996) J. Biol. Chem.

271, 1925-34.

30. Traebert, M., Roth, J., Biber, J., Murer, H., and Kaissling, B. (2000) Am. J.

Physiol. 278, F148-F154.

31. Walden, P. D., and Cowan, N. J. (1993) Mol. Cell Biol. 13, 7625-7635.

32. Custer, M., Spindler, B., Verrey, F., Murer, H., and Biber, J. (1997) Am. J.

Physiol. 273, F801-806.

33. Kocher, O., Comella, N., Tognazzi, K., and Brown, L. F. (1998) Lab Invest. 78,

117-125.

30




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

34. White, K. E., Biber, J., Murer, H., and Econs, M. J. (1998) An. Human Genetics

62, 287-290.

35. Weinman, E. J., Minkoff, C., and Shenolikar, S. (2000) Am. J. Physiol. 279,

F393-F399.

36. Weinman, E. J., Steplock, D., Wang, Y., and Shenolikar, S. (1995) J. Clin. Invest.

95, 2143-2149.

37. Yun, C. H., Oh, S., Zizak, M., Steplock, D., Tsao, S., Tse, C.-M., Weinman, E. J.,

and Donowitz, M. (1997) Proc. Natl. Acad. Sci. USA 94, 3010-3015.

38. Hoffmann, T., and Hovemann, B. (1988) Gene 74, 491-501.

39. Morgan, M. J., and Madgwick, A. J. (1996) Biochem. Biophys. Res. Commun.

225, 632-638.

40. Chong, S. S., Kozak, C. A., Liu, L., Kristjansson, K., Dunn, S. T., Bourdeau, J. E.,

and Hughes, M. R. (1995) Am. J. Physiol. 268, F1038-F1045.

41. Fanning, A. S., and Anderson, J. M. (1999) J. Clin. Invest. 103, 767-772.

42. Staub, O., and Rotin, D. (1997) Curr. Opinion Nephrol. Hypertens. 6, 447-454.

43. Kocher, O., Cheresh, P., and Lee, S. W. (1996) Am. J. Pathology 149, 493-500.

44. Kocher, O., Comella, N., Gilchrist, A., Pal, R., Tognazzi, K., Brown, L. F., and

Knoll, J. H. M. (1999) Lab. Invest. 79, 1161-1170.

45. Moore, S. K., Rijli, F., and Appella, E. (1990) DNA Cell Biol. 9, 387-400.

46. Murthy, A., Gonzalez-Agosti, C., Cordero, E., Pinney, D., Candia, C., Solomon,

31




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

F., Gusella, J., and Ramesh, V. (1998) J. Biol. Chem. 272, 1273-1276.

47. Breton, S., Wiederhold, T., Marshansky, V., Nsumu, N. N., Ramesh, V., and

Brown, D. (2000) J. Biol. Chem. 275, 18219-18224.

48. Lötscher, M., Kaissling, B., Biber, J., Murer, H., and Levi, M. (1997) J. Clin.

Invest. 99, 1302-1312.

49. Garner, C. C., Nash, J., and Huganir, R. L. (2000) Trends Cell Biol. 10, 274-280.

50. Moyer, B. D., Duhaime, M., Shaw, C., Denton, J., Reynolds, D., Karlson, K. H.,

Pfeiffer, J., Wang, S., Mickle, J. E., Milewski, M., Cutting, G. R., Guggino, W.

B., Li, M., and Stanton, B. A. (2000) J. Biol. Chem. 275, 27069-27074.

51. Muth, T. R., Ahn, J., and Caplan, M. J. (1998) J. Biol. Chem. 273, 25616-25627.

52. Tsukita, S., and Yonemura, S. (1999) J. Biol. Chem. 274, 34507-34510.

53. Hall, R. A., Premont, R. T., Chow, C. W., Blitzer, J. T., Pitcher, J. A., Claing, A.,

Stoffel, R. H., Barak, L. S., Shenilokar, S., and Weinmann, E. J. (1998) Nature

392, 626-630.

54. Wang, S., Raabe, R. W., Schatz, P. J., Guggino, W. B., and Li, M. (1998) FEBS

Letters 427, 103-108.

55. Dransfield, D. T., Bradford, A. J., Smith, J., Martin, M., Roy, C., Mangeat, P. H.,

and Goldenring, J. R. (1997) EMBO J. 16, 35-43.

