Expanding the repertoire of microsatellite markersfor polymorphism studies in Indian accessions of mung bean(Vigna radiata L. Wilczek)

Divya Shrivastava • Priyanka Verma •

Sabhyata Bhatia

Received: 4 November 2013 / Accepted: 26 May 2014

� Springer Science+Business Media Dordrecht 2014

Abstract Limited availability of validated, polymorphic

microsatellite markers in mung bean (Vigna radiata), an

important food legume of India, has been a major hurdle

towards its improvement and higher yield. The present study

was undertaken in order to develop a new set of microsat-

ellite markers and utilize them for the analysis of genetic

diversity within mung bean accessions from India. A GA/CT

enriched library was constructed from V. radiata which

resulted in 1,250 putative recombinant clones of which 850

were sequenced. SSR motifs were identified and their

flanking sequences were utilized to design 328 SSR primer

pairs. Of these, 48 SSR markers were employed for assess-

ing genetic diversity among 76 mung bean accessions from

various geographical locations in India. Two hundred and

thirty four alleles with an average of 4.85 alleles per locus

were detected at 48 loci. The polymorphic information

content (PIC) per locus varied from 0.1 to 0.88 (average:

0.49 per locus). The observed and expected heterozygosities

ranged from 0.40 to 0.95 and 0.40 to 0.81 respectively.

Based on Jaccard’s similarity matrix, a dendrogram was

constructed using the unweighted pair-group method with

arithmetic averages (UPGMA) analysis which revealed that

one accession from Bundi, Rajasthan was clustered out

separately while remaining accessions were grouped into

two major clusters. The markers generated in this study will

help in expanding the repertoire of the available SSR

markers thereby facilitating analysis of genetic diversity,

molecular mapping and ultimately broadening the scope for

genetic improvement of this legume.

Keywords Microsatellites � Vigna radiata � SSRs �Enriched library � Genetic diversity

Introduction

Vigna radiata L. Wilczek, commonly known as mung bean

or green gram, is an important grain legume and is widely

cultivated in Asia. It is a self pollinated diploid (2n = 22)

pulse crop, with a genome size of 515 Mb/1C [1]. It is

grown for its rich dietary protein content and high nutri-

tional value and also consists of minerals, amino acids,

beneficial enzymes and phytochemicals. Mung bean seeds,

which are widely eaten as sprouts are a rich source of

antioxidants like flavanoids (Quercetin-3-O-glucoside),

vitamin C and phenolics [2]. The extract of germinated

seeds of V. radiata exhibit higher content of phenolics like

pyrocatechol and ascorbic acid [3]. It is a rich source of

lysine in comparison to cereals which have lower contents.

In addition to being nutritionally important, it is well

adapted to low water requirement, poor fertility of soil and

has short growth duration [4, 5]. Moreover, its biological

value is enhanced since it is used in intercropping systems

due to its capability of fixing atmospheric nitrogen.

Mung bean is mainly cultivated in India, China, Ban-

gladesh, Myannmar, Nepal and Pakistan [5] and India

contributes about 70 % of the total world’s mungbean

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11033-014-3436-7) contains supplementarymaterial, which is available to authorized users.

D. Shrivastava � P. Verma � S. Bhatia (&)

National Institute of Plant Genome Research,

Post Box No. 10531, Aruna Asaf Ali Marg, New Delhi 110067,

India

e-mail: sabhyatabhatia@nipgr.ac.in

Present Address:

D. Shrivastava

School of Life Sciences, Jawaharlal Nehru University,

New Delhi 110067, India

123

Mol Biol Rep

DOI 10.1007/s11033-014-3436-7

production [6]. Currently, mung bean cultivation occupies

3.24 Mha of land in the country which leads to 1.56 million

tonnes of the crop annually [7]. It is most widely distributed

in the Western Ghats and Rajasthan [7], moreover Madhya

Pradesh and North-western Himalayas also cover a large

area under mung bean cultivation [8, 9]. Despite being a

nutritionally important crop, the genetic exploration leading

to yield enhancement is lacking in mung bean. The yield of

mungbean has been stagnant over years due to several

reasons and conventional breeding efforts have been going

on with the objective of increasing yields, disease resistance

(Mungbean Yellow Mosaic Virus), seed size and dryland

utilization. Moreover, attempts at interspecific hybridiza-

tion [10–14] have also been going on but have not yielded

significant success. Therefore, knowledge of genetic

diversity in this legume would help in development of

superior varieties by the thorough characterization of the

available germplasm [15]. The identification of diverse

germplasm for maximizing the scope of genetic improve-

ment of the crop may be attained with the help of molecular

markers which have been demonstrated to be highly effi-

cient for genetic diversity studies as they are inheritable,

extensively distributed across the genome and are not

affected by the environment [16]. Molecular markers such

as random amplification of polymorphic DNA (RAPD) and

amplified fragment length polymorphism (AFLP) have

been used to detect polymorphism in mung bean [17–19] as

well as for constructing genetic linkage maps [20, 21].

However microsatellites, commonly known as simple

sequence repeats (SSRs) have become the most popular

markers for population genetic studies due to their high

polymorphic potential. SSRs are stretches of 1–6 nucleotide

tandem repeats that are found ubiquitously in all genomes.

Their efficacy is based on the fact that they are highly

polymorphic, co-dominant in nature, highly reproducible,

have good genome coverage, high interspecific transfer-

ability [22, 23], high-throughput assay speed and are cost

effective. Therefore, SSR markers have proved to be rev-

olutionary in plant genetic analysis and they have been

applied to important crops like pea [24], barley [25], maize

[26], soybean [27], rice [28], common bean [29], peanut

[30], sugarcane [31], chickpea [32–34], Jatropha [35],

onion [36], guava [37] and tea [38]. The use of SSR markers

has been especially significant in exploring the diversity

amongst legumes due to their narrow genetic base [39].

Therefore, this study aimed at the development of genomic

SSR markers in mung bean and their utilization for the

analysis of genetic diversity, since at the time of its initia-

tion, genomic resources in mung bean were limited and

‘‘\350’’ SSRs were available [40–44]. More recently, with

the availability of ESTs and next generation based sequence

databases, more than 2,000 genic SSR loci have been

reported [45–49]. However only *5 % were validated for

use as functional markers [48, 49]. Moreover SNPs have

also been reported [47, 50] though the more polymorphic

genomic SSRs continue to be limited. Both SSR and SNP

marker systems have been extensively used in a variety of

genetic analysis. SSRs are preferred over other marker

systems including SNPs as they are more polymorphic with

high heterozygosity values [51–53] and are predominantly

used for evaluating genetic relatedness and species diver-

sity. Hence this study was initiated with the objective of

developing a robust set of SSR markers which would enrich

the existing set of microsatellite markers in mung bean.

In the present study, genomic SSR markers were

developed through construction of a microsatellite enriched

genomic library. Further, their polymorphic potential and

utility was demonstrated by assessing the genetic diversity

among mung bean accessions belonging to different geo-

graphical locations in India. This study would promote the

exploitation of diverse germplasm in mung bean breeding

programs aimed at development of improved varieties.

Materials and methods

Plant materials and DNA extraction

Seventy six accessions of V. radiata were used for the

analysis of genetic diversity in this study. Among the 76

accessions, 26 accessions from Delhi and adjoining areas

were provided by the National Bureau of Plant Genetic

Resources (NBPGR), New Delhi while 50 accessions from

Rajasthan and Gujarat were provided by the NBPGR centre

at Central Arid Zone Research Institute (CAZRI), Jodhpur.

All accessions were grown under natural conditions at the

institute (NIPGR) field site. Five seeds of each accession

were sown and leaf samples were pooled from each of

these. Genomic DNA was isolated from the leaves of each

accession using CTAB method [54] with modifications.

