ORIGINAL PAPER

Enzymatic and genetic profiles in environmental strainsgrown on polycyclic aromatic hydrocarbons

Lucia Cavalca Æ Nicoletta Guerrieri ÆMilena Colombo Æ Silvia Pagani ÆVincenza Andreoni

Received: 27 June 2006 / Accepted: 11 September 2006� Springer Science+Business Media B.V. 2006

Abstract The possible generation of oxidative

stress induced by aromatic hydrocarbon degra-

dation suggests that ancillary enzyme activities

could facilitate the utilization of polycyclic

aromatic hydrocarbons as sole carbon source.

To investigate the metabolic profiles of low

molecular weight polycyclic aromatic hydrocar-

bon-degrading strains of Sphingobium chlor-

ophenolicum, Rhodococcus aetherovorans,

Rhodococcus opacus and Mycobacterium

smegmatis, the determination of the activity of

putative detoxifying enzymes (rhodanese-like

and glutathione S-transferase proteins) was

combined with genetic analyses. All the studied

strains were able to utilize phenanthrene or

naphthalene. Glutathione S-transferase activity

was found in S. chlorophenolicum strains grown

on phenanthrene and it was related to the

presence of the bphK gene, since modulation of

glutathione S-transferase activity by phenan-

threne paralleled the induction of glutathione

S-transferase transcript in the S. chlorophenoli-

cum strains. No glutathione S-transferase activ-

ity was detectable in R. aetherovorans,

R. opacus and in M. smegmatis strains. All

strains showed 3-mercaptopyruvate:cyanide sul-

furtransferase activity. A rhodanese-like SseA

protein was immunodetected in R. aetherovo-

rans, R. opacus and in M. smegmatis strains,

where increase of 3-mercaptopyruvate:cyanide

sulfurtransferase activity was significantly in-

duced by growth on phenanthrene.

Keywords Phenanthrene � PAH � Glutathione

S-transferase � Rhodanese-like enzymes �Catabolic genes � bphK gene expression

AbbreviationsbphK gene for glutathione S-transferase

CDNB 1,dichloro-2,4-nitrobenzene

GST glutathione S-transferase

MST 3-mercaptopyruvate:cyanide

sulfurtransferase

PAHs polycyclic aromatic hydrocarbons

phnA1 gene for 3,4-phenanthrene dioxygenase

ROS reactive oxygen species

TST thiosulfate:cyanide sulfurtransferase

xylE 2,3-catechol dioxygenase

xylX ring hydroxylating dioxygenase

narAa naphthalene dioxygenase

Sequence accession numbers: narAa of 1BN was underthe GeneBank acc. num.: AJ401612.

L. Cavalca � M. Colombo � V. AndreoniDipartimento di Science e Tecnologie, Alimentari eMicrobiologiche, Universita degli Studi di Milano,Via Celoria 2, 20133 Milano, Italy

N. Guerrieri � S. Pagani (&)Dipartimento di Scienze Molecolari Agroalimentari,Universita degli Studi di Milano, Via Celoria 2, 20133Milano, Italye-mail: silvia.pagani@unimi.it

123

Antonie van Leeuwenhoek

DOI 10.1007/s10482-006-9119-1

Introduction

Polycyclic aromatic hydrocarbons (PAHs) are

ubiquitous environmental pollutants, that are

considered priority pollutants on the basis of

their toxicity, carcinogenicity and recalcitrance in

the environment (Kanaly and Harayama 2000).

The biodegradation of low-molecular-weight

PAHs has been studied with Gram-negative and

Gram-positive species and attention has also been

tuned to genes involved in their catabolism (Kim

and Zylstra 1999; Pinyakong et al. 2003a; Saito

et al. 1999). Genes coding for putative glutathione

S-transferases (GSTs) have been found within

degradative operons either of monoaromatic

hydrocarbons or PAHs (Bartels et al. 1999;

Favaloro et al. 2000; Xia et al. 2005).

The picture emerging from bacterial genome

sequences is that many bacteria contain large sets

of GST genes of widely divergent sequences.

Although their function, structure and regulation

are still not completely understood (Vuilleumier

and Pagni 2002), their involvement in the bio-

degradation of xenobiotics and/or in detoxifica-

tion from reactive oxygen species (ROS) was

claimed (Nagata et al. 1999). It was reported that

some GSTs show peroxidase activity and partic-

ipate in epoxide hydrolysis and dehalogenation

(Van Hylckama et al. 2000). Chavez et al. (2004)

proved that the growth of bacteria on polychlo-

rinated biphenyls led to a generation of oxidative

stress. ROS and other radicals were also found to

be produced in Ochrobactrum anthropi grown on

aromatic compounds, as a consequence of activ-

ities of either monoxygenases or dioxygenases

(Tamburro et al. 2004). In this respect, enzymes

with putative scavenger activities could help the

cell to overcome xenobiotic-induced stress. In

addition to GSTs, enzymes that could likely be

involved in detoxification processes should be

members of the rhodanese protein homology

superfamily (Accession number: PF00581; http://

www.sanger.ac.uk/Software/Pfam). They are

ubiquitous enzymes displaying sequence homol-

ogy with bovine rhodanese (thiosulfate:cyanide

sulfurtransferase; Ploegman et al. 1978) which

catalyze the in vitro transfer of a sulfur atom from

a suitable sulfur donor (thiosulfate for rhodanes-

es, and 3-mercaptopyruvate for 3-mercaptopyru-

vate:sulfurtransferases) to cyanide, with

concomitant formation of thiocyanate (Westley

1977). Rhodanese modules have been found in

arsenate resistance (Bordo and Bork 2002) and in

stress-related proteins (Adams et al. 2002; Ray

et al. 2000). Up-regulation of genes coding for

rhodanese-like proteins in response to phenol-

induced stress in Pseudomonas putida (Santos

et al. 2004) and in Mycobacterium sp. strain 6PY1

grown on pyrene (Krivobok et al. 2003) was

recently found by proteomic analysis.