32




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

FOOTNOTES

* This work was supported by the Swiss National Science Foundation (Grant to

H.M; No. 31-46523.96) and by the „Stiftung für wissenschaftliche Forschung,

University of Zürich (Grant to J.B.).

Q To whom correspondence should be addressed: Institute of Physiology,

University Zürich-Irchel, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland. Tel.

++41 1 635 50 32; Fax: ++41 1 635 57 15; e-mail: [email protected].

1 The abbreviations used are: PTH, parathyroid hormone; Na/Pi, Na+-dependent

inorganic phosphate; OK cells, opossum kidney cells; DNA-BD, DNA binding

domain; ADH, anti diuretic hormone; AD, activation domain; SD-Trp, synthetic

minimal tryptophan dropout medium; GST, glutathione S-transferase; BBMV, brush

border membrane vesicles; CT, C-terminus; NT, N-terminus.

33




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

FIGURE LEGENDS

FIG.1. Type IIa cotransporter is recovered in vitro by various proteins identified by the

two-hybrid approach. Purified GST alone or GST-fusion proteins (see “Experimental

Procedures”) immobilized on glutathione-agarose were incubated in the presence of

lysates from murine kidneys BBMV’s (A) or from Xenopus-laevis oocytes expressing

the mouse IIa Na/Pi-cotransporter (B). After intense washing, the final samples were

denatured in the absence of a reducing agent, and transferred material was

immunoblotted using a polyclonal antibody raised against the type IIa Na/Pi-

cotransporter. The band of approximately 85 kDa represents the mature Na/Pi-

cotransporter (see also Ref. 5). As controls for the stability of the type IIa protein,

aliquots of the lysates were analyzed as well.

FIG. 2. Expression pattern of mouse NaPi-Cap1 and NaPi-Cap2 mRNA. Poly

(A)+RNA from multiple mice tissues was probed with randomly labeled inserts of NaPi-

Cap1 (A) and NaPi-Cap2 (B). The multiple tissue blot was additionally probed for β-

actin (C).

FIG. 3. Localization of NaPi-Cap1 and NaPi-Cap2 in mice proximal tubules . A,

Cryosections were stained with polyclonal antibodies raised against NaPi-Cap1 and

34




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

NaPi-Cap2 (upper row) or with phalloidin-red to localize β-actin (middle row).

Merged pictures are shown in color. Colocalization of NaPi-Cap1 with microvillar β-

actin is indicated in yellow. Bar size = 50 µm. B, Immunogold electronmicroscopy. As

indicated by arrow heads, NaPi-Cap1 was associated with microvilli whereas NaPi-

Cap2 was detected as attached to vesicular structures in the subapical compartment.

Eventually, NaPi-Cap1 was also present in the intermicrovillar clefts (open arrow

heads).

FIG. 4. Single PDZ-domain interactions of mouse proteins NaPi-Cap1, NaPi-Cap2

and NHERF-1 with the C-terminus of the mouse type IIa Na/Pi-cotransporter in

yeast. Yeast cells containing the C-terminus as a bait were transformed with the

indicated prey constructs, and interactions were analyzed by liquid β-galactosidase

assays with permeabilized liquid cultures of total yeast lysates. All prey constructs

were also tested for possible LacZ activation in yeast harboring either the DNA-BD

from the empty vector (pBTM116) or the control bait protein p51, as shown in B but

not in A. All these controls were negative, indicating specific interactions of the C-

terminus with the PDZ-preys listed.

FIG. 5. Implication of the C-terminal amino acid motif (TRL) of the type IIa Na/Pi-

cotransporter for interaction with identified proteins. Yeast cells, transformed with the

35




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

C-terminus or with truncated C-termini (CT1-3; CT-46 or CT-56), were

retransformed with various PDZ proteins (A) or the heat shock proteins HSP84/86

(B), as depicted. LacZ activation (β-galactosidase) was determined in total lysates of

yeast. None of the prey constructs activated autonomously the reporter genes when

transformed in yeast containing either the DNA-BD alone (empty vector) or the viral

protein p51 as controls (not shown).

36




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/




ebruary 8, 2010w

ww

.jbc.orgD

ownloaded from

http://www.jbc.org/

Documents

Interaction of the Type IIa Na/Pi Cotransporter with PDZ Proteins