Identification of common polymorphisms in the promoter of the UGT1A9 gene

Identification of common polymorphisms in the promoter ofthe UGT1A9 gene: evidence that UGT1A9 protein and activitylevels are strongly genetically controlled in the liverHugo Girarda, Michael H. Courtb, Olivier Bernarda, Louis-Charles Fortiera,Lyne Villeneuvea, Qin Haob, David J. Greenblattb, Lisa L. von Moltkeb,Louis Perussedc and Chantal Guillemettea

Objectives Polymorphisms in UDP-glucuronosyltransfer-

ases (UGTs) can influence detoxifying capacities and have

considerable therapeutic implications in addition to

influence various (patho)physiological processes. UGT1A9

plays a central role in the metabolism of various classes of

therapeutic drugs in addition to carcinogens and steroids.

The great interindividual variability of UGT1A9-mediated

glucuronidation remains poorly explained, while evidence

for its genetic origin exists.

Methods The proximal UGT1A9 promoter was screened

for polymorphisms by sequencing and, the contribution of

single nucleotide polymorphisms (SNPs) to the variability

of UGT1A9 protein levels and activity was evaluated.

Results We confirmed the presence of the 2109 to 298

T10 polymorphism and found ten novel SNPs that

generated a diversity of haplotypes in two independent

populations. In a panel of 48 human liver microsomes, the

UGT1A9 expression varied by 17-fold and was significantly

correlated with SNPs 2275, 2331/2440, 2665 and

22152. The base insertion T10 reported to increase

reporter gene expression in HepG2 cells [33] was not

linked to 2275 and 22152 SNPs and was not associated

with changes in UGT1A9 protein levels. Compared to wild-

type individuals, there were statistically significant higher

glucuronidating activities in livers with the 2275 and

22152 using mycophenolic acid and propofol as UGT1A9

substrates, indicating an extensive glucuronidator

phenotype associated with these variants.

Conclusions This is the first study to demonstrate that

naturally occurring sequence variations in the UGT1A9

promoter are informative in predicting the levels of protein

and glucuronidating activity, providing a potential

mechanism for interindividual variation in UGT1A9-

mediated metabolism. Pharmacogenetics 14:501–515 &

2004 Lippincott Williams & Wilkins

Pharmacogenetics 2004, 14:501–515

Keywords: Glucuronosyltransferase, polymorphism, drug metabolism,mycophenolic acid, pharmacogenetics, mass spectrum analysis

aCanada Research Chair in Pharmacogenomics, Laboratory ofPharmacogenomics, Oncology and Molecular Endocrinology Research Center,CHUL Research Center and Faculty of Pharmacy, Laval University, Quebec,Canada, bDepartment of Pharmacology and Experimental Therapeutics, TuftsUniversity, Boston, MA, USA and cDivision of Kinesiology, Department ofPreventive Medicine, Laval University, Quebec, Canada.

Duality of interest: C.G. has been named as inventor on patent application ownedby Laval University in work related to this study.

Correspondence: Chantal Guillemette, PhD, Pharmacogenomics Laboratory,Molecular Endocrinology and Oncology Research Center, CHUL ResearchCenter, Faculty of Pharmacy, Laval University, 2705, boul. Laurier, room T3-48,Quebec, QC, G1V 4G2, Canada.Tel: +1 418 654-2296; fax: +1 418 654-2761;e-mail: [email protected]

Received 13 January 2004Accepted 27 May 2004

IntroductionGlucuronidation is the main conjugation reaction in

humans and represents one of the most essential

detoxification pathways leading to the formation of

hydrophilic glucuronides that are removed from the

body by excretion in bile and urine [1]. Glucuronida-

tion reactions are catalyzed by a multigene family of

UDP-glucuronosyltransferase (UGTs) enzymes that uti-

lize UDP-glucuronic acid (UDPGlcUA) as co-substrate

for the formation of generally inactive glucuronides

from a variety of structurally unrelated substrates. UGT

enzymes have been primarily studied for their role in

the detoxification of exogenous compounds, mostly

drugs but are also involved in the metabolism of

environmental and dietary carcinogens and a number of

endogenous molecules [2,3].

On the basis of sequence similarity, the UGT super

family of enzymes is subdivided into two families in

humans, UGT1 and UGT2, which are further divided

into three subfamilies: UGT1A, UGT2A and UGT2B

[2,4]. Members of the UGT1A subfamily are encoded

by a singular gene located on chromosome 2q37, which

spans over 200 kb and contains 17 exons [5]. To

synthesize the final protein, only one of 13 different

exon-1 sequences on the locus is associated with four

downstream exons, common to all UGT1A isoforms. Of

the 13 exon-1 sequences, nine code for functional

Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.

Original article 501

0960-314X & 2004 Lippincott Williams & Wilkins DOI: 10.1097/01.fpc.0000114754.08559.27

proteins (UGT1A1, UGT1A3–1A10) and four corre-

spond to pseudogenes (p) (UGT1A2p, UGT1A11p,

UGT1A12p and UGT1A13p). While human liver is

undoubtedly one of the organs that presents the most

diverse metabolic capabilities and which expresses the

highest levels of UGTs, the glucuronidation pathway is

also predominant in renal, respiratory and gastrointest-

inal (GI) tissues [3].

UGT1A9 is one of several UGTs found to be expressed

in the liver as well as in a number of extrahepatic

tissues, including the GI tract [6]. Due to its abundance

in these tissues and its large substrate spectrum,

UGT1A9 plays a central role in the detoxification of a

substantial number of molecules, including various

bulky phenols, steroids, fatty acids, bile acids, dietary

constituents, and mediates the conjunction of several

drugs currently prescribed or in development including

anticancer agents, fibrates and antiarrythmics [7–14].

Reactivity towards potent procarcinogens in tobacco

and tobacco smoke or from dietary sources is also

reported for UGT1A9 [15–18]. Polymorphic expression

and variable levels of glucuronidating activities

mediated by the UGT1A9 protein have been consis-

tently reported from a number of studies using various

substrates [8,19–26]. These observations strongly sug-

gest that UGT1A9 functions may be under the control

of genetic factors that influence the expression level

and activity of the UGT1A9 protein or its stability.

To support this hypothesis, the first evidence for the

existence of genetic variations in the gene encoding

UGT1A9 was reported recently. Several structural poly-

morphic variations were found in the coding region of

the gene, including C3Y, M33T, Y242X and D256N, that

lead to complete or partial inactivation of glucuronida-

tion activity for various substrates such as SN-38, the

active metabolite of the antitumor prodrug irinotecan

used worldwide for the treatment of colorectal cancer

[4,27,28]. On the other hand, these non-synonymous

coding SNPs were present in less than 5% of the

populations studied. Consequently, although the func-

tional impact of these genetic variations is undoubtedly

drastic, their low frequency in the population would

indicate that these UGT1A9 variants only play a limited

role in the overall interindividual variation of UGT1A9-

mediated glucuronidating activities in the population.

Thus, to date the mechanism for variability in UGT1A9-

mediated glucuronidation remains unexplained.

To examine additional genetic factors contributing to

the interindividual variability in UGT1A9-mediated

glucuronidation, we have searched for polymorphic

variations in the proximal 59 region of the UGT1A9gene and studied the phenotype–genotype relationship

using a human liver bank of 48 unrelated subjects.

Genetic variations were genotyped in an additional

larger population to assess haplotypic combinations.

This is the first study to demonstrate a substantial

genetic variability in the promoter region of this

pharmacologically relevant hepatic and extrahepatic

UGT metabolic enzyme. Moreover, we demonstrate

that a diversity of haplotypes is generated from the

presence of ten novel SNPs in two independent

Caucasian populations. Results from the study of

genotype–phenotype relationship further show that

levels of hepatic UGT1A9 protein and UGT1A9-

mediated glucuronidating activities using two specific

substrates, 7-O-mycophenolic acid (MPA) and propofol,

are strongly genetically controlled in the liver. These

findings provide a potential mechanism for interindivi-

dual variation in UGT1A9-mediated metabolism that

may have important therapeutic and pathological im-

plications.

MethodsGenomic DNA and liver samples

DNA samples and liver microsomal fractions from 48

American subjects (42 Caucasians, 4 African-Americans

and 2 Hispanics) were obtained from different sources,

including the International Institute for the Advance-

ment of Medicine (Exton, PA, USA), the National

Disease Research Interchange (Philadelphia, PA, USA),

and the University of Minnesota Liver Tissue Procure-

ment and Distribution system (Minneapolis, MN,

USA). These microsomes samples were used as de-

scribed in previous studies [29]. The use of these

tissues for this purpose was approved by the Tufts

University Institutional Review Board. DNA samples

from 257 healthy unrelated Caucasian subjects were

obtained from the Quebec Family Study (QFS) [30–

32]. Subject identifiers for these samples had been

removed prior to their reception in our laboratory. All

subjects have provided written consent for experimen-

tal purposes and the present study was reviewed and

approved by the Institutional Review Boards (CHUL

Research Center and Laval University).