In the present study, an investigation aimed to

define enzymatic profiles, as well as the presence

of catabolic genes, was carried out by using

environmental PAH-degrading strains (S. chlor-

ophenolicum, R. aetherovorans, R. opacus and M.

smegmatis). Determination of GST and 3-merca-

ptopyruvate:cyanide sulfurtransferase (MST)

activities after growth on PAHs, as compared to

the activities measured when glucose was the

carbon source, allowed the identification of

strains where these activities were induced selec-

tively by the presence of PAHs. Genetic analyses

revealed that the GST activity found in

S. chlorophenolicum strains was related to the

presence of the bphK gene.

Materials and methods

Chemicals

Benzene, toluene, benzoate (purity >99%) were

purchased from Merck (Darmstadt, Germany);

HPLC grade phenanthrene and naphthalene

(purity >96%), n-hexadecane (purity >99%),

o-phthalate (purity >99.5%), 3-mercaptopyruvate

(purity >90%), 1-dichloro-2,4-nitrobenzene (CD-

NB) (purity >99%) and reduced glutathione

(GSH) (purity >99%) from Sigma-Aldrich Che-

mie (Steinheim, Germany); salicylate (pur-

ity >99.5%) from Fluka Chemie (Buch,

Switzerland).

Antonie van Leeuwenhoek

123

Bacterial strains and culture conditions

Strains were isolated from PAH-contaminated

soils by successive enrichment cultures with

phenanthrene as the only carbon source (Andre-

oni et al. 2004). The growth characteristics of the

isolates on hydrocarbons (Table 1) were studied

in 100 ml flasks containing 20 ml of M9 mineral

medium (Kunz and Chapmann 1981) at 30�C on a

rotary shaker at 150 rpm. Phenanthrene and

naphthalene were dispensed as acetone solutions

sterilized by filtration with a 0.2 lm-pore-size-

membrane filter, at the final concentration of

400 mg l–1. Salicylate, benzoate and o-phthalate

were supplied as aqueous solutions at the final

concentrations of 200 mg l–1. n-Hexadecane, tol-

uene and benzene were supplied as pure com-

pounds at the final concentrations of 200 mg l–1,

the flasks were incubated in separate sealed jars.

Growth was evaluated by determining the tur-

bidity at 600 nm of cultures on a Beckman model

DU 640 spectrophotometer.

Strains were identified on the basis of sequence

analysis of the complete 16S rRNA gene by using

eubacterial universal primers P27f and P1495r

(Table 2) referred to Escherichia coli nucleotide

sequence of 16S rDNA gene, according to the

protocol previously reported (Cavalca et al.

2002). Strains C3R, 1.7, 1.8, 5.1 were identified

as S. chlorophenolicum (ex Sphingomonas flava)

(98% identity to GeneBank acc. num. X87164),

strain F was identified as M. smegmatis (99%

identity to GeneBank acc. num. AY457078),

strains 1.9 and 6.22 were identified as R. aethe-

rovorans (100% identity GeneBank acc. num.

AF447392). R. opacus 1BN was previously iden-

tified (Andreoni et al. 2000).

Preparation of cell extracts

Strains 1.7 and C3R were separately grown in M9

liquid cultures containing either glucose (1 g l–1)

or phenanthrene (400 mg l–1). Cells were har-

vested by centrifugation (15 min at 10,000 · g,

5�C) at fixed incubation times, washed twice with

50 mM Tris–HCl buffer pH 7.5, containing 0.3 M

NaCl. The washed cells were frozen and stored at

–20�C.

Cell-free extracts for immunological detection

and enzymatic assays were prepared from washed

frozen cells (1 g) by treatment with lysozyme

(1 mg) in 50 mM Tris–HCl buffer pH 8.0, con-

taining 0.3 M NaCl followed by pulse sonication

(3 min) and centrifugations (1 h at 10,000 · g,

and 40 min at 19,600 · g).

Enzyme assays

The discontinuous method that quantitates the

product thiocyanate, based on the absorption of

the ferric-thiocyanate complex at 460 nm, was

used to determine either thiosulfate:cyanide sul-

furtransferase (TST) activity (Sorbo 1953), or

MST activity (Jaraback and Westley 1980), with

thiosulfate and 3-mercaptopyruvate the sulfur

donor, respectively. One unit of enzyme activity

Table 1 Growth characteristics of the strains analysed in the study

Strains Growth substrates

Phen Naph Salicylate o-Phthalate Benzoate Benzene Toluene n-Hexa

S. chlorophenolicum 1.7 + – + – + – + –S. chlorophenolicum 1.8 + – + – + – – –S. chlorophenolicum C3R + + + – + – – –S. chlorophenolicum 5.1 + + + – + – + –R. aetherovorans 1.9 + – + – + – – +R. aetherovorans 6.22 +/– + + – + – + +R. opacus 1BN – + + – + + + +M. smegmatis F + – + – + – – +

phenanthrene (Phen); naphthalene (Naph); n-hexadecane (n-Hexa); growth (+); absence of growth (–); weak growth(+/–)

Results were recorded after growth of two subsequent cultures

Antonie van Leeuwenhoek

123

(U) is defined as the amount of enzyme that

produces 1 lmol thiocyanate min–1 at 37�C.