Leaf tissue samples were ground in liquid nitrogen and

suspended in about 3 ml of extraction buffer containing

100 mM Tris–Cl (pH 8.0), 25 mM EDTA, 1.5 M NaCl,

2.5 % CTAB, 0.2 % b-mercaptoethanol (v/v fresh) and

1 % PVP and incubated at 60 �C for 1 h. The homogenate

was extracted with chloroform–isoamylalcohol (24:1) and

an aqueous layer was separated. The DNA was precipitated

by adding 1.5 ml of 5 M NaCl and 0.6 volume of isopro-

panol and pelleted down at 10,000 rpm for 15 min fol-

lowed by washing with 80 % ethanol. The pellet was air

dried and dissolved in 500 ll TE buffer (1 M NaCl,

10 mM Tris–Cl, 1 mM EDTA). RNA contamination was

removed by incubating DNA at 37 �C for 30 min after

adding RNase A (a concentration of 10 lg/ml was used).

Further extraction was done by using equal amount of

chloroform–isoamylalcohol (24:1) and final precipitation

Mol Biol Rep

123

of the genomic DNA was done by adding ice-cold ethanol.

After washing and drying, the pellet was dissolved in

100 ll of water. The quality and quantity of DNA samples

of all the genotypes was determined on 0.8 % agarose gel

and using known concentration of uncut kDNA (25 ng/ll)

as standard. Additionally, nuclear DNA from the leaves of

mung bean accession IC326026 was isolated using the

protocol described by Malmberg et al. [55] and used in

genomic library preparation.

SSR enriched genomic library construction

A genomic library was constructed using a methodology

adapted from Kijas et al. [56]. Nuclear DNA (8 lg) of mung

bean accession IC326026 was isolated and digested with

RsaI restriction enzyme (NEB). The digested products were

ligated to two adaptors: BEPA; (CTCTTGCTTACGCGT

GGACTA) and BEPB (pTAGTCCACGCGTAAGCAAG

AGCACA) and were subjected to amplification with adap-

tor-specific primers. Biotinylated SSR oligo BO2 was used

to hybridize the purified DNA fragments at 50 �C (according

to the Tm of the oligo) for 20 min and streptavidin-coated

magnesphere beads (Promega, Streptavidin MagneSphere

paramagnetic particles) were used to capture the DNA

fragments hybridized with oligoprobe. The beads were first

washed three times with 0.59 SSC, then suspended in 0.59

SSC. To this, the hybridized biotinylated probe–DNA

mixture was added and incubated at room temperature for

10 min and supernatant was removed. The bead–probe–

DNA complex was then suspended in 0.19 SSC, washed

three times with 0.19 SSC and eluted in MQ water. The

eluted DNA–probe complex was amplified with BEPA

primer and amplified fragments were ligated with the

pGEMT vector using the pGEMT easy T/A cloning system

(Promega, Madison, USA) according to the manufacturer’s

instructions and transformation was carried out using

chemically competent cells (NEB). The transformed cells

were screened first on IXA [isopropyl-b-D-thiogalactopy-

ranoside (IPTG), X-gal and ampicillin] plates and further by

colony PCR. The amplified products were size selected by

resolving on 1.2 % agarose gels to identify recombinants

with inserts C250 bp in size.

Microsatellite identification and primer designing

The white recombinant colonies were selected and colony

PCR was performed to confirm the presence of inserts. The

alkaline lysis method [57] was employed for isolation of

plasmid DNA followed by PEG precipitation and

sequenced on the ABI 3700 automated sequencer (Applied

Biosystems, USA). Vecscreen was used to identify and

remove the vector sequences which were then subjected to

CAP3 Program (http://pbil.univ-lyon1.fr/cap3.php) [58] to

remove redundancy. The assembled sequences were ana-

lyzed for the presence of microsatellites which were

identified using the tandem repeat occurrence locator

(TROLL) program [59] where the parameters C4 for di-,

C3 for tri-, tetra- and pentanucleotides was used. The

unique microsatellite enriched sequences were submitted to

the NCBI database and accession numbers were procured

and are mentioned in Supplementary Table S1. Primer 3

(http://frodo.wi.mit.edu/primer3/) [60] software was used

to design primers based on the criteria mentioned in Cho-

udhary et al. [61]. The designed primers were designated as

VrSSR and were synthesized by Bioneer, Korea.

PCR amplification

PCR amplification was carried out in the BIORAD thermal

cycler in a 20 ll reaction mix, each containing 25 ng of

genomic DNA, 19 PCR buffer (50 mM KCl, 20 mM Tris–

Cl pH 8.0), 0.125 mM of each dNTPs, 0.5 lM of primer,

4 % DMSO and 2.5 units of Taq DNA polymerase (New

England Biolabs, USA). A touchdown amplification profile

was used which consisted of an initial denaturation at

95 �C for 2 min followed by 15 cycles: denaturation at

95 �C for 20 s, annealing at 65 �C for 50 s and extension at

72 �C for 50 s. During these 15 cycles the annealing

temperature was set to decrease by 1 �C after every cycle

till it reached the temperature of 55 �C. Another 25 cycles

was performed which consisted of denaturation for 20 s at

95 �C, annealing for 50 s at 55 �C and extension for 50 s at

72 �C followed by a final extension of 7 min at 72 �C. The

amplified products were resolved on 6 % polyacrylamide

gels and analyzed on Typhoon 9210 multi imaging system

(Amersham Biosciences, GE Healthcare, Singapore).

Data analysis

The PCR amplified alleles were visualized by the multi

imaging system and scored manually on a binary matrix,

where the presence and absence of band was designated as

‘1’ and ‘0’ respectively. By using the binary matrix data in

POPGENE version 1.32 [62] genetic diversity parameters

like observed heterozygosity (HO), expected heterozygosity

(HE), Shannon’s information index (I) and fixation index

(FIS) were evaluated. Polymorphic information content

(PIC) was calculated at each locus [63]. The allelic data

obtained across all accessions were used to analyze the

genetic relationships among the 76 mung bean accessions.

The data matrix generated was further used to calculate

Jaccard’s similarity coefficient [64]. After scoring and

computing the allelic data, a dendrogram based on UP-

GMA (Unweighted Pair Group Method with Arithmetic

Averages) algorithm was constructed on NTSYS-pc

Mol Biol Rep

123

version 2.1software [65] and was evaluated with 1,000

bootstraps using the WinBoot software [66].

Results and discussion

Construction of a microsatellite enriched genomic

library for SSR identification and primer design

A microsatellite enriched genomic library was constructed

from nuclear DNA of V. radiata IC326026. Blue-white

selection on IXA plates yielded 1,250 recombinant clones.

Screening through colony PCR resulted in the identifica-

tion of 850 (68 %) recombinant clones with insert size of

C250 bp. Plasmids were isolated from all the recombinant

clones and were sequenced. Of these, 396 sequences were

found to have microsatellite motifs C4 repeats, 345 con-

tained SSRs with \4 repeats, while no repeats were found

in 109 sequences. The observed enrichment rate in this

study was 59.3 % which was significantly higher

(10–20 %) to other plants like sugarcane [31], sorghum

[67] and maize [68] as well as in a previous report of mung

bean where the rate of enrichment was reported to be only

32.04 % [43]. There has been a noteworthy (40–60 %)