UGT1A9 promoter resequencing and genotyping

PCR was used to amplify the UGT1A9 promoter region

from �2224 to þ2 (relative to the translational start

site). PCR conditions for primers 248 and 608 (Table 1)

were 3 min at 968C for denaturation, followed by 35


Table 1 Primer sequences

Primers Sequences

PCR amplificationF-248 59-ttgagacagagtcgtgctgttt-39R-608 59-gcaaagccacaggtcagc-39Direct sequencingR-507 59-cctgaaacagcaaaaccaa-39F-510 59-gtggatcatgataaaggtcttcc-39F-516 59-gcattgcagagacacagg-39R-517 59-ggaatttgtcccagagc-39R-568 59-gcagaacatgccctgtgctg-39

502 Pharmacogenetics 2004, Vol 14 No 8

cycles at 958C for 30 s, 618C for 30 s and 728C for

2 min, with a final extension at 728C for 7 min. PCR

products were purified on Qiagen quick columns (Qia-

gen Inc., Mississauga, ON, Canada) and sequenced

with primers listed in Table 1 using an ABI 3700

automated sequencer. All sequences were analyzed

with the Staden preGap4 and Gap4 programs. Ambig-

uous sequencing chromatograms and samples with

single nucleotide polymorphisms were systematically

reamplified and resequenced.

For the genotyping of the larger population, PCR

products amplified with primers 248 and 608 were

sequenced to determine genotypes at positions �2208,

�2152, �2141, �1887 and �1818 using primer 507 and

primer 568 for positions �665 and �440 and primer 516

for positions �331, �275, �87, as well as the �109 to

�98 base pair insertion recently described [33]. Se-

quences were analyzed with Staden preGap4 and Gap4

programs. The M33T polymorphism of UGT1A9 exon

1 was genotyped by allelic specific oligonucleotides

(ASO) as described previously [28].

Western blot analysis

A specific polyclonal antibody directed against

UGT1A9 was developed to determine the protein

content of this UGT in liver microsomal fractions from

48 patients. The 1A9 antibody 520 was raised against

the N terminus of UGT1A9 protein from amino acid 61

to 142. This antibody was used for specific quantifica-

tion of 1A9 protein levels in human liver. Whereas it

also reacts with UGT1A7, UGT1A8 and UGT1A10

isoforms, the absence of these enzymes in the liver

renders this antibody specific to UGT1A9 in this tissue.

Microsomal fractions (20 �g) from all 48 patients and

controls were separated on a 10% sodium dodecyl

sulfate–polyacrylamide gel electrophoresis gel and

transferred onto the same nitrocellulose membrane.

The membrane was probed for 3 h in PBST 13 (phos-

phate buffer saline with 0.2% Tween 20) containing

5% dry milk, as described previously, in the presence

of the anti-UGT1A9 antibody (1/2000) [8]. The mem-

brane was washed four times in PBST 13 for 10 min at

room temperature. The secondary antibody consisting

of a 1/10 000 dilution of a horse anti-rabbit immuno-

globulin antibody coupled to peroxidase, was incubated

for 1 h in PBST 13, 5% dry milk. The membrane was

washed as mentioned above with a final wash for 2 min

in PBS 13. The blot was revealed using a chemilumin-

escence kit (ECL; Renaissance, QC, CAN) and ex-

posed on Kodak XB-1 film. The relative levels of UGT

proteins were determined by integrated optical density

(IOD) using Bioimage programs Visage 110S (Genomic

Solution Inc., Ann Arbor, MI, USA) and compared to

the lowest expression level obtained.

Enzyme assays

Propofol glucuronidation activities were measured as

previously described [34,35] with minor modifications.

Briefly, incubations were performed in a 100 �l reactionvolume of 50 mM pH 7.5 phosphate buffer containing

5 mM UDPGA, 5 mM MgCl2, 0.1 mg/ml microsomal

protein, 50 �g/ml alamethicin, and 50 �M propofol, and

were incubated for 30 min at 378C. Propofol glucuronide

was quantitated by high-performance liquid chromato-

graphy (HPLC) with ultraviolet absorbance detection

(214 nm wavelength). Propofol glucuronide peak iden-

tity was confirmed by HPLC-mass spectrometry (Agi-

lent 1100 MS, Palo Alto, CA, USA) and glucuronide

concentrations determined using a standard curve gener-

ated using a series of known concentrations of propofol,

assuming similar ultraviolet absorbance [34].

MPA glucuronidation activities were performed in the

same conditions for 1 h with 100 �M MPA. Detection of

mycophenolic acid 7-O-glucuronide (MPAG) was per-

formed by a HPLC-mass spectrometry protocol as

described previously [36]. The analysis system con-

sisted of a HPLC module (Alliance model 2695, Waters

Corporation, Milford, MA, USA) and a LCQ Advantage

quadrupole ion trap mass spectrometer using an elec-

trospray ion source (Thermo Finnigan, San Jose, CA,

USA) controlled by the Xcalibur software (Thermo

Finnigan). The identity of the glucuronide was con-

firmed by a scan of full MS/MS base peak at 319.1.

Activities are expressed as nmol/min/mg microsomal

protein for propofol and MPA.

Statistical analysis

Haplotype frequencies were estimated using Phase

V2.0.1 program and Hardy–Weinberg disequilibrium

analyses were estimated using Arlequin V2.0 program

[37,38]. Normality of distribution of activity data were

determined using Shapiro–Wilk W test (P . 0.05). Data

that did not show normal distribution were transformed

into a normal distribution using a logarithm function.

Relationships between genotypes, protein levels and

enzymatic assays were analyzed using the JMP V4.0.2

program (SAS Institute, Cary, NC, USA). The signifi-

cance of relationships between different activities and

relationships between protein level and activities were

assessed using a bivariate analysis of variance and non-

parametric Spearman’s correlation analysis. A P value

less than 0.05 and an Rs value higher than 0.50 were

considered significant. Significance of the relationship

between wild-type promoter, non-carriers and carriers

of polymorphisms were calculated using the Tukey–

Kramer HSD test (Æ value was set at 0.05). Mapping of

the UGT1A9 promoter variant to potential cis-actingelements were predicted using MatInspector V6.2.2

database [39].


Common polymorphisms in UGT1A9 promoter Girard et al. 503

ResultsUGT1A9 promoter sequence variation

A total of 3073 bp of the UGT1A9 gene was screened

for genetic variation, including the entire exon 1 of

UGT1A9 and the promoter region (�1 to �2218).

Analysis of these sequences revealed the presence of

10 novel SNPs in the UGT1A9 gene exclusively

located in its promoter region as well as the variation

at codon 33 previously reported [28]. We also con-

firmed the presence of the base insertion T10 poly-

morphism at positions �109 to �98 recently

identified by Yamanaka et al. [33]. Novel sequence

variant sites were found at positions �87 G.A, �275

T.A, �331 C.T, �440 T.C, �665 C.T, �1818

T.C, �1887 T.G, �2141 C.T, �2152 C.T and

�2208 C.T, relative to the adenine of the predicted

start codon (Fig. 1). Of these, only the �331 C.T

and �440 T.C polymorphisms were in complete

association. The overall frequency was one variant per

222 bp in the proximal promoter region. No additional

cSNP in UGT1A9 exon-1 was found in the poly-

morphism screening. In addition, several dissimilarities

with the Genbank accession number AF297093

(UGT1 gene) were found especially in the microregion

from �1826 to �1992. However, these dissimilarities

were not found in a second Genbank sequence

corresponding to the UGT1A9 gene (AC019072). (The

complete information is provided in the supplemen-

tary material.) Accordingly, these sequencing discre-

pancies with AF297093 are more likely sequencing

artifacts or, less likely, rare haplotypes not observed

in our sample.


�2208(C→T)

�2152(C→T)

�2141(C→T)

�1887(T→G)

�1818(T→C)

�665(C→T)

�440(T→C)

�331(C→T)

�275(T→A)

�87(G→A)

�109 to �98T(n)

(9→10)Common shared UGT1A Exons

EXON 1A9

MEF3HNF1HOX1.3MYT1

NKX3.1MEF2

E4BP4PLZFMYT1

STAT6STAT

AP1GATA-2V-JUNOCT1DBP

GATA-3ATF

NFYNKX2.5EN1

Proximal PromoterRegion

(a)

(b)

�2208 �2152 �2141 �1887 �1818 �665 �440 �331 �275 �109 to �98 �87

Referencea

Caucasion populationb

Mixed populationd

C C C T T C T C T G9

Variant sequence

Caucasion populationb

Mixed populationd

1.00 0.94 1.00 0.83c 0.77c 0.90c 0.33c 0.33c 0.94 0.64 0.96

0.97e0.600.930.300.300.58e0.710.850.990.950.99

T T T G C T C T A 10 A

0.04

0.03e

0.36

0.40

0.06

0.07

0.67c

0.70

0.67c

0.70

0.10c

0.42e

0.23c

0.29

0.17c

0.15

0.00

0.01

0.06

0.05

0.00

0.01

aCompared to Genbank AF297093 at these positionsbFrench-Canadian subject (n � 52)cFrench-Canadian subject (n � 257)dAmerican subjects (Total n � 48): Caucasian (n � 42), Black (n � 4), Hispanic (n � 2)eHardy–Weinberg disequilbrium (P � 0.05)

2 3 4 5

Fig. 1

(a) Putative transcription factor binding sites were identified using the program MatInspector V6.2.2 database. Each sequence was screened at highlevels of stringency for human transcription factors with a transcription factor score of 90%. Putative binding sites that contain SNPs are indicated.Putative transcription factor binding sites found only in the wild-type promoter sequence are in italic while putative transcription factor binding sitesfound only in the polymorphic promoter sequence are indicated in bold. (b) Allelic frequencies for each promoter SNP in two populations are shown.AP1: Activator protein 1; ATF: ATF binding site; DBP: Albumin D-box binding protein; E4BP4: Adenovirus E4 promoter-binding protein, Member ofthe basic region/leucine zipper transcription factor; EN1: Homeobox protein engrailed (en-1); GATA 2 and 3: GATA-binding factor; HNF1: Hepaticnuclear factor 1; HOX1.3: Hox-1.3, vertebrate homeobox protein; MEF2: Myogenic enhancer factor 2; MEF3: MEF3 binding site, present in skeletalmuscle-specific transcriptional enhancers; MYT1: MyT1 zinc finger transcription factor involved in primary neurogenesis; NFY: Nuclear factor Y (Y-box binding factor); NKX2.5: Homeo domain factor Nkx-2.5/Csx, tinman homologue, high affinity sites; NKX3.1: Prostate-specific homeodomainprotein NKX3.1; OCT1: Octamer-binding factor 1; PLZF: Promyelocytic leukemia zink finger (TF with nine Krueppel-like zink fingers); STAT: Signaltransducers and activators of transcription; STAT6: signal transducer and activator of transcription 6; v-JUN: cAMP-Responsive Element Bindingproteins.