GST activity was determined as described in

Asaoka et al. (1977) in the presence of CDNB

and GSH, by measuring the absorbance increase

at 340 nm due to the formation of S-chloronitro-

phenyl glutathione (e340 = 9.600 M–1 cm–1). One

unit of enzyme activity (U) is defined as the

amount of enzyme that produces the conjugation

of 1 lmol of substrate (CDNB) min–1 at 37�C. All

enzymatic assays were carried out in a spectro-

photometer (Lambda 2, Perkin-Elmer) equipped

with a thermostatic cell holder.

The protein concentration of cell-free extracts

was determined by the method of Bradford

(1976).

Western Blot

Immunological detection of either RhdA-like or

SseA-like proteins blotted onto nitrocellulose

membranes from SDS-PAGE gels of the extracts,

was performed as previously described (Cereda

et al. 2003). Polyclonal anti-RhdA antibodies

raised against purified Azotobacter vinelandii

RhdA after overexpression in E. coli (Bordo

et al. 2000), and polyclonal anti-SseA antibodies

raised against purified E. coli SseA (Colnaghi

et al. 2001) were used.

Phenanthrene degradation experiments

Two strains, named C3R and 1.7, which exhibited

both GST and MST activities after growth on

phenanthrene, were chosen. Phenanthrene degra-

dation experiments were carried out in triplicate

in 100 ml vials. To each vial, 400 mg l–1 phenan-

threne dissolved in acetone was added and, after

evaporation of the solvent, the vials were filled

with 19 ml of M9 medium. The systems were

separately inoculated with 1 ml (OD600 = 0.5) of

cell suspension of S. chlorophenolicum C3R and

1.7 strains. Vials were closed with butyl rubber

stoppers and incubated at 30�C on a rotary shaker

at 150 rpm and they were sacrificed at intervals to

determine growth curves and phenanthrene con-

tent. The viable plate count method on 0.1·Tryptic Soy Agar was used to determine microbial

growth. Phenanthrene was quantified by HPLC

analyses carried out in a HPLC chromatograph

(mod. LG 980/02, Jasco Ternary Gradient Unit)

equipped with an octyl silane column (Merck

Lichrosorb RP-8, length 25 cm). A mixture of

methanol–water (75:25, vol/vol) acidified by the

addition of 0.1% phosphoric acid was the mobile

phase. The flow rate of eluent was 0.8 ml min–1.

The compound was detected by measuring the UV

absorbance at 254 nm in an UV-975 Intelligent

Jasco detector. The concentration of

Table 2 PCR primers used in the study

Primer name Sequence (5¢–3¢) Amplifiedgene

Amplicon(bp)

Reference

P27F GAGAGTTTGATCCTGGCTCAG 16S rDNA 1468 Cavalca et al. (2002)P1495R CTACGGCTACCTTGTTACGAPhn238F TGCAC(G/C/T)CA(C/T)CGCCAACCAG phnA1 691 This workPhn929R GT(G/A)TTGGT(G/T)CC(G/A)TA(C/A/

G)AGGAACGPhn321F TTCTCGGTCGGG ACTTTCCAA phnA1 350 This workPhn671R GGCAACCAGATCTGTCATGGst46F AT(T/C)GCCCTGCGCGAAACCG bphK 442 This workGst488R CCCAGCATCACG(T/A)ACAGATAGATGTCXyl124F GC(T/C)TT(T/C)TTCCAGGC(G/C)TT(T/C)GACG xylE 652 This workXyl776R GGATCGAAGAA(G/A)TAGATCGTCTGTbd646F GGCAACTGGAAG(T/A)TGCAGG xylX 524 This workTbd1170R CTG(G/A)CAGTTGTTGAA(T/C)TCGGTCAGNarAa1010F TACCTCGGCGACCTGAAGTTCTA narAa 625 Andreoni et al.

(2000)NarAa1611R AGTTCTCGGCGTCGTCCTGTTCGAA

Antonie van Leeuwenhoek

123

phenanthrene in the samples was calculated by

using standards of known concentrations.

DNA extraction

Cell suspensions (100 ll OD600 = 2.0) were cen-

trifuged at 13,000 · g for 7 min and suspended in

100 ll of sterile MilliQ water, 100 ll of 10 mM

Tris–HCl buffer pH 8.0 and 13 ll of Proteinase K

(1 mg ml–1). The mix was incubated for 2 h at

55�C then boiled for 10 min and centrifuged at

13,000 · g for 5 min. The DNA-containing super-

natant was withdrawn and put in sterile

microtubes.

Polymerase chain reaction (PCR)

amplifications

Amplification of genes for 3,4-phenantrene diox-

ygenase large subunit (phnA1), for GST (bphK),

for toluate/benzoate dioxygenase large subunit

(xylX) and for 2,3-extradiol dioxygenase (xylE),

were performed in 50 ll final volume containing:

10X buffer (BIO101 Qbiogene), 1.75 mM MgCl2,

200 lM nucleotides (dNTPs) (GE Healthcare,

Sweden), 0.2 lM forward and reverse primers

each (Invitrogen, UK), 1 U Taq polymerase

(BIO101 Qbiogene), and 1 ll of template DNA.

On the basis of database available sequences

degenerated primers were designed (Table 2) for

PCR amplification of homologous catabolic genes

in soil isolates using the following strategies.

Primer set Phn238F/Phn929R was placed at

positions 238 and 929 of the reference nucleotide

sequence of phnA1 gene for 3,4-phenanthrene

dioxygenase large subunit of strain Sphingomonas

sp. CHY1 (GeneBank acc. num. AJ633551).