increase in the efficiency of enriched libraries over con-

ventional libraries and has resulted in great progress

towards plant genetic studies [69, 70] as conventional

protocols are laborious, time consuming, costly and

microsatellite isolation rate is also low ranging from 5 to

12 % [70]. The 396 sequences with repeat motifs C4 were

assembled into 318 sequences. About 19.7 % sequences

were found to be redundant. The flanking sequences of the

microsatellites which are conserved DNA sequences were

used to design the primers. More than one primer pairs

could be designed from longer sequences having more than

one SSR locus placed *200 bp apart, while in some cases

primers could not be designed due to presence of micro-

satellite motifs at the terminal ends. As a result 328 primer

pairs were designed from 318 consensus sequences (Sup-

plementary Table S1). Earlier studies in mung bean have

utilized different approaches to design genomic SSR

primers where the numbers ranged from a minimum of 7

[40] to a maximum of 210 [71] using conventional

approaches and some of these have been utilized for the

analysis of genetic diversity [40–43] and for linkage

mapping [72, 73]. Moreover, *2,000 genic SSRs were

identified recently [49] of which only about 100 were

validated. Therefore, the 328 genomic SSR primer pairs

reported here would contribute largely to the existing

repertoire of genomic SSR primers for utilization by the

mung bean community in map saturation. Primer devel-

opment may be governed by several factors, such as

insufficient length of flanking region and failure of

sequencing past the microsatellite motif [70, 74]. Primer

design from enriched genomic clones has been observed to

range from 25 to 91 % in many crops like sugarcane [31],

wheat [75], ryegrass [76, 77], Zoysia grass [78], tall fescue

[79], foxtail millet [80] and switchgrass [81]. All the 328

sequences were subjected to BLASTX homology search

(NCBI). Only 86 sequences showed significant hits. Some

sequences showed significant homologies to many impor-

tant and interesting proteins such as micronuclear-linker

histone polyprotein, to bHLH and bZIP transcription factor,

pectinesterase-1 precursor etc.

Sequence analysis of the microsatellite containing

sequences showed the abundance of the targeted GA/CT

motifs in 58.3 % sequences. In addition to the GA/CT

motifs, different non-targeted SSR motifs were also

obtained (4 % GT/CA; 1 % AT/TA; 11 % GAA/CTT;

1.5 % GAT/CTA; 1 % GTT/CAA; 0.4 % each of GGA/

CCT and ACA/TGT; 0.2 % each of GTG/CAC; TGC/

ACG; TCA/AGT; AGC/TCG and others) along with 6 %

tetranucleotide repeats and 12 % pentanucleotide repeats

motifs. Various types of microsatellites are found to occur

ubiquitously in plant genomes. However, they differ

greatly based on their repeat motif number, repeat motif

type, length, composition of repeat motif and distribution

throughout the genome. The GT/CA dinucleotide repeat is

one of the most common microsatellites in humans and

other mammals [82] while AT/TA is the most common

dinucleotide repeat in plants followed by GA/CT and CA/

GT [83]. The self-complimentary nature of AT/TA restricts

its use in SSR-enrichment procedures [84]. Therefore, the

GA/CT motif—the second highest in abundance was used

in this study of microsatellite isolation. The same has also

been used to efficiently isolate microsatellites in different

plant species such as chickpea [32], foxtail millet [80],

wheat [85], rice [86], lentil [87] and Catharanthus [88].

Occurrence of non-targeted motifs in enriched libraries has

been observed in other plants also [88–90] and the most

likely reason may be hybridization of the probe to partially

homologous repeat motif loci. On the basis of the

arrangement of the microsatellites, they were categorized

as perfect (69.2 %), interrupted (2.2 %) and compound

(8.6 %) repeats. In case of the perfect GA/CT, the number

of repeats varied from 4 to 35 (VsSSR52) whereas in case

of perfect GAA/CTT, the number ranged from 4 to 28

(VrSSR326). (Supplementary Table S1).

Polymorphism detection for analysis of genetic

diversity

Three hundred and twenty eight primers could be designed

from the microsatellite containing sequences (Supplemen-

tary Table S1). Validation of a set of 96 primer pairs was

done by PCR amplification of genomic DNA of mung bean

Mol Biol Rep

123

Table 1 Genetic diversity analysis at 48 SSR loci shown under the parameters: number of alleles per locus (NA), observed heterozygosity (HO),

expected heterozygosity (HE), polymorphic information content (PIC), fixation index (FIS) and Shannon’s informative index (I)