The population of patients used in the initial poly-

morphism screening were mostly Caucasian (n ¼ 24)

with one African-American subject. Subsequent geno-

typing of all ten novel polymorphic sites in larger

populations indicated that these SNPs are not evenly

distributed in the ethnic population studied, although

larger studies are needed to confirm these findings (Fig.

1). A total of 100 unrelated subjects were genotyped for

all ten variations and included 94 Caucasians (52

French-Canadians and 42 Americans), 4 African-Amer-

icans and 2 Hispanic-Americans. Additional French-

Canadian subjects were also genotyped for the most

frequent variant SNPs at positions �109 to �98, �331,

�440, �665, �1818 and �1887. Each of the poly-

morphic variations were found in at least two patients

except for the �2208 and �2141 polymorphic variations

which were only found in one person each (both

Caucasian subjects). Genotype distribution did not

deviate from Hardy–Weinberg expectations in the

larger Caucasian population studied, with frequencies

ranging from 0.04 to 0.67 (Fig. 1). On the other hand,

the �87 and �665 variations were in Hardy–Weinberg

disequilibrium in the American population (P , 0.05),

most likely due to the limited sample size studied and

the fact that this population was of mixed racial origin,

including Caucasian-American (88%), African-American

(8%) and Hispanic-American (4%) subjects.

Haplotype structure of the UGT1A9 promoter

Genotyping results were analyzed with the PHASE

program to determine UGT1A9 haplotype structures.

Only subjects for whom we had the information at all

ten polymorphic positions as well as a confidence value

over 90% for all genotypes were included in this analy-

sis. The non-synonymous changes at codons 3 and 33

recently reported were also genotyped in all subjects

[28] and included in the haplotype analysis. For the

haplotype analysis, the French-Canadian population

was analyzed separately from the American-Caucasian

population while African Americans (n ¼ 4) and Hispa-

nics (n ¼ 2) were excluded.

Altogether, 14 different haplotypes were identified.

The nomenclature used for naming these haplotypes is

presented in Table 2. The analysis of haplotypes in the

American population was conducted with all subjects

(overall, Table 2) and with Caucasian subjects only

(Caucasians, Table 2). Haplotype 1, corresponding to

the reference sequence of the proximal promoter region

of the UGT1A9 gene, was present in at least 26% of the

French-Canadian and up to 42% in the Caucasian-

American population. Significantly higher prevalence

of the haplotypes 2 (�665T, �440C, �331T, �109T10),

5 (�2152T, �665T, �440C, �331T, �275A) and 7

(�1818, �665T, �440C and �331T) were observed in

the Caucasian population from the American popu-

lation compared to the French-Canadian population.

Conversely, haplotype 11 characterized by the tightly

linked �331T, �440C and �109T10 variations, was

highly present in the French-Canadian subjects (22%)

compared to the Caucasian-American population (2%; 1

of 30 subjects), (�2 ¼ 10.2, d.f. ¼ 1, P < 0.01).

Haplotypes 1 to 8 represent the most frequent combi-

nation of SNPs in the mixed population and account

for 88% of all observed haplotypes. Similarly, haplo-

types 1 to 8, 11 and 13 account for 85% of all observed

haplotypes in the larger population, except for the

haplotypes 5 and 7 which were not observed. Several

haplotypes (9, 10, 12 and 14) were found at low

frequency (< 5%) and were not observed in both

populations studied, more likely due to the limited

number of patients investigated. Haplotypes 2, 5, 7 and

9 were observed in the Caucasian-American subjects

while haplotypes 13 and 14 were found exclusively in

the French-Canadian population.

Haplotype 14 (�1818C, �440C, �331T) was also

characterized by the presence of the variation in exon 1

of the UGT1A9 gene at position 98 (T.C) previously

described as the UGT1A9*3 (M33T) allele (Table 2). A

separate analysis limited to African-American subjects

did not identify additional haplotypes.

UGT1A9 is polymorphically expressed in human adult

livers

UGT1A9 protein expression was analyzed in 48 human

liver samples obtained from unrelated adult individuals.

For UGT1A9 protein quantification, an antibody raised

against the N-terminus of UGT1A9 enzyme from

amino acid 61 to 142 of the UGT1A9 protein was used.

Upon characterization with all known human UGTs by

Western blot analysis (Fig. 2), this antibody was shown

to recognize closely related UGT1A family members,

namely UGT1A7–1A10. This antibody is considered

specific for UGT1A9 in liver since UGT1A7, UGT1A8

and UGT1A10 are not present in this tissue [3]. The

distribution of UGT1A9 immunoreactive protein was

normally distributed (Shapiro–Wilk W test; P , 0.62)

and varied 17-fold. No significant effect of donor

gender (P ¼ 0.11) or age (P ¼ 0.11) on protein content

could be detected (data not shown).

Interindividual variability of glucuronosyltransferase

activities for UGT1A9 substrates from 48 human livers and

correlation analyses with UGT1A9 protein content

In a previous study by our group, of all sixteen

functional proteins included in the study, UGT1A9

was identified as the major hepatic UGT involved in

the formation of 7-O-mycophenolic acid glucuronide

(MPAG) from MPA [36,40]. Therefore, glucuronosyl-

transferase activities for MPA and for a known substrate

of the UGT1A9 protein, propofol, were determined in

microsomes from 48 human livers.



Copyright ©

Lippincott William

s & W

ilkins. Unauthorized reproduction of this article is prohibited.

Table 2 Haplotype structure of the UGT1A9 promoter and haplotype frequencies

Haplotypenumber Promoter 1A9 polymorphisms Exon 1 Mixed populationa

French-CanadianCaucasiansa

Comparison betweenCaucasian

populationsb

�2208 �2152 �2141 �1887 �1818 �665 �440 �331 �275 �109 to �98A(T)nAT

�87 Codon 33 Overallfrequency

(n ¼ 74 Chr.)%

Caucasianfrequency

(n ¼ 60 Chr.)%

Frequency(n ¼ 98 Chr.)

%

(�2, P value)

Reference C C C T T C T C T 9 G T1 C C C T T C T C T 9 G T 35 42 262 C C C T T T C T T 10 G T 11 8 0 7.8, < 0.01

3 C C C T C T C T T 10 G T 9 11 5

4 C C C G T C C T T 9 G T 7 7 20

5 C T C T T T C T A 9 G T 7 7 0 6.3, < 0.025

6 C C C T C C C T T 10 G T 7 8 7

7 C C C T C T C T T 9 G T 7 5 0 4.8, < 0.05

8 C C C T T C C T T 9 G T 5 0 4

9 C C C G T T C T T 9 G T 4 3 0

10 C C C T T C T C T 9 A T 4 5 4

11 C C C T T C C T T 10 G T 3 2 22 10.2, < 0.01

12 C C C T C C C T T 9 G T 1 2 3

13 C T C T T C C T A 9 G T 0 0 6

14 C C C T C C C T T 9 G C 0 0 3

aNumber of informative individuals as described in the Methods section (i.e. . 90% confidence with the PHASE program). Polymorphic sites are specified in boxes.bComparison between Caucasian subjects of the mixed population and French-Canadian Caucasians. Chr., chromosome.

50

6Pharm

aco

genetics

20

04

,Vo

l14

No

8

Distribution of MPA and propofol glucuronosyltransfer-

ase activities did not follow a normal distribution

(Shapiro–Wilk W test; P ¼ 0.0076 and P ¼ 0.0004,

respectively). MPA glucuronidation measured in hepa-

tic microsomes ranged from 0.73 to 7.23 nmol/min/mg

representing more than a 9.5-fold range in activities

(Fig. 3a). The interindividual difference in propofol

glucuronosyltransferase activities was of 11-fold (0.24 to

2.73 nmol/min/mg protein; Fig. 3b). Interestingly, with

both substrates, a group of patients with an extensive

glucuronidation phenotype was apparent (Fig. 3).