Primer set Gst46F/Gst488R was placed at posi-

tions 46 and 488 of the reference nucleotide

sequence of gene bphK for GST of strain

Sphingomonas aromaticivorans F199 (GeneBank

acc. num. AF079317). Primer set Xyl124F/

Xyl776R was placed at positions 124 and 776 of

the reference nucleotide sequence of xylE gene

for 2,3-extradiol dioxygenase of strain S. aromat-

icivorans F199 (GeneBank acc. num. AF079317).

Primer set Tbd646F/Tbd1170R was placed at

positions 646 and 1170 of the reference nucleotide

of xylX gene for toluate/benzoate dioxygenase

large subunit of strain S. aromaticivorans F199

(GeneBank acc. no. AF079317). The thermal

profile was: 94�C for 2 min, followed by 35 cycles

(94�C for 40 s, 60�C for 50 s, 72�C for 1 min) and

72�C for 7 min. Amplifications of narAa gene for

1,2-naphtalene dioxygenase large subunit was

carried out as previously described (Andreoni

et al. 2000).

All sequences were obtained by using the Taq

Dye-Deoxy Terminator Cycle Sequencing kit

(Applied Biosystems, USA) and automatic

DNA sequencer (373A, Applied Biosystems,

USA) according to the manufacturer’s instruc-

tions. Primers used in the PCR reaction of

sequencing products were the same as in normal

PCR reactions.

RNA extraction and RT-PCR analysis

Total RNA was extracted from S. chlorophenol-

icum cultures (1.7 and C3R strains) after 4 day

growth in mineral medium (M9) supplemented

with 400 mg l–1 phenanthrene or 1 g l–1 glucose.

Samples (1010 cells) were spun down (8000 · g for

15 min), the cell pellets were suspended in

3.25 ml lysing buffer (80 mM Tris–HCl buffer

pH 7.6 containing 800 mM NaCl and 8 mM

EDTA) and digested for 1 h at 50 �C with 1 mg

proteinase K. RNA was further extracted with

phenol, phenol:chlorophorm:isoamil alcohol

(25:24:1, vol/vol/vol) and chlorophorm:isoamil

alcohol (24:1, vol/vol). RNA was recovered after

precipitation with ethanol and treated with

RNase-free DNase I (GE Healthcare, Sweden).

For semi-quantitative RT-PCR, DNAse treated

total RNAs were retrotranscribed to first-strand

cDNA using Stratascript Reverse Transcriptase

(Stratagene, USA) according to the manufac-

turer’s instructions. cDNA aliquots from the RT

reactions were used for the amplification of the

different genes with Taq DNA Polymerase (Invi-

trogen, UK). The PCR primers used were the

followings: Phn321F/Phn671R primer set, specif-

ically designed on the nucleotide sequences

obtained from phnA1 3,4-phenanthrene dioxy-

genase gene of strains 1.7 and C3R (Table 2); the

Gst46F/Gst488R primer set; P27F/P1495R primer

set, used to amplify the 16S rRNA gene as an

amplification control of housekeeping gene. The

Antonie van Leeuwenhoek

123

PCR products were separated on 2% agarose gels

along with O’gene Ruler 1 kb ladder (Fermentas,

Canada). As positive controls, genomic DNA

from the same strains was used as template. As

negative controls, not retro transcribed DNase-

treated RNA was used as template in order to

avoid false positive results.

Results

Growth profiles and genetic traits of the

studied strains

The ability of the strains to utilize PAHs as sole

sources of carbon and energy is reported in

Table 1. The strains were differently able to

utilize phenanthrene and/or naphthalene. All

the strains grew on benzoate and on salicylate,

but not on o-phthalate. R. aetherovorans strains

1.9 and 6.22, R. opacus 1BN and M. smegmatis F

grew also on n-hexadecane. Genetic analyses

were performed to identify in the strains some

genetic traits for catabolic features, and the

presence of GSTs (Table 3). Amplification of

the genes (phnA1 and xylE) for phenanthrene

degradation present, respectively, in the upper

and in the lower degradative operons, for monoa-

romatic ring hydroxylating dioxygenase (xylX)

and for GST (bphK) were obtained in all the

S. chlorophenolicum strains. Genes for 1,2-naph-

thalene dioxygenase (narAa) were amplified in

R. aetherovorans strains 1.9 and 6.22, R. opacus

1BN and M. smegmatis F.

Enzymatic activity profiles

RhdA from A. vinelandii and SseA from E. coli,

are prototypes of rhodanese-like proteins with

TST and MST activity, respectively (Bordo et al.

2001, 2002; Pagani et al. 2000; Colnaghi et al.

2001). Taking advantage of the finding that the

antibody raised against RhdA did not recognize

SseA, and vice versa, a preliminary screening for

the presence of RhdA-like and or SseA-like

proteins in the strains here studied was carried

out by Western blot analysis. RhdA-like proteins

were never detected, whereas SseA-like proteins

were detected in R. aetherovorans strains 1.9 and

6.22, R. opacus 1BN and M. smegmatis F, but not

in S. chlorophenolicum strains. In agreement with

the absence of RhdA-like proteins, TST activity

was very low in all strains (0.30–0.50 U mg–1),

while MST activity was always ‡1.0 U mg–1.

To deepen the possible correlation between

detoxifying activities and phenanthrene utiliza-

tion, the modulation of MST and GST activities as

Table 3 Functional genes found in the studied strains

Strains Enzyme-coding genes Reference organisms GeneBankAcc. Num.