S. no. Locus name Primer sequence (50–30)F: Forward R: Reverse

Heterozygosity FIS I

NA HO HE PIC

1. VrSSR2 F: ACGGAATCACTTGCTGGTTT 5 0.774 0.632 0.501 -0.233 1.090

R: GCAAGCCTCTATTGTGAAGGA

2. VrSSR6 F: GCAGGTACATGGCCTTTCC 5 0.714 0.639 0.669 -0.127 1.153

R: CCGAAGTCCGAAATCAGCTA

3. VrSSR7 F: AAAGAGAAAGAGGGGGATGC 4 0.606 0.425 0.473 -0.434 0.613

R: GCTGATGATGAAGACTTGAAGC

4. VrSSR9 F: CTGCTTTTTGGGGATTTCAG 4 0.714 0.637 0.483 -0.128 1.126

R: TTTGTTTGGACCTCTCAGTCTT

5. VrSSR10 F: TGCCTAAAAAGGCTATGAAGTC 3 0.791 0.647 0.506 -0.230 1.064

R: AGGTAATGATATTTCTTGAGCATGT

6. VrSSR11 F: TTCACAAAGAACTATGGACTTTTCT 4 0.811 0.671 0.243 -0.217 1.184

R: CCCCAGGCAAACCTCTAAG

7. VrSSR12 F: GGCAGGATGTCAATATGGGTA 5 0.644 0.685 0.677 0.052 1.347

R: TCAACAAGGAAACCACCAAA

8. VrSSR16 F: CAGCCCTAACTATTGCGAAA 5 0.869 0.683 0.231 -0.280 1.280

R: AGATTGGTCGCTCCTTCTCT

9. VrSSR18 F: TTGGATTTTTCAGTGGATTCAT 5 0.678 0.632 0.710 -0.082 1.162

R: CCCCCAAAGCATAGTTTGAT

10. VrSSR23 F: GGTCCATGGATTTTCCTGAG 5 0.830 0.763 0.589 -0.097 1.461

R: CAACCAAACCTACGATCATCA

11. VrSSR27 F: AACCATTGAAGGAAGAGAGAGAGA 5 0.725 0.726 0.853 -0.010 1.359

R: ACCCACCTCATTCACTCACA

12. VrSSR29 F: CAAGAGCTTTACCCGAACTGA 5 0.761 0.702 0.475 -0.094 1.297

R: CTGCGGTGTCATTTTCCTTA

13. VrSSR32 F: GAAAGAGGATGCGTTGGAAA 5 0.900 0.748 0.602 -0.214 1.420

R: AAGAGTAGGGGTGAAGGAAGGA

14. VrSSR33 F: CAATTCACCTTGAGAGTGAGAGA 6 0.944 0.797 0.444 -0.195 1.656

R: CAAGCAGCTCATCCAGAAAA

15. VrSSR45 F: TGAACAATTTGAAAGGAAGAAGT 4 0.400 0.402 0.806 -0.003 0.727

R: GGAAACCACTTTTTCTCACAGG

16. VrSSR47 F: AACTCAATCCCCTCTTCCTC 5 0.950 0.754 0.314 -0.269 1.451

R: ACGTTGCAAAACAAAATCACT

17. VrSSR48 F: AGGTGAGTGAAAATTGGAATAGG 5 0.692 0.695 0.483 -0.002 1.337

R: AATAGGGCCCATAACATGTCC

18. VrSSR50 F: TGAAACCAATTAATGACAGTTCA 4 0.739 0.722 0.880 -0.034 1.322

R: CCACAAAGATCACCGTGCTA

19. VrSSR51 F: CCACATAAAGATAATAAGCAAAGGA 4 0.639 0.616 0.589 -0.046 1.088

R: CCCCCAATACCCTTCTTCTG

20. VrSSR54 F: CCTTTATGGCAAATGAATGAAA 4 0.818 0.705 0.317 -0.168 1.263

R: ATCCCAACAACCTAACCAACAC

21. VrSSR55 F: TGCCATTGTCTCTCATCATCTC 5 0.794 0.750 0.174 -0.066 1.416

R: TGGGCTTGTGTATCTAATTGTG

22. VrSSR56 F: AACATACCTAGCTTGGGAAAGG 5 0.887 0.766 0.329 -0.166 1.494

R: GCAGTAGCAAGATCTCCTTCTCTT

23. VrSSR59 F: TGAGTGAGGTGATCAAAGTGAGA 5 0.919 0.749 0.146 -0.236 1.454

R: TCAAATAATTGTAGCGGTAAGTGTG

Mol Biol Rep

123

Table 1 continued

S. no. Locus name Primer sequence (50–30)F: Forward R: Reverse

Heterozygosity FIS I

NA HO HE PIC

24. VrSSR61 F: TGGTTTCAAGCCTCCGTATC 5 0.688 0.673 0.809 -0.033 1.277

R: GAATGTAATGCCAACCCATGT

25. VrSSR62 F: TTCTCAACCAAAAGCCAAAAA 5 0.788 0.770 0.644 -0.033 1.503

R: GGGTTGAGGAATTAAGTGAAGG

26. VrSSR64 F: TTTAGTCTTAATTGTTTCCTCAGTG 5 0.785 0.760 0.574 -0.042 1.462

R: CGTCGTTTTAGGGTTAGATGGA

27. VrSSR65 F: CGACATTTCAATTTCCAAAA 5 0.613 0.737 0.795 0.158 1.429

R: GAGGAAGCTGACAGGATTGAGT

28. VrSSR66 F: TGTTCCCTACCAACTTGACCA 5 0.884 0.725 0.607 -0.231 1.342

R: GAAAACACTAAGGATGGATCACTAC

29. VrSSR67 F: TTGCTGATGCGCTCTTTG 5 0.873 0.768 0.337 -0.145 1.503

R: TCATTCCTCCTTCTTCCTTTG

30. VrSSR68 F: AGGAGAGAAGGAAGGTAAAGAAAG 5 0.702 0.698 0.793 -0.016 1.295

R: CTCTCACACGCACGCATATC

31. VrSSR69 F: TCATCCTCGTAATCTTTCTCCA 5 0.746 0.726 0.462 -0.035 1.368

R: CCCTAGTCACCTCAAAACTTCC

32. VrSSR70 F: GGTTTTGTATCATTGCTGCTACC 5 0.857 0.783 0.309 -0.102 1.540

R: CATGACACAAAGCTCAAAAAGC

33. VrSSR73 F: TGGGAAATTCCGAAAACTGA 5 0.693 0.711 0.746 0.014 1.368

R: GGAGCGGGAAAAATAAATCA

34. VrSSR74 F: TCAGGGACTGGAAACAACCT 5 0.711 0.708 0.701 -0.014 1.370

R: TCTGATTCCTTCGTTTTCCA

35. VrSSR75 F: GCCTCTTTCTTTGAACTTCTCA 5 0.812 0.746 0.364 -0.097 1.407

R: GAGGAAGTGGATGGTGAAGG

36. VrSSR76 F: CTTTGGCACATTACGTGCAG 5 0.796 0.759 0.346 -0.058 1.456

R: CTCAATTCTCGAAAACTCACAAGTC

37. VrSSR77 F: TGGTGCTTCACAAGCTCAGA 5 0.759 0.741 0.628 -0.033 1.398

R: TTATTGCATGTGGCACCTTG

38. VrSSR78 F: CCAACAAACTCACACAGACCA 5 0.892 0.781 0.166 -0.151 1.538

R: GCTCCGATCAAATGGAAAGT

39. VrSSR79 F: AGTTGCTGCAGTAATAGGGTGA 5 0.887 0.779 0.356 -0.147 1.532

R: TCGTGTTTGGTAGGGAGATTG

40. VrSSR80 F: TGTGAGAGTGGAAGAGCAACTT 5 0.812 0.774 0.704 -0.060 1.505

R: AATGGTCCCTTTACCCCTTTT

41. VrSSR82 F: CTGAAGCTCCTCCACCACCT 6 0.880 0.813 0.101 -0.091 1.685

R: AGAAAGCAAAAACCTCATCACC

42. VrSSR84 F: AGCCATCAGTAGCAAGAACTCC 5 0.785 0.768 0.551 -0.031 1.490

R: TGAGAGAAAACAGGAGGAACAA

43. VrSSR85 F: GTAGTGTGAGCAGCAGTCTTGG 5 0.770 0.758 0.482 -0.024 1.472

R: GTTACTTGGGCAACCAGTCTTC

44. VrSSR86 F: CTATACTGCAATGAAGTGGATCTC 5 0.678 0.711 0.661 0.037 1.343

R: ATCGGTATATGTTGCCAATCAG

45. VrSSR88 F: ACAAGGATTCCCGATGAAGAC 6 0.895 0.747 0.205 -0.206 1.446

R: GCTCTCTGCAACCAAACTTTTC

46. VrSSR89 F: GCTTCGTTCTTTTCAATCTTCC 5 0.714 0.750 0.185 0.041 1.444

R: AGTAGGGATAGGCAATGTTGGA

Mol Biol Rep

123

accession IC326026. Of these, 57 primer pairs produced

bands of the expected amplifiable size (functional primers),

26 primers failed to amplify, while 13 produced a complex

pattern (multiple unspecific bands) or faint smears. Of the

57 functional primers, 48 primer pairs were employed for

the assessment of genetic diversity in 76 mung bean

accessions (Table 1). A representative set of mung bean

accessions amplified using primer pair VrSSR54 is shown

in Fig. 1. An average of 4.87 alleles per locus was obtained

from 234 total alleles, amplified at 48 loci which varied

from 3 (VrSSR10) to 6 (VrSSR82, VrSSR88 and

VrSSR33) (Table 1) and were comparable to other plants

such as groundnut (2.44; [89]), Catharanthus (4.75; [91])

and foxtail millet (2.2; [92]). In earlier studies, genetic

diversity in large collections of mung bean using SSR

markers have been done where variable number of alleles

has been reported (3.57; [40], 3; [43], 2.25; [44]), 2.08;

[71]. The PIC value for 48 loci ranged from 0.101

(VrSSR82) to 0.880 (VrSSR50) with an average of 0.49

which was higher than the previous studies on mung bean

(0.34; [5], 0.26; [45], 0.24; [44], 0.26; [71]) thereby justi-

fying their robustness as a potential tool for analysis of

genetic diversity. However, the PIC values were lower than

those obtained in other plants such as soybean (0.60; [84]),

maize (0.72; [93]) and wheat (0.79; [94]). In the present

work, it was observed that a correlation was observed

between length of the repeat motif and PIC value of the

loci. Among the 48 loci used for the genetic diversity

analysis, maximum number of dinucleotide repeat motifs

was present in VrSSR27 (GA18), having fairly high PIC

value of 0.85. Similarly higher PIC value of 0.81 was also

observed for locus VrSSR61 (GA17). The PIC values for

the trinucleotide repeat motifs at loci VrSSR6 (CTT9) and

VrSSR66 (GAA11) were 0.67 and 0.61 respectively.