Correlation analyses were then performed between

UGT1A9 protein levels and glucuronosyltransferase

activities (Fig. 4). MPA and propofol glucuronosyltrans-

ferase activities were significantly correlated with

UGT1A9 protein levels in the 48 human liver micro-

somes studied; (Rs ¼ 0.66, P , 0.0001 and Rs ¼ 0.50,

P , 0.0001, respectively; Fig. 4a,b). In parallel, a sig-

nificant correlation was observed between propofol and

MPA glucuronidation activities (Rs ¼ 0.64, P , 0.0001;

Fig. 4c).

The presence of certain SNPs is associated with higher

hepatic UGT1A9 expression and glucuronosyltransferase

activities

To assess the potential effects of UGT1A9 promoter

polymorphisms on gene expression, the entire set of 48

human liver samples were genotyped for all 10 SNPs

identified in the regulatory region. UGT1A9 expression

levels were higher in patients with variations at posi-

tions �275 (P ¼ 0.006), �331/�440 (P ¼ 0.046), �665

(P ¼ 0.042) and �2152 (P ¼ 0.0004) and remained un-

changed in the presence of the T insertion at �109 to

�98 (T10; P ¼ 0.272), �1818 (P ¼ 0.626) and the �1887

(P ¼ 0.612) polymorphisms (data not shown). Since few

individuals carried the variations at positions �87,

�2141 and �2208, analyses were not performed for

these SNPs.

A total of five subjects were found to carry the wild-type

promoter while the remaining 43 subjects presented at

least one of the 10 newly found polymorphic variations.

In the second series of analyses, the microsomal

UGT1A9 protein content of individuals with the wild-

type promoter was compared to the content of subjects

with polymorphisms at positions �109T10, �275, �331/

�440, �665 or �275/�2152 (carriers) and also to sub-

jects with other genotypes (non-carriers; Table 3). Sig-

nificant differences in microsomal UGT1A9 protein

content were observed among UGT1A9 genotype

groups for comparison between individuals with the

wild-type promoter (4023 � 2083 arbitrary units; the

mean expressed is the mean of values after reporting the

levels of expression relative to the lowest) and subjects

with variation at position �275 (8086 � 2471 arbitrary

units; two-fold higher, P ¼ 0.014). This elevation was

even more pronounced when the comparison was re-

stricted to individuals with both the �275 and �2152

SNPs (9156 � 1779; 2.3-fold higher, P ¼ 0.003; Fig. 5a).

Since individuals with both the �275 and �2152

variations have other SNPs in their promoter (Table 2),

levels of UGT1A9 protein were also compared to the

group of subjects with SNPs other than the �275 and

�2152 variations (non-carriers) to gain information on

the impact of the �275 and �2152 SNPs on expression

levels. Relative levels of UGT1A9 protein were signifi-

cantly higher in subjects with the �275 (1.4-fold, P ¼0.011) and �275/�2152 (1.6-fold, P ¼ 0.0006) SNPs


UGT1A over expressing-HEK293 cell lines Controls

UGT2B over expressing-HEK293 cell lines

Anti-UGT1A9

UGT1A9

Liver samples (ID number)

2 3 4 5 6 7 8 13 14 20 HL 21 22 23 24 25 26 27

1A1 1A3 1A4 1A5 1A6 1A7 1A8 1A9 1A10 HK293 HL 2B4 2B7 2B10 2B11 2B15 2B17 2B28

Fig. 2

Specificity of the UGT1A9 polyclonal antibody. Western blot analyses were performed with individual human UGT1A and UGT2B isoenzymes toassess the specificity of the UGT1A9 antibody. Immunoblotting analysis of UGT1A9 protein levels in 10 �g of human liver microsomes. Arepresentative portion of the blot is shown in a subset of samples. HL, human liver.


compared to individuals with other SNPs (non-carriers).

These findings point to the �275 and �2152 variations

as the likely cause of elevated UGT1A9 protein levels.

Differences between homozygous wild-type genotype

and SNPs carriers were also significant for propofol and

MPA glucuronidation when comparison was restricted

to �275 as well as �2152/�275 carriers (Table 3, Fig.

5). Compared to individuals with the wild-type homo-

zygous promoter, propofol glucuronidation activities for

subjects with the �275 and �2152/�275 SNPs were

elevated by 2.2- and 2.3-fold, respectively (Fig. 5b).

Similar results were observed for MPA with a 1.9- and

2.1-fold elevated activities for carriers of the �275 and

�2152/�275 SNPs, respectively, compared to indivi-

duals homozygous for the wild-type promoter (Fig. 5c).

Data support that the elevated protein associated with

these two SNPs leads to higher glucuronidation activ-

ities of specific substrates of the UGT1A9 protein.

A slight but significant elevation in propofol glucuroni-

dation activities was also observed for carriers of the

�665 (0.99 � 0.49 pmol/min/mg; 1.74-fold) and �1887

(1.00 � 0.32 pmol/min/mg; 1.75-fold), compared to

wild-type promoter carriers (0.57 � 0.30 pmol/min/mg).

Similar results were obtained for MPAG formation.

MPA glucuronidation activities were elevated by 1.62-


20

15

10

5

0 1 2 3 4 5 6 7 8

Num

ber o

f liv

ers

MPAG (nmol/min/mg)

(a)

20

15

10

5

0.0

Num

ber o

f liv

ers

Propofol-G (nmol/min/mg)

(b)

0.4 0.8 1.2 1.6 2.0 2.4 2.8

Fig. 3

Frequency distribution of MPA (a) and Propofol (b) glucuronosyl-transferase activities measured with liver microsomes from 48 patients.

(a)

(b)

(c)

�0.2 �0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9

0.90.80.70.60.50.40.30.20.10.0

�0.1�0.2

Log

MP

AG

(nm

ol/m

in/m

g)

Rs � 0.66, P � 0.0001

*

0 5 10 15UGT1A9 protein range (relative to lowest)

0.6

0.4

0.2

0.0

�0.2

�0.4

�0.6

�0.8

Log

Pro

pofo

l-G (n

mol

/min

/mg)

Rs � 0.64, P � 0.0001

*

Log MPAG (nmol/min/mg)

0.6

0.4

0.2

0.0

�0.2

�0.4

�0.6

�0.8

Log

Pro

pofo

l-G (n

mol

/min

/mg)

Rs � 0.50, P � 0.0001

*

0 5 10 15UGT1A9 protein range (relative to lowest)

Fig. 4

Correlation analysis of UGT1A9 protein content and MPAG activity (a),UGT1A9 protein content and propofol-G activity (b), MPAG activityand propofol-G activity (c). Immunoquantified protein content wascompared to the lowest expression. The Spearman rank ordercorrelation (Rs) and P value for the comparison are indicated.*Individual with the UGT1A9*3 allele.


to 1.66-fold in subjects with the �331/�440, �665 or

�1887 SNPs (Table 3).

Relationship between the presence of SNPs in the coding

region and UGT1A9 expression and

glucuronosyltransferase activities

The same group of individuals were genotyped for

variations in the coding region at codons 3 (UGT1A9*2;

C3Y) and 33 (UGT1A9*3; M33T). One subject was

found to carry the UGT1A9*3 allele while none were

found to have the UGT1A9*2 allele, previously found

in the African-Americans [28]. Compared the mean of

all individuals tested (5993 � 2236 arbitrary units),

similar expression of the UGT1A9 protein was detected

in the individual carrying the UGT1A9*3 (6836 arbi-

trary units). Conversely, the glucuronosyltransferase

activity for propofol (0.44 pmol/min/mg) and MPA

(1.36 pmol/min/mg) in the subject with the UGT1A9*3

allele were below the mean of all individuals tested

(0.92 � 0.47 nmol/min/mg and 3.01 � 1.29 nmol/min/

mg, respectively) indicating that this mutation de-

creases the activity of the protein. The significantly

decreased enzymatic activity caused by the presence of

this polymorphism in the UGT1A9 protein was pre-

viously revealed using the irinotecan active metabolite,

SN-38 [28]. Data suggest that the presence of this

variant may result in lower UGT1A9-mediated glucur-

onidating activity in heterozygote carrier.

DiscussionWe have investigated mechanisms underlying variation

in UGT1A9 mediated glucuronidation in human liver

through sequencing of the 59-regulatory region of the

human gene encoding this enzyme. To our knowledge,

this is the first report to describe genetic polymorph-

isms in the UGT1A9 promoter that are linked to in-

vivo effects on UGT1A9 liver protein content and

-mediated glucuronidating activities for pharmacologi-

cally relevant substrates. In addition, these mutations

are the first to be associated with an extensive glucur-

onidator phenotype for this family of detoxifying

proteins. Given the diversity of endogenous and exo-

genous substrates conjugated by the UGT1A9 protein

and its wide tissue distribution, we propose that the

genotyping of UGT1A9 promoter polymorphisms, pre-

sent in a large proportion of the population, will be of

utility in determining the clearance of therapeutics and

individual susceptibility to diseases (such as cancer) via

significant effects on UGT1A9 expression and

mediated glucuronidation.

Several lines of evidence indicate that there is a wide

interindividual variability in UGT1A9 expression and

mediated glucuronidation [8,20,21,26,41]. In a recent

study, we revealed the presence of functional coding

variants of the UGT1A9 protein suggesting that genetic

factors could be the origin of such variability [28,42].