Homology(%)

S. chlorophenolicum1.7, 1.8, C3R, 5.1

phnA1 (3,4-phenanthrenedioxygenase)

S. aromaticivorans F199 AF079317 97.8Sphingomonas sp. CHY1 AJ633551 79.2

xylX (ring hydroxylatingdioxygenase)

S. aromaticivorans F199 AF079317 97Sphingomonas sp. P2 AB091692 87

xylE (2,3-catechol dioxygenase) S. aromaticivorans F199 AF079317 95S. chungbukense DJ77 U83882 95

bphK (glutathione S-transferase) S. chungbukense DJ77 AF001103 96.5S. aromaticivorans F199 AF079317 84.5

R. aetherovorans1.9, 6.22

narAa (naphthalene dioxygenase) Rhodococcus sp. P400 AY392423 98R. opacus 1BN AJ401612 90

R. opacus1BN

narAa (naphthalene dioxygenase) Rhodococcus sp. NCIMB12038

AF082663 99

Rhodococcus sp. I24 AF121905 90

M. smegmatisF

narAa (naphthalene dioxygenase) Mycobacterium sp. 6PY1 AJ494745 86M. vanbaalenii PYR-1 AF249301 83

Antonie van Leeuwenhoek

123

a function of the carbon source (glucose or

phenanthrene) was analysed (Table 4). High level

of MST activity, independent of the presence of

immunodetectable SseA-like proteins, was found

in all strains. A significant increase of MST activity

in the presence of phenanthrene was found in the

strains where GST activity was absent, and where

a SseA-like protein was revealed by immunode-

tection. GST activity correlated well with the

presence of the bphK gene in S. cholorophenol-

icum, in which a very low level of activity

was found in the presence of glucose, whereas a

high activity was induced by the growth on

phenanthrene (Table 4).

Phenanthrene degradation and enzyme

activities

S. chlorophenolicum 1.7 and C3R strains were

chosen for further investigating whether phenan-

threne degradation could be related to the ‘‘acti-

vation’’ of detoxifying enzymes. As shown in

Fig. 1A, the profiles of cell growth and time-

course of phenanthrene disappearance were

essentially identical for both strains. Both strains

exhibited a comparable degradation rate, and

more than 80% of the hydrocarbon was degraded

in the exponential phase. The figures of GST and

MST activities, measured either in the presence of

glucose or phenanthrene at different time growth

(Fig. 1B), indicated different enzymatic modula-

tion behaviours for these S. chlorophenolicum

isolates. Slight time-dependent increase and

induction by phenanthrene of GST activity was

found in S. chlorophenolicum C3R. In S. chlor-

ophenolicum 1.7, GST activity was significantly

induced by phenanthrene after 4 days growth and

doubled after 7 days growth. Similar trend was

found in S. chlorophenolicum 1.7 for MST activ-

ity. Noticeably, the figures of both GST and MST

activities did not change from 4 to 7 days growth

when glucose was the carbon source.

The increase of GST activity found in extracts

from phenanthrene grown cells, as compared to

glucose grown cells, suggested a transcriptional

regulation of the expression of this enzyme.

Glutathione S-transferase and

3,4-phenanthrene dioxygenase gene trancripts

Gene expression was, therefore, measured

by determining levels of both the GST and

3,4-phenanthrene dioxygenase gene transcripts.

To determine whether these genes were actually

transcribed in response to phenanthrene, RT-

PCR experiments were performed with total

RNA isolated from induced (i.e. growth in the

presence of phenanthrene) and uninduced (i.e.

growth in the presence of glucose) cells of

S. chlorophenolicum 1.7 and C3R (Fig. 2). With

Table 4 MST and GST activities of the strains grown on glucose and on PAHs

Strain Growth on MST (U mg-1) GST (U mg–1)

S. chlorophenolicum 1.7 glucose 1.16 ± 0.07 0.05 ± 0.04phenanthrene 1.43 ± 0.23 1.49 ± 0.13

S. chlorophenolicum 1.8 glucose 1.33 ± 0.23 0.00 ± 0.00phenanthrene 1.28 ± 0.12 0.39 ± 0.05

S. chlorophenolicum 5.1 glucose 1.19 ± 0.19 0.09 ± 0.01phenanthrene 1.66 ± 0.04 0.61 ± 0.11

S. chlorophenolicum C3R glucose 1.64 ± 0.39 0.14 ± 0.02phenanthrene 1.58 ± 0.18 0.97 ± 0.11

R. aetherovorans 1.9 glucose 1.74 ± 0.09 0.00 ± 0.00phenanthrene 2.72 ± 0.33 0.00 ± 0.00

R. aetherovorans 6.22 glucose 1.43 ± 0.24 0.00 ± 0.00naphthalene 1.68 ± 0.35 0.00 ± 0.00

R. opacus 1BN glucose 1.00 ± 0.11 0.00 ± 0.00naphthalene 1.41 ± 0.17 0.00 ± 0.00

M. smegmatis F glucose 1.03 ± 0.18 0.00 ± 0.00phenanthrene 2.37 ± 0.44 0.00 ± 0.00

Each value is a mean of four replicates determined after 4 day growth

Antonie van Leeuwenhoek

123

0

50

100

150

200

250

300

350

400

450

0 1 2 3 4 5 6 7

Time (days)

7

7.5

8

8.5

9

9.5

10

Ph

enan

thre

ne

(mg

ml-1

)

Bac

teri

al c

ell g

row

th (

Lo

g C

FU

ml-1

)

MST (U mg-1) GST (U mg-1)Strain

Time of growing (days)