The observed heterozygosity for individual loci ranged

from 0.4 (VrSSR45) to 0.95 (VrSSR47) with an average of

0.78. The expected heterozygosity ranged from 0.4

(VrSSR45) to 0.81 (VrSSR82) with an average of 0.71

(Table 1) which was comparable to previous reports where

SSR markers in mung bean showed a wide range of het-

erozygosity values of 0.90, 0.56, 0.09, 0.13 and 0.2 [40, 41,

43, 44, 71]. However, the number of accessions used in

these studies was lower (45 in [40, 41], 34 in [43], 22 in

[44] and 17 in [71]). In earlier studies, levels of polymor-

phism have been found to be associated with the occur-

rence of dinucleotide repeats [95, 96]. In the present study

also, high PIC values (average 0.49) were obtained for the

loci with dinucleotide motifs (Table 1) and thus justify

Table 1 continued

S. no. Locus name Primer sequence (50–30)F: Forward R: Reverse

Heterozygosity FIS I

NA HO HE PIC

47. VrSSR91 F: ACATATGTATCTGTCTGTGTGCCTA 5 0.938 0.773 0.243 -0.223 1.521

R: TGGAGATGCAGGACTAAGAAGAG

48. VrSSR96 F: ACCCTAGCTGGTTCAGCAAA 5 0.876 0.749 0.190 -0.178 1.431

R: TGCAGACTGAAGACAGTGCAA

Avg. 4.875 0.780 0.714 0.488 -0.104 1.352

400bp

300bp

200bp

M M1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

Fig. 1 PCR amplification profiles of 34 V. radiata accessions

obtained using primer pair VrSSR 54 The PCR amplified products

were resolved on 6 % polyacrylamide gel. M indicated size ladders.

Lanes 1–34 represent V. radiata accessions. 1-IC326026, 2-IC39294,

3-IC39303, 4-IC370489, 5-IC285161,6-IC311426, 7-IC311408,

8-IC370714, 9-IC323998, 10-IC39344, 11-IC324012, 12-IC324025,

13-IC39381, 14-IC325774, 15-IC329067, 16-IC369790,

17-IC369819, 18-IC370467, 19-IC39320, 20-IC370515,

21-IC311437, 22-IC370731, 23-IC415117, 24-IC415144,

25-IC39323, 26-IC324005, 27-IC39368, 28-IC39372, 29-IC328756,

30-IC285192, 31-IC325817, 32-IC39360, 33-IC370743, 34-IC373426

Mol Biol Rep

123

their efficacy for genetic diversity analysis. Fixation index

was tested on all the loci and the values were found to be

negative for 43 loci indicating excess number of hetero-

zygotes (Table 1). The values of Shannon’s informative

index (I) varied from 0.61 (VrSSR7) to 1.68 (VrSSR82),

averaging at 1.35 per locus.

In this study, deviation from the Hardy–Weinberg

equilibrium (HWE) with P \ 0.05 was observed for all the

loci which is in concurrence with earlier studies on diver-

sity analysis in mung bean using SSR markers [5, 43, 45].

The higher observed heterozygosity along with the nega-

tive values of fixation index for majority of loci [97]

observed in our study indicates the heterozygous nature of

the accessions compared to other studies carried out in

mung bean [41, 43, 44, 71]. Lower heterozygosity values

were observed for markers VrSSR12, VrSSR65, VrSSR73,

VrSSR89 and VrSSR96. These findings are further sup-

ported by the fact that the center of diversity of mung bean

lies in India [98] and hence the accessions analyzed in this

study are quite diverse [99]. Further, in a study carried out

on elite parental lines of V. radiata by AVRDC-World

vegetable center [5] and in another study carried out by

Sangiri et al. [100], it was observed that lines which were

of Indian origin were quite diverse. These findings are

further supported by the fact that the center of diversity of

mung bean lies in India where it is believed that the

domestication might have been started [98] and hence the

accessions analyzed in this study are quite diverse. Overall,

the high PIC and heterozygosity values obtained in this

study indicated the potential usefulness of the mung bean

markers for population genetic studies.

Genetic relationships among mung bean accessions

A dendrogram was constructed using the allelic informa-

tion obtained from 48 polymorphic loci across 76 acces-

sions of mung bean (Fig. 2). Genetic similarity was

calculated between all pairs of accessions using Jaccard’s

similarity coefficient which varied from 0.54 to 0.92. The

dendrogram clearly distinguished all the accessions used in

NBPGR,New DelhiNBPGR,New DelhiPali, Raj.Pali, Raj.Jodhpur, Raj.Kutchh, Guj.Kutchh, Guj.Jalore, Raj. Sirohi, Raj.Barmer, Raj.Kutchh, Guj.Sikar, Raj.Jalore, Raj.NBPGR,New DelhiPatan, Guj.NBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiJaiselmer, Raj.Jhunjhunu, Raj.Jodhpur, Raj.Baran, Raj.Pali, Raj.Jaiselmer, Raj.Pali, Raj.Bikaner, Raj.Pali, Raj.NBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiKutchh, Guj.Ahmedabad, Guj.Ahmedabad, Guj.Barmer, Raj.Kutchh, Guj.Kutchh, Guj.Kutchh, Guj.Kutchh, Guj.NBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiPali, Raj.NBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiNBPGR,New DelhiBarmer, Raj.Pali, Raj.Sirohi, Raj.Pali, Raj.Jalore, Raj.Pali, Raj.Pali, Raj.NBPGR,New DelhiKutchh, Raj.Kutchh, Raj.NBPGR,New DelhiKutchh, Raj.Kutchh, Raj.NBPGR,New DelhiNBPGR,New DelhiAhmedabad, Guj.Pali, Raj.Jalore, Raj.NBPGR,New DelhiJalore, Raj.Pali, Raj.Pali, Raj.Pali, Raj.Pali, Raj.Bundi, Raj.

5238 87

53

64

47

71

70

3032

3550

59

59

40

4967

67

8491

48

I

II

IA

IB

IIB

IIA

IIC

Fig. 2 Dendrogram showing genetic relationships among mung bean accessions from different geographical locations constructed using

UPGMA cluster analysis

Mol Biol Rep

123

this study except for two accessions, IC39321 and

IC323998 obtained from NBPGR (New Delhi) and Kutch

(Gujarat), respectively, which showed maximum similarity

(0.92). The dendrogarm revealed that one accession

IC369819 from Bundi, Rajasthan clustered out separately

as an outlier. The remaining accessions were clustered into

two major clusters (I and II) in which the accessions were

randomly distributed and showed no correlation with the

geographical location from which they were obtained.

However, both the major clusters: Cluster I and II were

further divided into sub-clusters, Cluster I in sub-cluster IA

and sub-cluster IB while Cluster II into three sub-clusters

(IIA, IIB and IIC). Sub-cluster IIA was the largest sub-

cluster and most of the accessions from New Delhi were

clustered in this sub-cluster. Since all the accessions could

be successfully distinguished in this study using 48 SSRs, it

established the robustness and utility of the marker set

developed for mung bean.

The current investigation reports the development of

new microsatellite markers for mung bean that were iso-

lated using an SSR enriched genomic library. Marker

potential was evaluated by analysis of genetic diversity

among mung bean accessions obtained from various geo-

graphical locations in India. Overall a set of 328 SSR

primer pairs were designed and 48 of them were used for

the genetic diversity analysis within 76 mung bean acces-

sions. These markers possessed high PIC values and

exhibited high heterozygosity levels and therefore consti-

tute a valuable addition to the genomic microsatellite

marker repository of mung bean and may in future facili-

tate genetic mapping and germplasm characterization for

use in molecular breeding programmes.

Acknowledgments This research work was supported by the

National Institute of Plant Genome Research (NIPGR), New Delhi,

India. Financial assistance provided by the Department of Biotech-

nology (DBT), India through the Project Grant (DBT-PDF Program,

IISc, Bangalore) to DS is thankfully acknowledged. We are thankful to

Dr. Arjun Lal (NBPGR, New Delhi) and Dr. Rakesh Aggarwal (CA-

ZRI, Jodhpur) for providing the accessions of V. radiata for the study.