Table 3 UGT1A9 protein expression and glucuronosyltransferase activities in human livers genotyped forUGT1A9 promoter SNPs

UGT1A9 protein expressiona Propofol-G nmol/min/mgb MPAG nmol/min/mgb

Promoter SNP Number of

position subjects Mean SD Mean SD Mean SD

wt/wt 5 4023 2083 0.57 0.30 1.99 0.82298 to 2109T insertionNon-carriers 13 6141 597 0.88 0.13 3.00 1.13Carriers 30 6285 393 0.97 0.08 3.12 1.392275Non-carriers 36 5883 1899 0.90 0.44 3.01 1.11Carriersc 7 8086 2472*† 1.23 0.55* 3.72 1.96*22152/2275Non-carriers 38 5858 1879 0.91 0.45 2.98 1.10Carriers 5 9156 1779*† 1.30 0.54* 4.21 2.13*2331/2440Non-carriers 2 5601 1687 0.85 0.58 2.50 0.83Carriers 41 6273 2166 0.96 0.47 3.16 1.31*2665Non-carriers 6 5494 1458 0.76 0.34 2.60 0.84Carriers 37 6363 2216 0.99 0.49* 3.22 1.34*21818Non-carriers 19 6325 2094 0.99 0.54 3.21 1.20Carriers 23 6175 2208 0.93 0.42 3.06 1.3821887Non-carriers 31 6437 2186 0.94 0.52 3.06 1.29Carriers 12 5736 1992 1.00 0.32* 3.30 1.32*

Genotypes of UGT1A9 in 48 human livers were determined as described in Methods section. Propofol and MPA glucuronidationactivities were determined at 50 �M and 100 �M, respectively.*Significantly different from the wt/wt group.†Significantly different from the corresponding non-carriers group.aArbitrary units. Data include individual with UGT1A9*3.bData exclude individual with UGT1A9*3.cFive out of seven subjects also carry the �2152 SNP.


This was confirmed by another group with the finding

of additional coding variants of the UGT1A9 protein

[4,27]. However, studies were limited in terms of

sequence coverage, populations evaluated, and func-

tional analysis. In addition, the few genetic variants

described in the coding region were found only at low

frequency (less than 5% of the populations studied). In

contrast, in the present study, 10 novel SNPs were

found at various positions within the regulatory ele-

ments of the UGT1A9 gene. Furthermore, following

genotyping of two independent populations, a diversity

of haplotypic combinations was found, indicating the

multiplicity of genetic factors that could potentially

influence UGT1A9 expression. Among those, the bio-

logical and pharmacological significance of SNP �275

and �2152 is proposed given their association with

significantly higher hepatic UGT1A9 expression and

UGT1A9-mediated glucuronosyltransferase activities

using two clinically relevant drugs MPA and propofol.

In fact, the elevation in glucuronidation activities of

both substrates corresponded to the level of increase in

protein content, suggesting that these variants might be

capable of altering transcription efficiency. Because of

their high frequencies variants at positions �275 and

�2152 are more likely key contributors to the inter-

individual variability in the UGT1A9-mediated glucur-

onidation, at least in the liver, in a significant

proportion of the population. That is, over 15% of

individuals in the liver bank of 48 samples were found

to carry these SNPs. The coding region polymorphism

UGT1A9 (M33T), present in less than 5% of the

Caucasian population, may also contribute to lower

UGT1A9-mediated glucuronidating activity in hetero-

zygote carrier, since the individual carrier of this allele

had similar protein level but lower glucuronidating

activities for both pharmacological substrates, as pre-

dicted by the functional in-vitro data [28].

To date, only two polymorphisms of functional signifi-

cance located in the promoter of a human UGT gene

have been reported. The first promoter variant is

probably the most common genetic variant described to

date in the UGT1A1 gene, characterized by a dinucleo-

tide repeat polymorphism in the atypical TATA-box

region of the promoter [43,44]. This variant decreases

the UGT1A1 gene expression in vitro and homozygous

individuals are predicted to have a reduction of ap-

proximately 30% in UGT1A1 protein [43–46]. The

second functional promoter polymorphism was de-

scribed in the UGT2B7 gene and leads to a seven-fold

lower promoter activity in vitro in HepG2 hepatoma

cells [47]. The phenotypic consequences of carrying at

least one UGT1A1 promoter variant allele was demon-

strated in several studies and findings indicate that this

polymorphism may contribute to modify one’s suscept-

ibility to disease (such as cancer) and influence the risk

of developing drug-induced toxicity [46,48–50]. In the


14000

12000

10000

8000

6000

4000

2000

0

(a)

UG

T1A

9 ex

pres

sion

leve

l

*P � 0.05

n.s.

*P � 0.05

ANOVA

Wild typepromoter(n � 5)

Non-carriers of �275/�2152

(n � 38)

Carriers of�275/�2152

(n � 5)

P � 0.0003

3.0

2.5

2.0

1.5

1.0

0.5

0

(b)

Pro

pofo

l-G (n

mol

/min

/mg)

*P � 0.05

n.s.n.s.

ANOVA



(n � 37)


(n � 5)

P � 0.02

8

7

6

5

4

3

2

0

(c )

MP

AG

(nm

ol/m

in/m

g)

*P � 0.05

n.s.n.s.

ANOVA



(n � 37)


(n � 5)

P � 0.02

1

Fig. 5

Influence of the �275 and �2152 polymorphisms on UGT1A9 proteinexpression (a) and propofol (b) and MPA (c) glucuronosyltransferaseactivities in human livers. P value for ANOVA oneway analysis ontransformed data are shown as well as results of the Tukey-KramerHSD test, Æ value was set to 0.05 (*P, 0.05). Data forglucuronosyltransferase activities exclude individuals with thefunctional coding variant UGT1A9*3. n.s., non-significant.


case of the UGT2B7 promoter SNP, although cancer

patients displayed lower morphine-6-glucuronide/mor-

phine and morphine-3-glucuronide/morphine ratios

compared to the non-carriers, the clinical relevance of

the UGT2B7 promoter polymorphism remains to be

clearly established [47]. In contrast to the UGT1A1 and

UGT2B7 promoters, the genetic variability of the reg-

ulatory regions of the UGT1A9 gene is much greater

with one variant per 222 bp. In addition, contrary to the

other promoter polymorphisms characterized by a de-

crease transcriptional activity, the presence of the

�275/�2152 SNPs is found to lead to an increased

level of the UGT1A9 protein and is associated with an

extensive glucuronidator phenotype, supported by en-

zymatic activities using two specific pharmacological

substrates of the UGT1A9 protein.

At present, little is known about how the UGT1A9 gene

itself is regulated. Only a limited analysis of the

structure of the human UGT1A9 promoter has been

performed and, until recently, no possible regulatory

mutations that affect the expression of UGT1A9 have

been reported [51,52]. The recent study by Yamanaka

et al. reported that the base insertion T10 at position

�109 to �98 in the UGT1A9 promoter leads to a 2.6-

fold increased reporter gene expression in HepG2 cells,

using a �170 bp construct [33]. The presence of this

variant was confirmed in the two independent popula-

tions that we have tested at similar frequencies. We

were particularly interested in determining if the T10

polymorphism described by Yamanaka et al. was linkedto the �275 and �2152 SNPs, in order to determine if

the higher levels of UGT1A9 protein and glucuronidat-

ing activities observed in association with the �275 and

�2152 SNPs were explained by the presence of the T10

allele. In both populations tested, the T10 polymorph-

ism was not linked to the �275 and �2152 SNPs and

was not associated with significant changes in UGT1A9

protein levels or with elevated glucuronidating activ-

ities. These findings suggest that the �275 and �2152

variants occur independently from the T10 insertion

and that the elevation of UGT1A9 protein levels and

UGT1A9-mediated activities associated with the �275

and �2152 variants are not caused by the presence of

the T10 insertion. These results also draw attention to

potential difficulties in relating results of functional in-

vitro reporter gene assays and the effects in vivo of

promoter polymorphisms.

The mechanisms behind the transcriptional regulation

of the UGT1A9 gene and the impact of the �275 and

�2152 SNPs are yet to be explained and deserve

further investigation. The �275 and the �2152 poly-

morphisms are in strong association with each other,

making it difficult to clearly differentiate the effect of

these two polymorphisms on UGT1A9 levels. Thus, it

should be stressed that the effect of the �275 or �2152

polymorphisms alone may not be distinguishable from

that of the haplotype combining the �275, �331/�440,

�665 SNPs with or without the �2152 SNP (haplo-

types 5 and 13) because of the strong association

between these polymorphisms. However, the signifi-

cant difference in the UGT1A9 protein content be-

tween carriers of the �275/�2152 SNP and the carriers

of other SNPs supports a causative role for the �275

and/or �2152 SNPs in this effect.

A number of putative transcriptional binding sites were

found in regions containing novel polymorphic sites;

however the exact role of these potential binding sites

in UGT1A9 promoter function still remains to be

determined and necessitates a detailed investigation

into the transcriptional regulation of the UGT1A9 gene.

On the other hand, one has to keep in mind that invivo, transcription factors binding to proximal regulatory

elements can interact with transcription factors binding

to sequences within the distal region. Thus, we cannot

exclude the possibility that these results reflect an

unidentified functional polymorphism located else-

where, which is in linkage disequilibrium with the

�275 and �2152 SNPs. Nevertheless, these results

emphasize the fact that the effect of genetic variation

on regulation of UGT1A9 protein levels and activities

is complex and probably involves more than one single

functional variant.