4 7 4 7

S. chlorophenolicum 1.7

Glucose Phenanthrene

1.16±0.02 1.43±0.23

1.27±0.14 2.27±0.28

0.05±0.02 1.49±0.13

0.03±0.01 2.60±0.33

S. chlorophenolicum C3R

GlucosePhenanthrene

1.61±0.21 1.58±0.18

1.66±0.22 1.86±0.33

0.14±0.02 0.97±0.11

0.13±0.02 1.12±0.05

A

B

Fig. 1 (A) S. chlorophenolicum strains 1.7 (circles) andC3R (squares) were grown on 400 mg l–1 phenanthrene.Cell growth (empty symbols) and phenanthrene degrada-tion (full symbols) are shown. Each value is a mean of

three replicates, and standard deviations are reported. (B)MST and GST activities measured at 4 day and 7 dayincubation. The activity figures from control experimentsof cells grown on glucose are also shown

bphK phnA11.7 C3R

G Phen G Phen G Phen G Phen

1.7 C3R

MM M

442 bp

350 bp

Fig. 2 Transcriptional analysis of glutathione S-transfer-ase (bphK) and 3,4-phenanthrene dioxygenase (phnA1)encoding genes of S. chlorophenolicum strains 1.7 and C3R

using RT-PCR. Total RNA from cells grown on glucose(G) or on phenanthrene (Phen) was used as template foramplification. M: O’Gene Ruler 1 kb ladder

Antonie van Leeuwenhoek

123

the use of primer set Gst46F and Gst488R, an

expected fragment of 442 bp corresponding to

GST was amplified from the total RNA extracted

from cells grown with phenanthrene, while no

fragment was amplified from cells grown on

glucose. With the use of primer set Phn321F

and Phn671R, an expected fragment of 350 bp

corresponding to 3,4-phenanthrene dioxygenase

was amplified from the total RNA extracted from

cells grown on phenanthrene, while the product

was barely amplified from cells grown on glucose.

The 1500 bp fragment corresponding to the 16S

rRNA, used as a control, gave the expected

fragment in all the experiments (data not shown).

These results indicated that the growth of

S. chlorophenolicum 1.7 and C3R strains in the

presence of phenanthrene led to increasing the

expression of GST and 3,4-phenanthrene dioxy-

genase genes.

Discussion

S. chlorophenolicum, R. aetherovorans, R. opacus

and M. smegmatis strains were able to utilize both

monocyclic and polycyclic aromatic hydrocarbons

as carbon and energy sources for growth, thus

confirming the common traits of the aromatic

hydrocarbon-degrading strains of these genera.

The ability grown on salicylate and not on

o-phthalate, and the presence of the catechol

2,3-dioxygenase (xylE) gene indicated that these

strains utilized phenanthrene through the salicy-

late meta pathway, as reported for Sphingomonads

(Pyniakong et al. 2003a; Demaneche et al. 2004).

Sequence analysis revealed that the xylX gene

for ring hydroxylating dioxygenase and the

gene bphK for GST were present along with

genes involved in PAH degradation. This gene

organization seems to be highly conserved in

strains exhibiting diverse origins and might be

typical for PAH-degrading Sphingomonas strains

(Pyniakong et al. 2003b; Romine et al. 1999;

Lloyd-Jones and Lau 1997; Xia et al. 2005).

Considering that the reaction of oxygenases

involved in the degradation of xenobiotics might

produce oxidative damage in the cells (Favaloro

et al. 2000), we focussed our studies on GST gene

products for which, in addition to a catalytic role

in the metabolism of endogenous or exogenous

toxic electrophilic chemicals, a detoxification role

could be figured (Vuillemieur and Pagni 2002),

and to members of the rhodanese homology

superfamily whose detoxifying activity may not

be limited to cyanide scavenging.

The availability of selected antibodies that did

not show cross-reactions, allowed the screening

for the presence of rhodanese-like protein exam-

ples (RhdA-like and SseA-like) belonging to the

two different subdomains of the widespread

rhodanese-homology proteins. The active-site

loop of E. coli SseA, shared by a number of

rhodanese-like proteins listed in databases, rep-

resents a signature for MST activity, while the

active-site loop of A. vinelandii RhdA, found in a

limited number of rhodanese-like proteins is

discriminant for TST activity (Bordo et al. 2000;

Pagani et al. 2000; Colnaghi et al. 2001; Bordo

et al. 2001). No presence of RhdA-like proteins,

nor significant level of TST activity were found in

any of the analysed strains. The prominent

presence of MST activity and the modulation of

this activity by phenanthrene in these strains, is in

agreement with a recent proteomic investigation

that revealed up-regulation of a putative SseA in

Pseudomonas putida in phenol-induced stress

conditions (Santos et al. 2004). The presence of

MST activity in strains where a SseA-like protein

was undetectable indicated that other sulfurtrans-

ferase enzymes were present, according to the

revealed presence of paralogs of these proteins in

sequenced genomes. Interestingly, besides the

widespread presence of high level of MST activ-

ity, significant modulation of this activity, inferred

by phenanthrene as carbon source, was found in

the strains where GST activity was absent. GST

activity was modulated by the presence of phen-

anthrene in the strains where molecular analyses

revealed the presence of bphK gene. Genetic

analyses indicated that the GST activity was

related to a bphK gene product, and that the

modulation of GST activity by phenanthrene

paralleled the induction of GST transcript. These

results suggest that the role of GST in S. chlor-

ophenolicum could be related to catabolic func-

tions. In the present study a search for

glutathione-conjugated intermediates was how-

ever not done. Since genes for putative GSTs

Antonie van Leeuwenhoek

123

have been found in the gene clusters responsible

for aromatic degradation in several Sphingomon-

as strains of widely diverse origins (Lloyd-Jones

and Lau 1997; Bae et al. 2003), they should have

been recruited by the strains for specific meta-

bolic functions. The phenanthrene-induced GST

activity showed a time-dependent increase, and

the highest level was measured when cells were in

stationary growth phase. The induction of GST

transcript was determined at 4 day growth, at a

time in which in the presence of glucose the

transcript was undetectable. The low level of the

GST activity found in the presence of glucose

suggests that in strains C3R and 1.7 GST tran-

script can be constitutively expressed. Growth

dependent levels of GST induction on m-toluate

have been related to the presence of multiple

copies of bphK gene in Sphingomonas yan-

oikuyae strain B1 (Bae et al. 2003).