References

1. Parida A, Raina SN, Narayan RKJ (1990) Quantitative DNA

variation between and within chromosome complements of

Vigna species (Fabaceae). Genetica 82(2):125–133

2. Guo X, Li T, Tang K, Liu RH (2012) Effect of germination on

phytochemical profiles and antioxidant activity of mung bean

sprouts (Vigna radiata). J Agric Food Chem 60(44):11050–11055

3. Ramesh CK, Rehman A, Prabhakar BT, Vijay ABR, Aditya RSJ

(2011) Antioxidant potentials in sprouts vs. seeds of Vigna rad-

iata and Macrotyloma uniflorum. J Appl Pharm Sci 1(7):99–110

4. Lavanya RG, Srivastava J, Ranade SA (2008) Molecular

assessment of genetic diversity in mung bean germplasm.

J Genet 87(1):65–74

5. Somta P, Seehalak W, Srinives P (2009) Molecular diversity

assessment of AVRDC—World vegetable center elite-parental

mungbeans. Breed Sci 59:149–157

6. Raturi A, Singh SK, Sharma V, Pathak R (2012) Stability and

environmental indices analyses for yield attributing traits in

Indian Vigna radiata genotypes under arid conditions. Asian J

Agric Sci 4:126–133

7. Ali M, Gupta S (2012) Carrying capacity of Indian agriculture:

pulse crops. Curr Sci 102(6):874–881

8. Arora RK, Nayar ER (1984) Wild relatives of crop plants in

India. NBPGR Scientific monograph No. 7. National Bureau of

Plant Genetic Resources, New Delhi

9. Bisht IS, Bhatl KV, Lakhanpaul S, Latha M, Jayan PK, Biswas

BK, Singh AK (2005) Diversity and genetic resources of wild

Vigna species in India. Genet Res Crop Evol 52:53–68

10. Chen NC, Parrot JF, Jacobs T, Baker LR, Carlson PS (1977)

Interspecific hybridization of food legumes by unconventional

methods of plant breeding. In: Proceedings first international

mungbean symposium: Asian Vegetable Research and Devel-

opment Centre. Shanhnua, pp 247–252

11. Chowdhury RK, Chowdhury JB (1977) Intergeneric hybridiza-

tion between Vigna mungo L. Hepper and Phaseolus calcaratus

RoxB. Indian J Agric Sci 47:117–121

12. Ahn CS, Hartmann RW (1977) Interspecific hybridization

among four species of the genus Vigna. In: Proceedings of first

international mungbean symposium. Asian vegetable Research

and Development Centre, Shanhua, pp 240–246

13. Gosal SS, Bajaj YPS (1983) Interspecific hybridization between

Vigna mungo and Vigna radiata through embryo culture. Eu-

phytica 32:129–137

14. Bharathi A, VijaySelvaraj KS, Veerabadhiran P, Subba Lakshmi

B (2006) Advances in winter pulse pathology research in Aus-

tralia. Australas Plant Pathol 1(2):120–124

15. Salam MU, Davidson JA, Thomas GJ, Ford R, Jones RAC,

Lindbeck KD, MacLeod WJ, Kimber RBE, Galloway J, Mantri

N, Leur JAG, Coutts BA, Freeman AJ, Richardson H, Aftab M,

Moore KJ, Knights EJ, Nash P, Verrell A (2011) Advances in

winter pulse pathology research in Australia. Australas Plant

Pathol 40(6):549–567

16. Mantri N, Pang E, Ford R (2010) Molecular biology for stress

management. In: Yadav SS, McNeil DN, Weeden N, Patil SS

(eds) Climate change and management of cool season grain

legume crops. Springer, Dordrecht, pp 377–408

17. Santalla M, Power JB, Davery MR (1998) Genetic diversity in

mungbean germplasm revealed by RAPD markers. Plant Breed

117(5):473–478

18. Lakhanpaul S, Chadha S, Bhat KV (2000) Random amplified

polymorphic DNA (RAPD) analysis in Indian mungbean (Vigna

radiata L. Wilczek) cultivars. Genetica 109(3):227–234

19. Bhat KV, Lakhanpaul S, Chadha S (2005) Amplified fragment

length polymorphism (AFLP) analysis of genetic diversity in

Indian mungbean (Vigna radiata (L.) Wilczek) cultivars. Indian

J Biotech 4:56–64

20. Lambridges CL, Lawn RL (2000) Two genetic linkage maps of

mungbean using RFLP and RAPD markers. Aust J Agric Res

51(4):415–425

21. Humphry ME, Konduri V, Lambrides CJ, Magner T, McIntyre

CL, Aitken EAB, Liu CJ (2002) Development of a mungbean

(Vigna radiata) RFLP linkage map and its comparison with

lablab (Lablab purpureus) reveals a high level of colinearity

between the two genomes. Theor Appl Genet 105(1):160–166

22. Eujayl I, Sledge MK, Wang L, May GD, Chekhovskiy K,

Zwonitzer JC, Mian MAR (2004) Medicago truncatula EST-

SSRs reveal cross species genetic markers for Medicago spp.

Theor Appl Genet 108(3):414–422

Mol Biol Rep

123

23. Gautami B, Ravi K, Narasu ML, Hoisington DA, Varshney RK

(2009) Novel set of groundnut SSR markers for germplasm

analysis and interspecific transferability. Int J Integr Biol (IJIB)