UGT1A9 is highly expressed in the liver and thus

substantially contributes to the first-pass clearance of

several therapeutic drugs widely used in clinic, such as

anticancer agents, of which several are most exclusively

conjugated by UGT1A9 [20,23–26]. Biotransformation

by UGT enzymes occurring in the liver and other

tissues, controls the systemic level of drugs, and plays a

dominant role in the clearance of other xenobiotics

including carcinogenic chemicals [15–18]. The present

findings point to a specific UGT1A9 promoter genotype

that might contribute to the marked interindividual

variation in UGT1A9-mediated metabolism of drugs

leading to an increase in intrinsic drug clearance. In

addition, UGT1A9 is expressed in extrahepatic tissues,

including those exposed to foreign compounds such as

the GI tract. Several reports have clearly demonstrated

high reactivity of this enzyme towards a number of

harmful chemicals such as tobacco-smoke carcinogens

and heterocyclic amines [15–18]. In these tissues,

UGT1A9 may therefore contribute to protect from

these foreign compounds in addition to influence

bioavailability of drugs. In addition, recent findings

indicate that the presence of UGT polymorphisms may

modify the risk of developing cancer and reinforce the

critical role of this pathway in the regulation of the

biological activity of endogenous molecules and in

determining the response to toxic chemicals [46,53–

60]. Accordingly, it will be critical to assess their impact



on cancer risk. In addition, our previous study, and

those of others, indicate that the likelihood of being

carriers of UGT1A9 polymorphisms is dependent on

ethnicity [4,27,28]. For example, the UGT1A9*3 allele

was seen only in Caucasians while the UGT1A9*2

allele was discovered in African-Americans and the *4

and *5 alleles in the Japanese population [4,27,28]. It is

also of interest to note that within the Caucasian

population, French-Canadian and American-Caucasian,

a significant difference in haplotype frequencies was

observed (haplotypes 3, 6, and other minor haplotypes)

and justifies the genotyping of these SNPs and analysis

of haplotypes in larger populations. It will therefore be

essential to study racial variation in allele frequency

and the haplotypic structure of the promoter SNPs.

In conclusion, in this study we demonstrate that inter-

individual variations of hepatic UGT1A9 levels and

UGT1A9-mediated glucuronidation activities are

strongly genetically determined. Some of the novel

polymorphisms identified, several in putative cis-actingelements promoter of the UGT1A9 gene, appear to

account for a significant part of this genetic variability.

The mechanistic basis for the relationship between

these SNPs, UGT1A9 protein levels and glucuronida-

tion activities requires further investigation. In vitrostudies are thus needed to evaluate the functional

importance of these polymorphisms and are currently

being carried out in our laboratory. Moreover, it will be

important to assess the role of these polymorphisms in

relation to the metabolism of a number of molecules

including therapeutic drugs and carcinogens. It is

predicted that promoter polymorphisms of the UGT1A9gene may have a significant impact on drug metabolism

and disease susceptibility.

AcknowledgementsWe are grateful to Dr Olivier Barbier for helpful discus-

sion. This work was supported by the Canadian Insti-

tutes of Health Research (CIHR), Fonds de la

Recherche en Sante du Quebec (FRSQ) and the

Canada Research Chair Program (C.G.), and grants

GM-61834, MH-58435, DK-58496, AG-17880 and DA-

05258 from the National Institutes of Health (Bethesda,

MD). H.G. is a recipient of a studentship award from

the CIHR and Canada’s Research-Based Pharma-

ceutical Companies (Rx&D). O.B. is a recipient of an

undergraduate studentship award from the CIHR. C.G.

is chairholder of the Canada Research Chair in Pharma-

cogenomics.

References1 Dutton GJ. Glucuronidation of drugs and other compounds. Boca Raton,

FL: CRC Press; 1980.2 Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A, Belanger A,

et al. The UDP glycosyltransferase gene superfamily: recommended

nomenclature update based on evolutionary divergence. Pharmaco-genetics 1997; 7:255–269.

3 Tukey RH, Strassburg CP. Human UDP-glucuronosyltransferases: meta-bolism, expression, and disease. Annu Rev Pharmacol Toxicol 2000;40:581–616.

4 UDP Glucuronosyltransferase home page, http://som.flinders.edu.au/FUSA/ClinPharm/UGT.

5 Gong QH, Cho JW, Huang T, Potter C, Gholami N, Basu NK, et al.Thirteen UDPglucuronosyltransferase genes are encoded at the humanUGT1 gene complex locus. Pharmacogenetics 2001; 11:357–368.

6 Strassburg CP, Nguyen N, Manns MP, Tukey RH. UDP-glucuronosyl-transferase activity in human liver and colon. Gastroenterology 1999;116:149–160.

7 Gaiser BK, Lockley DJ, Staines AG, Baarnhielm C, Burchell B, WynaldaMA, et al. Almokalant glucuronidation in human liver and kidney micro-somes: evidence for the involvement of UGT1A9 and 2B7. Xenobiotica2003; 33:1073–1083.

8 Gagne JF, Montminy V, Belanger P, Journault K, Gaucher G, GuillemetteC. Common human UGT1A polymorphisms and the altered metabolismof irinotecan active metabolite 7-ethyl-10-hydroxycamptothecin (SN-38).Mol Pharmacol 2002; 62:608–617.

9 Ciotti M, Basu N, Brangi M, Owens IS. Glucuronidation of 7-ethyl-10-hydroxycamptothecin (SN-38) by the human UDP-glucuronosyltrans-ferases encoded at the UGT1 locus. Biochem Biophys Res Commun1999; 260:199–202.

10 Ethell BT, Riedel J, Englert H, Jantz H, Oekonomopulos R, Burchell B,et al. Glucuronidation of HMR1098 in human microsomes: evidence forthe involvement of UGT1A1 in the formation of S-glucuronides. DrugMetab Dispos 2003; 31:1027–1034.

11 Wynalda MA, Wynalda KM, Amore BM, Fagerness PE, Wienkers LC,Ethell BT, et al. Characterization of bropirimine O-glucuronidation inhuman liver microsomes. Xenobiotica 2003; 33:999–1011.

12 Watanabe Y, Nakajima M, Yokoi T. Troglitazone glucuronidation in humanliver and intestine microsomes: high catalytic activity of UGT1A8 andUGT1A10. Drug Metab Dispos 2002; 30:1462–1469.

13 Barbier O, Girard H, Inoue Y, Duez H, Villeneuve L, Kamiya A, et al.HNF4 alpha governs the expression of UGT1A9 in human liver. Sub-mitted.

14 Ebner T, Burchell B. Substrate specificities of two stably expressedhuman liver UDP-glucuronosyltransferases of the UGT1 gene family. DrugMetab Dispos 1993; 21:50–55.

15 Kuehl GE, Murphy SE, Yueh MF, Nguyen N, Famourzadeh M, StrassburgCP, et al. N-glucuronidation of nicotine and cotinine by human livermicrosomes and heterologously expressed UDP-glucuronosyltrans-ferases. Drug Metab Dispos 2003; 31:1361–1368.

16 Yueh MF, Nguyen N, Famourzadeh M, Strassburg CP, Oda Y, Guenger-ich FP, et al. The contribution of UDP-glucuronosyltransferase 1A9 onCYP1A2-mediated genotoxicity by aromatic and heterocyclic amines.Carcinogenesis 2001; 22:943–950.

17 Ciotti M, Lakshmi VM, Basu N, Davis BB, Owens IS, Zenser TV, et al.Glucuronidation of benzidine and its metabolites by cDNA-expressedhuman UDP-glucuronosyltransferases and pH stability of glucuronides.Carcinogenesis 1999; 20:1963–1969.

18 Nowell SA, Massengill JS, Williams S, Radominska-Pandya A, Tephly TR,Cheng Z, et al. Glucuronidation of 2-hydroxyamino-1-methyl-6-phenylimi-dazo[4,5-b]pyridine by human microsomal UDP-glucuronosyltransferases:identification of specific UGT1A family isoforms involved. Carcinogenesis1999; 20:1107–1114.

19 Strassburg CP, Manns MP, Tukey RH. Differential down-regulation of theUDP-glucuronosyltransferase 1A locus is an early event in human liverand biliary cancer. Cancer Res 1997; 57:2979–2985.

20 Ramirez J, Iyer L, Journault K, Belanger P, Innocenti F, Ratain MJ, et al.In vitro characterization of hepatic flavopiridol metabolism using humanliver microsomes and recombinant UGT enzymes. Pharm Res 2002;19:588–594.

21 Congiu M, Mashford ML, Slavin JL, Esmond PV. UDP glucuronosyltrans-ferase mRNA levels in human liver disease. Drug Metab Dispos 2002;30:129–134.

22 Court MH, Duan SX, von Moltke LL, Greenblatt DJ, Patten CJ, Miners JO,et al. Interindividual variability in acetaminophen glucuronidation by humanliver microsomes: identification of relevant acetaminophen UDP-glucuro-nosyltransferase isoforms. J Pharmacol Exp Ther 2001; 299:998–1006.

23 Nakajima M, Sakata N, Ohashi N, Kume T, Yokoi T. Involvement ofmultiple UDP-glucuronosyltransferase 1A isoforms in glucuronidation of5-(49-hydroxyphenyl)-5-phenylhydantoin in human liver microsomes. DrugMetab Dispos 2002; 30:1250–1256.