Both C3R and 1.7 strains degraded phenan-

threne with comparable degradation rates (Fig. 1)

and transcriptional analysis of phenanthrene

3,4-dioxygenase gene phnA1 confirmed the pres-

ence of this phenanthrene-activated dioxygenase.

Glucose did not suppress the transcription of

3,4-phenanthrene dioxygenase gene, in agreement

with recent data about the activity of degradative

enzymes on glucose (Basu et al. 2006).

The ability of R. aetherovorans, R. opacus and

M. smegmatis strains to grow on phenanthrene

was not hampered by the absence of GST. In

these examples, the ability to grow by utilizing

phenanthrene as sole carbon source should be

related to the presence of different catabolic

operon and facilitated by the detoxification activ-

ity of MST enzymes. In Mycobacterium sp. strain

6PY1, in addition to dioxygenases, an up-regula-

tion of a rhodanese-like protein induced by

pyrene was found (Krivobok et al. 2003).

The multiple experimental approaches used in

this study allowed the definition of metabolic

traits and enzymatic profiles that differently

characterize PAH-degrading strains of environ-

mental relevance.

Acknowledgements This work was supported by ItalianNational Research Program PRIN 2003 ‘‘Selezione dicolture batteriche per la degradazione di POP e loromonitoraggio in processi di bioarricchimento dei suoli’’.

References

Adams H, Teertstra W, Koster M, Tommassen J (2002)PspE (phage-shock protein E) of Escherichia coli is arhodanese. FEBS Lett 518:173–176

Andreoni V, Bernasconi S, Colombo M, Beilen JB,Cavalca L (2000) Detection of genes for alkane andnaphthalene catabolism in Rhodococcus sp. strain1BN. Environ Microbiol 2:572–577

Andreoni V, Cavalca L, Rao MA, Nocerino G, BernasconiS, Dell’Amico E, Colombo M, Gianfreda L (2004)Bacterial communities and enzyme activities of PAHspolluted soils. Chemosphere 57:401–412

Asaoka K, Ito H, Takahashi K (1977) Monkey glutathioneS-aryltransferases. J Biochem 82:973–981

Bae M, Sul WJ, Koh SC, Lee JH, Zylstra GJ, Kim YM,Kim E (2003) Implication of two glutathione S-transferases in the optimal metabolism of m-toluateby Sphingomonas yanoikuyae B1. Ant van Leeuw84:25–30

Bartels F, Backhaus S, Moore ERB, Timmis KN, Hofer B(1999) Occurrence and expression of glutathione S-transferase-encoding bphK genes in Burkholderia sp.strain LB400 and other biphenyl-utilizing bacteria.Microbiology 145:2821–2834

Basu A, Apte SK, Phale PS (2006) Preferential utilizationof aromatic compounds over glucose by Pseudomonasputida CSV86. Appl Environ Microbiol 72:2226–2230

Bordo D, Forlani F, Spallarossa A, Colnaghi R, Carpen A,Bolognesi M, Pagani S (2001) A persulfurated cyste-ine promotes active-site reactivity in Azotobactervinelandii rhodanese. Biol Chem 382:1245–1252

Bordo D, Bork P (2002) The rhodanese/Cdc25 phospha-tase superfamily. Sequence-structure-function rela-tions. EMBO Rep 8:741–746

Bordo D, Deriu D, Colnaghi R, Carpen A, Pagani S,Bolognesi M (2000) The crystal structure of asulfurtransferase from Azotobacter vinelandii high-lights the evolutionary relationship between rhoda-nese and phosphatase enzymes family. J Mol Biol298:691–704

Bradford MM (1976) A rapid and sensitive method for thequantitation of microgram quantities of protein uti-lizing the principle of protein-dye binding. AnalBiochem 72:248–254

Cavalca L, Colombo M, Larcher S, Gigliotti C, Collina E,Andreoni V (2002) Survival and naphthalene-degrad-ing activity of Rhodococcus sp. strain 1BN in soilmicrocosms. J Appl Microbiol 92:1058–1065

Cereda A, Forlani F, Iametti S, Bernhardt R, Ferranti P,Picariello G, Pagani S, Bonomi F (2003) Molecularrecognition between Azotobacter vinelandii rhoda-nese and a sulfur acceptor protein. Biol Chem384:1473–1481

Chavez FP, Lunsdorf H, Jerez CA (2004) Growth ofpolychlorinated-biphenyl-degrading bacteria in thepresence of biphenyl and chlorobiphenyls generatesoxidative stress and massive accumulation of inor-ganic polyphosphate. Appl Environ Microbiol70:3064–3072

Antonie van Leeuwenhoek

123

Colnaghi R, Cassinelli G, Drummond M, Forlani F, PaganiS (2001) Properties of the Escherichia coli rhodanese-like protein SseA: contribution of the active-siteresidue Ser240 to sulfur donor recognition. FEBSLett 500:153–156