7(2):100–106

24. Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger

A (2001) Microsatellite polymorphism in Pisum sativum. Plant

Breed 120(4):311–317

25. Koebner RMD, Donini R, Reeves JC, Cooke RJ, Law JR (2003)

Temporal flux in the morphological and molecular diversity of

UK barley. Theor Appl Genet 106(3):550–558

26. Taller JM, Bernardo R (2004) Diverse adapted populations for

improving northern maize inbreds. Crop Sci 44(4):1444–1449

27. Wang L, Guan Y, Guan R, Li Y, Ma Y, Dong Z, Liu X, Zhang H,

Zhang Y, Liu Z, Chang R, Xu H, Li L, Lin F, Luan W, Yan Z, Ning

X, Zhu L, Cui Y, Piao R, Liu Y, Chen P, Qiu L (2006) Estab-

lishment of Chinese soybean Glycine max core collections with

agronomic traits and SSR markers. Euphytica 151(2):215–223

28. Cao QJ, Lu BR, Xia H, Rong J, Sala F, Spada A, Grassi F (2006)

Genetic diversity and origin of weedy rice (Oryza sativa f. spon-

tanea) populations found in North-eastern China revealed by

simple sequence repeat (SSR) markers. Ann Bot 98(6):1241–1252

29. Blair MW, Giraldo MC, Buendia HFE, Duque MC, Beebe SE

(2006) Microsatellite marker diversity in common bean

(Phaseolus vulgaris L.). Theor Appl Genet 113(1):100–109

30. Gimenes MA, Hoshino AA, Barbosa AV, Palmieri DA, Lopes

CR (2007) Characterization and transferability of microsatellite

markers of the cultivated peanut (Arachis hypogaea L.). BMC

Plant Biol 7:9

31. Parida SK, Kalia SK, Kaul S, Dalal V, Hemaprabha G, Selvi A,

Pandit A, Singh A, Gaikwad K, Sharma TR, Srivastava PS,

Singh NK, Mohapatra T (2009) Informative genomic micro-

satellite markers for efficient genotyping applications in sugar-

cane. Theor Appl Genet 118(2):327–338

32. Sethy NK, Shokeen B, Edwards KJ, Bhatia S (2006) Develop-

ment of microsatellite markers and analysis of intra-specific

genetic variability in chickpea (Cicer arietinum L.). Theor Appl

Genet 112(8):1416–1428

33. Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S

(2011) Advancing the STMS genomic resources for defining

new locations on the intraspecific genetic linkage map of

chickpea (Cicer arietinum L.). BMC Genomics 12:117

34. Choudhary S, Gaur R, Gupta S, Bhatia S (2012) EST-derived

genic molecular markers: development and utilization for gen-

erating an advanced transcript map of chickpea. Theor Appl

Genet 124(8):1449–1462

35. Mastan SG, Sudheer PDVN, Rahman H, Ghosh A, Rathore MS,

Prakash CR, Chikara J (2012) Molecular characterization of

intra-population variability of Jatropha curcas L. using DNA

based molecular markers. Mol Biol Rep 39(4):4383–4390

36. Baldwin S, Pither-Joyce M, Wright K, Chen L, McCallum J

(2012) Development of robust genomic simple sequence repeat

markers for estimation of genetic diversity within and among

bulb onion (Allium cepa L.) populations. Mol Breed

30(3):1401–1411

37. Rai MK, Phulwaria M, Shekhawat NS (2013) Transferability of

simple sequence repeat (SSR) markers developed in guava

(Psidium guajava L.) to four Myrtaceae species. Mol Biol Rep

40(8):5067–5071

38. Bali S, Raina SN, Bhat V, Aggarwal RK, Goel S (2013)

Development of a set of genomic microsatellite markers in tea

(Camellia L.) (Camelliaceae). Mol Breed 32(3):735–741

39. Varshney RK, Kudapa H, Roorkiwal M, Thudi M, Pandey MK,

Saxena RK, Chamarthi SK, Mohan SM, Mallikarjuna N, Up-

adhyaya H, Gaur PM, Krishnamurthy L, Saxena KB, Nigam SN,

Pande S (2012) Advances in genetics and molecular breeding of

three legume crops of semi-arid tropics using next-generation

sequencing and high-throughput genotyping technologies.

J Biosci 37(5):811–820

40. Kumar SV, Tan SG, Quah SC, Yusoff K (2002) Isolation of

microsatellite markers in mungbean, Vigna radiata. Mol Ecol

Notes 2(2):96–98

41. Kumar SV, Tan SG, Quah SC, Yusoff K (2002) Isolation and

characterization of seven tetranucleotide microsatellite loci in

mung bean, Vigna radiata. Mol Ecol Notes 2:293–295

42. Miyagi M, Humphry M, Ma ZY, Lambrides CJ, Bateson M, Liu

CJ (2004) Construction of bacterial artificial chromosome

libraries and their application in developing PCR-based markers

closely linked to a major locus conditioning bruchid resistance

in mungbean (Vigna radiata L. Wilczek). Theor Appl Genet

110(1):151–156

43. Gwag JG, Chung WK, Chung HK, Lee JH, Ma KH, Dixit A,

Park YJ, Cho EG, Kim TS, Lee SH (2006) Characterization of

new microsatellite markers in mungbean, Vigna radiata (L.).

Mol Ecol Notes 6(4):1132–1134

44. Seehalak W, Somta P, Sommanas W, Srinives P (2009)Microsatellite markers for mungbean developed from sequence

database. Mol Ecol Res 9(3):862–864

45. Tangphatsornruang S, Somta P, Uthaipaisanwong P, Chanpra-

sert J, Sangsrakru D, Seehalak W, Sommanas W, Tragoonrung

S, Srinives P (2009) Characterization of microsatellites and gene

contents from genome shotgun sequences of mungbean (Vigna

radiata (L.)Wilczek). BMC Plant Biol 9:137

46. Somta P, Seehalak W, Srinives P (2009) Development, character-

ization and cross-species amplification of mungbean (Vigna radi-

ata) genic microsatellite markers. Conserv Genet 10(6):1939–1943

47. Moe KT, Chung J-W, Cho Y-I, Moon J-K, Ku J-H, Jung J-K,

Lee J, Park Y-J (2011) Sequence information on simple

sequence repeats and single nucleotide polymorphisms through

transcriptome analysis of mungbean. J Integr Plant Biol

53(1):63–73

48. Singh N, Singh H, Nagarajan P (2013) Development of SSR

markers in mung bean, Vigna radiata (L.) Wilczek using in

silico methods. J Crop Weed 9(1):69–74

49. Gupta SK, Bansal R, Gopalakrishna T (2014) Genome-wide

SNP discovery in mungbean by Illumina HiSeq. Theor Appl

Genet 195:245–258

50. Van K, Kang YJ, Han KS, Lee YH, Gwag JG, Moon JK, Lee SH

(2013) Genome-wide SNP discovery in mungbean by Illumina

HiSeq. Theor Appl Genet 126(8):2017–2027

51. Hamblin MT, Warburton ML, Buckler ES (2007) Empirical

comparison of simple sequence repeats and single nucleotide

polymorphisms in assessment of maize diversity and related-

ness. PLoS One 2(12):e1367

52. Yang X, Xu Y, Shah T, Li H, Han Z, Li J, Yan J (2011)

Comparison of SSRs and SNPs in assessment of genetic relat-

edness in maize. Genetica 139(8):1045–1054

53. Emanuelli F, Lorenzi S, Grzeskowiak L, Catalano V, Stefanini

M, Troggio M, Myles S, Martinez-Zapater JM, Zyprian E,

Moreira FM, Grando MS (2013) Genetic diversity and popula-

tion structure assessed by SSR and SNP markers in a large

germplasm collection of grape. BMC Plant Biol 13:39

54. Khanuja SPS, Shasany AK, Darokar MP, Kumar S (1999) Rapid

isolation of DNA from dry and fresh samples of plant producing

large amounts of secondary metabolites and essential oils. Plant

Mol Biol Rep 17(1):74

55. Malmberg R, Messing J, Sussex I (1985) Molecular biology of

plants: a laboratory course manual. Cold Spring Harbor, New

York

56. Kijas JMH, Fowler JCS, Garbett CA, Thomas MR (1994)

Enrichment of microsatellites from the citrus genome using

biotinylated oligonucleotide sequences bound to streptavidin-

coated magnetic particles. Biotechniques 16(4):656–662

Mol Biol Rep

123

57. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a

laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory

Press, New York

58. Huang X, Madan A (1999) CAP3: a DNA sequence assembly

program. Genome Res 9(9):868–877

59. Castelo AT, Martins W, Gao GR (2002) TROLL-tandem repeat

occurrence locator. Bioinformatics 18(4):634–636

60. Rozen S, Skaletsky HJ (1997) PRIMER 3. Code available at, http://

www.genome.wi.mit.edu/genome_software/other/primer3.html

61. Choudhary S, Sethy NK, Shokeen B, Bhatia S (2009) Develop-

ment of chickpea EST-SSR markers and analysis of allelic vari-

ation across related species. Theor Appl Genet 118(3):591–608

62. Yeh FC, Boyle TJB (1997) Population genetic analysis of co-

dominant and dominant markers and quantitative traits. Belg J

Bot 129:157

63. Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells

ME (1993) Optimizing parental selection for genetic linkage

maps. Genome 36(1):181–186

64. Jaccard P (1908) Nouvelles recherches sur la distribution florale

Bulletin de la societe vauodoise des sciences. Naturelles

44:223–270

65. Rohlf FJ (1998) NTSYS-pc: numerical taxonomy and multi-

variate analysis system, in: Version 2. 1. Exeter Software,

Applied Biostatistics Setauket, NewYork

66. Yap IV, Nelson RJ (1996) WinBoot: a program for performing

bootstrap analysis of binary data to determine the confidence

limits of UPGMA-based dendrograms. IRRI, Philippines

67. Bhattramakki D, Dong J, Chhabra K, Hart GE (2000) An inte-

grated SSR and RFLP linkage map of Sorghum bicolor (L.)