24 Nakajima M, Tanaka E, Kwon JT, Yokoi T. Characterization of nicotine and



cotinine N-glucuronidations in human liver microsomes. Drug MetabDispos 2002; 30:1484–1490.

25 Rudek MA, Venitz J, Ando Y, Reed E, Pluda JM, Figg WD. Factorsinvolved in the pharmacokinetics of COL-3, a matrix metalloproteinaseinhibitor, in patients with refractory metastatic cancer: clinical andexperimental studies. J Clin Pharmacol 2003; 43:1124–1135.

26 Hagenauer B, Salamon A, Thalhammer T, Kunert O, Haslinger E, KlinglerP, et al. In vitro glucuronidation of the cyclin-dependent kinase inhibitorflavopiridol by rat and human liver microsomes: involvement of UDP-glucuronosyltransferases 1A1 and 1A9. Drug Metab Dispos 2001;29:407–414.

27 Jinno H, Saeki M, Saito Y, Tanaka-Kagawa T, Hanioka N, Sai K, et al.Functional characterization of human UDP-glucuronosyltransferase 1A9variant, D256N, found in Japanese cancer patients. J Pharmacol Exp Ther2003; 306:688–693.

28 Villeneuve L, Girard H, Fortier LC, Gagne JF, Guillemette C. Novelfunctional polymorphisms in the UGT1A7 and UGT1A9 glucuronidatingenzymes in Caucasian and African-American subjects and their impact onthe metabolism of 7-ethyl-10-hydroxycamptothecin and flavopiridol anti-cancer drugs. J Pharmacol Exp Ther 2003; 307:117–128.

29 Court MH, Duan SX, Guillemette C, Journault K, Krishnaswamy S, VonMoltke LL, et al. Stereoselective conjugation of oxazepam by humanUDP-glucuronosyltransferases (UGTs): S-oxazepam is glucuronidated byUGT2B15, while R-oxazepam is glucuronidated by UGT2B7 andUGT1A9. Drug Metab Dispos 2002; 30:1257–1265.

30 Lanouette CM, Giacobino JP, Perusse L, Lacaille M, Yvon C, Chagnon M,et al. Association between uncoupling protein 3 gene and obesity-relatedphenotypes in the Quebec Family Study. Mol Med 2001; 7:433–441.

31 Simonen RL, Perusse L, Rankinen T, Rice T, Rao DC, Bouchard C.Familial aggregation of physical activity levels in the Quebec FamilyStudy. Med Sci Sports Exerc 2002; 34:1137–1142.

32 Ukkola O, Perusse L, Chagnon YC, Despres JP, Bouchard C. Interactionsamong the glucocorticoid receptor, lipoprotein lipase and adrenergicreceptor genes and abdominal fat in the Quebec Family Study. Int JObes Relat Metab Disord 2001; 25:1332–1339.

33 Yamanaka H, Nakajima M, Katoh M, Hara Y, Tachibana O, Yamashita J,et al. A novel polymorphism in the promoter region of human UGT1A9gene (UGT1A9*22) and its effects on the transcriptional activity. Pharma-cogenetics 2004; 14:329–332.

34 Krishnaswamy S, Duan SX, Von Moltke LL, Greenblatt DJ, Court MH.Validation of serotonin (5-hydroxtryptamine) as an in vitro substrate probefor human UDP-glucuronosyltransferase (UGT) 1A6. Drug Metab Dispos2003; 31:133–139.

35 Court MH, Krishnaswamy S, Hao Q, Duan SX, Patten CJ, Von Moltke LL,et al. Evaluation of 39-azido-39-deoxythymidine, morphine, and codeine asprobe substrates for UDP-glucuronosyltransferase 2B7 (UGT2B7) inhuman liver microsomes: specificity and influence of the UGT2B7*2polymorphism. Drug Metab Dispos 2003; 31:1125–1133.

36 Bernard O, Guillemette C. In vitro glucuronidation of mycophenolic acidby human UGTs and the impact their polymorphic isoenzymes. DrugMetab Dispos 2004; 32:775–778.

37 Schneider S, Roessli D, Excoffier L. Arlequin: a software for populationgenetics data analysis. Ver 2.000. Genetics and Biometry Lab, Dept. ofAnthropology, University of Geneva; 2000.

38 Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotypereconstruction from population data. Am J Hum Genet 2001; 68:978–989.

39 Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd andMatInspector: new fast and versatile tools for detection of consensusmatches in nucleotide sequence data. Nucleic Acids Res 1995;23:4878–4884.

40 Bernard O, Guillemette C. In vitro glucuronidation of mycophenolic acidby human UGTs and the impact of known polymorphisms of UGT1A8,UGT1A9 and UGT2B7. in 12th North American Meeting of the Interna-tional Society for the Study of Xenobiotics (ISSX), Providence (RI, USA),12–16 October (#106), 2003.

41 Strassburg CP, Strassburg A, Kneip S, Barut A, Tukey RH, Rodeck B,et al. Developmental aspects of human hepatic drug glucuronidation inyoung children and adults. Gut 2002; 50:259–265.

42 Guillemette C, Villeneuve L. Substrate-dependant impact of a novelUGT1A9 polymorphism. In 8th European ISSX-meeting, Dijon, France,April 27–May 1, 2003.

43 Bosma P, Chowdhury J, Jansen P. Genetic inheritance of Gilbert’ssyndrome. Lancet 1995; 346:314–315.

44 Monaghan G, Ryan M, Seddon R, Hume R, Burchell B. Genetic variationin bilirubin UDP-glucuronosyltransferase gene promoter and Gilbert’ssyndrome. Lancet 1996; 347:578–581.

45 Beutler E, Gelbart T, Demina A. Racial variability in the UDP-glucuronosyl-

transferase 1 (UGT1A1) promoter: a balanced polymorphism for regula-tion of bilirubin metabolism? Proc Natl Acad Sci U S A 1998; 95:8170–8174.

46 Guillemette C, Millikan RC, Newman B, Housman DE. Genetic poly-morphisms in uridine diphospho-glucuronosyltransferase 1A1 and asso-ciation with breast cancer among African Americans. Cancer Res 2000;60:950–956.

47 Duguay Y, Baar C, Skorpen F, Guillemette C. A novel functionalpolymorphism in the UDP-glucuronosyltransferase 2B7 promoter withsignificant impact on promoter activity. Clin Pharmacol Ther 2004;75:223–233.

48 Iyer L, Das S, Janisch L, Wen M, Ramirez J, Karrison T, et al. UGT1A1*28polymorphism as a determinant of irinotecan disposition and toxicity.Pharmacogenomics J 2002; 2:43–47.

49 Ando Y, Saka H, Ando M, Sawa T, Muro K, Ueoka H, et al. Polymorph-isms of UDP-glucuronosyltransferase gene and irinotecan toxicity: apharmacogenetic analysis. Cancer Res 2000; 60:6921–6926.

50 Duguay Y, McGrath M, Lepine J, Gagne J, Hankinson S, Colditz G, et al.The functional UGT1A1 promoter polymorphism decreases endometrialcancer risk. Cancer Res 2004; 64:1202–1207.

51 Barbier O, Villeneuve L, Bocher V, Fontaine C, Torra IP, Duhem C, et al.The UDP-glucuronosyltransferase 1A9 enzyme is a peroxisome prolifera-tor-activated receptor alpha and gamma target gene. J Biol Chem 2003;278:13975–13983.

52 Gregory PA, Gardner-Stephen DA, Lewinsky RH, Duncliffe KN, Mack-enzie PI. Cloning and characterization of the human UDP-glucuronosyl-transferase 1A8, 1A9, and 1A10 gene promoters: differential regulationthrough an interior-like region. J Biol Chem 2003; 278:36107–36114.

53 Vogel A, Kneip S, Barut A, Ehmer U, Tukey RH, Manns MP, et al. Geneticlink of hepatocellular carcinoma with polymorphisms of the UDP-glucur-onosyltransferase UGT1A7 gene. Gastroenterology 2001; 121:1136–1144.

54 Zheng Z, Park JY, Guillemette C, Schantz SP, Lazarus P. Tobaccocarcinogen-detoxifying enzyme UGT1A7 and its association with oro-laryngeal cancer risk. J Natl Cancer Inst 2001; 93:1411–1418.

55 Guillemette C, De Vivo I, Hankinson SE, Haiman CA, Spiegelman D,Housman DE, et al. Association of genetic polymorphisms in UGT1A1with breast cancer and plasma hormone levels. Cancer EpidemiolBiomarkers Prev 2001; 10:711–714.

56 Guillemette C, Ritter JK, Auyeung DJ, Kessler FK, Housman DE.Structural heterogeneity at the UDP-glucuronosyltransferase 1 locus:functional consequences of three novel missense mutations in the humanUGT1A7 gene. Pharmacogenetics 2000; 10:629–644.

57 Strassburg CP, Vogel A, Kneip S, Tukey RH, Manns MP. Polymorphismsof the human UDP-glucuronosyltransferase (UGT) 1A7 gene in colorectalcancer. Gut 2002; 50:851–856.

58 Gsur A, Preyer M, Haidinger G, Schatzl G, Madersbacher S, MarbergerM, et al. A polymorphism in the UDP-Glucuronosyltransferase 2B15 gene(D85Y) is not associated with prostate cancer risk. Cancer EpidemiolBiomarkers Prev 2002; 11:497–498.