Demaneche S, Meyer C, Micoud J, Louwagie M, WillisonJC, Jounanneau Y (2004) Identification and func-tional analysis of two aromatic ring hydroxylatingdioxygenases from a Sphingomonas strain that de-grades various polycyclic aromatic hydrocarbons.Appl Environ Microbiol 70:6714–6725

Favaloro B, Tamburro A, Trofino MA, Bologna L, RotilioD, Heipieper HJ (2000) Modulation of the glutathi-one S-transferase in Ochrobactrum anthropi: functionof xenobiotic substrates and other forms of stress.Biochem J 346:553–559

Kim E, Zylstra GJ (1999) Functional analysis of genesinvolved in biphenyl, naphthalene, phenanthrene, andm-xylene degradation by Sphingomonas yanoikuyaeB1. J Ind Microbiol Biotechnol 23:294–302

Jarabak R, Westley J (1980) 3-Mercaptopyruvate sulfo-transferase rapid equilibrium-ordered mechanismwith cyanide as the acceptor substrate. Biochemistry19:900–904

Kanaly RA, Harayama S (2000) Biodegradation of high-molecular-weight polycyclic aromatic hydrocarbonsby bacteria. J Bacteriol 182:2059–2067

Krivobok S, Kuony S, Meyer C, Louwagie M, Willison JC,Juoanneau Y (2003) Identification of pyrene-inducedproteins in Mycobacterium sp. strain 6PY1:evidencefor two ring-hydroxylating dioxygenases. J Bacteriol185:3828–3841

Kunz DA, Chapman PJ (1981) Catabolism of pseudocum-ene and 3-ethyltoluene by Pseudomonas putida (ar-villa) mt–2: evidence for new function of the TOL(pWW0) plasmid. J Bacteriol 146:179–191

Lloyd-Jones G, Lau PCK (1997) Glutathione S-transferaseencoding gene as a potential probe for environmentalbacterial isolates capable of degrading polycyclicaromatic hydrocarbons. Appl Environ Microbiol63:3286–3290

Nagata Y, Miyauchi K, Takagi M (1999) Completeanalysis of genes and enzymes for hexachlorocyclo-hexane degradation in Sphingomonas paucimobilisUT26. J Industr Microbiol Biotechnol 23:380–390

Pagani S, Forlani F, Carpen A, Bordo D, Colnaghi R(2000) Mutagenic analysis of Thr232 in rhodanesefrom Azotobacter vinelandii highlighted thedifferences of this prokaryotic enzyme from theknown sulfurtransferases. FEBS Lett 472:307–311

Pinyakong O, Habe H, Omori T (2003a) The uniquearomatic catabolic gene in sphingomonads degrading

polycyclic aromatic hydrocarbons (PAHs). J Gen AppMicrobiol 49:1–19

Pinyakong O, Habe H, Yoshida T, Nojiri H, Omori T(2003b) Identification of three novel salicylate1-hydroxylases involved in the phenanthrene degra-dation of Sphingobium sp. strain P2. Biochem Bio-phys Res Commun 301:350–357

Ploegman JH, Drent G, Kalk KH, Hol WG, HeinriksonRL, Keim P, Weng L, Russell J (1978) The covalentand tertiary structure of bovine liver rhodanese.Nature 273:124–129

Ray WK, Zeng G, Potters MB, Mansuri AM, Larson TJ(2000) Characterization of a 12-Kilodalton rhodaneseencoded by glpE of Escherichia coli and its interactionwith thioredoxin. J Bacteriol 182:2277–2284

Romine MF, Stillwell LC, Wong KK, Thurston SJ, SiskEC, Sensen C, Gaasterland T, Fredrickson JK, SafferJD (1999) Complete sequence of a 184-KilobaseCatabolic Plasmid from Sphingomonas aromaticivo-rans F199. J Bacteriol 181:1585–1602

Saito A, Iwabuchi T, Harayama S (1999) Characterizationof genes for enzymes involved in the phenanthrenedegradation in Nocardioides sp. KP7. Chemosphere38:1331–1337

Santos PM, Benndorf D, Sa-Correla I (2004) Insights intoPseudomonas putida KT2440 response to phenol-induced stress by quantitative proteomics. Proteomics4:2640–2652

Sorbo B (1953) Rhodanese. Acta Chem Scand 7:1137–1145Tamburro A, Robuffo I, Heipieper HJ, Allocati N, Rotilio

D, Di Ilio C, Favaloro B (2004) Expression ofglutathione S-transferase and peptide methioninesulfohoxide reductase in Ochrobactrum anthropi iscorrelated to the production of reactive oxygenspecies caused by aromatic substrates. FEMS Micro-biol Lett 241:151–156

Van Hylckama JET, Leemhuis H, Spelberg JHL, JanssenDB (2000) Characterization of the gene clusterinvolved in isoprene metabolism in Rhodococcus sp.strain AD45. J Bacteriol 182:1956–1963

Vuilleumier S, Pagni M (2002) The elusive roles ofbacterial glutathione S-transferase: new lessons fromgenome. Appl Microbiol Biotechnol 58:138–146

Westley J (1977) Sulfane-transfer catalysis by enzymes. In:Van Tamelen EE (eds) Bio-organic chemistry, vol. 1.Academic Press, Orlando, FL, pp 371–390

Xia Y, Min H, Rao G, Lv Z, Liu J, Ye Y, Duan X (2005)Isolation and characterization of phenanthrene-degrading Sphingomonas paucimobilis strain ZX4.Biodegradation 16:393–402

Antonie van Leeuwenhoek

123