Moench. Genome 43(6):988–1002

68. Sharopova N, McMullen MD, Schultz L, Schroeder S, Sanchez-

Villeda H, Gardiner J, Bergstrom D, Houchins K, Melia-Han-

cock S, Musket T, Duru N, Polacco M, Edwards K, Ruff T,

Register JC, Brouwer C, Thompson R, Velasco R, Chin E, Lee

M, Woodman-Clikeman W, Long MJ, Liscum E, Cone K, Davis

G, Coe EH (2002) Development and mapping of SSR markers

for maize. Plant Mol Biol 48:463–481

69. Gupta P, Varshney R (2000) The development and use of

microsatellite markers for genetic analysis and plant breeding

with emphasis on bread wheat. Euphytica 113(3):163–185

70. Zane L, Bargelloni L, Patarnello T (2002) Strategies for

microsatellite isolation: a review. Mol Ecol 11(1):1–16

71. Somta P, Musch W, Kongsamai B, Chanprame S, Nakasathien

S, Toojinda T, Sorajjapinun W, Seehalak W, Tragoonrung S,

Srinives P (2008) New microsatellite markers isolated from

mungbean (Vigna radiata (L.) Wilczek). Mol Ecol Res

8(5):1155–1157

72. Isemura T, Kaga A, Tabata S, Somta P, Srinives P, Shimizu T, Jo

U, Vaughan DA, Tomooka N (2012) Construction of a genetic

linkage map and genetic analysis of domestication related traits in

mungbean (Vigna radiata). PLoS One 7(8):e41304

73. Dan Z, Xu-Zhen C, Li-Xia W, Su-Hua W, Yan-Ling M (2010)

Construction of mungbean genetic linkage map. Acta Agron Sin

36(6):932–939

74. Squirrell J, Hollingsworth PM, Woodhead M, Russell J, Lowe AJ,

Gibby M, Powell W (2003) How much effort is required to isolate

nuclear microsatellites from plants? Mol Ecol 12(6):1339–1348

75. Pestova F, Ganal MW, Roder MS (2000) Isolation and mapping

of microstallite markers specific for the D-genome of bread

wheat. Genome 43(4):689–697

76. Jones ES, Dupal MP, Kolliker R, Drayton MC, Forster JW

(2001) Development and characterization of simple sequence

repeat (SSR) markers for perennial ryegrass (Lolium perenne

L.). Theor Appl Genet 102:405–415

77. Hirata M, Cai HW, Inoue M, Yuyama N, Miura Y, Komatsu T,

Takamizo T, Fujimori M (2006) Development of simple

sequence repeat (SSR) markers and construction of an SSR

based linkage map in Italian ryegrass (Lolium multiflorum

Lam.). Theor Appl Genet 113(2):270–279

78. Tsuruta SI, Hashiguchi M, Ebina M, Matsuo T, Yamamoto T,

Kobayashi M, Takahara M, Nakagawa H, Akashi R (2005)

Development and characterization of simple sequence repeat

markers in Zoysia japonica Steud. Grassl Sci 51(3):249–257

79. Saha MC, Cooper JD, Rouf Mian MA, Chekhovskiy K, May GD

(2006) Tall fescue genomic SSR markers: development and

transferability across multiple grass species. Theor Appl Genet

113(8):1449–1458

80. Jia X, Zhang Z, Liu Y, Zhang C, Shi Y, Song Y, Wang T, Li Y

(2009) Development and genetic mapping of SSR markers in

foxtail millet [Setaria italica (L.) P. Beauv.]. Theor Appl Genet

118(4):821–829

81. Wang YW, Samuels TD, Wu YQ (2011) Development of 1,030

genomic SSR markers in switchgrass. Theor Appl Genet

122(4):677–686

82. Toth G, Gaspari Z, Jurka J (2000) Microsatellites in different

eukaryotic genomes survey and analysis. Genome Res 10(7):967–981

83. Cardle L, Ramsay L, Milbourne D, Macaulay M, Marshall D,

Waugh R (2000) Computational and experimental character-

ization of physically clustered simple sequence repeats in plants.

Genetics 156:847–854

84. Powell W, Machray GC, Provan J (1996) Polymorphism revealed

by simple sequence repeats. Trends Plant Sci 1(7):215–222

85. Varshney RK, Kumar A, Balyan HS, Roy JK, Prasad M, Gupta

PK (2000) Characterization of microsatellites and development

of chromosome specific STMS markers in bread wheat. Plant

Mol Biol Rep 18(1):5–16

86. Rajendrakumar P, Biswal AK, Balachandran SM, Srinivasarao

K, Sundaram RM (2007) Simple sequence repeats in organellar

genomes of rice: frequency and distribution in genic and inter-

coding regions. Bioinformatics 23(1):1–4

87. Hamwieh A, Udupa SM, Sarker A, Jung C, Baum M (2009)

Development of new microsatellite markers and their applica-

tion in the analysis of genetic diversity in lentils. Breed Sci

59:77–86

88. Shokeen B, Choudhary S, Sethy NK, Bhatia S (2011) Devel-

opment of SSR and gene-targeted markers for construction of a

framework linkage map of Catharanthus roseus. Ann Bot

(Lond) 108(2):321–336

89. Cuc LM, Mace ES, Crouch JH, Quang VD, Long TD, Varshney

RK (2008) Isolation and characterization of novel microsatellite

markers and their application for diversity assessment in culti-

vated groundnut (Arachis hypogaea). BMC Plant Biol 8:55

90. Jena SN, Srivastava A, Rai KM, Ranjan A, Singh SK, Nisar T,

Srivastava M, Bag SK, Mantri S, Asif MH, Yadav HK, Tuli R,

Sawant SV (2012) Development and characterization of geno-

mic and expressed SSRs for levant cotton (Gossypium herba-

ceum L.). Theor Appl Genet 124(3):565–576

91. Shokeen B, Sethy NK, Kumar S, Bhatia S (2007) Isolation and

characterization of microsatellite markers for analysis of

molecular variation in the medicinal plant Madagascar peri-

winkle (Catharanthus roseus (L.) G. Don). Plant Sci

172(3):441–451

92. Gupta S, Kumari K, Sahu PP, Vidapu S, Prasad M (2012)

Sequence-based novel genomic microsatellite markers for robust

genotyping purposes in foxtail millet [Setaria italic L.) P.

Beauv.]. Plant Cell Rep 31(2):323–337

93. Pejic I, Ajmone-Marsan P, Morgante M, Kozumplick V, Cas-

tiglioni P, Taramino G, Motto M (1998) Comparative analysis of

genetic similarity among maize inbred lines detected by RFLPs,

RAPDs, SSRs, and AFLPs. Theor Appl Genet 97:1248–1255

94. Prasad M, Varshney RK, Roy JK, Balyan HS, Gupta PK (2000)

The use of microsatellites for detecting DNA polymorphism,

Mol Biol Rep

123

genotype identification and genetic diversity in wheat. Theor

Appl Genet 100:584–592

95. Morgante M, Olivieri AM (1993) PCR amplified microsatellites

as markers in plant genetics. Plant J 3(1):175–182

96. Lagercrantz U, Ellegren H, Andersson L (1993) The abundance

of various polymorphic microsatellite motifs differs between

plants and vertebrates. Nucleic Acids Res 21(5):1111–1115

97. Wright S (1978) Evolution and the genetics of populations.

Variability within and among natural populations, vol 4. Uni-

versity of Chicago Press, Chicago

98. Smartt J (1990) Grain legumes: evolution and genetic resources.

Cambridge University Press, Cambridge

99. Tomooka N, Lairungreang C, Nakeeraks P, Egawa Y, Thav-

arasook C (1991) Center of genetic diversity, dissemination

pathways and landrace differentiation in mung bean. In: Tha-

vasarook C (ed) Proceedings of mung bean meeting 90, Tropical

agricultural Research Center, Japan, Thailand office, Bangkok,

pp 47–71

100. Sangiri C, Kaga A, Tomooka N, Vaughan D, Srinives P (2007)

Genetic diversity of the mungbean (Vigna radiata, Legumino-

sae) genepool on the basis of microsatellite analysis. Aust J Bot

55:837–847

Mol Biol Rep

123