59 MacLeod SL, Nowell S, Plaxco J, Lang NP. An allele-specific polymerasechain reaction method for the determination of the D85Y polymorphism inthe human UDP-glucuronosyltransferase 2B15 gene in a case-controlstudy of prostate cancer. Ann Surg Oncol 2000; 7:777–782.

60 Gestl SA, Green MD, Shearer DA, Frauenhoffer E, Tephly TR, Weisz J.Expression of UGT2B7, a UDP-glucuronosyltransferase implicated in themetabolism of 4-hydroxyestrone and all-trans retinoic acid, in normalhuman breast parenchyma and in invasive and in situ breast cancers. AmJ Pathol 2002; 160:1467–1479.

Supplementary materialGenomic sequence of the UGT1A9 promoter region

from the initiation codon to �2224 (relative to the

ATG). Polymorphisms are marked with underlined

capital letters and positions are numbered. Shaded grey

boxes correspond to sequence dissimilarities with gen-

bank accession number AF297093 (UGT1A gene) [5].

Haplotypes genbank accession numbers 1: AY273792;

2: AY282542; 3: AY282537; 4: AY282535; 5: AY282534;

6: AY326394; 7: AY282541; 8: AY282539; 9: AY345903;

10: AY282538 and 11: AF481810.



1Reported by Yamanaka et al. [33]


-2208 (c→t) gt cgtgctgttt tgccCgggct

–2152 (c→t)ggagtataat ggcgtgatct cagctcaatg caacctccgc ttcccgggtt Caagtgattc-2141 (c→t)tCctgcctca gcctccagag tagctgggat tacaggcatg caccaccacc tgcagctaattttttgcatt tttagtagag atagggtttc accatgttgg ccaggctggt ctccaactcctggcctcccg tgatacgccc accttgacct cccaaagtgc tgggactaca ggtgtgagccaccacgccca gcacacatag aatttttgac tccctaaaaa tttaactatt aatagcctac

-1887 (t→g)tgtgcactag aagccTtacc aataacagaa acagttgctt aacacatatt tggcatgtta

-1818 (t→c)

gaaaatctta aggaagagaa aattaagtat tcattaagtg gaagtggatc atgataaaggtcttcctctt gattgtcctc cattgagtag gctgagaagg aggaagaggt gggttggttttgctgtttca ggggtggcag agggggaaga agtggaggaa gaaggaggag agacaggtacacttggtgta actttacaga attacatcat aattattatt tgactttttt gcctttgcaattctttgaaa atgctttttt acagtactag tccttcttcc ccatttgctt tagtttcagtgcccattcat ggaagggttt gtgttgtaaa ataagtcaaa agtagtctta ataattggaagcctttgcca aactgtttaa taggaatttg ttttctggca tggcttcttc tatgtcttctttagtatctg gtactgattc aaaagcactc atctccatca agtcatcttc tgttgattcctctggtgtgg tgtctattca ttcttgaatt tctcacagat tcatatcttg aaagaccatatcccccacct tttgttgctg aattagagat gttgggtttg caggcaagta gaccactttgacaccttcag tgttgaactc atgggttctg ggtggctagg ggcattgtcc aaaaatcaaaagaactttga aagaccgtct cttactggca agatattacc tgacttcagg gacaaagtaatgatagaacc aatccagaaa aagtgttctt gccgaggcct tcttgtacaa caaaaaaactggcagtgggt attgatcttt tccctttaag gcttggaggc tagcaggctt atggatgggggcagtcctat ttgtaaaccc aaacatacaa acatacaaac tatgtcaaag gcatagcatgggtactgtga aaggagggtg aaaacacaaa gttgacatca cctctgacct caaggagtgctcagcagact gagagagaca agtacatatt ttcctgaagg agggcactgg agtgatggcgtgtttagaat gtgcaagttg agcggtcact gagaggcagc tcagcagagt gctctcgcaa

- 665 (c→t)ggattgggcg ggcaacttcc cactgcgtgc gatgtatCtt aggaaagcca tttaaaataggagacggtta ctttccatca agtccctggt atggtccatg gaagcagggt tgtcagtctcatttcagcat tttagaggct tctcagggtt tggaaatgga agaagagaag cagcaatatgtatgcattgc agagacacag gcgagcccca atttaggagg ttaggaggtc agtgctaagg -440 (t→c)gccttgtttt ctttgcttag agTatgagtt gccatcttct ctggacagag agtatttggttgcctaaagg taaaatctaa attttgctct gggacaaatt ccaaaaaaaa ttagctttaa -331 (c→t)tcaaatttac tCttacttta tctttctgaa ccttcaaggt ccaaaagcat tggttaataa-275 (t→a)ttctgctTct aaacttaaca ttgcagcaca gggcatgttc tgcccccaag gcaaagaccataagctactg ttgtctggaa aacatacaaa tagatatctc agcaaaagct actcatatat

-109 to -98 (T)n (n = 9 or 10)1

tcttgttctt ttgggtaaat cattgtcagt gactgaTTTT TTTTTatgaa aggataaaaa -87 (g→a)cacgccctct attggGgtca ggttttgtgc tggtatttct cccacctact gtatcatagg

+1agcttagatt cccagctgct tgctctcagc tgcagttctc tgatggcttg cacagggtggaccagccccc ttcctctatg tgtgtgtctg ctgctgacct gtggctttgc cgaggcaggg

Codon 33 (t→a)aagctactgg tagtgcccaT ggatgggagc cactggttca ccatgaggtc ggtggtggagaaactcattc tcagggggca tgaggtggtt gtagtcatgc cagaggtgag ttggcaactgggaagatcac tgaattgcac agtgaagact tattcaactt catataccct ggaggatctggaccgggagt tcaaggcttt tgcccatgct caatggaaag cacaagtacg aagtatatattctctattaa tgggttcata caatgacatt tttgacttat ttttttcaaa ttgcaggagtttgtttaaag acaaaaaatt agtagaatac ttaaaggaga gttcttttga tgcagtgtttctcgatcctt ttgataactg tggcttaatt gttgccaaat atttctccct cccctccgtggtcttcgcca ggggaatact ttgccactat cttgaagaag gtgcacagtg ccctgctcctctttcctatg tccccagaat tctcttaggg ttctcagatg ccatgacttt caaggagagagtacggaacc acatcatgca cttggaggaa catttattat gccaccgttt tttcaaaaatgccctagaaa tagcctctga aattctccaa acacctgtta cggagtatga tctctacagccacacatcaa tttggttgtt gcgaacggac tttgttttgg actatcccaa acccgtgatg

End of exon 1cccaacatga tcttcattgg tggtatcaac tgccatcagg gaaagccgtt gcctatggtaagttatctct cctttagcac cttaagaata cttcaccttt ggaaattaaa aaaggattctttactgaact gtgatttgac attttcattt gtttcatttc aaatttcttt ccagtttaac

tatgtgttat atactgtatt atcaTaatga agtcagctag agaaaagaaa atgttattaa



Demographic information on liver samples studied

Donor ID Age Gender Ethnicitya Cause of death Smoking Alcoholc

LV 02 8 F A Head trauma No NoLV 03 5 M C Meningitis No NoLV 04 24 F C Auto accidentLV 05 20 M C Head trauma Yes NoLV 06 35 F C Head trauma No NoLV 07 21 M A Head trauma Yes YesLV 08 26 F A Head trauma Yes NoLV 09 17 M C Head trauma Yes NoLV 10 19 M C Head trauma No NoLV 11 46 F A Stroke Yes NoLV 12 36 M C Head trauma No NoLV 13 16 M C Head trauma No NoLV 14 14 M C Head trauma Yes NoLV 15 35 M C Auto accident Yes NoLV 16 45 F H Stroke No NoLV 17 6 M C Auto accident No NoLV 20 61 M C Colon cancerb

LV 21 74 M C Bladder cancerb YesLV 22 68 M C Colon cancerb

LV 23 74 M C Colon cancerb

LV 24 66 M C Hepatomab

LV 25 49 F C Stroke Yes NoLV 26 52 F C Stroke No YesLV 27 40 M C Head trauma No YesLV 28 58 M C Stroke No NoLV 29 22 F H Cardiac arrest No NoLV 30 40 F C Head trauma Yes YesLV 31 66 M C Stroke No YesLV 32 45 F C Stroke Yes YesLV 33 42 M C Gun shot wound Yes YesLV 34 33 M C Stroke No NoLV 35 65 F C Stroke No NoLV 37 32 M C Head trauma No NoLV 39 36 M C Head trauma Yes YesLV 40 34 M C Gun shot wound Yes NoLV 41 43 M C Head trauma No YesLV 42 35 M C Encephalopathy No NoLV 43 24 M C Blunt trauma No NoLV 46 49 M C Stroke Yes YesLV 47 72 M C Stroke No NoLV 48 68 F C Stroke No NoLV 49 21 M C Head trauma Yes NoLV 50 37 M C Head trauma Yes YesLV 51 62 M C Stroke No NoLV 52 53 M C Stroke Yes NoLV 53 54 M C Brain abscess No NoLV 54 63 M C Stroke No YesLV 55 46 M C Stroke No No

aC, Caucasian; A, African-American; H, Hispanic.bApparently normal liver tissue obtained by surgical biopsy during exploratory laparotomy.cHistory of consumption of more than 14 drinks per week.


Documents

Identification of common polymorphisms in the promoter of the UGT1A9 gene